associations between variants of bone morphogenetic ...download.xuebalib.com/36ilptil4brw.pdf ·...
TRANSCRIPT
Full Terms & Conditions of access and use can be found athttp://www.tandfonline.com/action/journalInformation?journalCode=cbps20
British Poultry Science
ISSN: 0007-1668 (Print) 1466-1799 (Online) Journal homepage: http://www.tandfonline.com/loi/cbps20
Associations between variants of bonemorphogenetic protein 7 gene and growth traits inchickens
Yan Wang, Fuyou Guo, Hao Qu, Chenglong Luo, Jie Wang & Dingming Shu
To cite this article: Yan Wang, Fuyou Guo, Hao Qu, Chenglong Luo, Jie Wang & Dingming Shu(2018): Associations between variants of bone morphogenetic protein 7 gene and growth traits inchickens, British Poultry Science, DOI: 10.1080/00071668.2018.1454586
To link to this article: https://doi.org/10.1080/00071668.2018.1454586
Accepted author version posted online: 18Apr 2018.
Submit your article to this journal
Article views: 3
View related articles
View Crossmark data
Accep
ted M
anus
cript
1
Accepted 30th January 2018
Publisher: Taylor & Francis & British Poultry Science Ltd
Journal: British Poultry Science
DOI: 10.1080/00071668.2018.1454586
Associations between variants of bone morphogenetic protein 7 gene and growth
traits in chickens
Yan Wang, Fuyou Guo, Hao Qu, Chenglong Luo, Jie Wang, and Dingming Shu*
Institute of Animal Science, Guangdong Academy of Agricultural Sciences,
Guangzhou 510640, China; State Key Laboratory of Livestock and Poultry Breeding
& Guangdong Key Laboratory of Animal Breeding and Nutrition, Guangzhou
510640, China
* Corresponding author: Dingming Shu Email: [email protected]
Short title: BMP 7 gene variants and growth
Abstract:
1. Enhancing bone strength to solve leg disorders in poultry has become an important
goal in broiler production.
2. Bone morphogenetic protein 7 (BMP7), a member of the BMP family, represents
an attractive therapeutic target for bone regeneration in humans and plays critical
roles in skeletal development.
3. The objective of this study was to investigate the relationship between BMP7 gene
expression, single nucleotide polymorphisms (SNPs) and growth traits in chickens.
Here, a SNP (c.1995T>C) in the chicken (Gallus gallus) BMP7 gene was identified,
Accep
ted M
anus
cript
2
Accepted 30th January 2018
that was associated with growth and carcass traits.
4. Genotyping revealed that the T allele occurred more frequently in breeds with high
growth rates, whereas the C allele was predominant in those with low growth rates.
The expression level of BMP7 in the thigh bone of birds with the TT genotype was
significantly higher than in those with the CC genotype at 21, 42 and 91 days of age.
5. These findings suggest that selecting the birds with the TT genotype of SNP
c.1995T>C could improve bone growth, could reduce leg disorders in fast-growing
birds. The SNP c.1995T>C may serve as a selective marker for improving bone
growth and increasing the consistency of body weights in poultry breeding.
Keywords: bone formation, single nucleotide polymorphism, gene expression, shank
circumference, shank length
Introduction
In past decades, broiler chickens (Gallus gallus) have experienced significant
increases in the growth rates and meat yields. However, certain problems, such as
obesity, ascites and leg disorders have accompanied the improvement of these
production traits (Dunnington and Siegel, 1996). Birds with leg disorders show
reduced feed intake, poor growth, loss of immunity and declining carcass quality,
increasing the cost of rearing. In particularly, birds with leg problems are
characterised by decreased uniformity and poor economic performance. Enhancing
bone strength to maintain bone proportions as a method to prevent chicken leg
problems has become an important goal in current broiler production. Some studies
have already reported that leg problems have a genetic component (Rekaya et al.,
2013; Gonz´alez-Cer´on et al., 2015).
Accep
ted M
anus
cript
3
Accepted 30th January 2018
Bone morphogenetic proteins (BMPs) are growth factors and secreted signalling
molecules that can induce ectopic bone growth. BMPs belong to the transforming
growth factor β (TGFβ) superfamily. BMPs play critical roles in embryonic
development and cellular functions, both in postnatal and adult animals, especially in
postnatal bone formation (Chen et al., 2004). Bone morphogenetic protein 7 (BMP7)
is an attractive therapeutic agent for bone regeneration in humans, because it can
induce new bone formation when implanted within a suitable matrix (Sampath et al.,
1990; Sengle et al., 2008). In fact, BMP7 plays important roles in multiple processes,
such as murine hind brain development, tooth and eye development, nephrogenesis
and skeletal patterning (Luo et al., 1995; Arkell and Beddington, 1997; Helder et al.,
1998). In 1994, Houston et al (1994) cloned and expressed chicken BMP7 in the
epiphyseal growth plate. BMP7 has been previously identified as a likely candidate
gene affecting hyperpigmentation of the visceral peritoneum (HVP) in chickens by
using a genome wide association study (Luo et al., 2013). Body weights (BW) of
Huiyang Beard chickens (HB; a Chinese chicken breed native to the Guangdong
province with a low growth rate and high meat quality, tailored to Chinese tastes)
with HVP was significantly lower than that of normal Huiyang Beard chickens (P <
0.05, unpublished data). Such results revealed that BMP7 plays a specific role in the
growth plate, possibly in osteoblast activation or as a chemotactic agent for the
metaphyseal vessels.
This study investigated the functional importance of BMP7 by analysing its
sequence and identifying polymorphisms associated with growth and body
composition in an F2 intercross between Huiyang Bearded (HB) breed and the
fast-growing Lingnanhuang Line A (HQLA, which has undergone over 10
generations of selection for a high growth rate). Differences in gene expression were
Accep
ted M
anus
cript
4
Accepted 30th January 2018
validated among birds with different genotypes. The information concerning the
polymorphisms could be integrated into breeding programs to address leg problems
and increase body weights in broiler breeders.
Materials and methods
Sample collection and phenotypic measurements
Screening for polymorphisms in the chicken BMP7 gene was performed on 10
birds each from the HB and HQLA breeds. In the association analysis, the birds were
from the HB × HQLA F2 resource population, which included 824 birds (436 males,
388 females) from six hatches. The F2 individuals were generated and fed as
described in previous studies (Sheng et al., 2013; Luo et al., 2014). All birds had free
access to feed and water, and were sacrificed at 91 days of age, at which point their
vein blood was collected into centrifuge tubes with anticoagulant containing
ethylenediaminetetraacetic acid disodium salt solution and stored at -80°C.
Body weight was measured at hatching and every other week from hatch until the
birds reached 84 days of age. Shank length (SL) and circumference (SC) were
measured every 14 days during 28–84 days of age. Feed intake (FI) was measured
every seven days from 77–84 days of age, and feed conversion ratio (FCR) was
calculated during 77–84 days of age. At 91 days of age, the BW, SL and SC were
measured and the birds were slaughtered. Anatomical and carcass traits, such as
carcass weight (CW), thigh and shankbone weight (LBW), metatarsal and phalanx
weight (MPW; these two bones being tested together), leg muscle weight (LMW)
and breast muscle weight (BMW) were recorded.
A total of 1029 DNA samples from eight breeds were genotyped to determine the
allele frequencies. These included the Red Jungle Fowl, Recessive Rock White,
Accep
ted M
anus
cript
5
Accepted 30th January 2018
HQLA, HB, Silkies, Beijing-You, Xiayan and Xinghua Chicken, were tested. All
experimental birds were from the Guangdong Wiz Agricultural Science &
Technology Co. (Guangzhou, China). Genomic DNA was isolated from the blood
samples of 1853 birds using a standard phenol and phenol/chloroform
purification-based protocol.
Polymorphism identification
Seven primer pairs were used to amplify a fragment of the BMP7 gene to identify
polymorphic sites in the exons of BMP7 from the HB breed and HQLA chickens
(Table 1). PCR amplification was performed in a 25-μl reaction volume on a
GeneAmp PCR system 9600 PCR Cycler (Perkin Elmer, Foster City, CA, USA). The
PCR reaction mixture contained 100 ng of chicken genomic DNA as a template,
primers at 10 μM each, 1×PCR reaction mix and 1 U of Taq DNA polymerase
(Dongsheng, Guangzhou, China). The PCR amplification was performed with the
following cycling parameters; initial denaturation at 94°C for 4 min, followed by 35
cycles of denaturation for 45 s at 94°C, then annealing for 45 s at the optimal
temperature and elongation for 90 s at 72°C (Table 1). A final extension was
performed at 72°C for 10 min. All amplified products were separated on agarose gels,
purified and then sequenced in both directions. The DNAstar software (DNAstar Inc.,
Madison, WI, USA) was used to analyse and align the potential polymorphic sites.
Table 1. Primers used to study BMP7 gene and bone traits in broiler chickens
Gene names
Primer names
Primer sequences (5’-3’) Binding regions
Product sizes (bp)
Annealing
temperature (°C)
Sequence amplification and SNP detection
BMP7 BMP7-exon1-F
GCGTCCTCGCCGACTTCAC
Exon 1 Intron 1
411 58
Accep
ted M
anus
cript
6
Accepted 30th January 2018
BMP7-exon1-R
CTCGCCACCCATCCCACCT
BMP7-exon2-F BMP7-exon2-R
ACAGACAACAGGACCAGGA AGATTTCACCATACCACCC
Intron 1 Intron 2
1193 58
BMP7-exon3-F BMP7-exon3-R
GTTTTGAGTCGGTTGTGTG TTCTGTTGTGCTCTGTTGC
Intron 2 Intron 3
1629 58
BMP7-exon4-F BMP7-exon4-R
GGACTGATGCGTATGGATGT TCGCTTGTTTGTTTGTTTTG
Intron 3 Intron 4
524 58
BMP7-exon5-F BMP7-exon5-R
TGACTACAGCACAAGAGACT GTGAAATACAAAGCAGAATA
Intron 4 Intron 5
772 54
BMP7-exon6-F BMP7-exon6-R
TCCACAATCTAATGTCTTCA ATCCTGCTCTTCCCTCCCTG
Intron 5 Intron 6
433 58
BMP7-exon7-F BMP7-exon7-R
CTGTGTGTGCTTATGGGGGA TGTTGGTTTGTTGTGGGGTT
Intron 6 Exon 7
1352 58
Quantitative real-time PCR analyses
BMP7 BMP7-Rt-F BMP7-Rt-R
GAGAACAGCAGCAGCGACC CAAAATAGAGCACTGAGATGGC
Exon 4-5 Exon 7
271 58
ACTB β-actin-F β-actin-R
CCCCAAAGCCAACAGAGAGA GGTGGTGAAGCTGTAGCCTCTC
Exon 2 Exon 3
274 58
GAPDH
GAPDH-F GAPDH-R
GGTGAAAGTCGGAGTCAACGG TCGATGAAGGGATCATTGATGGC
Exon 2 Exon 3 108 58
SNP analyses
SNP analysis was performed for a polymorphic site located in exon 7 using the
PCR-restriction fragment length polymorphism method. A 1352 bp fragment was
Accep
ted M
anus
cript
7
Accepted 30th January 2018
amplified using specific primer pairs (BMP7-exon7-F/R; Table 1) and digested with
EcoRI (Thermo scientific, Shanghai, China) for 6 h at 37°C. Then, the digested
products were analysed by agarose gel electrophoresis on 2% agarose gels.
Association of polymorphisms with growth and carcass traits
All 824 birds from the F2 resource population were used for the association analysis.
The GLM program from JMP software (SAS Institute Inc., Cary, NC USA)
evaluated the associations between genotypes and phenotypes. The model used to
analyse the data was assumed to be:
Yijklm = μ + Si + Hj + Sk + Dkl + Gm + eijklm
where Yijklm was the phenotypic value of the trait, μ was the overall mean, Si was the
effect of the ith sex, Hj was the effect of the jth hatch, Sk was the effect of the kth sire,
Dkl was the effect of the lth dam within the kth sire, Gm was the effect of the mth
genotype and eijklm was the residual effect. The adjusted phenotypic value was
calculated as μ + eijklm.
Quantitative real-time PCR (qPCR)
The TRIzol reagent (Life Technologies, Rockville, MD USA) was used to isolate
total RNA from the thigh bones of the F8 birds that were obtained from six
generations in the HB × HQLA F2 resource population at 21, 42 and 91 days of age.
Bone tissue samples were weighed (approximately 0.2 g), ground into a powder in
liquid nitrogen, and then homogenised in 2 ml of TRIzol using a handheld electric
homogenate instrument (Germany, Staufen, IKA). The homogenised samples were
left for 5 min at room temperature and then centrifuged at 12,000 rpm at 4°C for 10
min. Subsequent operations were performed according the manufacturer’s
instructions. There were eight individuals with the TT, TC and CC genotypes of SNP
c.1995T>C, respectively; 50% of the birds in each group were male and female.
Accep
ted M
anus
cript
8
Accepted 30th January 2018
First-strand cDNA synthesis and reverse transcriptase PCR were performed as
described in the instructions for the PrimeScriptTM II reagent Kit with gDNA Eraser
(TaKara, Dalian, China). Primer pairs BMP7-Rt-F/BMP7-Rt-R (Table 1) were used
to determine the relative expression values of the BMP7 gene by qPCR. The PCR
amplifications were performed in 20 μl reaction volumes comprising 0.5 μl of
chicken cDNA, 0.5 μl of each primer and 10 μl of SYBR Green Real-time PCR
Master Mix (TOYOBO, Tokyo, Japan) in a LightCycler 480 Real-Time PCR System
(Roche Applied Science, Indianapolis, IN, USA). The PCR conditions were: 95°C
for 1 min, followed by 40 cycles of 95°C for 15 s, 58°C for 15 s, and 72°C for 20 s.
The level of fluorescence was used to calculate the threshold cycle (Ct) value for
each sample. The relative expression levels of gene were analysed using the
comparative Ct method, in which housekeeping genes β-actin and GAPDH (Table 1)
were used as internal controls and the geometric averaging of those two internal
control genes was calculated according a previously published method
(Vandesompele et al., 2002). The quantitation procedures recommended by Roche
Applied Science were used to correct for differences in mRNA quantities. All 72
birds (24 from each age) from the F8 population were used for gene expression
analysis. Each time point was analysed separately.
The GLM program from JMP software (SAS Institute Inc., Cary, NC, USA) was
used to evaluate the associations between genotypes and expressions. The model
used to analyse the data was assumed to be:
Yim = μ + Si + Gm + eijklm
where Yim was the gene relative expression levels, μ was the overall mean, Si was the
effect of the ith sex, Gm was the effect of the mth genotype and eijklm was the residual
effect. Differences showing P<0.05 were considered significant.
Accep
ted M
anus
cript
9
Accepted 30th January 2018
Ethics statement
The Animal Care Committee of the Institute of Animal Science, Guangdong
Academy of Agricultural Sciences (Guangzhou, People’s Republic of China)
approved the study (approval number GAAS-IAS-2009-73).
RESULTS
Identification of SNPs in the BMP7 gene
Seven primer pairs were designed to detect single nucleotide polymorphisms (SNPs)
in the 97.98% sequences of all exons of chicken BMP7. Comparative sequencing
revealed only one potential polymorphic site, which created a restriction sites for the
endonuclease EcoRI in the 3’ UTR of BMP7 (c.1995T>C, GenBank accession No.
XM_417496.3). A 1352 bp DNA fragment containing the SNP, which was amplified
using primers BMP7-exon7-F/R, was detected by digestion with EcoRI, allowing us
to distinguish between the T allele (which produced a DNA fragment of 1352 bp)
and the C allele (which produced two DNA fragments with lengths of 989 bp and
363 bp) (Figure 1).
FIG 1 HERE
Figure legends
Fig. 1. The electrophoresis patterns obtained after digestion with EcoRI
endonuclease at the c.1995T>C locus. Agarose gel electrophoresis (2.0%) image
showing the DNA restriction fragment patterns indicative of polymorphisms in
BMP7 gene after amplification with the primer pair BMP7-exon7-F/R. The
genotypes are shown at the top of the lanes, M, Marker DL2000 DNA Ladder
(TaKara).
Accep
ted M
anus
cript
10
Accepted 30th January 2018
Allelic frequencies of the SNP c.1995T>C in different chicken breeds
The allelic frequencies of the SNP c.1995T>C in fast-growing and low-growing
chicken breeds were notably different. As shown in Table 2, the C allele was
predominant in those breeds with a low growth rate, such as Red Jungle Fowl, HB
and Xinghua chicken. However, the T allele was predominant in high-growth-rate
breeds, including Silkies, HQLA and White Recessive Rock chicken.
Table 2. Allelic frequencies for the SNP c.1995T>C in the BMP7 gene in 8 chicken
breeds
Breeds BW10 (μ±S.E.)
No. of
birds
Genotypic number
Allelic frequency
male female TT TC CC T C Silkies 1444±64.31 1340±50.31 54 54 0 0 1.000 0.000
Fast-growing Lingnanhuang
Line A 2305±26.31 2017±25.51 70 61 8 1 0.929 0.071
White Recessive
Rock 1890±171.82 1556±125.12 95 54 38 3 0.768 0.232
Xiayan 1152±81.02 875±75.02 91 28 47 16 0.566 0.434Beijing-You 1101±168.02 962.0±88.02 51 15 22 14 0.510 0.490
Xinghua 704±63.02 661±59.02 100 3 29 68 0.175 0.825Huiyang Bearded
855±69.32 620.0±56.12 549 0 39 510 0.036 0.964
Red jungle fowl
-3 -3 19 0 0 19 0.000 1.000
BW10: live body weight at 70 days of age, g.
1These data were from the Guangdong Wiz Agricultural Science & Technology Co.
(Guangzhou, China).
2These data were from the “Animal Genetic Resources in China. Poultry” (Chen et
al., 2010).
3Data not collected
Accep
ted M
anus
cript
11
Accepted 30th January 2018
Associations between the SNP c.1995T>C and growth traits
The SNP c.1995T>C in BMP7 was significantly associated with certain growth and
carcass traits in the HB × HQLA F2 resource population. Furthermore, the growth
traits, including BW, SC and SL at 56 and 91 days of age for the birds with the TT
genotype were significantly higher than those for the birds with the CC genotype
(P<0.05; Table 3). However, the birds with the TT genotype had the lowest FCR at
77–84 days of age in all birds tested (P<0.05; Table 3). For carcass traits, individuals
with the TT genotype were heavier than those with the CC genotype in terms LBW
and MPW (P<0.05, Table 3).
Table 3. Association analyses in the “HB × HQLA” F2 resource population
Traits SNP c.1995T>C Genotype (μ±S.E.)2
P-value TT (n=100) TC (n=416) CC (n=308) BW8 0.031 1271±16.1a 1238±7.9ab 1221±9.2b BW13 0.004 2180±29.1a 2096±14.2b 2063±16.7b SC8 1.727E-4 3.81±0.020a 3.76±0.010b 3.72±0.011c
SC13 2.27E-3 4.25±0.023a 4.19±0.011b 4.15±0.013c SL8 0.020 80.94±0.381a 80.28±0.185ab 79.74±0.215b SL13 7.04E-3 93.69±0.465a 92.85±0.226a 92.98±0.263b
1FCR11-12 0.008 -0.27±0.110b 0.03±0.053a 0.13±0.063a LBW 0.011 36.32±0.542a 35.10±0.264b 34.41±0.306b MPW 0.032 34.09±0.539a 33.20±0.263ab 32.49±0.305b
n: the number of birds studied.
BW8, 13: live body weight at 56 and 91 days of age, g.
SC8, 13: shank circumference at 56 and 91 days of age, cm.
SL8, 13: shank length at 56 and 91 days of age, cm.
FCR11–12: feed conversion ratio at 77–84 days of age.
LBW: thigh bone and shank bone weight, g.
MPW: metatarsal and phalanx weight, g.
Accep
ted M
anus
cript
12
Accepted 30th January 2018
1 The adjusted phenotypic value was calculated twice as μ + eijklm by Johnson Su.
2 Means within a row lacking a common superscript are different (P<0.05).
Gene expression in birds with different variants of BMP7
The effects of the SNP c.1995T>C on the expressions of BMP7 gene were
investigated in the thighbones of the HB × HQLA F8 birds at 21, 42 and 91 days of
age. The expression level of the TT genotype of BMP7 was significantly higher than
the CC genotype in thighbones both at 21, 42 and 91 days of age (P<0.05; Figure 2).
FIG 2 HERE
Fig. 2. Different expressions of BMP7 in different genotypes of SNP c.1995T>C.
Relative expression analyses in chicken thigh bones of BMP7 gene were normalized
to the geometric average of ACTB (β-actin) and GAPDH genes for alleles at 21, 42
and 91 days of age that varied at SNP c.1995T>C. Error bars represent the SE, and
the P-values for the expression of BMP7 at each time point were 0.019, 0.001, 0.038,
respectively (from left to right in the order of the corresponding graph). a, b indicates
significant differences between different genotypes on the same day (P<0.05).
DISCUSSION
Recombinant BMPs have been applied successfully to induce healing of segmental
bone defects in number of species, including humans, rats, sheep and dogs (Yasko et
al., 1992; Gerhart et al., 1993; Cook et al., 1994; Kirker-Head et al., 1998; Geesink
et al., 1999). BMPs are well-established agents for inducing orthotopic and ectopic
bone formation. For gene therapy for bone formation, cells received the transfer by
adenovirus vectors containing the BMP7 cDNA, which produce biologically active
Accep
ted M
anus
cript
13
Accepted 30th January 2018
BMP7, which may be a viable route for stimulating bone regeneration (Franceschi et
al., 2000). Similar to other BMPs, BMP7 stimulates the expression of the osteoblast
phenotype in vitro, and possibly causes osteoblast precursors to migrate into the
metaphyseal edge of the growth plate where they developed their physiological
functions (Vukicevic et al., 1989; Ahrens et al., 1993; Asahina et al., 1993; Houston
et al., 1994). BMP7-deficient mice exhibit various developmental defects, such as
holes in the basisphenoid bone and the xyphoid cartilage, polydactyly in hind limbs,
and cleft palate, indicating a requirement for BMP7 for the coordination of digit
formation and palatogenesis (Jena et al., 1997; Kouskoura et al., 2013). Studies have
suggested that the expression of BMP7 in the interdigital and peridigital tissues is
responsible for the outgrowth of the digit cartilages; BMP7 plays an important role in
the formation of the digits in chickens (Montero and Hurlé, 2007; Lorda-Diez et al.,
2009) and has an important role in the process of skeletogenesis.
The chicken BMP7 gene is located between 12 Mb to 12.1 Mb on chromosome 20,
and QTL analysis of bone traits in an F2 intercross, between domesticated white
Leghorn and wild-type red jungle fowl chickens, identified a QTL that affects bone
biomechanical strength (Rubin et al., 2000). This QTL is located on chicken
chromosome 20 from 26 cM to 67 cM, which contains the BMP7 gene. Jacobsson et
al (2005) identified a QTL that located in a similar region on chicken chromosome
20 (form 26 cM to 62 cM) that affected BW in an F2 intercross from two
growth-selected lines (http://www.animalgenome.org/cgi-bin/QTLdb/GG/). In this
study, an SNP (c.1995T>C) was identified in the BMP7 gene that was significantly
associated with partial growth and carcass traits, and genotyping results revealed that
T alleles predominated in high-growth-rate chicken breeds, and C alleles
predominated in breeds with a low growth rate (Table 3, Table 2). Significant
Accep
ted M
anus
cript
14
Accepted 30th January 2018
associations at 70 and 84 days of age showed that birds with the TT genotype had the
highest growth rates at 28–56 and 56–84 days of age in all birds tested. However, for
LMW and BMW, there was no statistically significant difference among the
individuals with TT, TC and CC genotypes (data not shown). Therefore, the results
suggest that SNP c.1995T>C can improve bone growth while maintaining high
growth rates with no adverse effects on muscle growth and development. Phenotypic
correlations of leg problems with growth rate were unfavourable, and this agreed
with recent genetic analysis that indicated that the genetic relationship between
growth traits and leg problems was extremely weak in chickens, ranging only from
0.01 to 0.08 (Gonz´alez-Cer´on et al., 2015). Taken together, the BMP7 gene was
identified as a likely candidate gene for bone and body growth traits in chickens.
To explore whether the SNP c.1995T>C could affect the expression of BMP7 in the
bones of chicken, the expression of this gene in chicken thighbones with different
alleles was examined. The expression level of the TT genotype was significantly
higher than the CC genotype in the thighbone both at 21, 42 and 91 days of age
(Figure 2). SNP c.1995T>C is in 3′ UTR of the chicken BMP7 gene, did not change
the amino acid sequence of the protein, but it may be in linkage disequilibrium with a
cis-regulatory mutation that affects the expression of BMP7 (Wang et al., 2014).
Additionally, studies have indicated that the 3′ UTR plays an important role in the
spatial and temporal regulation of mRNA translation (Dalby and Glover, 1993;
Samson, 1998). In recent experiments, Kuree et al (2014) found a
miRNA—miR-542-3p, which targets in the 3’UTR of BMP7, and over-expression of
miR-542-3p which led to repression of BMP7 and inhibition of BMP7/PI3K-survivin
signalling, which suppressed osteoblast cell proliferation and differentiation and
inhibited bone formation. Unfortunately, the SNP c.1995T>C did not change the
Accep
ted M
anus
cript
15
Accepted 30th January 2018
miR-542-3p target sequences in the 3’UTR of BMP7, but this SNP may influence the
structure of the 3'UTR of the BMP7 gene, resulting in abatement of the binding
efficiency of miR-542-3p, or change the target sequences, binding some miRNA that
have not been found so far. However, this hypothesis requires further experimental
validation. BMP can induce the phosphorylation of Smad1/5/8, which is essential for
the activation of bone-specific genes (Chen et al., 2012). In BMPR1b and BMP7
double mutant mice, the ulna and radius are severely affected, being either absent or
shortened (Yi et al., 2000). In the chicken, BMP7 is expressed throughout limb
development, and has been implicated in early limb patterning, as well as in
skeletogenesis (Francis et al., 1994). The BMP7 as a member of the BMP family has
an important role osteogenesis. The results suggested that SNP c.1995T>C in BMP7
may play an important regulatory role in the process of skeletogenesis and improve
growth in birds.
In this study, a SNP, c.1995T>C, was identified in the BMP7 gene of chicken
(Gallus gallus) genome and showed that selecting birds with the TT genotype of
SNP c.1995T>C could improve their bone growth to reduce leg disorders during
breeding for fast-growing broilers. Further confirmation in different populations is
needed.
Acknowledgments
The curatorial works about the phenotypic measurements in this study were
supported by the Operating Funds for Guangdong Provincial Key Laboratory of
Animal Breeding and Nutrition.
Disclosure statement
Accep
ted M
anus
cript
16
Accepted 30th January 2018
No potential conflict of interest was reported by the authors.
Funding
This study was supported by the Scientific Research Project of Guangzhou
(201610010178, 201504010017, Guangzhou, P. R. China), ‘Youth Top-notch Talent
on Science & Technology’ of Guangdong Province Special Support Program
(2016TQ03N898, Guangzhou, P. R. China) and the Earmarked Fund for Modern
Agro-Industry Technology Research System (nycytx-41, Beijing, P. R. China).
References
Ahrens, M., Ankenbauer, T., Schröder, D., Hollnagel, A., Mayer, H. & Gross, G.
(1993) Expression of human bone morphogenetic proteins-2 or -4 in murine
mesenchymal progenitor C3H10T1/2 cells induces differentiation into distinct
mesenchymal cell lineages. DNA and Cell Biology, 12: 871–880. doi:
10.1089/dna.1993.12.871
Arkell, R. & Beddington, R.S.P. (1997) BMP-7 influences pattern and growth of the
developing hindbrain of mouse embryos. Development, 124: 1–12. pmid:
9006062
Asahina, I., Sampath, T.K., Nishimura, I. & Hauschka, P.V. (1993) Human
osteogenic protein-1 induces both chondroblastic and osteoblastic differentiation
of osteoprogenitor cells derived from newborn rat calvaria. The Journal ofCcell
Biology, 123: 921–933. PMID: 8227149
Chen, G., Deng, C. & Li, Y.P. (2012) TGF-beta and BMP signaling in osteoblast
differentiation and bone formation. International Journal of Biological Sciences,
8: 272–288. doi: 10.7150/ijbs.2929
Chen, D., Zhao, M. & Mundy, G.R. (2004) Bone Morphogenetic proteins. Growth
Accep
ted M
anus
cript
17
Accepted 30th January 2018
Factors, 22: 233–241. doi: 10.1080/08977190412331279890
Chen, K.W., Yang, N. & Wang, G.Y. (2010) Animal Genetic Pesources in China:
Poultry. China National Commission of Animal Genetic Resources. China
agriculture press. Beijing, China.
Cook, S.D., Baffes, G.C., Wolfe, M.W., Sampath, T.K. & Rueger, D.C. (1994)
Recombinant human bone morphogenetic protein-7 induces healing in a canine
long-bone segmental defect model. Clinical Orthopaedics and Related Research,
301: 302–312. PMID: 8156691
Dalby, B. & Glover, D.M. (1993) Discrete sequence elements control posterior pole
accumulation and translational repression of maternal cyclin B RNA in
Drosophila. The EMBO Journal, 12: 1219–1227. pmid: 8458334
Dunnington, E.A. & Siegel, P.B. (1996) Long-term divergent selection for
eight-week body weight in White Plymouth rock chickens. Poultry Sscience, 75:
1168–1179. pmid: 8893291
Franceschi, R.T., Wang, D., Krebsbach, P.H. & Rutherford, R.B. (2000) Gene
therapy for bone formation: in vitro and in vivo osteogenic activity of an
adenovirus expressing BMP7. Journal of Cellular Biochemistry. Supplement, 78:
476–486. pmid: 10861845
Francis, P.H., Richardson, M.K., Brickell, P.M. & Tickle, C. (1994) Bone
morphogenetic proteins and a signalling pathway that controls patterning in the
developing chick limb. Development, 120: 209–218. pmid: 8119128
Geesink, R.G., Hoefnagels, N.H. & Bulstra, S.K. (1999) Osteogenic activity of OP-1
bone morphogenetic protein (BMP-7) in a human fibular defect. The Journal of
Bone and Joint Surgery. British volume, 81: 710–718. pmid: 10463751
Gerhart, T.N., Kirker-Head, C.A., Kriz, M.J., Holtrop, M.E., Hennig, G.E., Hipp, J.,
Accep
ted M
anus
cript
18
Accepted 30th January 2018
Schelling, S.H. & Wang, E. (1993) Healing segmental femoral defects in sheep
using recombinant human bone morphogenetic protein. Clinical Orthopaedics
and Related Research, 293: 317–326. pmid: 8339499
Gonz´alez-Cer´on, F., Rekaya, R., Anthony, N.B. & Aggrey, S.E. (2015) Genetic
analysis of leg problems and growth in a random mating broiler population.
Poultry Science, 94: 162–168. doi: 10.3382/ps/peu052
Helder, M.N., Karg, A., Bervoets, T.J.M., Vukicevic, S., Burger, E.H., Souza, R.N.D.,
Woltgens, J.H.M., Karsenty, G. & Bronckers. A.L.J.J. (1998) Bone
morphogenetic protein-7 (osteogenic protein-1, OP-1) and tooth development.
Journal of dental research, 77: 545–554. doi: 10.1177/00220345980770040701
Houston, B., Thorp, B.H. & Burt, D.W. (1994) Molecular cloning and expression of
bone morphogenetic protein-7 in the chick epiphyseal growth plate. Journal of
Molecular Endocrinology, 13: 289–301. pmid: 7893347
Jacobsson, L., Park, H.B., Wahlberg, P., Fredriksson, R., Perez-Enciso, M., Siegel,
P.B. & Andersson, L. (2005) Many QTLs with minor additive effects are
associated with a large difference in growth between two selection lines in
chickens. Genetical Research, 86: 115–125. doi: 10.1017/S0016672305007767
Jena, N., Martin-Seisdedos, C., McCue, P. & Croce, C.M. (1997) BMP7 null
mutation in mice: developmental defects in skeleton, kidney, and eye.
Experimental Cell Research, 230: 28–37. pmid: 9013703
Kirker-Head, C.A., Gerhart, T.N., Armstrong, R., Schelling, S.H. & Carmel, L.A.
(1998) Healing bone using recombinant human bone morphogenetic protein 2
and copolymer. Clinical Orthopaedics and Related Research, 349: 205–217.
pmid: 9584385
Kouskoura, T., Kozlova, A., Alexiou, M., Blumer, S., Zouvelou, V., Katsaros, C.,
Accep
ted M
anus
cript
19
Accepted 30th January 2018
Chiquet, M., Mitsiadis, T.A. & Graf, D. (2013) The etiology of cleft palate
formation in BMP7-deficient mice. PloS One, 8: e59463. doi:
10.1371/journal.pone.0059463
Kureel, J., Dixit, M., Tyagi, A.M., Mansoori, M.N., Srivastava, K., Raghuvanshi, A.,
Maurya, R., Trivedi, R., Goel, A. & Singh, D. (2014) miR-542-3p suppresses
osteoblast cell proliferation and differentiation, targets BMP-7 signaling and
inhibits bone formation. Cell Death and Disease. 5: e1050. doi:
10.1038/cddis.2014.4
Lorda-Diez, C.I., Torre-Pérez, N., García-Porrero, J.A., Hurle, J.M. & Montero, J.A.
(2009) Expression of Id2 in the developing limb is associated with zones of
active BMP signaling and marks the regions of growth and differentiation of the
developing digits. The International Journal of Developmental Biology, 53:
1495–1502. doi: 10.1387/ijdb.072415cl
Luo, C., Qu, H., Wang, J., Wang, Y., Ma, J., Li, C., Yang, C., Hu, X., Li, N. & Shu, D.
(2013) Genetic parameters and genome-wide association study of
hyperpigmentation of the visceral peritoneum in chickens. BMC Genomics, 14:
334. doi: 10.1186/1471-2164-14-334
Luo, C.L., Qu, H., Ma, J., Wang, J., Hu, X.X., Li, N. & Shu, D.M. (2014) A
genome-wide association study identifies major loci affecting the immune
response against infectious bronchitis virus in chicken. Infection, Genetics and
Evolution, 21: 351–358. doi: 10.1016/j.meegid.2013.12.004
Luo, G., Hofmann, C., Bronckers, A.L.J.J., Sohocki, M., Bradley, A. & Karsenty, G.
(1995) BMP-7 in an inducer of nephrogenesis, and is also required for eye
development and skeletal patterning. Genes & Development, 9: 2808–2820. pmid:
7590255
Accep
ted M
anus
cript
20
Accepted 30th January 2018
Montero, J.A. & Hurlé. J.M. (2007) Deconstructing digit chondrogenesis. BioEssays,
29: 725–737. doi: 10.1002/bies.20607
Rekaya, R., Sapp, R.L., Wing, T. & Aggrey. S.E. (2013) Genetic evaluation for
growth, body composition, feed efficiency, and leg soundness. Poultry Science,
92: 923–929. doi: 10.3382/ps.2012-02649
Rubin, C.J., Brändström, H., Wright, D., Kerje, S., Gunnarsson, U., Schutz, K.,
Fredriksson, R., Jensen, P., Andersson, L., Ohlsson, C., Mallmin, H., Larsson, S.
& Kindmark, A. (2000) Quantitative trait loci for BMD and bone strength in an
intercross between domestic and wildtype chickens. Journal of Bone and Mineral
Research, 22: 375–384. DOI: 10.1359/jbmr.061203
Sampath, T.K., Coughlin, J.E., Whetstone, R.M., Banach, D., Corbett, C., Ridge, R.J.,
Ozkaynak, E., Oppermann, H. & Rueger, D.C. (1990) Bovine osteogenicprotein
is composed of dimers of OP-1 and BMP-2A, two members of the transforming
gfd-beta superfamily. The Journal of Biological Chemistry, 265: 13198–13205.
pmid: 2376592
Samson, M.L. (1998) Evidence for 3’ untranslated region-dependent autoregulation
of the Drosophila gene encoding the neuronal nucle2 arRNA-binding protein
ELAV. Genetics, 150: 723–733. pmid: 9755203
Sengle, G., Ono, R.N., Lyons, K.M., Bächinger, H.P. etstone, R.M., Banach, D.,
Corbett, C., Ridge, R.J., Ozkaynak, E., Oppermann, H. & Sakai, L.Y. (2008) A
new model for growth factor activation: type II receptors compete with the
prodomain for BMP-7. Journal of Molecular Biology, 381: 1025–1039. DOI:
10.1016/j.jmb.2008.06.074
Sheng, Z.Y., Pettersson, M.E., Hu, X.X., Luo, C.L., Qu, H., Shu, D.M., Shen, X.,
Carlborg, Örjan & Li, N. (2013) Genetic dissection of growth traits in a Chinese
Accep
ted M
anus
cript
21
Accepted 30th January 2018
indigenous x commercial broiler chicken cross. BMC Genomics, 14: 151–174.
doi: 10.1186/1471-2164-14-151
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A. &
Speleman, F. (2002) Accurate normalisation of real-time quantitative RT-PCR
data by geometric averaging of multiple internal control genes. Genome Biology,
3: research0034. pmid: 12184808
Vukicevic, S., Luyten, F.P. & Reddi, A.H. (1989) Stimulation of the expression of
osteogenic and chondrogenic phenotypes in vitro by osteogenin. Proceedings of
the National Academy of Sciences of the United States of America, 86: 8793–
8797. pmid: 2554330
Wang, Y., Wang, J., Li, B.H., Qu, H., Luo, C.L. & Shu, D.M. (2014) An association
between genetic variation in the roundabout, axon guidance receptor, homolog 2
gene and immunity traits in chickens. Poultry Science, 93: 31–38. doi:
10.3382/ps.2013-03512
Yasko, A.W., Lane, J.M., Fellinger, E.J., Rosen, V., Wozney, J.M. & Wang, E.A.
(1992) The healing of segmental bone defects, induced by recombinant human
bone morphogenetic protein (rhBMP-2). A radiographic, histological, and
biomechanical study in rats. The Journal of Bone and Joint Surgery. American
volume, 74: 659–670. pmid: 1378056
Yi, S.E., Daluiski, A., Pederson, R., Rosen, V. & Lyons, K.M. (2000) The type I BMP
receptor BMPRIB is required for chondrogenesis in the mouse limb.
Development, 127: 621–630. pmid: 10631182
Accep
ted M
anus
cript
22
Accepted 30th January 2018
Figure 1
Accep
ted M
anus
cript
23
Accepted 30th January 2018
Figure 2
本文献由“学霸图书馆-文献云下载”收集自网络,仅供学习交流使用。
学霸图书馆(www.xuebalib.com)是一个“整合众多图书馆数据库资源,
提供一站式文献检索和下载服务”的24 小时在线不限IP
图书馆。
图书馆致力于便利、促进学习与科研,提供最强文献下载服务。
图书馆导航:
图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具