Full Terms & Conditions of access and use can be found athttp://www.tandfonline.com/action/journalInformation?journalCode=icnv20

Download by: [156.223.193.29] Date: 24 February 2017, At: 11:10

Cancer Investigation

ISSN: 0735-7907 (Print) 1532-4192 (Online) Journal homepage: http://www.tandfonline.com/loi/icnv20

Association of Osteopontin Gene Polymorphismswith Colorectal Cancer

Asmaa Kamal, Rania Kamal Darwish, Samar Saad, Mohamed Salama, TarekS. El-Baradie, Heba G. M. Mahmoud & Yasmine Elshiwy

To cite this article: Asmaa Kamal, Rania Kamal Darwish, Samar Saad, Mohamed Salama,Tarek S. El-Baradie, Heba G. M. Mahmoud & Yasmine Elshiwy (2017) Association of OsteopontinGene Polymorphisms with Colorectal Cancer, Cancer Investigation, 35:2, 71-77, DOI:10.1080/07357907.2016.1247454

To link to this article: http://dx.doi.org/10.1080/07357907.2016.1247454

Published online: 17 Jan 2017.

Submit your article to this journal

Article views: 31

View related articles

View Crossmark data

CANCER INVESTIGATION, VOL. , NO. , –http://dx.doi.org/./..

Association of Osteopontin Gene Polymorphisms with Colorectal Cancer

Asmaa Kamala, Rania Kamal Darwisha, Samar Saada, Mohamed Salamab, Tarek S. El-Baradieb,Heba G. M. Mahmoudb, and Yasmine Elshiwya

aDepartment of Clinical & Chemical Pathology, Faculty of Medicine, Cairo University, Cairo, Egypt; bDepartment of Surgical Oncology, NationalCancer Institute, Cairo Univeristy, Cairo, Egypt

ARTICLE HISTORYReceived May Accepted October

KEYWORDSOsteopontin; Colorectalcancer; Gene polymorphism;OPN rs; OPN rs

ABSTRACTWe investigated the association of the Osteopontin (OPN) (rs9138 and rs1126616) polymorphisms withcolorectal cancer (CRC). One hundred CRC patients and 112 healthy individuals were subjected to OPN(rs9138 and rs1126616) genotyping and measurement of OPN protein plasma level. The C allele of OPNrs1126616 and the CC haplotype were significantly higher in CRC patient (p = 0.036, 0.003, respectively).In females, the C allele of OPN rs9318 (A/C) polymorphism was significantly associated with increasedCRC risk (p = 0.036). The plasma OPN level >104.35 ng/mL was significantly associated with CRC. Ourfindings suggest a significant role played by OPN (rs9138 and rs1126616) in colorectal carcinogenesis.

Introduction

Colorectal cancer (CRC) is considered the third mostcommon cancer worldwide, accounting for 9.7% of allcancers according to Globoccae estimates (1). Despitethe advancement in diagnostic tools and therapeuticapproaches for CRC over the last two decades, stillcolorectal-related deaths represent the second cause ofdeath in the United States (2).

The incidence of CRC is increasing lately in theyoung population (under 40 years) worldwide (3). Pre-vious hospital-based studies in Egypt showed the highproportion of young-onset disease (4, 5). The registrydata of Egypt reported a higher incidence of CRC insubjects under the age of 40 years as compared to thesame age group in the United States (6).

The difference in the reported proportion of youngCRC patients between Egypt and the Western countries(3–8) sheds light on a different disease pattern that wor-thy further investigations and understanding.

Screening for precancerous lesions and early diag-nosis of CRC results in better survival and preventionof the disease. Despite considerable progress that hasbeen made over the past two decades in CRC diagnosticprocedures and therapeutic strategies, still many of theCRC patients are diagnosed in advanced stages and do

CONTACT Asmaa Kamal asmaakamal@yahoo.com; asmaakamal@kasralainy.edu.eg Department of Clinical & Chemical Pathology, Faculty of Medicine,Cairo University, Al-Saray St, El Manial, Cairo , Egypt.Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/icnv.

not suitably respond to treatment (9), thus researchesshould be done to improve our understanding of genet-ics and epigenetic alterations in the CRC for identifyingdiagnostic, prognostic, and predictive biomarkers sup-porting its prevention, early detection, and treatment(10).

Osteopontin (OPN) is a member of small integrin-binding ligand N-linked glycoproteins family (11) Itis a secreted glycol-phosphoprotein between 44 and75 kDa discovered in various cells and its gene islocated in the human chromosome 4 (4q21–4q25) (12).In a Chinese meta-analysis, genetic polymorphisms ofOPN were shown to be associated with different can-cers (13). A recent Chinese study results suggested thatrs9138 and rs1126616 polymorphisms of OPN genewere associated with increased CRC risk (14).

The aim of the present study was to assess therole of the polymorphisms of rs9138 (+1239; 3′UTR:3′untranslated regions) and rs1126616 (+750; exon7) located in the OPN gene with respect to CRC sus-ceptibility in Egyptian patients and whether thesepolymorphisms are associated with clinical and lab-oratory features of the disease. Also determinationof plasma OPN concentration in relation to differentgenotypes and in relation to the CRC.

© Taylor & Francis Group, LLC

72 A. KAMAL ET AL.

To our knowledge, this is the first study to investigatethe association of the OPN gene polymorphism and itsprotein-level expression in plasma with increased riskof CRC in an Egyptian population as well as its cor-relation with the clinicopathological parameters in thestudied population specifically the age, sex, and diseaseprogression.

Subjects and methods

This study was conducted on 212 subjects who weredivided into two groups. Group 1 included 100 newlydiagnosed and pathologically confirmed CRC patientswith no other cancer; they were recruited from theNational Cancer Institute, Cairo University. Diagno-sis of CRC was confirmed through pathology. Gradingand staging of the tumor were performed according tothe AJCC staging seventh edition (2016) (15). The datacompiled from the patients’ files included demographicdata, clinical features (TNM staging, tumor site, and theresults of histopathological examination). All patientswere subjected to full history taking, full clinical exami-nation, laboratory investigations, including carcinoem-bryonic antigen (CEA) and cancer antigen 19.9 (CA19.9). Radiological examination, including plain chestX-ray, abdominopelvic-CT, and interventional in theform of colonoscopy and biopsy to confirm the diag-nosis were performed.

Group 2 included 112 ages and sex-matched healthysubject as a control group. CRC patients and healthycontrol volunteers were subjected to genotyping ofOPN rs9138 gene polymorphism by real-time poly-merase chain reaction (RT-PCR) using TaqMan probetechnology, genotyping of OPN rs1126616 gene poly-morphism by PCR-restriction fragment length poly-morphism and measuring of plasma OPN level byenzyme-linked immunosorbent assay (ELISA).

Clinicopathological and demographic data of thepatients were collected from the files and correlatedwith the OPN gene and its plasma protein level. Theassociation of the gene polymorphism with sex andage based on two age groups [young vs. old (<40 and>40 years)] was also investigated.

Sample collection

Seven mL of blood was collected and divided as follows:� 2 mL in a plain sterile vacutainer. Serum was sep-

arated and assayed for CEA and CA 19.9 Cobase

411 analyzer (Roche Diagnostics, Mannheim,Germany).

� 2 mL in a sterile ethylenediaminetetraacetic acid(EDTA) vacutainer for the OPN genotyping.

� 3 mL in a sterile EDTA vacutainer. Plasma wasseparated and stored at −20°C till analysis of OPNlevel by ELISA.

DNA extraction and OPN genotyping

Double stranded nucleic acid (DNA) was extractedfrom EDTA anticoagulated blood TINAamp genomicDNA extraction kit (Tangen Biotech, Beijing, China).The DNA concentration was assessed by Qubit dsDNABR assay kit 10 and Qubit 2.0 fluorometer (Invitrogen,Paisley, UK). The extracted DNA was stored at −20°Cuntil time of amplification.

Genotyping of rs9138 polymorphism in the OPNgene was analyzed using Taq-Man probe RT-PCR tech-nique. The Taq-Man probes were labeled using VICand FAM fluorescent dyes. PCR reactions were run in a25 μL final volume containing 12.5 uL of TaqMan Uni-versal PCR Master Mix (2×), 1.25 uL of TaqMan SNPGenotyping Assay (20×) and 20 ng of genomic DNA.Cycling conditions were 95°C for 10 min, 50 cyclesof 92°C for 10 s and 60°C for 1 min. Controls wereincluded in each run. Data analysis for allele discrim-ination was performed with the Applied BiosystemsStep One Real-Time PCR System software (AppliedBiosystems, Foster City, CA, USA).

Genotyping of OPN rs1126616 was done by themethod of PCR-restriction fragment length poly-morphism. Enzymatic amplification was done asproposed by Fan et al. (2013) (14) using one set ofprimers (Operon Biotechnologies, Cologne, Ger-many). Forward primer: 5′CCGTGGGAAGGACAGTTATG3′ and reverse primer: 5′TTTAATTGACCTCAGAAGATGCAC3′.

After an initial denaturation at 95°C for 2 min, 40PCR cycles were performed (95°C for 30 s, 55°C for30 s, and 72°C for 60 s), followed by an elongation of72°C for 10 min.

The reaction was performed in a Biometra ther-mal cycler (Biometra Corporation, Göttingen, Ger-many). The PCR product (290 bp) was digested withAluI restriction enzyme (Thermo Fisher Scientific,Waltham, MA, USA) which resulted in two frag-ments of 198 and 92 bp. PCR products were sized by

CANCER INVESTIGATION 73

electrophoresis on a 2% agarose gel stained withethidium bromide.

Measurement of plasma OPN protein

This was done using SunRed human OPN ELISA kit(Shanghai SunRed Biotechnology Company, BaoshanDistrict, China). The optical density was detected at450 nm with a microplate reader.

Statistical analysis

All OPN polymorphisms in all groups were in Hardy–Weinberg equilibrium. Data of the study were codedand entered using the Statistical Package for SocialScience (SPSS) software Version 17. Parametric datawere summarized as mean ± SD, whereas nonpara-metric data were presented as median and percentilesfor quantitative variables, frequency and percentagesfor qualitative variables. Comparison between differentgroups was performed using the chi-square test and theFischer exact test for the qualitative variable. For thequantitative variables, student’s t-test and the nonpara-metric Mann–Whitney U-test were used to comparetwo groups, while the Kruskal–Wallis test was used tocompare multiple groups. The strength of associationwas assessed by calculation of the odds ratio (OR) and95% confidence intervals (CIs). The correlation analy-sis was assessed using the Spearman coefficient of cor-relation. The haplotype frequencies were performedusing Haploview, a web-based calculator SNP status.The receiver operator characteristic (ROC) curve wasplotted to detect the best OPN cutoff value. The p value< 0.05 was considered significant.

Results

This study was conducted on 100 CRC patients and112 age- and sex-matched healthy control subjects.The CRC group included 100 patients, 46 males (46%)and 54 females (54%), with the mean age of 46.6 ±13.9 years. The clinical and pathological data of theCRC group are shown in Table 1.

Regarding OPN rs9138, no significant differencecould be detected by comparing the genotype and allelefrequencies in the two studied groups (Table 2). Infemale subjects, the frequencies of the combined geno-types (AC + CC) and C allele were significantly higherin CRC patients than those of controls (p = 0.010,

Table . Clinical, pathological, and laboratory data of CRC patients(n = ).

Data Percentage

Site Colon .Rectum .

Family history Present .Absent .

Differentiation degree Low .Moderate .

High .Histological type Mucinous .

Adenocarcinoma .Tumor stage I + II .

III + IV .Polyp Yes .

No .CEA (ng/mL) . (.–.)a

CA – (IU/mL) . (.–)a

aData are presented in median (th–th percentiles).

Table . Genotypes and alleles frequency of OPN rs in the twostudied groups.

Cases (n = ) Controls (n = )OPNgenotype Frequency % Frequency % p value

AA . .AC .CC A allele . .C allele .

OPN, Osteopontin.

0.036, OR = 2.98, 1.83, 95% CI = 1.29 −6.87, 1.04–3.22, respectively) (Table 3).

On comparing the genotypes and allele frequenciesof OPN rs1126616 in the two studied group, the fre-quency of the combined genotypes (CT + CC) was sig-nificantly higher in CRC patients (62.0%) than that ofcontrols (42.8%) as compared to the frequency of TTgenotypes (p = 0.005, OR = 2.18, 95% CI = 1.25–3.77), also the frequency of the C allele was significantlyhigher in CRC patients (39.0%) than that of controls(27.0%) (p = 0.036, OR = 1.56, 95% CI = 1.03–2.35)(Table 4).

Table . OPN rs genotype frequency in females in the twostudied groups.

Cases (n = ) Controls (n = )

OPN genotype Frequency % Frequency % p-value

AA . . .a

AC . .CC . .A allele . . .b

C allele . .

ap-value of (AC+CC) versus (AA) is ., OR = ., % CI (.-.).bOR = ., % CI (.-.).

74 A. KAMAL ET AL.

Table . Genotypes and alleles frequency of OPN rs in thetwo studied groups.

Cases (n = ) Controls (n = )

OPN genotype Frequency % Frequency % p-value

TT . .a

CT .CC .T allele .b

C allele

ap-value of (CT+CC) versus (TT) is . and OR = ., % CI (.-.).bOR = ., % CI (.-.).

Considering the AT haplotype as a reference group,the frequency of CC haplotype was significantly higherin CRC patients (18.99%) as compared to healthy sub-jects (7.86%) (p = 0.0027) (Table 5).

Regarding the relationship between OPN polymor-phisms and the clinical data or the laboratory parame-ters (OPN protein, CEA, and CA 19–9), it was foundthat only in OPN rs1126616, the level of OPN pro-tein was significantly higher in patients with CC geno-type [116.2 (92.7–138.6) ng/mL] as compared to thosewith combined (CT + TT) genotype [84.2 (72.1–104.5)ng/mL], with p = 0.015.

In this study, we found that the level of OPN was sig-nificantly higher in CRC patients [129.7 (108.8–157.8)ng/mL] when compared with the healthy control vol-unteers [93.7 (76.5–114.9) ng/mL] with p = 0.0001(Figure 1).

The mutant (CC + CT) combined genotypes of OPNrs1126616 were predominant in the old-age group ofCRC patients as compared to healthy control subjects(p = 0.002, OR = 3.27, 95% CI = 1.6–6.9) (Table 6).

Classification of CRC patients according to age indi-cated that old CRC patients (�40 years) had a marginalassociation with the mutant (CC + CT) combinedgenotypes of OPN rs1126616 as compared to youngCRC patients (<40 years), p = 0.093 (Table 7).

Table . Analysis of OPN haplotype frequencies with the risk ofCRC.

Haplotypers-rs

Totalfrequency

Controlfrequency

CRCfrequency OR (% CI) p value

AT . . . . —CC . . . .

(.–.).

CT . . . .(.–.)

.

CC . . . .(.–.)

.

Figure . Median plasma OPN protein concentration in cases andcontrol group.

The ROC curve was made to detect the best cut-off value for OPN to be used as a tumor marker forscreening of CRC (Figure 2). At a cutoff 104.35 ng/mL,the sensitivity was 81.8% and specificity was 68.2% forscreening of CRC above this level. Area under the curve(AUC) = 79.5% (95% CI = 0.70–0.89, p < 0.0001).

There was no significant correlation between plasmaOPN protein and CEA or CA 19–9 (R = 0.001, 0.010,p = 0.994, 0.96), respectively. Also, no significantdifference could be detected between OPN proteinand different clinical parameters in patients, such astumor site, differentiation degree, histological type,tumor stage, the presence of polyps, and family his-tory (p = 0.341, 0.576, 0.353, 0.841, 0.598, and 0.935,respectively).

Table . Genotype and allele frequency of OPN rs polymor-phism in old-age group.

OPN genotypeCases

(n = ) %Controls

(n = ) % p value OR (% CI)

TT . . .CT . .CC . .TT . . . . (.–.)CC + CT . .

Table . Genotype and allele frequency of OPN rs polymor-phism among CRC patients classified according to age.

OPN genotype Young (n = ) % Old (n = ) % p value

TT . . .CT . .CC . .TT . . .CC + CT . .

CANCER INVESTIGATION 75

Figure . Osteopontin ROC curve.

Discussion

CRC is the most common cancer worldwide after lungand breast cancers with two-thirds of all CRCs occur-ring in the most developed regions of the world. CRCaffects men and women of all racial and ethnic groupsand is most often found in those aged 50 years or older(1). OPN gene expression was found to be significantlyelevated (twofold to fourfold) in cancer of the colon,rectum, breast, uterus, ovary, lung, and thyroid in theprevious studies (16).

OPN was reported to be the leading candidate geneimplicated in the occurrence and progression of CRCamong more than 300 tumor markers and more than100 tumor progression markers (17). The OPN proteinregulation is affected by transcription factors and somegenetic polymorphisms in the 3′UTR (18), exons (19),and the promoter region (20). A study done by Fan et al.(2013) (14) suggested that the polymorphisms in theOPN gene were associated with increased risk of devel-oping CRC.

Despite the abundance of studies suggesting the sig-nificant role of OPN in tumorigenesis and cancer pro-gression, there is a paucity of data and published stud-ies regarding the role of SNP rs9138 and rs1126616in OPN gene with respect to CRC. According to ourknowledge, only one Chinese study investigated theassociation of OPN gene polymorphisms with CRC(14). So, confirmation studies conducted in other pop-ulations and on a larger scale are required to elucidatesuch an association.

In this study, the frequency of the C allele of OPNrs1126616 was significantly higher in CRC patientsthan that of controls (p = 0.036, OR = 1.56, 95%CI = 1.03–2.35) and this suggests that the carri-ers of this allele may be more predisposed to CRCdevelopment.

Furthermore, we studied the effect of age on theOPN gene polymorphisms association with CRC. Wefound that the significant association between OPNrs1126616 and CRC was evident in the old-age group(�40 years) but not in the young-age group (<40 years)as compared to healthy control volunteers of the sameage groups (p = 0.002, 0.636, respectively). This sug-gests a significant role played by the OPN polymor-phisms in colorectal carcinogenesis at a relatively oldage group.

Our results also reported a significantly higherOPN plasma level in patients with CC genotypeof OPN rs1126616 as compared to CRC patientswith other genotypes (p = 0.015). This suggeststhat OPN rs1126616 polymorphism might affectOPN gene expression besides its effect on CRCSusceptibility.

Regarding OPN rs9138 polymorphism, this studyreported the predominance of the mutant C allelein female CRC patients (50.9%) as compared to thehealthy female group (36.2%), suggesting increasedrisk of CRC in females carrying the mutant OPN rs9138allele (OR = 1.83, 95% CI = 1.04–3.22, p = 0.036).

In studying the combined effect of OPN rs9138and rs1126616 polymorphisms, the CC haplotype wasfound to be significantly associated with increased CRCrisk (OR = 2.87, 95% CI = 1.45–5.69, p = 0.0027).

These results come in partial accordance with Fanet al. (2013) (14), who found a significant associationof OPN rs9138 genotype and occurrence of CRC ina Chinese population. The genotypes AA and AC ofrs9138 were associated with increased risk of CRCas compared with the CC genotype (OR = 2.351and 2.067, 95% CI = 1.264–4.370 and 1.440–2.965,p = 0.007 and < 0.001, respectively). Also, the geno-types CC and CT of rs1126616 were associated withincreased risk of CRC (OR = 1.979 and 2.284, 95%CI = 1.111–3.524 and 1.585–3.291, p = 0.020 and< .001, respectively). Moreover, the A allele of rs9138and the C allele of rs1126616 were both significantlyassociated with increased risk of CRC (OR = 1.688,95% CI = 1.302–2.189, p < 0.001 and OR = 1.660,95% CI = 1.283–2.148, p < 0.001, respectively).

76 A. KAMAL ET AL.

The results of this study showed that the medianplasma OPN protein level was significantly higher inCRC patients [129.7 (108.8–157.8) ng/mL] when com-pared with the healthy control volunteers [93.7 (76.5–114.9) ng/mL] (p = 0.0001), but there was no signifi-cant correlation between its plasma level and CEA level(R = 0.001, p = 0.994) or with CA19–9 level (R = 0.010,p = 0.96).

Similarly, Fan et al. (2013) (14) found signif-icantly increased levels of plasma OPN in CRCpatients (133.57 ± 29.20 ng/mL) compared with con-trols (78.70 ± 23.64 ng/mL) (p < 0.001) and foundno relationship between OPN, CA19–9, and CEA(p > 0.05).

Several tumor markers have been proposed for thescreening and diagnosis of CRC like CEA, CA19–9,cytokeratin fragment (CYFRA) 21–1, and OPN. OPNlevel in plasma of CRC patients has been investigatedin previous studies for its potential use as a diagnos-tic marker either alone or in combination with othertumor markers in a serum biomarker panel to improvethe diagnostic value of single marker (21).

In this study, The sensitivity and specificity of OPNprotein level as a biomarker were 81.8% and 68.2%,respectively, with an AUC of 79.9% and a significantassociative cutoff level with CRC of >104.35 ng/mL.

Previous studies have illustrated the value of OPNas an indicator for progression of colon cancer. In thisstudy, we identified the plasma level, above which theassociation with CRC becomes significant.

The sensitivity of the OPN protein as a biomarkerfor CRC has been reported in several previous studiesto range from 45.1% (21) to 96.5% (14).

Our results reported no significant associationbetween plasma OPN protein concentration and dif-ferent CRC clinical parameters such as tumor site, dif-ferentiation degree, histological type, tumor stage, thepresence of polyps and family history (p = 0.341, 0.576,0.353, 0.841, 0.598, and 0.935, respectively).

Again, this comes in agreement with Fan et al. (2013)(14), who reported no significant association betweenOPN plasma level and the clinicopathological featuresof CRC.

In contrary, OPN levels were significantly raisedwith increasing tumor stage as reported by a categoricalmeta-analysis including six studies in which colorectaltumor stage (T stage) was related to OPN protein ormRNA levels in a total of 420 patients (22). Furtherinvestigations are needed to find out the correlation

between OPN plasma levels with the outcome of thedisease.

The molecular mechanisms by which OPN (rs9138and rs1126616) polymorphisms contribute to CRCrisk remain uncertain. However, polymorphisms at3′UTR may change miRNA binding power, regulategene expression, and affect cancer risk (23–25). Addi-tionally, Giacopelli et al. (2004) (26) reported that OPNpolymorphisms could affect its transcriptional activity.Furthermore, it was reported that the A allele of rs9138could enhance OPN mRNA degradation, thus dimin-ishing cancer risk (27).

OPN protein and polymorphisms have beenreported as important modulators in cancer regard-ing risk, prognosis, and outcomes (28–30). However,very limited data are available regarding the asso-ciation of OPN polymorphisms with CRC. In thisstudy, we suggest that OPN (rs9138 and rs1126616)polymorphisms are important contributors to CRCrisk, may be through interaction with other genetic orenvironmental factors.

Larger scale studies should be done in different eth-nicity and population to validate and confirm the fewpublished results regarding the role of SNPs rs9138 andrs1126616 in OPN gene and CRC increased risk, and itsclinical impaction.

The results of this study could be a step toimprove our understanding of genetic alterations in theCRC; to identify diagnostic, prognostic, and predictivebiomarkers supporting its prevention, early detection,and treatment.

Conclusion

OPN gene polymorphisms are associated withincreased risk of CRC. Age and gender are impor-tant modulators in the distribution of OPN genotypes.

Declaration of interest

The authors report no conflicts of interest. The authors aloneare responsible for the content and writing of the article.

References

1. Ferlay J, Soerjomataram I, Ervik M, Dikshi R, EserS, Mathers C, et al. Cancer incidence and mortal-ity worldwide: Sources, methods and major patterns inGLOBOCAN 2012. Int J Cancer 2015;136(5):359–386.doi:10.1002/ijc.29210.

CANCER INVESTIGATION 77

2. Poston GJ, Tait D, O’Connell S, Bennett A, BerendseS. Diagnosis and management of colorectal cancer:Summary of Nice Guidance. BMJ 2011;343:d6751. doi:10.1136/bmj.d6751.

3. Rojas-Puentes L, De La Garza JG, Calderillo-Ruiz G, Limo-Silva LS, Millan SV, Noveron NR, et al. Increased incidenceof colorectal cancer in young people (less than 40 years old)over the last ten years. J Cancerology 2014;1:16–22.

4. Khafagy W, El-Ghazaly M, E-Shobaky TM, Khafagy M.Colorectal cancer in Egypt – Does it differ? Coloproctol-ogy 2000;22(3):109–115.

5. Abou-Zeid AA, Khafagy W, Marzouk DM, Alaa A, MostafaI, Ela MA. Colorectal cancer in Egypt. Dis Colon Rectum2002;45(9):1255–1260.

6. Veruttipong D, Soliman AS, Gilbert SF, Blachley TS,Hablas A, Ramadan M, et al. Age distribution, polyps andrectal cancer in the Egyptian population-based cancer reg-istry. World J Gastroenterol 2012;18(30):3997–4003. doi:10.3748/wjg.v18.i30.3997.

7. Al-Barrak J, Gill S. Presentation and outcomes of patientsaged 30 years and younger with colorectal cancer: A 20-year retrospective review. Med Oncol 2011;28:1058–1061.

8. Ganapathi S, Kumar D, Katsoulas N, Melville D, Hodg-son S, Finlayson C, et al. Colorectal cancer in the young:Trends, characteristics and outcome. Int J Colorectal Dis2011;26:927–934.

9. Zauber AG, Winawer SJ, O’Brien MJ, Lansdorp-VogelaarI, van Ballegooijen M, Hankey BF, et al. Colonoscop-icpolypectomy and long-term prevention of colorectal-cancer deaths. N Engl J Med 2012;366(8):687–696. doi:10.1056/NEJMoa1100370.

10. Schoen RE, Pinsky PF, Weissfeld JL, Yokochi LA, Church T,Laiyemo AO, et al. Colorectal-cancer incidence and mor-tality with screening flexible sigmoidoscopy. Colorectal-cancer incidence and mortality with screening flexi-ble sigmoidoscopy. N Engl J Med 2012;366:2345–2357.doi:10.1056/NEJMoa1114635.

11. Stepien E, Wypasek E, Stopyra K, Konieczynska M, Przy-bylo M, Pasowicz M. Increased levels of bone remodelingbiomarkers (osteoprotegerin and osteopontin) in hyper-tensive individuals. Clin Biochem 2011;44:826–831. doi:10.1016/j.clinbiochem.2011.04.016.

12. Sodek J, Ganss B, McKee MD. Osteopontin. Crit Rev OralBiol Med 2000;11(3):279–303.

13. Mi Y, Ren K, Dai F, Zhu L, Feng N. OPN gene polymor-phisms, and rs9138 C/A, and cancer risk in a Chinese pop-ulation. Sci Rep 2015;15(5):14164. doi:10.1038/srep14164.

14. Fan Y, Zhang X, Yang ZH, Sun XW, Li SN, ZhongL, et al. The polymorphisms of osteopontin gene andplasma osteopontin protein level with susceptibility to col-orectal carcinoma. DNA Cell Biol 2013;32:594–600. doi:10.1089/dna.2013.2090.

15. Edge S, Byrd D, Compton C, Fritz A, Greene F, TrottiA. Cancer Staging Manual. American Joint Committee onCancer (AJCC). 7th ed. New York: Springer; 2010.

16. Fisher LW, Jain A, Tayback M, Fedarko NS. Smallintegrin-binding ligand n-linked glycoprotein gene family

expression in different cancers. Clin Cancer Res2004;10:8501–8511. doi: 10.1158/1078-0432.CCR-04-1072.

17. Weber GF. The cancer biomarker osteopontin: Combi-nation with other markers. Cancer Genomics Proteomics2011;8:263–288.

18. Barizzone N, Marchini M, Cappiello F, Chiocchetti A,Orilieri E, Ferrante D. Association of osteopontin reg-ulatory polymorphisms with systemic sclerosis. HumImmunol. 2011;72:930–934.

19. Han S, Guthridge JM, Harley ITW, Sestak AL, Kim-howard X, Kaufman KM, et al. Osteopontin and sys-temic lupus erythematosus association: A probablegene-gender interaction. PLoS ONE 2008;3(3):e1757.doi:10.1371/journal.pone.0001757.

20. El-Tanani MK, Campbell FC, Kurisetty V. The regulationand role of osteopontin in malignant transformation andcancer. Cytokine Growth Factor Rev 2006;17:463–474.

21. Lumarche F, Marino F, Orlando R, Chiara GB, Basso SMM.Simultaneous multianalyte immunoassay measurement offive serum tumor markers in the detection of colorectalcancer. Anticancer Res 2012;32:985–988.

22. Weber GF, Lett GS, Haubein NC. Osteopontin is a markerfor cancer aggressiveness and patient survival. Br J Cancer2010;103:861–869.

23. Chin LJ, Ratner E, Leng S, Zhai R, Weidhaas JB. A SNPin a let-7 microRNA complementary site in the KRAS3′untranslated region increases nonsmall cell lung cancerrisk. Cancer Res 2008;68:8535–8540.

24. Conne B, Stutz A, Vassalli JD. The 3′untranslated region ofmessenger RNA: A molecular ‘hotspot’ for pathology? NATMed 2000;6:637–641.

25. Landi D, Gemignani F, Nacarati A. Polymorphisms withinmicro-RNAbinding sites and risk of sporadic colorectalcancer. Carcinogenesis 2008;29:579–584.

26. Giacopelli F, Marciano R, Pistorio A, Catarsi P, Canini S,Karsenty G, et al. Polymorphisms in the osteopontin pro-moter affect its transcriptional activity. Physiol Genomics2004;20:87–96. doi: 10.1152/physiolgenomics.00138.2004.

27. Castelli EC, Moreau P, Oya E, Chiromatzo A. In silico anal-ysis of microRnaS targeting the Hla-g 3′untranslated regionalleles and haplotypes. Hum Immunol 2009;70:1020–1025.

28. Xu Q, Yuan B, Xue F, Zhang L, Li J, Guo H, et al. OPNgene polymorphisms are associated with susceptibility andclinicopatholigical characteristics of cervical cancer in aChinese cohort. Cancer Biomark 2011;10:233–239. doi:10.3233/CBM-2012-0251.

29. Zhao F, Chen X, Meng T, Hao B, Zhang Z, ZhangG. Genetic polymorphisms in the osteopontin promoterincreases the risk of distance metastasis and deathin Chinese patients with gastric cancer. BMC Cancer2012;12:477. doi:10.1186/1471-2407-12-477.

30. Dong QZ, Zhang XF, Zhao Y, Jia HL, Zhou HJ, Dai C,et al. Osteopontin promoter polymorphisms at locus – 443significantly affect the metastasis and prognosis of humanhepatocellular carcinoma. Hepatology 2013;57:1024–1034.doi: 10.1002/hep.26103.