Detection, characterization and expression dynamics of histone proteins in the dinoflagellate Alexandrium pacificum during growth regulation

Sadaf Riaz1,2 , Zeeshan Niaz1,3 , Sohrab Khan1,3, Yuan Liu1, *, Zhenghong Sui1, *

1Key Laboratory of Marine Genetics and Breeding (Ocean University of China), Ministry of Education, Qingdao, 266003, China.

2Department of Microbiology, University of Central Punjab, Lahore, Pakistan

3Department of Microbiology, Hazara University, Mansehra, Pakistan

*Corresponding author :

E-mail: liuyuan@ouc.edu.cn; suizhengh@ouc.edu.cn

Phone number: +86 532 82031128 ; Fax number: +86 532 82031128

Table S1. Genes and primers used in this study for expression analysis

GeneID

Gene name in the A. pacificum transcriptome (SRX368254)

Primers used, forward/reverse (5′-3′) Product(bp)

Reference

H2A.a Algae_064-1_Unigene_BMK.10533

CGTGCTGCCGAACATCCACACATGCTCCATTCCGTCTCCTTTGC

124 (Riaz and Sui, 2018)

H2A.b Algae_064-3_Unigene_BMK.9977

GTCGCCAAGGACCTGAAGACCAAGTCAGCAGGGACTTGTCGATGTGG

142 (Riaz and Sui, 2018)

H2B.a Algae_064-3_Unigene_BMK.33389

CCAAAGCGGACAAAGAAGAGGACGGTGACACAGGACTCCATGAC

124 (Riaz and Sui, 2018)

H2B.b Algae_064-2_Unigene_BMK.13294

CAGATTCACCCAGAGTGTGGCATTTCCGTCTCTTCATGGTCCTTAACA

124 (Riaz and Sui, 2018)

H3.a Algae_064-1_Unigene_BMK.42014

CACGGACCTTCTCATTCGCAAACCAAGCACAGCCTGGGATTGGAAC

101 (Riaz and Sui, 2018)

H3.b Algae_064-1_Unigene_BMK.10241

CTTCGAGGACGCCAACCTCTGCTGCGACGACACCCCCTTTACCC

125 (Riaz and Sui, 2018)

H4.a Algae_0641_Unigene_BMK.40313

CGCAGGAAGACGGTCACGGCACTGTCACTCACCCGCAGCCCTCCAC

135 (Riaz and Sui, 2018)

H4.b Algae_064-2_Unigene_BMK.7539

AGGGCGACAAGTTCAGCAAGGAGCAGGCTTGGTGATGCCCGAGAT

108 (Riaz and Sui, 2018)

H1.a Algae_064-1_Unigene_BMK.29547

GCTCAAGGACCCTGCCATCTTTACTACCGGCTTTGCTTTCCCTTTA

159 (Riaz and Sui, 2018)

Control GAPDHGACGGTGACTCCCTGGTGATTGTTCAAGTGCGGCTGCACCTTTT

152 (Niaz et al., 2018)

Control ActinTCGCGTTGTATTCTTGTTGTAGCCTCGTCGCCGATGTAACTGTCCT

197 (Niaz et al., 2018)

HLP Histone-Like protein CCTCCGCAGTGGCAATCTCCCAAGGCGAAGGCAATGAA

135 (Chunyan, 2016)

Figure S1. Maximum likelihood phylogenetic tree of H1 proteins sequences in A. pacificum. The representative sequences included in this figure were downloaded from NCBI protein database. The number below each node represents a bootstrap statistic value, while red circles denotes sequences from A. pacificum.

Figure S2. Multiple sequence alignment of H2A.X and H2A.Z of A. pacificum and other eukaryotes. Sequences were obtained from NCBI protein database, aligned using MUSCLE, and visualized using JalView. The gene H2A.X has a signature sequence (SQEF) at the C-terminus that is also commonly present in dinoflagellates; similar motifs including SQEY, SQQY, and SQDF are seen in other species (Marinov and Lynch, 2016). The H2A.Z variant is most conserved among other H2A variants. This is especially true for the docking domain sequence of this gene, which is more conserved among eukaryotes, while the L1-loop is conserved in many animal species (TTSH) as well as in dinoflagellates (ITHN).

Figure S3. Sequence alignment of A. pacificum histones with human for the calculation of conserved residues that could be posttranslational modified. References of these modifications were described previously (Marinov and Lynch, 2016).

Figure S4. Sequence alignment of A. pacificum histones (H2A and H2B) with human histones to determine conserved histone-DNA and histone-histone interacting sites. Human histone sequences and corresponding interacting site were obtained from Molecular Modeling Database (MMDB ID: 112938) (Madej et al,. 2015; Iwasaki et al., 2013).

H2A

H2B

Figure S5. Sequence alignment of A. pacificum histones (H3 and H4) with human histones to determine conserved histone-DNA and histone-histone interacting sites. Human histone sequences and corresponding interacting site were obtained from Molecular Modeling Database (MMDB ID: 112938) (Madej et al,. 2015; Iwasaki et al., 2013)

.

H3

H4

Figure S6. FACT complex domain organization in A. pacificum, yeast (S. cerevisiae), and human (H. sapiens). The FACT complex comprises two subunits of SPT16 and SSRP1 (POB3 in yeast), and domains were predicted by scanning representative protein sequences against the Pfam database.

Figure S7. Standard curve of histone genes used for RT-qPCR analysis

Figure S8. (A) Western blot of eukaryotic core histones (other than dinoflagellates) using commercially available human origin antibodies, all obtained from Sangon, China (H2A: D261744; H2B: D162913; H3: D124055; H4: D222482). Western blot analysis was performed as described in materials and methods section using 1:200 dilution of primary antibodies. Same antibodies did not show positive reaction for A. pacificum histone (Riaz and Sui, 2018) (B) Western blot of A. pacificum core histones using dinoflagellate/histone-specific antibodies.

Figure S9. Different variants of histone H4 in A. pacificum. Antibodies were raised against the histone H4 variant 1 (KY659044) while this variant shares 88% antigenic similarity (22/25 amino acids) with the H4 variant 2.

References

Chunyan W. Screening of environmental factors responsive genes from Alexandrium catenella and the isolation and identification of nanoplanktonic algae from the North Yellow Sea. 2016. Thesis Ocean univeristy of China.

Iwasaki W, Miya Y, Horikoshi N, Osakabe A, Taguchi H, Tachiwana H, Shibata T, Kagawa W, Kurumizaka H. Contribution of histone N-terminal tails to the structure and stability of nucleosomes. FEBS Open Bio, 2013: 3 p.363-369. https://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?dps=0&uid=3W98

Madej T, Lanczycki CJ, Zhang D, Thiessen PA, Geer RC, Marchler-Bauer A, Bryant SH. MMDB and VAST+: tracking structural similarities between macromolecular complexes. Nucleic Acids Res, 42(Database issue). 2014:D297-303.

Marinov, G. K. & Lynch, M. Diversity and divergence of dinoflagellate histone proteins. G3: Genes| Genomes| Genetics. 2016, 6: 397-422.

Niaz Z, Sui Z, Riaz S, Yuan L, Shang E, Xing Q, Khan S, Du Q, Zhou W. Identification of valid reference genes for the normalization of RT-qPCR gene expression data in Alexandrium catenella under different nutritional conditions. Journal of Applied phycology. 2018,  https://doi.org/10.1007/s10811-018-1664-2.

Riaz S. & Sui Z. Molecular cloning, transcript profiling, and characterization of histone genes in the dinoflagellate Alexandrium pacificum. Journal of microbiology and biotechnology.2018, DOI: 10.4014/jmb.1802.01075.