argumentos para investigar en ciencia el paradigmático ... · scientists have identified hundreds...

50
Francisco J. M. Mojica Argumentos para investigar en ciencia El paradigmático caso de los sistemas CRISPR

Upload: others

Post on 09-Aug-2020

0 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Francisco J. M. Mojica

Argumentos para investigar en cienciaEl paradigmático caso de los sistemas CRISPR

Page 2: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

De This vector version: Eric Gaba (Sting - fr:Sting) - NASA Astrobiology Institute, found in an article(Source unavailable), Dominio público, https://commons.wikimedia.org/w/index.php?curid=26075698

Procariotas Eucariotas

Page 3: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy
Page 4: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Genoma (ADN)

CRISPR CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats)

Espaciador

Espaciadores

Page 5: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy
Page 6: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

1992: 1os Estudios

Salinas Solares. Santa Pola (Alicante)

Haloferax spp.

Boán, I.F. Universidad de Alicante

Francisco E.Rodríguez-Valera

GuadalupeJuez-Pérez

Martin Nieto, J. Universidad de Alicante

Page 7: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

GTTACAGACGAACCCTAGTTGGGTTGAAGCGAACAGGATGGCGAACCGGTGTCTGCACCAGTTGTTACAGACGAACCCTAGTTGGGTTGAAGCCACGACAATCAAGTCTGGTTGCATGGCGACACGGAGTTACAGACGAACCCTAGTTGGGTTGAAGCCTGTGCCTCCAGCGGCCGTCAGACAGTCGCATCCGAGTTACAGACGAACCCTAGTTGGGTTGAAGCAAGAAGCCGCTCGCCGTCCTCGATGACGGGCGGGCGGTTACAGACGAACCCTAGTTGGGTTGAAGCGACAAGACTCGCGACGAAGCCGAGTCGAAACGCCGCGTTACAGACGAACCCTAGTTGGGTTGAAGCCTCTTTATCCCTCCTGCCCGAATGTCTACGAATATCGTTACAGACGAACCCTAGTTGGGTTGAAGCGAACCCACTGGTGAAGAAAAAGTTGTAGAGACCCTAGTTACAGACGAATCCCTAGTTGGGTTGAAGCACGACAATCAAGTCTGGTTACATGGCGACAGGATGGGTTACAGACGAACCCTAGTTGGGTTGAAGCTTCCACAACGTCGGGGAGGGCGAAATTAGCCAAGCAGTTACAGACGAACCCTAGTTGGGTTGAAGC

1992: 1os Estudios

Mojica. FJM. Tesis Doctoral (1993)

A C G T

Page 8: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

¿Qué función desempeñan?

Mojica et al. Molecular Microbiology (1995)

Mojica, FJM.; Tesis Doctoral (1993)

ARN

?

?

¿

¿

Page 9: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

2000: Una nueva familia de repeticiones

Francisco J.M. Mojica et al. Molecular Microbiology (2000)

Page 10: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

ClusteredRegularlyInterspacedShortPalindromicRepeats

CRISPR-Cas systems, Barrangou and van der Oost (Springer-Verlag Berlin Heidelberg 2013) With permission of Springer.

Page 11: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Proteínas Cas

C R I S P R

Sistemas CRISPR

Genes cas (CRISPR associated )

Page 12: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Proteínas Cas

C R I S P R

Sistemas CRISPR

Page 13: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Sistemas CRISPR

Proteínas Cas

C R I S P R

Sistema de Inmunidad Adquirida

Page 14: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Mojica & Almendros. Investigación y Ciencia. 2017

Page 15: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Infección

Page 16: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Inmunización

Page 17: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Célula Inmunizada

Page 18: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Producción de guías

ARN guía

Page 19: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Reinfección

Page 20: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Reconocimiento

Page 21: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Corte

Page 22: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Inactivación

Page 23: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Aplicaciones de CRISPR en procariotas

Page 24: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Vacunación

Page 25: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Almacenamiento de datos

Page 26: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

IIIIIIIIIIII

Cas9

ARN guía

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIADN

La Tecnología CRISPR

Page 27: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Cas9

ARN guía

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIADNIIIIIIIIIIII

La Tecnología CRISPR

Page 28: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Matar bacterias

Page 29: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy
Page 30: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Aplicaciones de la tecnología CRISPR en cualquier ser vivo

Page 31: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Cas9

ARN guía

dCas9

• Diagnóstico molecular

• Control de la actividad genética

• Reescribir el ARN

• Actuar sobre el ADN

Visualización

Arquitectura

Emplazamiento

Cambios epigenéticos

Edición genética

Page 32: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Cas9

ARN guía

dCas9

• Diagnóstico molecular

• Control de la actividad genética

• Reescribir el ARN

• Actuar sobre el ADN

Visualización

Arquitectura

Emplazamiento

Cambios epigenéticos

Edición genética

Page 33: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Diagnóstico Molecular

Page 34: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Edición Genética

-- ACTGGGGGCCCATGGTACCGGTTAATTACCGGTAC --(Esta proteína se encarga de sintetizar colesterol)

-- ACTGGGGGCCCTACCATGAGGTTAATTACCGGTAC --(Esta proteína ya no puede sintetizar colesterol)

-- ACTGGGGGCCCATGGTACCGGTTAATT--------GTAC--(Esta proteína no es funcional)

-- ACTGGGGGCCCATGGTACCGGTTAATTACCGGTACCATACCG --(Esta proteína se encarga de sintetizar diversos lípidos)

Page 35: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy
Page 36: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy
Page 37: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy
Page 38: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy
Page 39: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy
Page 40: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy
Page 41: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

• Biotecnología

• Productividad y calidad de alimentos

• Salud y bienestar animal

• Salud humana

• Prevención y tratamiento de infecciones

• Alteraciones genéticas

• Diagnóstico de enfermedades

Aplicacionesde la edición

genética en …

Page 42: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Agricultura• Frutas sin semillas

• Cultivos con mayor productividad

• Composición modificada (sin gluten, contenido oleico…)

• Inmunes a enfermedades …

• Cultivos resistentes

• ….

Moderador
Notas de la presentación
ment: A recent article in Fast Company Magazine detailed efforts at DuPont to develop new commodity crops, which are expected to hit the market in 5 to 10 years – almost half the traditional development timeline.
Page 43: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy
Page 44: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Ganadería

Page 45: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Estudio y prevención de enfermedades

Page 46: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Estudio y prevención de enfermedades

Moderador
Notas de la presentación
SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy tissue unharmed. Researchers disrupted every gene in over 30 types of cancer to discover thousands of key genes essential for the survival of the disease. In one of the largest studies of its kind, the team, from Britain’s Wellcome Sanger Institute, found 600 genes that show promise of leading into effective treatments.
Page 47: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Estudio y prevención de enfermedades

Moderador
Notas de la presentación
SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy tissue unharmed. Researchers disrupted every gene in over 30 types of cancer to discover thousands of key genes essential for the survival of the disease. In one of the largest studies of its kind, the team, from Britain’s Wellcome Sanger Institute, found 600 genes that show promise of leading into effective treatments.
Page 48: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

CRISPR como agente terapéutico en animales

• Deficiencia de ornitina transcarbamilasa• Enfermedad granulomatosa crónica• Distrofia muscular de Duchenne• Amaurosis congénita de Leber• Enfermedad de Huntington• Tirosinemia hereditaria• Retinosis pigmentaria• Cataratas congénitas• Hemofilias• Diabetes• Cáncer• VIH• …

Page 49: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Ensayos clínicos con CRISPR en humanos

Page 50: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy

Mojica & Almendros. Investigación y Ciencia. 2017