argumentos para investigar en ciencia el paradigmático ... · scientists have identified hundreds...
TRANSCRIPT
![Page 1: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/1.jpg)
Francisco J. M. Mojica
Argumentos para investigar en cienciaEl paradigmático caso de los sistemas CRISPR
![Page 2: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/2.jpg)
De This vector version: Eric Gaba (Sting - fr:Sting) - NASA Astrobiology Institute, found in an article(Source unavailable), Dominio público, https://commons.wikimedia.org/w/index.php?curid=26075698
Procariotas Eucariotas
![Page 3: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/3.jpg)
![Page 4: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/4.jpg)
Genoma (ADN)
CRISPR CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats)
Espaciador
Espaciadores
![Page 5: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/5.jpg)
![Page 6: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/6.jpg)
1992: 1os Estudios
Salinas Solares. Santa Pola (Alicante)
Haloferax spp.
Boán, I.F. Universidad de Alicante
Francisco E.Rodríguez-Valera
GuadalupeJuez-Pérez
Martin Nieto, J. Universidad de Alicante
![Page 7: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/7.jpg)
GTTACAGACGAACCCTAGTTGGGTTGAAGCGAACAGGATGGCGAACCGGTGTCTGCACCAGTTGTTACAGACGAACCCTAGTTGGGTTGAAGCCACGACAATCAAGTCTGGTTGCATGGCGACACGGAGTTACAGACGAACCCTAGTTGGGTTGAAGCCTGTGCCTCCAGCGGCCGTCAGACAGTCGCATCCGAGTTACAGACGAACCCTAGTTGGGTTGAAGCAAGAAGCCGCTCGCCGTCCTCGATGACGGGCGGGCGGTTACAGACGAACCCTAGTTGGGTTGAAGCGACAAGACTCGCGACGAAGCCGAGTCGAAACGCCGCGTTACAGACGAACCCTAGTTGGGTTGAAGCCTCTTTATCCCTCCTGCCCGAATGTCTACGAATATCGTTACAGACGAACCCTAGTTGGGTTGAAGCGAACCCACTGGTGAAGAAAAAGTTGTAGAGACCCTAGTTACAGACGAATCCCTAGTTGGGTTGAAGCACGACAATCAAGTCTGGTTACATGGCGACAGGATGGGTTACAGACGAACCCTAGTTGGGTTGAAGCTTCCACAACGTCGGGGAGGGCGAAATTAGCCAAGCAGTTACAGACGAACCCTAGTTGGGTTGAAGC
1992: 1os Estudios
Mojica. FJM. Tesis Doctoral (1993)
A C G T
![Page 8: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/8.jpg)
¿Qué función desempeñan?
Mojica et al. Molecular Microbiology (1995)
Mojica, FJM.; Tesis Doctoral (1993)
ARN
?
?
¿
¿
![Page 9: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/9.jpg)
2000: Una nueva familia de repeticiones
Francisco J.M. Mojica et al. Molecular Microbiology (2000)
![Page 10: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/10.jpg)
ClusteredRegularlyInterspacedShortPalindromicRepeats
CRISPR-Cas systems, Barrangou and van der Oost (Springer-Verlag Berlin Heidelberg 2013) With permission of Springer.
![Page 11: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/11.jpg)
Proteínas Cas
C R I S P R
Sistemas CRISPR
Genes cas (CRISPR associated )
![Page 12: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/12.jpg)
Proteínas Cas
C R I S P R
Sistemas CRISPR
![Page 13: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/13.jpg)
Sistemas CRISPR
Proteínas Cas
C R I S P R
Sistema de Inmunidad Adquirida
![Page 14: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/14.jpg)
Mojica & Almendros. Investigación y Ciencia. 2017
![Page 15: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/15.jpg)
Infección
![Page 16: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/16.jpg)
Inmunización
![Page 17: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/17.jpg)
Célula Inmunizada
![Page 18: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/18.jpg)
Producción de guías
ARN guía
![Page 19: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/19.jpg)
Reinfección
![Page 20: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/20.jpg)
Reconocimiento
![Page 21: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/21.jpg)
Corte
![Page 22: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/22.jpg)
Inactivación
![Page 23: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/23.jpg)
Aplicaciones de CRISPR en procariotas
![Page 24: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/24.jpg)
Vacunación
![Page 25: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/25.jpg)
Almacenamiento de datos
![Page 26: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/26.jpg)
IIIIIIIIIIII
Cas9
ARN guía
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIADN
La Tecnología CRISPR
![Page 27: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/27.jpg)
Cas9
ARN guía
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIADNIIIIIIIIIIII
La Tecnología CRISPR
![Page 28: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/28.jpg)
Matar bacterias
![Page 29: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/29.jpg)
![Page 30: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/30.jpg)
Aplicaciones de la tecnología CRISPR en cualquier ser vivo
![Page 31: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/31.jpg)
Cas9
ARN guía
dCas9
• Diagnóstico molecular
• Control de la actividad genética
• Reescribir el ARN
• Actuar sobre el ADN
Visualización
Arquitectura
Emplazamiento
Cambios epigenéticos
Edición genética
![Page 32: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/32.jpg)
Cas9
ARN guía
dCas9
• Diagnóstico molecular
• Control de la actividad genética
• Reescribir el ARN
• Actuar sobre el ADN
Visualización
Arquitectura
Emplazamiento
Cambios epigenéticos
Edición genética
![Page 33: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/33.jpg)
Diagnóstico Molecular
![Page 34: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/34.jpg)
Edición Genética
-- ACTGGGGGCCCATGGTACCGGTTAATTACCGGTAC --(Esta proteína se encarga de sintetizar colesterol)
-- ACTGGGGGCCCTACCATGAGGTTAATTACCGGTAC --(Esta proteína ya no puede sintetizar colesterol)
-- ACTGGGGGCCCATGGTACCGGTTAATT--------GTAC--(Esta proteína no es funcional)
-- ACTGGGGGCCCATGGTACCGGTTAATTACCGGTACCATACCG --(Esta proteína se encarga de sintetizar diversos lípidos)
![Page 35: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/35.jpg)
![Page 36: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/36.jpg)
![Page 37: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/37.jpg)
![Page 38: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/38.jpg)
![Page 39: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/39.jpg)
![Page 40: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/40.jpg)
![Page 41: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/41.jpg)
• Biotecnología
• Productividad y calidad de alimentos
• Salud y bienestar animal
• Salud humana
• Prevención y tratamiento de infecciones
• Alteraciones genéticas
• Diagnóstico de enfermedades
Aplicacionesde la edición
genética en …
![Page 42: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/42.jpg)
Agricultura• Frutas sin semillas
• Cultivos con mayor productividad
• Composición modificada (sin gluten, contenido oleico…)
• Inmunes a enfermedades …
• Cultivos resistentes
• ….
![Page 43: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/43.jpg)
![Page 44: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/44.jpg)
Ganadería
![Page 45: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/45.jpg)
Estudio y prevención de enfermedades
![Page 46: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/46.jpg)
Estudio y prevención de enfermedades
![Page 47: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/47.jpg)
Estudio y prevención de enfermedades
![Page 48: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/48.jpg)
CRISPR como agente terapéutico en animales
• Deficiencia de ornitina transcarbamilasa• Enfermedad granulomatosa crónica• Distrofia muscular de Duchenne• Amaurosis congénita de Leber• Enfermedad de Huntington• Tirosinemia hereditaria• Retinosis pigmentaria• Cataratas congénitas• Hemofilias• Diabetes• Cáncer• VIH• …
![Page 49: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/49.jpg)
Ensayos clínicos con CRISPR en humanos
![Page 50: Argumentos para investigar en ciencia El paradigmático ... · SCIENTISTS have identified hundreds of opportunities for new drugs to precisely kill cancer cells but leave healthy](https://reader033.vdocuments.us/reader033/viewer/2022050517/5fa0d8988ebf4b3c752c9b60/html5/thumbnails/50.jpg)
Mojica & Almendros. Investigación y Ciencia. 2017