an rmla gene encoding d-glucose-1-phosphate thymidylyltransferase is essential for mycobacterial...

R E S E A R C H L E T T E R

An rmlA gene encodingD-glucose-1-phosphatethymidylyltransferase is essential formycobacterial growthHong Qu1, Yi Xin2, Xu Dong1 & Yufang Ma1,3

1Department of Biochemistry and Molecular Biology; 2Liaoning Provincial Core Lab of Glycobiology and Glycoengineering; and 3Department of

Biotechnology, Dalian Medical University, Dalian, China

Correspondence: Yufang Ma, Department

of Biochemistry and Molecular Biology, Dalian

Medical University, Dalian 116027, PR China.

Tel.: 186 411 8472 0612; fax: 186 411 8472

1582; e-mail: [email protected]

Received 11 April 2007; revised 8 July 2007;

accepted 16 July 2007.

First published online September 2007.

DOI:10.1111/j.1574-6968.2007.00890.x

Editor: Roger Buxton

Keywords

Mycobacterium tuberculosis ; Mycobacterium

smegmatis ; mycobacterial cell wall; dTDP-

rhamnose; rmlA ; D-glucose-1-phosphate

thymidylyltransferase.

Abstract

The rhamnose-GlcNAc disaccharide is a critical linker which connects arabinoga-

lactan to peptidoglycan via a phosphodiester linkage. The biosynthesis of dTDP-

rhamnose is catalysed by four enzymes, and the first reaction is catalysed by

an rmlA gene encoding D-glucose-1-phosphate thymidylyltransferase (RmlA).

We generated a Mycobacterium smegmatis mc2155 mutant lacking the rmlA gene

via a homologous recombination method. We tested the requirement for the rmlA

gene and the effect of a lack of RmlA on bacterial cell morphology. The results

demonstrate that the rmlA gene is essential for mycobacterial growth and that lack

of RmlA activity has profound negative effects on bacterial cell morphology. RmlA

is thus a potential target for the development of new antituberculosis drugs.

Introduction

The mycobacterial cell wall is a complex structure composed

of peptidoglycan, arabinogalactan and mycolic acids. The

D-N-acetylglucosamine–L-rhamnose disaccharide connects

the galactan region of arabinogalactan to the peptidoglycan

via a phosphodiester linkage (Brennan & Nikaido, 1995;

Crick et al., 2004). Therefore, the disaccharide is a critical

linker to the structural integrity of the cell wall and is thus

required for mycobacterial viability. The L-rhamnose of the

disaccharide linker is from a precursor, dTDP-rhamnose.

dTDP-rhamnose is synthesized from D-glucose-1-phosphate

and dTTP via a biosynthetic pathway that consists of four

distinct enzymes (Stevenson et al., 1994; Ma et al., 1997;

Tsukioka et al., 1997a, b): D-glucose-1-phosphate thymidy-

lyltransferase (RmlA), dTDP-D-glucose-4, 6-dehydratase

(RmlB), dTDP-4-keto-6-deoxyglucose-3, 5-epimerase

(RmlC) and dTDP-6-deoxy-L-lyxo-4-hexulose reductase

(RmlD). RmlA–D enzymes are encoded by the genes

rmlA–D, previously named rfbA–D (Reeves et al., 1996).

Briefly, RmlA catalyses the reaction of D-glucose-1-phos-

phate and dTTP to produce dTDP-D-glucose and PPi

(Pyrophosphate). RmlB oxidizes dTDP-D-glucose to form

dTDP-6-deoxy-D-xylo-4-hexulose. RmlC converts dTDP-6-

deoxy-D-xylo-4-hexulose to dTDP-6-deoxy-L-lyxo-4-hexulose,

and RmlD catalyzes the reaction of dTDP-6-deoxy-L-lyxo-4-

hexulose and NADPH to generate dTDP-rhamnose and

NADP. The rhamnosyl transferase encoded by the wbbL gene

transfers the rhamnosyl residue of dTDP-rhamnose into D-

N-acetylglucosaminosyl-1-phosphate to form a D-N-acetyl-

glucosamine-L-rhamnose disaccharide linker. Mycobacterium

tuberculosis rmlA–D genes are not located in one locus in the

genome (Cole et al., 1998). The rmlA (Rv0334) gene is isolated

from any other rhamnosyl formation enzymes, the rmlB

(Rv3464) and rmlC (Rv3465) genes are together in one

operon, and the rmlD (Rv3266c) gene is found in an operon

with wbbL (Rv3265c) and manB (Rv3264c) (Cole et al., 1998).

Mycobacterium tuberculosis is a remarkably successful

pathogen that has latently infected one-third of the World’s

population. One in every ten of these individuals will

develop tuberculosis at some point in their lifetime and

2 million people die of tuberculosis each year (Warner &

Mizrahi, 2004; Zhang et al., 2006). There have been no new

drugs to combat tuberculosis in nearly 40 years; the identi-

fication of more drug targets for the development of

antituberculosis drugs is therefore urgently required. It is

FEMS Microbiol Lett 275 (2007) 237–243 c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

obvious that the disaccharide linker is an excellent drug target

given that inhibition of the disaccharide biosynthesis could

affect the integrity of the mycobacterial cell wall, which is

required for the survival and growth of mycobacteria in the

host. In previous studies, we have generated Mycobacterium

smegmatis mc2155 mutants with the rmlB–C and rmlD genes

knocked out, respectively, and performed tests of the essential

requirement for the rmlB, rmlC and rmlD genes for mycobac-

terial growth. The results provided the direct evidence that

M. tuberculosis rmlB, rmlC and rmlD genes are valid targets

(Ma et al., 2002; Li et al., 2006). We also established

M. tuberculosis RmlB–D enzyme assays to screen inhibitors

for developing new tuberculosis therapeutics (Ma et al., 2001).

In the present study, we generated an M. smegmatis mc2155

rmlA gene knock-out strain via a homologous recombination

strategy and tested the essential requirement for the rmlA

gene for mycobacterial growth. We also observed the mor-

phology of the mc2155 rmlA gene knock-out cells by scanning

electron microscopy (SEM) to determine the effects of RmlA

activity on the morphological phenotype of M. smegmatis.

Materials and methods

Bacterial strains and plasmids

The characteristics of all bacterial strains and plasmids used in

this study are detailed in Table 1. Escherichia coli NovaBlue

cells were routinely grown in Luria-Bertani (LB) broth or on

LB agar plates at 37 1C. Mycobacterium smegmatis mc2155

cells were routinely grown in LB broth containing 0.05%

Tween 80 or on LB agar plates at 37 1C. The rmlA knock-out

strain mc2155 was grown at 30 and 42 1C. The final concen-

trations of antibiotics used were as follows: ampicillin (Ap),

100mg mL�1 for NovaBlue; kanamycin (Km), 50mg mL�1 for

NovaBlue and 25mg mL�1 for mc2155; gentamicin (Gm),

5mg mL�1 for NovaBlue and mc2155; and streptomycin

(Sm), 25mg mL�1 for NovaBlue and 12.5mg mL�1 for mc2155.

Preparation of M. smegmatis mc2155 genomicDNA and Southern blot analysis

mc2155 cells from 5 mL of culture were harvested for

genomic DNA preparation as described (Li et al., 2006).

mc2155 genomic DNA was dissolved in 15 mL TE buffer and

stored at 4 1C for further use.

The genomic DNA was digested by SmaI and the resulting

DNA fragments was separated by running a 0.8% agarose gel.

The DNA was transferred to Nytran membrane (Schleicher &

Schuell) as described (Li et al., 2006). Southern hybridization

was performed using a DIG High Prime Labeling and

Detection Starter Kit I (Roche). The membrane was prehy-

bridized at 42 1C for 1 h in DIG Easy Hyb and hybridized via a

digoxigenin-labeled rmlA probe overnight at 42 1C. After the

membrane was washed with 2� SSC containing 0.1% SDS

and 0.5� SSC containing 0.1% SDS, the hybridized DNA

bands were detected by colorimetric solution.

Construction of conditional replication plasmidand rescue plasmid

Mycobacterium tuberculosis H37Rv RmlA (Rv0334) protein

sequence was acquired from the TubercuList (http://

genolist.pasteur.fr/TubercuList/). Mycobacterium tuberculosis

RmlA protein sequence was used as a query in BLASTP to

identify the most homologous gene in the M. smegmatis

Table 1. Bacterial strains and plasmids used in this study

Strains/plasmids Description Source/reference

Strains

E. coli NovaBlue For constructing plasmids Novagen

M. tuberculosis H37Rv Pathogenic; for amplifying M. tuberculosis rmlA gene ATCC

M. smegmatis mc2155 Nonpathogenic; for amplifying M. smegmatis rmlA gene

and achieving homologous recombination at rmlA locus

ATCC

mc2155 mutant-1 mc2155 with pPR27-rmlA::KmR integrated into rmlA locus This work

mc2155 mutant-2 mc2155 with knocked rmlA gene in presence of pCG76-Mtb rmlA This work

Plasmids

pMD18-T For cloning PCR product with A0 at 30 ends Takara

pUC4 K For disrupting M. smegmatis rmlA by kmR cassette GE Healthcare

pPR27-xylE Carries sacB and xylE genes; carries replication origins for E. coli and mycobacteria Guilhot et al. (1994)

pET23b-Phsp60 Carries M. bovis BCG hsp60 promoter Guilhot et al. (1994)

pCG76 Carries replication origins for E. coli and mycobacteria Li et al. (2006)

pMD-rmlA M. smegmatis rmlA gene with its upstream sequence was cloned to EcoRV site of pMD18-T This work

pMD-rmlA::KmR The KmR cassette was inserted to StuI site of pMD-rmlA This work

pPR27-rmlA::KmR M. smegmatis rmlA::KmR was cloned to NotI and SpeI sites of pPR27-xylE This work

pMD-Mtb rmlA M. tuberculosis rmlA gene was cloned to EcoRV site of pMD18-T This work

pET23b-Phsp60-Mtb rmlA M. tuberculosis rmlA gene was cloned to NdeI and XhoI sites of pET23b-Phsp60 This work

pCG76-Mtb rmlA Phsp60-Mtb rmlA was cloned to XbaI and XhoI sites of pCG76 This work

FEMS Microbiol Lett 275 (2007) 237–243c� 2007 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

238 H. Qu et al.

mc2155 genome. The M. smegmatis rmlA gene (867 bp) with

its upstream sequence (506 bp) was amplified from mc2155

genomic DNA by using the M. smegmatis rmlA-1 primer

(50AACTAGTGGCGACCCCCCTTTACCCGGATG 30, un-

derlined sequence is the SpeI site) and M. smegmatis rmlA-2

primer (50TGCGGCCGCCTACTCTCGATCCAGAAGTTG

30, underlined sequence is the NotI site). The PCR product

of 1373 bp was purified and ligated to pMD18-T to generate

pMD-rmlA (Table 1). The KmR cassette from pUC4 K

was inserted to the StuI site of the rmlA gene, yielding

pMD-rmlA::KmR (Table 1). The rmlA::kmR fragment

(2.63 kb) was ligated into NotI and SpeI sites of pPR27-xylE

(Li et al., 2006), resulting in a conditional replication plasmid

pPR27-rmlA::KmR (Table 1, Fig. 1a), which was used to

achieve the first single crossover at the rmlA locus of the

M. smegmatis mc2155 genome.

The M. tuberculosis rmlA gene was amplified from

M. tuberculosis H37Rv genomic DNA (supplied by Colorado

State University via an NIH contract) by using M. tuberculosis

rmlA-1 primer (50 CATATG ATGCGCGGGATCATCTTGGC

30, underlined sequence is the NdeI site) and M. tuberculosis

rmlA-2 primer (50 CTCGAGTCAGTTGCGCTCCAACA

ACTC 30 underlined sequence is the XhoI site). Mycobacterium

tuberculosis rmlA was cloned into pMD18-T vector to generate

a pMD-Mtb rmlA (Table 1). The M. tuberculosis rmlA gene

was ligated into NdeI and XhoI sites of pET23b-Phsp60

3.24 kb

10.12 kb

1.2 kb

1 2 3 4

8.07 kb

7.72 kb

(b) (c)

8.14 kb

3.24 kb

10.12 kb

6.50 kb

0.55 kb

1 2 3 4 5 6 7

(a)

Fig. 1. (a) The integration of pPR27-rmlA::KmR upstream of the rmlA locus resulted in mc2155 mutant-1; and the deletion of the rmlA gene from

mc2155 mutant-1 resulted in mc2155 mutant-2 (rmlA knock-out) strain. (b) Southern analysis of mc2155 mutant-1 strains. Lanes 1 and 2, two mc2155

mutant-1 strains generated 3.24-, 7.72- and 8.07-kb fragments; Lane 3, wild-type mc2155 shows a 10.12-kb fragment; Lane 4, pPR27-rmlA::KmR

shows 1.2- and 7.72-kb fragments. (c) Southern analysis of mc2155 rmlA knock-out strains. Lanes 1–5, five mc2155 rmlA knock-out strains (nos. 1, 2, 3,

4 and 5) generated 3.24-, 6.5- and 8.14-kb fragments – the 6.5-kb fragment comes from pCG76-Mtb rmlA; Lane 6, wild-type mc2155 shows a 10.12-kb

fragment; Lane 7, pCG76-Mtb rmlA shows 0.55- and 6.5-kb fragments.


239Essential RmlA enzyme

(Li et al., 2006) to generate pET23b-Phsp60-Mtb rmlA

(Table 1). The Phsp60-Mtb rmlA fragment was ligated to

pCG76 (Guilhot et al., 1994), resulting in a rescue plasmid

pCG76-Mtb rmlA (Table 1).

Selection of mc2155 mutant-1 strains withintegrated rmlA::KmR in the genome

Electrocompetent mc2155 cells were prepared as described

(Guilhot et al., 1994), and pPR27-rmlA::KmR was electro-

porated to mc2155 cells. Transformants were grown on LB

agar plates containing Km and Gm at 30 1C. One colony was

propagated in LB broth containing 0.05% Tween 80, Km

and Gm at 30 1C and the cells were spread on LB agar plates

containing Km and Gm at 42 1C. The mc2155 mutant-1

strains (Table 1) with the first single crossover event were

selected using Southern blot.

Selection of mc2155 mutant-2 (rmlA geneknock-out) strains

The rescue plasmid pCG76-Mtb rmlA was electroporated into

the mc2155 mutant-1 strain. Transformants were grown on

LB agar plates containing Km and Sm at 30 1C. One colony

was inoculated into LB broth containing Km and Sm, and

incubated at 30 1C. The cells were spread on LB agar plates

containing 10% sucrose, Km and Sm. Five mc2155 mutant-2

(rmlA knock-out) strains (nos. 1–5) (Table 1) with the second

single crossover event were selected via Southern blot.

Growth of the mc2155 rmlA knock-out strain

Five mc2155 rmlA knock-out strains (nos. 1–5) were inocu-

lated in LB broth containing 0.05% Tween 80 and appropriate

antibiotics, and incubated at both 30 and 42 1C. The wild-

type mc2155 carrying pCG76 was used as a control. Absor-

bance at 600 nm (A600 nm) was detected at intervals of 24 h

and the growth curves at both 30 and 42 1C were obtained.

Morphology of the mc2155 rmlA knock-outstrain after shifting from 30 to 42 1C

The mc2155 rmlA knock-out strain (no. 4) was grown in LB

broth containing 0.05% Tween 80 and Km at 30 1C for 20 h

(A600 nm was 0.026), and the cells were transferred to

a 42 1C incubator. A600 nm was detected at intervals of 24 h

(see Fig. 3a), and the cells grown at 42 1C for 72 and 120 h

were harvested for SEM observation. The cells were fixed

with 2.5% glutaraldehyde and 1% OsO4. After dehydration

through a graded series of ethanol (20, 40, 60, 70, 80, 90,

100%), the cells were applied to a silicon wafer slide. The

cells were examined with a JSM-6360 scanning electron

microscope (JEOL) at an accelerating voltage of 28 kV.

Results

Construction of conditional replication plasmidand rescue plasmid

Conditional replication plasmid pPR27-rmlA::KmR (Table 1)

was constructed to select mc2155 mutant-1 strains, which

have undergone the first homologous recombination at the

rmlA locus of the genome. In plasmid pPR27-rmlA::KmR, the

KmR cassette was introduced inside Sm rmlA, so it directly led

to the disruption of Sm rmlA. Sm rmlA::KmR would be

integrated to the mc2155 genome after the first single cross-

over event occurred. The parent plasmid pPR27 (Pelicic et al.,

1997) is a shuttle vector containing the replication origins for

both E. coli and mycobacteria. The replication origin for

mycobacteria has mutations sensitive to temperature; thus, it

can replicate at 30 1C (permissive temperature) but is effi-

ciently lost at 42 1C (nonpermissive temperature).

Rescue plasmid pCG76-Mtb rmlA (Table 1) was con-

structed for complementation of rmlA::KmR in the mc2155

mutant-2 (rmlA gene knock-out) genome with the second

single crossover event. The M. tuberculosis rmlA gene was

transcribed by the promoter of heat shock protein 60 from

Mycobacterium bovis BCG. The parent plasmid pCG76 has the

same temperature-sensitive mycobacterial replication origin as

pPR27 and thus can replicate at 30 1C but not at 42 1C.

Selection of mc2155 mutant-1 strains withintegrated rmlA::KmR in the genome

The mc2155 transformants with pPR27-rmlA::KmR were

selected on LB agar plates containing Km and Gm at 30 1C

and all colonies became yellow-pigmented when catechol

was sprayed on the plates owing to expression of the xylE

gene (Curcic et al., 1994) in the pPR27-rmlA::KmR plasmid.

The yellow colony was propagated in LB broth containing

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1 2 3 4 5

A60

0 nm

Incubation time (h)

Fig. 2. Growth curves of an mc2155 rmlA knock-out strain (no. 4) at 30

and 42 1C. (m) mc2155 rmlA knock-out strain at 30 1C; (n) mc2155 rmlA

knock-out strain at 42 1C; (�) wild-type mc2155 carrying pCG76 at

30 1C; (�) wild-type mc2155 carrying pCG76 at 42 1C.


240 H. Qu et al.

Km and Gm at 30 1C, and spread on LB agar plates contain-

ing Km and Gm at 42 1C. The Km-resistant colonies on the

plates have necessarily integrated rmlA::KmR into the

mc2155 genome at 42 1C. Southern hybridization analysis

of 17 yellow colonies revealed that six showed integration of

rmlA::KmR upstream of the rmlA locus (Fig. 1a) and one

colony showed integration of rmlA::KmR downstream of the

rmlA locus. Figure 1(b) shows two colonies with integration

of rmlA::KmR upstream of the rmlA locus.

Selection of mc2155 mutant-2 (rmlA geneknock-out) strains

To attempt the second single crossover event, rescue plasmid

pCG76-Mtb rmlA was electroporated to mc2155 mutant-1

(with the pathway 1) cells and spread on LB agar plates

containing sucrose, Km and Sm and incubated at 30 1C.

Under selection of sucrose and expression of M. tuberculosis

rmlA in the mc2155 mutant-1, the GmR, sacB (Pelicic et al.,

1996), xylE and M. smegmatis rmlA genes will be deleted from

the genome of the mc2155 mutant-1 when the second single

crossover event occurs, resulting in generation of mc2155

mutant-2 (rmlA gene knock-out) strains (Fig. 1a). Thus, only

the white colonies grown on LB agar plates containing

sucrose, Km and Sm were candidates for rmlA gene knock-

out. Genomic DNA from five white colonies was digested by

SmaI and hybridized using the M. smegmatis rmlA probe. All

five colonies showed bands at 3.24 and 8.14 kb as expected

(Fig. 1c) for the second single crossover event. The 6.5-kb

band was from the pCG76-Mtb rmlA plasmid.

Essentialness of the rmlA gene formycobacterial growth

To confirm whether the rmlA gene is essential for mycobac-

terial growth, the growth curves of five mc2155 rmlA knock-

out strains (nos. 1–5) at both 30 and 42 1C were determined;

similar patterns were observed for all, and the growth curve

for no. 4 is shown in Fig. 2. The results clearly showed that

rmlA knock-out strain mc2155 grew only at 30 1C but not at

42 1C at which pCG76-Mtb rmlA was unable to replicate. In

contrast, wild-type mc2155 containing pCG76 grew at both

30 and 42 1C, confirming that the M. tuberculosis rmlA gene

was essential for mycobacterial growth.

Morphological change of mc2155 rmlAknock-out strains after shifting from 30 to 42 1C

To determine whether decreasing RmlA activity has effects

on the morphology of mc2155 rmlA knock-out cells

a temperature shift experiment was performed to acquire

a certain amount of mc2155 rmlA knock-out cells. The

mc2155 rmlA knock-out strain (no. 4) with pCG76-Mtb

rmlA was grown at 30 1C for 20 h to produce M. tuberculosis

RmlA enzyme, and then the cells were grown at 42 1C.

0

1

0 24 48 72 84 96 120Incubation time (h)

1.2

0.8

0.6

0.4

0.2

A60

0 nm

(a) (b) (c)

(e)(d) (f)

Fig. 3. (a) Growth curves of an mc2155 rmlA knock-out strain (no. 4) after shifting from 30 to 42 1C. The mc2155 rmlA knock-out cells were grown at 30 1C for

20h (A600nm 0.026), and the cells were grown at 42 1C. mc2155 rmlA knock-out cells grown at 30 1C are shown as a control. Absorbance at 600 nm was

detected at 24, 48, 72, 96, 120 h after the temperature shift. (n) mc2155 rmlA knock-out strain at 42 1C; (m) mc2155 rmlA knock-out strain at 30 1C. (b–f)

Scanning electron micrographs. All photographs were taken at a magnification of 10 000. (b) mc2155 rmlA knock-out cells at 30 1C for 72 h; (c) mc2155 rmlA

knock-out cells at 42 1C for 72h; (d) mc2155 rmlA knock-out cells at 30 1C for 120h; (e) mc2155 rmlA knock-out cells at 42 1C for 120h; (f) wild-type mc2155

cells.



A600 nm over time was obtained as shown in Fig. 3(a). The

expressed M. tuberculosis RmlA protein from pCG76-Mtb

rmlA in mc2155 rmlA knock-out cells at 30 1C allowed the

cells to grow at 42 1C for a certain period and even multi-

plied for the first 24 h after the temperature shift to 42 1C.

The morphological phenotypes of mc2155 rmlA knock-out

cells and wild type mc2155 cells were examined via SEM (Fig.

3b–f). The mc2155 rmlA knock-out cells grown at 30 1C for

72 h (Fig. 3b) and 120 h (Fig. 3d) exhibited the normal rod-

like shape of wild-type mc2155 (Fig. 3f), whereas the mc2155

rmlA knock-out cells grown at 42 1C for 72 h appeared

significantly longer (Fig. 3c). Some of mc2155 rmlA knock-

out cells grown at 42 1C for 120 h had irregular surface

wrinkles and even lysed (Fig. 3e). These SEM results indicate

that lack of RmlA activity will cause dramatic morphological

changes in the bacteria prior to cell lysis.

Discussion

L-Rhamnose is also present in both Gram-negative and

Gram-positive bacteria. L-Rhamnose is a common compo-

nent of the O-antigen of lipopolysaccharides (LPS) of

Gram-negative bacteria such as E. coli (Stevenson et al.,

1994), Salmonella enterica (Jiang et al., 1991) and Shigella

flexneri (Macpherson et al., 1994). In Gram-positive bacteria

such as Lactococcus lactis (Boels et al., 2004), Streptococcus

mutans (Tsukioka et al., 1997a, b), L-rhamnose is a compo-

nent of cell-wall polysaccharides on their cell surfaces.

dTDP-rhamnose is a precursor of L-rhamnose and the

biosynthetic pathway of dTDP-rhamnose is ubiquitous and

highly conserved in both Gram-negative and Gram-positive

bacteria, but the essential requirement for rml genes for both

Gram-negative and Gram-positive bacterial growth has not

yet been investigated.

The rhamnose-GlcNAc disaccharide is a critical linker to

the structural integrity of the mycobacterial cell wall.

Neither L-rhamnose nor the genes encoding RmlA–D and

rhamnosyl transferase have been identified in humans so far

(Giraud & Naismith, 2000). Thus, inhibitors of RmlA–D

enzymes and rhamnosyl transferase (WbbL) are unlikely to

interfere with metabolic pathways in humans. Our previous

genetic approaches have provided the direct evidence that

M. tuberculosis rmlB, rmlC, rmlD and wbbL genes are valid

targets (Ma et al., 2002; Mills et al., 2004; Li et al., 2006).

Here we have investigated the essential requirement for the

rmlA gene in M. smegmatis and the effect of a lack of RmlA

on cellular morphology.

We used M. smegmatis mc2155 as a model organism to

test the essential requirement for rmlA for bacterial growth,

as M. tuberculosis and M. smegmatis have a basic cell-wall

structure (Daffe et al., 1993). BLAST analysis also showed that

the organization of rmlA–D genes in the M. smegmatis

mc2155 genome is the same as that in the M. tuberculosis

H37Rv genome. The results show that RmlA enzyme clearly

is essential for mycobacterial growth, because an mc2155

rmlA gene knock-out strain carrying rescue plasmid pCG76-

Mtb rmlA can grow only at 30 1C but not at 42 1C when the

rescue plasmid does not replicate. This result is consistent

with the report that M. tuberculosis rmlA is an essential gene

using an insertional mutagenesis technology (Sassetti et al.,

2003).

KasA (b-ketoacyl-ACP synthase) is a key enzyme of

mycolic acid biosynthesis in mycobacteria, and scanning

electron micrographs of kasA mutants have revealed that

KasA depletion results in the cell surface having a crumpled

appearance prior to lysis (Bhatt et al., 2005). Arabinosyl-

transferases (EmbA, EmbB and EmbC) are involved in the

biosynthesis of arabinan in the mycobacterial cell wall (Crick

et al., 2004). Escuyer et al. (2001) generated M. smegmatis

embA, embB and embC mutants and observed morphologi-

cal alterations of emb mutants. The embB mutant showed

drastically altered morphology with size shortening, swel-

ling and distortion. The embA mutant was also altered in its

morphology with size shortening, slight distortion and

swelling but to a lesser extent than with the embB mutant;

the embC mutant exhibited even greater size shortening.

Their results point to the probability that the emb mutants

had an altered cell wall. We examined morphological

changes of mc2155 rmlA knock-out cells as the biosynthesis

of the RmlA enzyme decreased in the temperature shift

experiment. The SEM data indicate that morphological

alterations (enlongation and lysis over time) of mc2155

rmlA knock-out cells correlated with lack of RmlA enzyme.

Thus, the present results demonstrate that RmlA, D-glucose-

1-phosphate thymidylyltransferase, can be used as a target to

develop new antituberculosis drugs.

Acknowledgements

This work was supported by funds provided through the

National Basic Research Program of China (2006CB504400)

and the National Natural Science Foundation of China

(30270320).

References

Bhatt A, Kremer L, Dai AZ, Sacchettini JC & Jacobs Jr WR (2005)

Conditional depletion of KasA, a key enzyme of mycolic acid

biosynthesis, leads to mycobacterial cell lysis. J Bacteriol 187:

7596–7606.

Boels IC, Beerthuyzen MM, Kosters MH, Van Kaauwen MP,

Kleerebezem M & De Vos WM (2004) Identification and

functional characterization of the Lactococcus lactis rfb operon,

required for dTDP-rhamnose biosynthesis. J Bacteriol 186:

1239–1248.


242 H. Qu et al.

Brennan PJ & Nikaido H (1995) The envelope of mycobacteria.

Ann Rev Biochem 64: 29–63.

Cole ST, Brosch R, Parkhill J et al. (1998) Deciphering the biology

of Mycobacterium tuberculosis from the complete genome

sequence. Nature 393: 537–544.

Crick DC, Brennan PJ & McNeil MR (2004) The cell wall of

Mycobacterium tuberculosis. Tuberculosis, 2nd edn (Rom WN

& Garay SM, eds), pp. 115–134. Lippincott Williams &

Wilkins, Philadelphia.

Curcic R, Dhandayuthapani S & Deretic V (1994) Gene

expression in mycobacteria: transcriptional fusions based on

xylE and analysis of the promoter region of the response

regulator mtrA from Mycobacterium tuberculosis. Mol

Microbiol 13: 1057–1064.

Daffe M, McNeil MR & Brennan PJ (1993) Major structural

features of the cell wall arabinogalactans of Mycobacterium,

Rhodococcus, and Nocardia spp. Carbohydr Res 249: 383–398.

Escuyer VE, Lety MA, Torrelles JB, Khoo KH, Tang JB, Rithner

CD, Frehel C, McNeil MR, Brennan PJ & Chatterjee D (2001)

The role of the embA and embB gene products in the

biosynthesis of the terminal hexaarabinofuranosyl motif of

Mycobacterium smegmatis arabinogalactan. J Biol Chem 276:

48854–48862.

Giraud MF & Naismith JH (2000) The rhamnose pathway. Curr

Opin Struct Biol 10: 687–696.

Guilhot C, Otal I, Van Rompaey I, Martin C & Gicquel B (1994)

Efficient transposition in mycobacteria: construction of

Mycobacterium smegmatis insertional mutant libraries.

J Bacteriol 176: 535–539.

Jiang XM, Neal B, Santiago F, Lee SJ, Romana LK & Reeves PR

(1991) Structure and sequence of the rfB (O antigen) gene

cluster of Salmonella serovar typhimurium (strain LT2). Mol

Microbiol 5: 695–713.

Li W, Xin Y, McNeil MR & Ma Y (2006) rmlB and rmlC genes are

essential for growth of mycobacteria. Biochem Biophys Res

Commun 342: 170–178.

Ma Y, Mills J, Belisle JT, Vissa V, Howell M, Bowlin K, Scherman

MS & McNeil MR (1997) Determination of the pathway for

rhmnnose biosynthesis in mycobacteria: cloning, sequencing

and expression of the M. tuberculosis gene encoding a-D-

glucose-1-phosphate thymidylyltransferase. Microbiology 143:

937–945.

Ma Y, Stern R, Scherman MS, Vissa V, Yan W, Jones VC, Zhang F,

Franzblau SG, Lewis WH & McNeil MR (2001) Drug targeting

M. tuberculosis cell wall synthesis: the genetics of dTDP-

Rhamnose synthetic enzymes and development of a microtiter

plate based screen for inhibitors of the conversion of dTDP-

Glucose to dTDP-Rhamnose. Antimicrob Agents Chemother

45: 1407–1416.

Ma Y, Pan F & McNeil MR (2002) Formation of dTDP-Rhamnose

is essential for growth of mycobacteria. J Bacteriol 184:

3392–3995.

Macpherson DF, Manning PA & Morona R (1994)

Characterization of the dTDP-rhamnose biosynthetic genes

encoded in the rfb locus of Shigella flexneri. Mol Microbiol 11:

281–292.

Mills JA, Motichka K, Jucker M et al. (2004) Inactivation of the

mycobacterial rhamnosyltransferase, which is needed for the

formation of the arabinogalactan-peptidoglycan linker, leads

to irreversible loss of viability. J Biol Chem 279: 43540–43546.

Pelicic V, Reyrat JM & Gicquel B (1996) Generation of unmarked

directed mutations in mycobacteria using sucrose counter-

selectable suicide vectors. Mol Microbiol 20: 919–925.

Pelicic V, Jackson M, Reyrat JM, Jacobs Jr WR, Gicquel B &

Guilhot C (1997) Efficient allelic exchange and transposon

mutagenesis in Mycobacterium tuberculosis. Proc Natl Acad Sci

USA 94: 10955–10960.

Reeves PR, Hobbs M, Valvano MA et al. (1996) Bacterial

polysaccharide synthesis and gene nomenclature. Trends

Microbiol 4: 495–503.

Sassetti CM, Boyd DH & Rubin EJ (2003) Genes required for

mycobacterial growth defined by high density mutagenesis.

Mol Microbiol 48: 77–84.

Stevenson G, Neal B, Liu D, Hobbs M, Packer NH, Batley M,

Redmond JW, Lindquist L & Reeves P (1994) Structure of the

O antigen of Escherichia coli K-12 and the sequence of its rfb

gene cluster. J Bacteriol 176: 4144–4156.

Tsukioka Y, Yamashita Y, Oho T, Nakano Y & Koga T (1997a)

Biological function of the dTDP-Rhamnose synthesis pathway

in Streptococcus mutans. J Bacteriol 179: 1126–1134.

Tsukioka Y, Yamashita Y, Nakano Y, Oho T & Koga T (1997b)

Identification of a fourth gene involved in dTDP-rhamnose

synthesis in Streptococcus mutans. J Bacteriol 179: 4411–4414.

Warner DF & Mizrahi V (2004) Mycobacterial genetics in target

validation. Drug Discov Today: Technol 1: 93–98.

Zhang Y, Post-Martens K & Denkin S (2006) New drug

candidates and therapeutic targets for tuberculosis therapy.

Drug Discov Today 11: 21–27.



an rmla gene encoding d-glucose-1-phosphate thymidylyltransferase is essential for mycobacterial...

Documents