of April 1, 2018.This information is current as

Host Immune ModulationMycobacterial Capsular Polysaccharides in

ofa Novel Ligand for DC-SIGN: Involvement -Glucan AsαIdentification of Mycobacterial

Lemassu, Mamadou Daffé and Ben J. AppelmelkVandenbroucke-Grauls, Jérôme Nigou, Germain Puzo, AnneTatsuo Terashima, Nicolai Bovin, Christina M. J. E. Roy Ummels, Janneke Maaskant, Hiroki Takata, Otto Baba,Cot, Nicole N. Driessen, Tounkang Sambou, Ryo Kakutani, Jeroen Geurtsen, Sunita Chedammi, Joram Mesters, Marlène

http://www.jimmunol.org/content/183/8/5221doi: 10.4049/jimmunol.0900768September 2009;

2009; 183:5221-5231; Prepublished online 25J Immunol 

Referenceshttp://www.jimmunol.org/content/183/8/5221.full#ref-list-1

, 27 of which you can access for free at: cites 73 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2009 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Identification of Mycobacterial �-Glucan As a Novel Ligandfor DC-SIGN: Involvement of Mycobacterial CapsularPolysaccharides in Host Immune Modulation1

Jeroen Geurtsen,2* Sunita Chedammi,* Joram Mesters,* Marlene Cot,† Nicole N. Driessen,*Tounkang Sambou,† Ryo Kakutani,‡ Roy Ummels,* Janneke Maaskant,* Hiroki Takata,‡

Otto Baba,§ Tatsuo Terashima,¶ Nicolai Bovin,� Christina M. J. E. Vandenbroucke-Grauls,*Jerome Nigou,† Germain Puzo,† Anne Lemassu,† Mamadou Daffe,† and Ben J. Appelmelk*

Mycobacterium tuberculosis possesses a variety of immunomodulatory factors that influence the host immune response. When thebacillus encounters its target cell, the outermost components of its cell envelope are the first to interact. Mycobacteria, includingM. tuberculosis, are surrounded by a loosely attached capsule that is mainly composed of proteins and polysaccharides. Althoughthe chemical composition of the capsule is relatively well studied, its biological function is only poorly understood. The aim of thisstudy was to further assess the functional role of the mycobacterial capsule by identifying host receptors that recognize itsconstituents. We focused on �-glucan, which is the dominant capsular polysaccharide. Here we demonstrate that M. tuberculosis�-glucan is a novel ligand for the C-type lectin DC-SIGN (dendritic cell-specific ICAM-3-grabbing nonintegrin). By using relatedglycogen structures, we show that recognition of �-glucans by DC-SIGN is a general feature and that the interaction is mediatedby internal glucosyl residues. As for mannose-capped lipoarabinomannan, an abundant mycobacterial cell wall-associated gly-colipid, binding of �-glucan to DC-SIGN stimulated the production of immunosuppressive IL-10 by LPS-activated monocyte-derived dendritic cells. By using specific inhibitors, we show that this IL-10 induction was DC-SIGN-dependent and also requiredacetylation of NF-�B. Finally, we demonstrate that purified M. tuberculosis �-glucan, in contrast to what has been reported forfungal �-glucan, was unable to activate TLR2. The Journal of Immunology, 2009, 183: 5221–5231.

T uberculosis (TB),3 caused by the bacterium Mycobacte-rium tuberculosis, is a major cause of death worldwideand kills �1.7 million people per annum (1). Upon inha-

lation, M. tuberculosis infects alveolar macrophages in which it isable to persist for extensive periods of time (2). Normally, theinfected macrophages are contained within so-called granulomas;however, in a substantial number of cases (�10%), the bacterium

escapes its containment and causes active disease (2, 3). The in-teraction between M. tuberculosis and the host immune system isvery complex (4, 5). An important question is how the bacillussurvives its hostile environment, that is, the intracellular compart-ments of the macrophage, and thereby is able to persist within itshost for many years. There are good indications that the distinctivefeatures of the mycobacterial cell envelope are of key importanceto this issue (6). Mycobacteria possess a unique cell envelope thatconsists of three major entities: the plasma membrane, the cellwall, and an outermost layer, known as the capsule (7). The plasmamembrane resembles that of other bacteria and consists of a sym-metrical bilayer of phospholipids. The cell wall consists of twosegments: a lower segment of peptidoglycan covalently linked to aheteropolysaccharide, the D-arabino-D-galactan, which itself islinked to long chain fatty acids (C60–C90) called mycolic acids,and an upper segment of free, intercalating glycolipids and waxes(7). Recently, the mycolic acid layer, which is now known as the“mycomembrane”, has been shown to be organized in a structurethat resembles the outer membrane of Gram-negative bacteria (8,9). Compounds that are secreted across the mycomembrane are thepolysaccharides that make up the outermost layer of the cell-en-velope, that is, the capsule (7). Bacterial capsules are protectivestructures expressed by many pathogenic bacteria and have beenshown to be important for the successful colonization of the host(10, 11). The mycobacterial capsule is loosely attached to the sur-face and is mainly composed of proteins and polysaccharides (7).Part of the capsular material is released into the environment of themycobacteria and is found in the culture filtrate (12). The poly-saccharide composition of the capsule is conserved among myco-bacteria and predominantly consists of an �-D-(134)-glucosyl

*Department of Medical Microbiology and Infection Control, VU University MedicalCenter, Amsterdam, The Netherlands; †Centre National de la Recherche Scientifique,Departement Mecanismes Moleculaires des Infections Mycobacteriennes, Institut dePharmacologie et de Biologie Structurale, and Institut de Pharmacologie et de Biolo-gie Structurale, Universite de Toulouse, Universite Paul Sabatier (Toulouse III), Tou-louse, France; ‡Biochemical Research Laboratory, Ezaki Glico Co., Ltd, Nishiyo-dogawa-ku, Osaka, Japan, §Department of Biostructural Science and ¶Department ofMaxillofacial Anatomy, Tokyo Medical and Dental University, Tokyo, Japan; and�Carbohydrate Chemistry Laboratory, Shemyakin and Ovchinnikov Institute of Bioor-ganic Chemistry, Russian Academy of Sciences, Moscow, Russia

Received for publication March 10, 2009. Accepted for publication August 6, 2009.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was funded under the European Union Framework 6 program (ref.37388): ImmunoVacTB: A new approach for developing a less immunosuppressivetuberculosis vaccine.2 Address correspondence and reprint requests to Dr. Jeroen Geurtsen, Department ofMedical Microbiology and Infection Control, VU University Medical Center, van derBoechorststraat 7, 1081 BT Amsterdam, The Netherlands. E-mail address: jeroen.geurtsen@vumc.nl3 Abbreviations used in this paper: TB, tuberculosis; BCG, bacillus Calmette-Guerin;CR3, complement receptor 3; DC, dendritic cell; DC-SIGN, dendritic cell-specificICAM-3-grabbing nonintegrin; HSA, human serum albumin; ManLAM, mannose-capped lipoarabinomannan; MOI, multiplicity of infection; MR, mannose receptor;NMR, nuclear magnetic resonance.

Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00

The Journal of Immunology

www.jimmunol.org/cgi/doi/10.4049/jimmunol.0900768

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

polymer, known as �-glucan (12, 13). �-Glucan production fol-lows the growth curve of M. tuberculosis (13), and the structure ofthe medium-released �-glucan is the same as �-glucan that is at-tached to the cell surface (12). The molecule has an apparent mo-lecular mass of 1.3 � 107 and is expressed both in vitro and in vivo(14–17). Its structure resembles that of cytosolic glycogen and iscomposed of repeating units of five or six �-D-(134)-glucosyl resi-dues substituted at some 6-OH positions with an oligo-glucosyl sidechain (15, 16). Recently, a detailed structural comparison of �-glu-can and glycogen, both derived from Mycobacterium bovis bacil-lus Calmette-Guerin (BCG), was performed (16). This analysisshowed that the two molecules are similar in terms of chemicalcomposition, degree of branching, and branching length. However,the backbone chains of �-glucan are longer and its three-dimen-sional structure is more compact (16).

M. tuberculosis possesses a variety of immunomodulatory fac-tors that influence the host immune response. When M. tubercu-losis encounters its target cell, the outermost components of its cellenvelope are the first to interact. However, until now, most studieshave focused on the role of cell wall components in this process,whereas the capsular constituents, that is, �-glucan, did not receivemuch interest. In one of the few studies regarding the functionalrole of the mycobacterial capsule, it was shown that in a numberof M. tuberculosis strains capsular polysaccharides mediate thenonopsonic binding to complement receptor 3 (CR3) and inhibitC3 surface deposition (18). It was postulated that CR3-mediateduptake may promote intracellular survival by suppressing the pro-duction of IL-12 and prohibiting a respiratory burst (19, 20). Lateron, Stokes et al. showed that in some types of macrophages, cap-sular polysaccharides prevented phagocytosis, thereby possiblypromoting the uptake via CR3 (21). More recently, Gagliardi andcoworkers showed that mycobacterial capsular �-glucan blockedCD1 expression and suppressed IL-12 production in monocyte-derived dendritic cells (DCs) (22). Finally, studies on M. bovisBCG fractions to identify active components in its use as an im-munotherapeutic agent against bladder cancer showed that �-glu-can might be an active component (23). Although these studiessuggest that �-glucan fulfills an important biological function, theunderlying mechanism and host factors involved remain largelyunknown.

The aim of this study was to further assess the functional role ofthe mycobacterial capsule by identifying �-glucan receptorspresent on host immune cells. Herein we report that the C-typelectin DC-SIGN (dendritic cell-specific ICAM-3-grabbing nonin-tegrin) represents an important host �-glucan receptor. Further-more, our findings support the idea that DC-SIGN-�-glucan inter-action can modulate the effector functions of DCs.

Materials and MethodsPurification of �-glucan

�-Glucan was isolated from M. tuberculosis strain H37Rv as previouslydescribed (14). In short, M. tuberculosis H37Rv was grown on syntheticSauton’s medium (24) as surface pellicles at 37°C. After 3 wk, duringexponential growth phase, the culture medium was filtered through a0.22-�m filter (Nalgene) to remove intact bacteria, concentrated 10-foldunder vacuum, after which the macromolecules were precipitated by add-ing 6 vol of cold ethanol overnight at 4°C. The precipitate was collected bycentrifugation (1 h at 14,000 � g), dissolved in and dialyzed against dis-tilled H2O, and lyophilized. The crude mixture was then dissolved in 0.01M NH4Cl (pH 8.35) and loaded on a DEAE-Trisacryl column (27 � 1 cm).Neutral polysaccharides were collected from the void volume, after which�-glucan was separated from other neutral polysaccharides by gel perme-ation chromatography using a Bio-Gel P-200 column (100–200 mesh,80 � 1 cm; Bio-Rad). After elution with 0.5% acetic acid, the fractionswere concentrated under vacuum and lyophilized. Purified �-glucan wasdissolved in double-distilled H2O and checked for purity using gas chro-

matography of trimethylsylilated monosaccharides liberated by trifluoro-acetic acid hydrolysis and 1H nuclear magnetic resonance (NMR) analysis(characteristic signals between 5.4 and 3.4 ppm). Mannose or arabinosewas not detected by any of these methods. Finally, �-glucan was treated inbatches with Affi-Prep polymyxin matrix (Bio-Rad) to remove possibleendotoxin contaminants. Removal of endotoxins was verified using theKinetic-QCL chromogenic Limulus amebocyte lysate assay (Lonza).

Treatment of �-glucan with amyloglucosidase, hydrogenperoxide, and phenol

�-Glucan was treated with amyloglucosidase (Sigma-Aldrich; A3514, EC3.2.1.3) by solubilizing 2 mg of purified �-glucan in 500 �l of acetate buffer(0.05 M, pH 4.5). After this, the suspension was separated into two equalfractions and 20 �l of amyloglucosidase (566.4 U/ml) or buffer was added.Samples were left overnight at 55°C, after which the reaction was stoppedby heating for 90 s at 100°C. Samples were deionized in batches usingTMD8 (Sigma-Aldrich; M8157) and lyophilized. Degradation was con-firmed by 1H NMR; signals at 5.38 and 5.00 ppm, present in the controlsample and characteristic of �-D-(134)-glucosyl and �-D-(136)-glucosyllinkages, completely disappeared after enzymatic treatment. �-Glucan andPam3CysK4 (InvivoGen) were treated with hydrogen peroxide as previ-ously described (25, 26). In short, �-glucan (0.5 mg/ml) and Pam3CysK4(1 �g/ml) were incubated for 48 h in the dark at 4°C in the absence orpresence of 1% hydrogen peroxide. After incubation, the samples weresnap-frozen using liquid nitrogen and subsequently lyophilized. For treat-ment with phenol, 2 mg of purified �-glucan was solubilized in 2 ml ofH2O, after which 2 ml of phenol was added for 1 h at 60°C. Then, themixture was centrifuged at 4°C for 10 min (1700 � g), after which theaqueous phase was collected and resubmitted to the same treatment. Fi-nally, the aqueous phase was dialyzed against double-distilled H2O andlyophilized. In all cases, the lyophilized �-glucan was dissolved in pyro-gen-free water and stored at �20°C for further analysis.

Detection of �-glucan with a cross-reactive mAb directedagainst glycogen

For detection of �-glucan with the mAb, serial dilutions of �-glucan werespotted on a methanol-activated polyvinylidene fluoride membrane andbaked for 1 h at 70°C. Thereafter, the membrane was washed with PBS/0.05% Tween 80, blocked with blocking solution (Boehringer Mannheim),and probed with the mAb (27). Following incubation, the membrane waswashed with PBS/0.05% Tween 80, incubated with peroxidase-labeledgoat anti-mouse IgM (American Qualex), and developed using 3,3�-dia-minobenzidine tetrahydrochloride and 4-chloronaphthol.

Human DC and macrophage generation and cell culture

Macrophages and immature human DCs were generated from humanPBMCs. In short, PBMCs were isolated from heparinized blood fromhealthy volunteers (Sanquin Bloodbank, Amsterdam, The Netherlands) us-ing density-gradient centrifugation over a Ficoll gradient (Amersham Bio-sciences). PBMC fractions were washed six times with 50 ml of cold PBScontaining 0.5% sodium citrate (w/v). Next, monocytes were isolated fromPBMCs by a CD14 selection step using the MidiMACS system (MiltenyiBiotec) (CD14-depleted PBMCs were used as PBLs in the bead-bindingassay with primary immune cells (see Fig. 1)). Monocytes were differen-tiated into immature DCs or macrophages (type 1 and type 2) in RPMI1640 medium supplemented with 10% FCS, 100 U/ml penicillin and 100�g/ml streptomycin (all from Invitrogen) in the presence of 500 U/mlrecombinant human IL-4 and 800 U/ml recombinant human GM-CSF forgenerating DCs, or in the presence of 50 U/ml GM-CSF for generatingmacrophage type 1, or in the presence of 50 ng/ml M-CSF for generatingmacrophage type 2 (all from PeproTech) (28). For macrophage differen-tiation, fresh cytokines were added after 3 days of culture. At day 6, mac-rophages and immature DCs were harvested. DCs were positive forCD11c, CD40, and DC-SIGN expression, negative for CD14 and CD83expression, and they expressed low levels of CD80, CD86, TLR2, TLR4,and HLA-DR as assessed by flow cytometry using FITC- or PE-labeledAbs (eBioscience). Macrophages were positive for CD11c, CD14, andCD40, negative for DC-SIGN and CD83, and they expressed low/inter-mediate levels of CD80, CD86, TLR2, TLR4, and HLA-DR. Raji cells andRaji cells transfected with DC-SIGN (29) were maintained in RPMI 1640medium supplemented with 10% FCS, 100 U/ml penicillin and 100 �g/mlstreptomycin. HEK293 cells transfected with TLR2 (30) were kept inDMEM medium (Invitrogen) supplemented with 10% FCS, 100 U/ml pen-icillin and 100 �g/ml streptomycin, 0.5 mg/ml GW418 (Sigma-Aldrich), 2mM L-glutamine, and 110 mg/L pyruvate. All cells were cultured at 37°Cin a 5% CO2 atmosphere.

5222 MYCOBACTERIAL �-GLUCAN: A NOVEL LIGAND FOR DC-SIGN

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Coating of fluorescent polystyrene beads

Purified �-glucan and biotin-labeled polyacrylamide neoglycoconjugates(synthesized by Syntesome as described (31)) were coated onto 1.0-�mFluoresbrite YG microspheres (Polysciences, catalog no. 17154) andstreptavidin Fluoresbrite YG microspheres (Polysciences, catalog no.24161), respectively, by adding 50 �g of purified compound to 1 ml of0.1 M carbonate-bicarbonate buffer (pH 9.6) containing 1.4 � 109 beads inpresiliconized tubes (Sigma-Aldrich). After overnight incubation at 4°C(while gently rotating), the beads were collected by centrifugation andincubated for 1 h in 1 ml of Tris-buffered saline supplemented with 1 mMMgCl2 and 2 mM CaCl2 (TSM) containing 5% human serum albumin(HSA) (Sigma-Aldrich). After this, the beads were washed four times with1 ml of TSM/0.5% HSA and finally resuspended in this same buffer. Thebead concentration was determined by measuring the absorption of thebead suspension and comparing it to the absorption of a serial dilutionseries of beads with known concentrations at 441 nm. HSA control beadswere prepared in a similar manner, except that �-glucan was replacedby H2O.

Cell binding assays

Fluorescent beads or M. bovis BCG strain Copenhagen expressing dsRed(grown in Middlebrook 7H9 broth (Difco) with 10% Middlebrook albu-min/dextrose/catalase enrichment (BBL), 0.05% Tween 80, and 50 �g/mlhygromycin) was added to cells (5 � 105 cells in 100 �l TSM/0.5% HSA)and incubated for 30 min at 37°C in absence or presence of competitors (50�g/ml AZN-D2 (32), 2 mg/ml yeast mannan (Sigma-Aldrich), 50 �g/ml M.tuberculosis �-glucan). AZN-D2 is specific for DC-SIGN and blocks li-gand binding, whereas mannan occupies the DC-SIGN carbohydrate rec-ognition domain and similarly blocks binding to other ligands. After wash-ing, the percentage of fluorescent cells was determined using a FACScananalytic flow cytometer (BD Biosciences) and analyzed using the manu-facturer’s software (CellQuest version 3.1f).

Lectin-Fc ELISA

�-Glucan, bovine glycogen (Fluka, catalog no. 50571), or synthetic gly-cogen �1-ESG-A (33) (all at 1 �g/ml in saline (100 �l)) was coated onNunc Maxisorp plates (Roskilde) overnight at 4°C. Plates were blockedwith 1% HSA, after which DC-SIGN-Fc (34), dectin-1-Fc (35), or man-nose receptor (MR) (carbohydrate recognition domains 4–7)-Fc (36) (2�g/ml; all dissolved in TSM/0.05% Tween 80) was added for 2 h at roomtemperature in the absence or presence of 5 mM EDTA, 50 �g/ml AZN-D2, or 2 mg/ml mannan. After incubation, the plates were washed fourtimes with TSM/0.05% Tween 80 and incubated with a goat anti-humanIgG Ab conjugated with peroxidase (Jackson ImmunoResearch Laborato-ries). After incubation, the plates were washed eight times with TSM/0.05% Tween 80 and developed using o-phenylenediamine dihydrochlo-ride. Absorption was measured at 490 nm using an EL808 Ultra microplatereader (Bio-Tek Instruments).

Cell stimulation assays

Cells (HEK293 cells were first released by trypsinization) were washedwith and resuspended in culture medium at a concentration of 1.25 � 106

cells/ml. Eighty microliters of cell suspension (1 � 105 cells) was trans-ferred to a sterile 96-well U-bottom plate (Greiner Bioscience) and left for2 h, followed by incubation (in triplicate) with �-glucan in the absence orpresence of LPS (from Salmonella enterica serovar Abortusequi (Sigma-Aldrich L5886)), bovine glycogen, synthetic glycogen �1-ESG-A,Pam3CysK4, or LPS alone (final stimulation volume of 100 �l). In somecases, the cells were preincubated with DC-SIGN inhibitors 2 h beforestimulation (3 �M anacardic acid (Calbiochem), 20 �g/ml AZN-D2). Un-stimulated cells served as controls in all experiments. Culture supernatantswere harvested after 24 h of incubation (37°C, 5% CO2) by centrifugationand stored at �80°C for cytokine measurements using an ELISA. In someexperiments, the cell pellets were pooled, washed three times with PBS,and lysed for subsequent mRNA isolation and analysis by quantitativereal-time PCR.

mRNA isolation and quantitative real-time PCR

mRNA was isolated from DCs (stimulated as described above) using themRNA capture kit (Roche) and cDNA was synthesized with the Super-Script VILO cDNA synthesis kit (Invitrogen). For quantitative real-timePCR analysis, PCR amplification was performed using Express SYBRGreenER qPCR Universal Supermix (Invitrogen) in a LightCycler 480(Roche). Analysis of mRNA expression was performed using specificprimers for IL-10 (GAGGCTACGGCGCTGTCAT (forward) andCCACGGCCTTGCTCTTGTT (reverse)) and for GAPDH (CCATGTT

CGTCATGGGTGTG (forward) and GGTGCTAAGCAGTTGGTGGTG(reverse) and Ct values were calculated using the second derivative max-imum method. For each sample, the normalized amount of IL-10 mRNA(Nt) was calculated using the following formula: Nt � 2(Ct(GAPDH)�Ct(IL-10))

(37). The relative IL-10 expression was calculated for each sample bysetting the Nt value for LPS-stimulated cells at 1.

Cytokine measurements using ELISA

Human IL-8, IL-10, and IL-12p40 concentrations in the supernatants ofstimulated cells were determined using ELISA according to the manufac-turer’s instructions (Invitrogen).

p65 Phosphorylation and acetylation

DCs (2.5 � 105 cells) were stimulated for 1 h (37°C, 5% CO2) with �-glu-can or mannose-capped lipoarabinomannan (ManLAM) (isolated from M.tuberculosis and provided by J. Belisle, Colorado State University, as partof the National Institutes of Health, National Institute of Allergy and In-fectious Diseases Contract no. HHSN266200400091C, titled “TuberculosisVaccine Testing and Research Materials” (complete standard operatingprocedure can be found at www.cvmbs.colostate.edu/microbiology/tb/pdf/lamlm.pdf)) in the absence or presence of LPS. DC nuclear extracts wereprepared with the NuncBuster protein extraction kit (Novagen). p65 fromnuclear extracts was captured with the Pathscan p65 sandwich ELISA kit(Cell Signaling Technology). Specific p65 phosphorylation and acetylationwas detected with rabbit anti-phospho-p65 (Ser276) or anti-acetyl-p65(Lys310) polyclonal Abs (all from Cell Signaling Technology).

Statistical analysis

Data were statistically analyzed using a Student’s t test (two-tailed, two-sample equal variance). Differences were considered to be significant whenp � 0.05.

ResultsMycobacterial �-glucan interacts with human DCs

As a first step in identifying �-glucan receptors on host immunecells, we performed a screen with different types of immune cellsfor their ability to interact with �-glucan. For this, fluorescentpolystyrene beads were coated with �-glucan (purified from M.tuberculosis strain H37Rv) and incubated with various types ofprimary immune cells, including PBLs, monocytes, and monocyte-derived macrophages (type 1 and type 2) and DCs. After washing,the percentage of fluorescently labeled cells was determined usingflow cytometry. As shown in Fig. 1, the �-glucan-coated beads, ascompared with the control beads coated with HSA, showed a sig-nificantly increased association with both types of macrophages,albeit only at a high cell-to-bead ratio, and with the DCs. Theinteraction with the cells was dose-dependent, as a higher bead-to-cell ratio increased the association with the beads (Fig. 1). Al-though significant, the relative increase in the binding of the �-glu-can-coated beads to the macrophages, as compared with the HSAcontrol beads, was only modest (macrophage type 1, 1.29 � 0.07;macrophage type 2, 1.53 � 0.18) (Fig. 1). In contrast, the associ-ation of the �-glucan-coated beads with the DCs was more prom-inent and varied between a 2.08- to 2.86-fold increase as comparedwith the control beads (Fig. 1). These results suggest that �-glucaninteracted with a receptor residing on the surface of the DCs.Hence, we set out to identify this receptor.

Interaction of �-glucan with human DCs is dependent onDC-SIGN

To investigate which lectin was responsible for the binding of�-glucan to DCs, a panel of lectin-Fc constructs representing DClectins known to interact with mycobacteria was tested for theability to bind to the molecule. As shown in Fig. 2A, �-glucan wasexclusively recognized by DC-SIGN-Fc but not by the other twolectin-Fc constructs tested, that is, MR-Fc and dectin-1-Fc. DC-SIGN is a Ca2-dependent C-type lectin that was previouslyshown to be the major mycobacterial receptor expressed by DCs

5223The Journal of Immunology

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

(38, 39). The interaction with DC-SIGN-Fc was specific, as man-nan, EDTA, and the blocking anti-DC-SIGN Ab AZN-D2 fullyabrogated binding (Fig. 2A). We also investigated whether �-glu-can could interact with native DC-SIGN. By incubating �-glucan-coated beads together with Raji cells (mock) or Raji cells express-ing DC-SIGN (Fig. 2B) or with DCs (Fig. 2C), we found that the�-glucan-coated beads showed a significantly increased binding ascompared with the HSA-coated control beads. This interaction wasDC-SIGN-dependent, as preincubation of the cells with mannan orAZN-D2 decreased the binding to the level of the HSA controls.Finally, we determined whether �-glucan could inhibit Mycobac-terium-DC-SIGN interactions. As shown in Fig. 3, preincubationof DCs or Raji cells expressing DC-SIGN with �-glucan strongly

abrogated their capability to bind M. bovis BCG at all three multi-plicities of infection (MOIs) tested. Overall, these data demonstratethat DC-SIGN functions as a cellular receptor for M. tuberculosis�-glucan. Additionally, they show that the observed binding of �-glu-can to the DCs, as demonstrated by the ability of AZN-D2 to blockthe interaction, was primarily dependent on this lectin.

DC-SIGN recognizes �-1,4-glucan polymers independently oftheir origin

DC-SIGN is a C-type lectin receptor that recognizes N-linked highmannose oligosaccharides and branched fucosylated structures(40–42). Cocrystallization experiments of DC-SIGN with man-nose structures have shown that DC-SIGN binding is mediated by

FIGURE 1. Mycobacterial �-glu-can interacts with human DCs. Pri-mary human PBLs, monocytes, DC,macrophages type 1 (M�-1), and mac-rophages type 2 (M�-2) were incu-bated with beads coated with �-glucanor HSA for 30 min at 37°C. Afterwashing, the percentage of fluorescentcells (cell-to-bead ratio of 1:5 or 1:25)was determined using flow cytometry.Results are presented as the mean rel-ative binding (HSA-coated beads (1:5)is set at 1) � SEM from three inde-pendent experiments (each experimentwas performed in triplicate). �, p �0.05 and ��, p � 0.001.

FIGURE 2. Mycobacterial �-glu-can is a ligand for DC-SIGN. A, Dif-ferential binding of DC lectin-Fc con-structs to purified �-glucan. Bindingof MR-Fc, DC-SIGN-Fc, and dectin-1-Fc to �-glucan was determined byELISA in the absence (�) or presenceof EDTA, mannan, or DC-SIGNblocking Ab AZN-D2. B and C, Theinteraction of �-glucan with cell sur-face localized DC-SIGN was investi-gated by incubating mock cells (Rajialone) and Raji cells expressing DC-SIGN (B) or DCs (C) with �-glucan orHSA-coated control beads at a cell-to-bead ratio of 1:25 for 30 min at 37°Cin the absence or presence of mannanor Ab AZN-D2. After washing, thepercentage of fluorescent cells was de-termined using flow cytometry. Re-sults are presented as the mean bind-ing � SEM from three independentexperiments (each experiment wasperformed in triplicate). ��, p � 0.001.

5224 MYCOBACTERIAL �-GLUCAN: A NOVEL LIGAND FOR DC-SIGN

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

the interaction of a Ca2 with the vicinal, equatorial 3- and 4-OHgroups of internal mannosyl residues (40). This preference for in-ternal residues is unusual since most mannose-binding lectins (e.g.,the MR) recognize terminal residues (43, 44). Although earlierstudies already demonstrated that DC-SIGN, besides binding tomannose and fucose, can also interact with glucose and �1,4-di-glucosyl (maltose) structures, the potential physiological impor-tance of this interaction was not appreciated (45, 46). To determine

whether the interaction of DC-SIGN with �1,4-glucan was specificfor the mycobacterial-derived compound or represented a generalphenomenon, binding of DC-SIGN-Fc to glycogen, which ischemically similar to �-glucan (14, 15), was tested. As for myco-bacterial �-glucan, DC-SIGN-Fc strongly interacted with bothsources of glycogen tested, that is, bovine-derived glycogen andenzymatically synthesized glycogen, thus suggesting that recogni-tion of �1,4-glucans by DC-SIGN was a general phenomenon(Fig. 4A). To determine the minimal structure that was needed forthe interaction, fluorescent streptavidin-coupled beads, coated withneoglycoconjugates consisting of biotinylated, polyacrylamidecarriers harboring single glucosyl, �-(134)-di-glucosyl (maltose),or �-(134)-tetra-glucosyl (maltotetraose) side chains, were testedfor the ability to bind to Raji cells expressing DC-SIGN. Beadscoated with (man)3ara or (ara)6 (47, 48) were used as positive andnegative controls, respectively. As shown in Fig. 4B, all beadsexhibited a similar binding to mock cells (Raji alone). However,with the Raji cells expressing DC-SIGN, beads harboring (man)3araand di- and tetra-glucosyl conjugates displayed strong binding,whereas those coated with mono-glucosyl- or (ara)6-containing neo-glycoconjugates did not. These data demonstrate that the �-(134)-di-glucosyl unit represented the minimal structure that was recognizedby DC-SIGN. This suggests that, reminiscent of high-mannose-DC-SIGN interactions, DC-SIGN probably recognizes �-glucans throughthe interaction with internal glucosyl residues.

�-Glucan induces IL-10 production in LPS-primed DCs in aDC-SIGN-dependent manner

Binding of mycobacterial ManLAM by DC-SIGN induces the pro-duction of IL-10 in LPS-primed DCs (37, 39). To determinewhether �-glucan was capable of inducing similar effects, DCs

FIGURE 3. Mycobacterial �-glucan inhibits the interaction betweenDC-SIGN and M. bovis BCG. Raji cells expressing DC-SIGN and DCswere incubated with M. bovis BCG expressing dsRed at a MOI of 0.5, 2,or 8 for 30 min at 37°C in the absence (filled bars (�)) or presence (whitebars ()) of 50 �g/ml �-glucan. The percentage of cells binding M. bovisBCG was determined using flow cytometry. Results are presented as themean binding � SEM from three independent experiments (each experi-ment was performed in triplicate). �, p � 0.05 and ��, p � 0.001.

FIGURE 4. Interaction of DC-SIGN with �-glucanis mediated by internal glucosyl residues. A, Binding ofDC-SIGN-Fc to HSA (negative control), purified �-glu-can, bovine glycogen, and enzymatically synthesizedglycogen (�1-ESG-A) was determined by ELISA. B,The ability of DC-SIGN to interact with various neo-glycoconjugates was assessed by incubating cells (mockcells or Raji cells expressing DC-SIGN) with beadscoated with biotin-labeled polyacrylamide neoglycocon-jugates harboring single glucosyl molecules (Glc1),�-(134)-di-glucosyl molecules (Glc2), or �-(134)-tet-ra-glucosyl molecules (Glc4) at a cell-to-bead ratio of1:10 for 30 min at 37°C. Beads coated with (man)3ara(Man3) or (ara)6 (Ara6) glycoconjugates served as pos-itive and negative controls, respectively. After washing,the percentage of cells positive for fluorescence was de-termined using flow cytometry. Results are presented asthe mean binding � SEM from three independent ex-periments (each experiment was performed in tripli-cate). ��, p � 0.001 differences as compared with theHSA control (A) or the beads coated with the Ara6 andGlc1 glycoconjugates (B).

5225The Journal of Immunology

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

were incubated with LPS in the absence or presence of �-glucan orwith �-glucan alone. As shown in Fig. 5A, stimulation with LPS inthe presence of �-glucan significantly increased the relative IL-10production (�4.2-fold) as compared with stimulation with LPSalone. �-Glucan by itself did not induce detectable levels of IL-10.To investigate whether the effect was specific of IL-10 or alsoaltered the IL-12/IL-23 axis, the relative amount of IL-12p40 wasalso determined. As shown in Fig. 5B, stimulation with LPS in thepresence of �-glucan did not significantly alter relative IL-12p40secretion. Similar results were obtained with �-glucan associatedto polystyrene beads (data not shown). Taken together, these re-sults demonstrate that �-glucan, like ManLAM, induced the pro-duction of IL-10 in LPS-primed DCs.

Recently, the molecular signaling pathway underlying DC-SIGN-dependent IL-10 induction in LPS-primed DCs was identi-

fied (37). It was demonstrated that ligand binding by DC-SIGNactivates the serine/threonine kinase Raf-1, which leads to phos-phorylation and acetylation of the NF-�B subunit p65 and, conse-quently, a prolonged and increased transcription of IL-10 (37). Toinvestigate the DC-SIGN dependency of �-glucan-induced IL-10production, DCs were pretreated with two specific inhibitors, afterwhich the consequences for �-glucan-dependent IL-10 inductionwere analyzed. Preincubation with the blocking Ab AZN-D2 ab-rogated the �-glucan-induced secretion of IL-10 (Fig. 5C). Thisinhibition was also observed at the mRNA level, as pretreatmentwith the Ab significantly reduced the expression of IL-10 mRNA(Fig. 5D). To test whether the induction was also dependent on theacetylation of the p65 subunit of NF-�B, the DCs were preincu-bated with anacardic acid. This CREB-binding protein/p300-spe-cific histone acyltransferase inhibitor prevents p65 acetylation and

FIGURE 5. �-Glucan induces IL-10production in LPS-primed DCs in a DC-SIGN-dependent manner. DCs werestimulated with �-glucan (20 �g/ml)in the absence or presence of LPS (20ng/ml) or with LPS alone. After 24 h,the supernatants were harvested andthe relative IL-10 (A) and IL-12p40(B) protein levels were determined.Additionally, the cells were stimulatedas in A in the absence or presence ofAZN-D2 or anacardic acid (com-pounds were added 2 h before stimu-lation), after which the relative IL-10production (C) and IL-10 mRNA ex-pression (D) were determined usingELISA and quantitative real-time PCRanalysis, respectively. In all cases, thevalues obtained for LPS-stimulatedcells were set at 1. Results are pre-sented as the mean � SEM from atleast five independent experiments(each experiment was performed intriplicate). �, p � 0.05 and ��, p �0.001; n.s., nonsignificant. E, Specificp65 phosphorylation (Ser276; blackbars) and acetylation (Lys310; graybars) was determined by ELISA onnuclear extracts of DCs stimulated for1 h with �-glucan or ManLAM (20�g/ml) in the absence or presence ofLPS (20 ng/ml) or anacardic acid.Data represent the means � SEM oftwo independent experiments.

5226 MYCOBACTERIAL �-GLUCAN: A NOVEL LIGAND FOR DC-SIGN

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

was previously shown to block ManLAM-induced expression ofIL-10 (37). Consistent with this earlier report, pretreatment withanacardic acid blocked the �-glucan-induced production of IL-10(Fig. 5C). This inhibition was also apparent at the mRNA level, asthe addition of anacardic acid significantly reduced the amount ofexpressed IL-10 (Fig. 5D). Furthermore, analysis of the phosphor-ylation and acetylation status of p65 extracted from the nucleus ofstimulated DCs demonstrated that �-glucan, like ManLAM, in-duced the phosphorylation of p65 serine residue 276 and the acet-ylation of lysine residue 310, with this latter process being inhib-ited by anacardic acid (Fig. 5E). Overall, these data demonstratethat the �-glucan-induced IL-10 production in LPS-primed DCs,as for ManLAM, was dependent on DC-SIGN and acetylation ofthe p65 subunit of NF-�B.

Mycobacterial �-glucan is not a ligand for TLR2

Extracellular �-glucans are not unique to mycobacteria, and sim-ilar molecules can be found in a variety of species. Some of these�-glucans have been shown to possess immune-stimulating prop-erties, for which the underlying mechanisms remain largely un-known (33, 49–51). Interestingly, for the fungus Pseudallescheriaboydii, it was recently reported that the stimulating activity of its�-glucan was dependent on the activation of TLR2 (51). This re-port, together with the earlier observation that mycobacterial�-glucan alone induced low, but detectable amounts of IL-12p40(Fig. 5B), prompted us to investigate whether the mycobacterialcompound may also be a ligand for TLR2. To test this, TLR2-transfected HEK293 cells were incubated with serial dilutions ofpurified �-glucan, after which IL-8 production was analyzed. Asshown in Fig. 6, stimulation with mycobacterial �-glucan activatedTLR2 in a dose-dependent manner (Fig. 6A). Consistent with theTLR2 dependency, the cells were also activated by the TLR2 ag-onist Pam3CysK4, but not by the TLR4 agonist LPS (Fig. 6A).Besides �-glucan, many structurally unrelated compounds, includ-ing various glycolipids, lipopeptides, proteins, and polysaccha-rides, have been shown to induce TLR2 activation (25, 52). How-ever, despite the sometimes convincing evidence, the activity ofmany of these compounds was later on shown to be caused bycontamination with lipopeptides (53–55). To investigate the pos-sibility that the observed TLR2-stimulating activity of �-glucanwas caused by lipopeptide contamination, �-glucan was pretreatedwith hydrogen peroxide, phenol, and amyloglucosidase and re-tested for the activity on HEK293 TLR2 cells. As shown in Fig.6B, treatment of �-glucan with hydrogen peroxide and phenol,treatments that inactivate (25) and remove (56) lipopeptides, re-spectively, completely abrogated the TLR2-stimulating activity.However, activity was recovered in the phenol extract (data notshown). In contrast, pretreatment with amyloglucosidase, whichcompletely degraded the �-glucan (Fig. 6C), did not significantlyreduce the TLR2-mediated activity (Fig. 6B). These data demon-strate that the observed TLR2-stimulating activity was not medi-ated by the �-glucan but was most likely due to a low-level con-tamination with lipopeptides. This conclusion was furthersupported by the observation that various types of glycogen, bothnatural and synthetic, were unable to activate TLR2 (data notshown). To investigate whether the removal of lipopeptides wouldalter the conclusions drawn from our earlier experiments, DCswere stimulated with phenol-treated �-glucan in the absence orpresence of LPS. As shown in Fig. 7, phenol-treated �-glucan, asfor the untreated �-glucan (Fig. 5A), specifically induced the pro-duction of IL-10, confirming the dependency on DC-SIGN (Fig.7A). However, in contrast to the earlier experiment in which un-treated �-glucan was found to induce low, but detectable amountsof IL-12p40 (Fig. 5B), the phenol-treated �-glucan did not induce

any cytokine secretion by itself (Fig. 7B). These results are con-sistent with the earlier report that ManLAM alone does not inducecytokine secretion by DCs (37). Finally, we tested whether thephenol-treated �-glucan could still block the interaction betweenDCs and M. bovis BCG. Similar to the results obtained for un-treated �-glucan (Fig. 3), phenol-treated �-glucan efficientlyblocked the interaction between M. bovis BCG and the DCs (Fig.7C), thus ruling out that the block was caused by the lipopeptidecontamination.

FIGURE 6. TLR2 activation by purified �-glucan is caused by contam-ination with lipopeptides. A, HEK293 cells transfected with TLR2 werestimulated with increasing amounts of �-glucan, with LPS (50 ng/ml), withPam3CysK4 (50 ng/ml), or with H2O (�) as a negative control for 24 h at37°C. Following stimulation, the supernatants were harvested and analyzedfor IL-8. B, HEK293 TLR2 cells were stimulated with �-glucan (50 �g/ml)that was pretreated or not with amyloglucosidase, 1% hydrogen peroxide(H2O2), or phenol. Stimulation with hydrogen peroxide-treatedPam3CysK4 (50 ng/ml) served as a positive control for lipopeptide inac-tivation. In both A and B, the results represent the mean IL-8 production �SEM from three independent experiments (each experiment was performedin triplicate). ��, p � 0.001; n.s., nonsignificant. C, Consequence of amy-loglucosidase, hydrogen peroxide, and phenol reatment on the integrity of�-glucan was assed by monitoring the reactivity of an anti-�-glucan mAbtoward the (pretreated) �-glucan. The figure shows the reactivity of the Abtoward a 5-fold serial dilution series of (pretreated) �-glucan (starting at 20�g/ml).

5227The Journal of Immunology

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

DiscussionPolysaccharide capsules are expressed by many pathogenic bacte-ria and play an important role during infection (10, 11). Althoughthe presence of a capsule on mycobacteria was already recognizedmany decades ago (57), so far only a few studies have been aimedat investigating its function. One important requirement for ob-taining insight into its functional role is to identify host receptorsthat recognize its constituents. The polysaccharide composition ofthe capsule is conserved among mycobacteria and predominantlyconsists of an �-(134)-glucosyl polymer known as �-glucan (upto �80% of the capsular polysaccharide content in M. tuberculo-sis) (12, 13). So far, only one potential host �-glucan receptor hasbeen identified. Cywes and colleagues demonstrated that both me-chanical and enzymatic removal of the capsule, and in particularthat of the capsular �-glucan, abolished the nonopsonic binding ofM. tuberculosis to Chinese hamster ovary cells expressing CR3(18). Additionally, it was shown that capsular �-glucan was able toinhibit Mycobacterium-CR3 interactions. These findings are puz-zling, as CR3 has been shown to bind well to �-glycans but not to�-glycans (58). Nevertheless, these data suggest that CR3 acts asa cellular �-glucan receptor. More recently, in a study performedby Gagliardi and coworkers, it was shown that incubation ofmonocytes with capsular �-glucan before differentiation blocksCD1 expression on the monocyte-derived DCs and suppressestheir IL-12 production (22). Although these immunosuppressiveeffects could be ascribed to the glucan, the host receptors involvedwere not identified, nor were the signaling routes explained. There-fore, our aim was to identify (additional) host �-glucan receptorsand investigate their role in the Mycobacterium-host interaction.

To do this, we first performed a screen in which different typesof primary immune cells were checked for their ability to interactwith �-glucan. This experiment indicated that �-glucan bound tomacrophages and, interestingly, also to DCs (Fig. 1). DCs are im-portant immune cells that are pivotal for the induction of an adap-

tive immune response. This characteristic makes DCs an attractivetarget for pathogenic microbes, as illustrated by the large numberof pathogens, including pathogenic mycobacteria, that modulatetheir function (59–61). For this reason, together with the obser-vation that �-glucan binding to the macrophages was generallyweak, we focused on the DC-�-glucan interaction. Several DClectins were previously shown to interact with mycobacteria.These include the MR (62), DC-SIGN (38, 39), and dectin-1 (63,64). By using Fc constructs of these lectins, we were able to showthat �-glucan was specifically recognized by DC-SIGN (Fig. 2A).Experiments with native DC-SIGN confirmed these results anddemonstrated that �-glucan represented a bona fide ligand for thislectin (Fig. 2, B and C). Furthermore, by using a blocking Ab, wecould demonstrate that �-glucan binding to DCs was primarilydependent on DC-SIGN (Fig. 2C). The inability of dectin-1-Fc tobind �-glucan was expected, as this receptor is mainly involved inthe recognition of �-linked glucans (65). However, the MR, likeDC-SIGN, harbors an EPN (in one-letter amino acid code) motifand has been shown to recognize mannose, fucose, N-acetylglu-cosamine, and glucose-containing structures (66–68). However, incontrast to DC-SIGN, which recognizes internal glycosyl residues,the MR interacts with terminal moieties (43, 44). This character-istic may explain the differential recognition, as the relativeamount of nonreducing termini in �-glucan is expected to be lowas compared with the number of internal motifs. This view is sup-ported by the observation that the MR-Fc construct showed a low,but significant binding to glycogen (data not shown). As glycogenpossesses a more open structure and shorter backbones than does�-glucan (16), it is expected to express a higher number of acces-sible terminal glucosyl residues. The assumption that �-glucan rec-ognition by DC-SIGN is potentially mediated by internal glucosylresidues was further supported by the observation that beadscoated with �-(134)-di-glucosyl (maltose) moieties (in the form

FIGURE 7. Phenol-treated �-glucan induces IL-10production in LPS-primed DCs and inhibits the interac-tion between DC-SIGN and M. bovis BCG. DCs werestimulated with phenol-treated �-glucan in the absenceor presence of LPS or with LPS alone. After 24 h, thesupernatants were harvested and the relative IL-10 (A)and IL-12p40 (B) protein levels were determined. C,DCs were incubated with M. bovis BCG expressingdsRed at a MOI of 0.5, 2, or 8 for 30 min at 37°C in theabsence (filled bars (�)) or presence (open bars ()) of50 �g/ml phenol-treated �-glucan. The percentage ofcells binding M. bovis BCG was determined using flowcytometry. In all cases, results are presented as themeans � SEM from three independent experiments(each experiment was performed in triplicate). ��, p �0.001; n.s., nonsignificant.

5228 MYCOBACTERIAL �-GLUCAN: A NOVEL LIGAND FOR DC-SIGN

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

of side chains of polymeric neoglycoconjugates) strongly inter-acted with DC-SIGN, whereas those coated with mono-glucosylresidues did not (Fig. 4B). Also in a previous study, maltose wasshown to be a much more effective competitor than glucose (Ki of0.27 and 8.08 mM, respectively) for inhibiting interactions be-tween gp120 and DC-SIGN (46). However, the conclusion thatDC-SIGN binds �-glucan through internal glucosyl residues alsoposes a fundamental problem in that it is known to preferentiallyrecognize equatorial 4-OH groups (40). As �-glucan is composedof �-(134)-linked residues, the internal 4-OH groups are notavailable for binding to DC-SIGN. This raises the intriguing ques-tion of how �-glucan is recognized, and additional experimentswill be needed to provide an answer to this important question.

Previously, ligand binding by DC-SIGN was shown to induceIL-10 production in LPS-primed DCs. This phenomenon was firstobserved for ManLAM, an abundant mycobacterial cell wall gly-colipid (39). It was proposed that mycobacteria target DC-SIGN toinduce IL-10 production and thereby subvert the host immune re-sponse (39). Consistent with this result, we observed that also�-glucan induced IL-10 production in LPS-primed DCs (Fig. 5A).This suggests that �-glucan, as for ManLAM, may promote im-mune suppression. However, one potential flaw in this reasoning isthat all of the experiments showing IL-10 induction by mycobac-terial compounds, including our own, were performed in the con-text of TLR costimulation (TLR4 in particular), the role of whichin M. tuberculosis infection remains unclear (69). Elucidation ofthe molecular pathways underlying DC-SIGN-TLR cross-modula-tion has only just begun. Important progress into this field wasmade when it was demonstrated that DC-SIGN ligation activatesthe serine/threonine kinase Raf-1, leading to the phosphorylationand acetylation of the NF-�B subunit p65 and a prolonged andincreased transcription of IL-10 (37). However, it remains unclearwhether this route is the only way by which DC-SIGN influencesTLR signaling or that alternative regulatory mechanisms may ex-ist. Importantly, stimulation of DC-SIGN alone does not seem toinduce IL-10 production (70). Additionally, in the bronchoalveolarlavage of patients with TB, IL-10 could not be detected (71). Fur-thermore, the cross-talk between DC-SIGN and TLR2—the TLRthat is probably most relevant in the context of mycobacterial in-fections—has not been investigated. Nevertheless, the potentialimportance of DC-SIGN ligation during infection is illustrated bythe large number of DC-SIGN ligands that (pathogenic) mycobac-teria may express. Together with ManLAM (39), lipomannan (72),mannose-capped arabinomannan (72), two mannosylated glycop-roteins (72), and the phosphatidylinositol mannosides (73), �-glu-can represents the seventh documented mycobacterial ligand forDC-SIGN. Interestingly, it has been shown that in patients with TBup to 70% of alveolar macrophages show DC-SIGN expression(71). It was demonstrated that infection with M. tuberculosis in-duced DC-SIGN expression, both on infected and noninfectedmacrophages, and that the DC-SIGN-expressing cells were moreprone to infection than were their DC-SIGN-negative counterparts(71). Overall, these findings strongly suggest that DC-SIGN liga-tion is an important process during mycobacterial infection. How-ever, how M. tuberculosis exactly benefits from this interactionremains unclear.

To date, a wide diversity of structurally unrelated moleculeshave been claimed to induce TLR2 activation. These structuresinclude various (lipo-)proteins and lipopeptides, glycolipids, pep-tidoglycans, and other polysaccharides and even whole viruses (fora comprehensive review, see Ref. 25). This apparent promiscuitycontrasts strongly with data suggesting a very high specificity (26).In the latter study, it was shown that variations in the acylation ofa (synthetic) lipopeptide, an established TLR2 ligand, had a dra-

matic effect on the biological activity. Additionally, simply con-verting the thioether linkage present in lipopeptides into a sulfox-ide (by hydrogen peroxide treatment) completely abrogated theactivity (26). This tight relation between structure and function canbe understood from x-ray data of a TLR1-TLR2-lipopetide com-plex (74). Hydrophobic pockets on the surface of the TLRs will, tofit in, put strong restrictions on the nature and spatial distributionof the ligand acyl chains. We therefore investigated the possibilitythat the TLR2 activity of capsular glucan was caused by contam-inating lipopeptides by two independent procedures: removal oflipopeptides by phenol extraction, and inactivation of lipopeptidesby treatment with hydrogen peroxide. As shown in Fig. 6B, pre-treatment of �-glucan with both hydrogen peroxide and phenolextraction fully abrogated its TLR2-activating potency. In contrast,the activity after degradation with amyloglucosidase was sus-tained. These results demonstrate that the TLR2 activation was notmediated by �-glucan but almost certainly was caused by contam-inating lipopeptides. These copurified lipopeptides were present atvery low concentrations, as they remained undetected by 1H NMRanalysis after �-glucan was purified. Fig. 6 shows that the presenceof 0.1% of lipopetides in the �-glucan fraction (a level that cannotbe detected by NMR) would be sufficient to account for the activityobserved. Our case is by no means novel, and the biomedical lit-erature shows that low-level endotoxin and/or lipopeptide contam-ination, undetectable with chemical methods, has been hauntingscientists for many years (25). Overall, our findings demonstratethat the analysis of putative TLR2 ligands, especially those that donot harbor hydrophobic domains, should be performed with greatcare, and that suitable controls, for example, treatment with phenoland hydrogen peroxide, should be included. Furthermore, it is clearthat before mycobacterial �-glucan is used in biological assays, anadditional purification step that removes lipopeptides, for example,treatment with phenol, should be performed.

Here we have demonstrated that mycobacterial �-glucan rep-resents a bona fide ligand for DC-SIGN. This has added a sec-ond host �-glucan receptor and has broadened the potential tar-get cell population to also include DCs. This observation,together with the notion that mycobacteria shed high amountsof �-glucan (12), suggests that the �-glucan capsule may fulfillan important role in pathogenesis. To investigate this issue, thegeneration of �-glucan-deficient mutants will be of major ben-efit. However, despite great endeavor, the construction of suchmutants has currently been unsuccessful. Recently, it wasshown that mutation of Rv3032, a homolog of the glycogensynthase glgA, greatly reduced the synthesis of methyl glucoseLPS and cytosolic glycogen, whereas the levels of extracellular�-glucan remained unchanged (75). However, deletion of a sec-ond glgA homolog, that is, Rv1212c, resulted in reducedamounts of �-glucan with no effect on the levels of methylglucose LPS and glycogen. Still, importantly, the Rv1212c mu-tant could be fully complemented by overexpression of Rv3032.Furthermore, a double mutant of Rv1212c and Rv3032 could notbe generated, indicating that the presence of at least one of thecopies was required for viability (75). These findings suggestthat �-glucan and glycogen may share, at least in part, a com-mon biosynthetic pathway. However, as the two polysaccha-rides also exhibit important structural differences (16), discrep-ancies between the biosynthetic pathways must exist.Nevertheless, the observation that enzymes involved in the bio-synthesis of �-glucan are essential for viability warrants its bio-synthetic pathway as an interesting target for TB drugdevelopment.

5229The Journal of Immunology

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

AcknowledgmentsWe thank Drs. T. Geijtenbeek and S. I. Gringhuis (Academic MedicalCenter, University of Amsterdam, Amsterdam, The Netherlands) for pro-viding DC-SIGN-Fc, mAb AZN-D2, DC-SIGN-transfected Raji cells, andtechnical advise and assistance; Dr. G. Brown (University of Cape Town,Cape Town, South Africa) for providing dectin-1-Fc; and Dr. L. Martinez-Pomares (University of Nottingham, Nottingham, United Kingdom) andDr. R. Stillion (University of Oxford, Oxford, United Kingdom) for pro-viding MR-Fc. Furthermore, we thank Dr. D. Golenbock (University ofMassachusetts Medical School, Worcester, MA) for providing the HEK293TLR2 cell line. We also thank Dr. U. Zahringer (Leibnitz Research Center,Borstel, Germany) for crucial discussions on TLR2 ligands.

DisclosuresThe authors have no financial conflicts of interest.

References1. World Health Organisation. 2008. WHO report 2008: global tuberculosis control.

Available at www.who.int/tb/publications/global_report/2008/chapter_1/en/index3.html.

2. Russell, D. G. 2007. Who puts the tubercle in tuberculosis? Nat. Rev. Microbiol.5: 39–47.

3. Saunders, B. M., and W. J. Britton. 2007. Life and death in the granuloma:immunopathology of tuberculosis. Immunol. Cell Biol. 85: 103–111.

4. Houben, E. N., L. Nguyen, and J. Pieters. 2006. Interaction of pathogenic my-cobacteria with the host immune system. Curr. Opin. Microbiol. 9: 76–85.

5. Pieters, J. 2008. Mycobacterium tuberculosis and the macrophage: maintaining abalance. Cell Host Microbe 3: 399–407.

6. Briken, V., S. A. Porcelli, G. S. Besra, and L. Kremer. 2004. Mycobacteriallipoarabinomannan and related lipoglycans: from biogenesis to modulation of theimmune response. Mol. Microbiol. 53: 391–403.

7. Daffe, M., and P. Draper. 1998. The envelope layers of mycobacteria with ref-erence to their pathogenicity. Adv. Microb. Physiol. 39: 131–203.

8. Hoffmann, C., A. Leis, M. Niederweis, J. M. Plitzko, and H. Engelhardt. 2008.Disclosure of the mycobacterial outer membrane: cryo-electron tomography andvitreous sections reveal the lipid bilayer structure. Proc. Natl. Acad. Sci. USA105: 3963–3967.

9. Zuber, B., M. Chami, C. Houssin, J. Dubochet, G. Griffiths, and M. Daffe. 2008.Direct visualization of the outer membrane of mycobacteria and corynebacteria intheir native state. J. Bacteriol. 190: 5672–5680.

10. Guo, H., W. Yi, J. K. Song, and P. G. Wang. 2008. Current understanding onbiosynthesis of microbial polysaccharides. Curr. Top. Med. Chem. 8: 141–151.

11. Taylor, C. M., and I. S. Roberts. 2005. Capsular polysaccharides and their role invirulence. Contrib. Microbiol. 12: 55–66.

12. Ortalo-Magne, A., M. A. Dupont, A. Lemassu, A. B. Andersen, P. Gounon, andM. Daffe. 1995. Molecular composition of the outermost capsular material of thetubercle bacillus. Microbiology 141: 1609–1620.

13. Lemassu, A., A. Ortalo-Magne, F. Bardou, G. Silve, M. A. Laneelle, andM. Daffe. 1996. Extracellular and surface-exposed polysaccharides of non-tuber-culous mycobacteria. Microbiology 142: 1513–1520.

14. Lemassu, A., and M. Daffe. 1994. Structural features of the exocellular polysac-charides of Mycobacterium tuberculosis. Biochem. J. 297: 351–357.

15. Dinadayala, P., A. Lemassu, P. Granovski, S. Cerantola, N. Winter, and M. Daffe.2004. Revisiting the structure of the anti-neoplastic glucans of Mycobacteriumbovis bacille Calmette-Guerin: structural analysis of the extracellular and boilingwater extract-derived glucans of the vaccine substrains. J. Biol. Chem. 279:12369–12378.

16. Dinadayala, P., T. Sambou, M. Daffe, and A. Lemassu. 2008. Comparative struc-tural analyses of the �-glucan and glycogen from Mycobacterium bovis. Glyco-biology 18: 502–508.

17. Schwebach, J. R., A. Glatman-Freedman, L. Gunther-Cummins, Z. Dai,J. B. Robbins, R. Schneerson, and A. Casadevall. 2002. Glucan is a componentof the Mycobacterium tuberculosis surface that is expressed in vitro and in vivo.Infect. Immun. 70: 2566–2575.

18. Cywes, C., H. C. Hoppe, M. Daffe, and M. R. W. Ehlers. 1997. Nonopsonicbinding of Mycobacterium tuberculosis to human complement receptor type 3 ismediated by capsular polysaccharides and is strain dependent. Infect. Immun. 65:4258–4266.

19. Ehlers, M. R. W., and M. Daffe. 1998. Interactions between Mycobacteriumtuberculosis and host cells: are mycobacterial sugars the key? Trends Microbiol.6: 328–335.

20. Fenton, M. J., L. W. Riley, and L. S. Schlesinger. 2005. Receptor-mediatedrecognition of Mycobacterium tuberculosis by host cells. In Tuberculosis and theTubercle Bacillus. S. T. Cole, K. Davis Eisenach, D. N. McMurray, andW. R. Jacobs Jr., eds. Am. Soc. Microbiol., Washington, DC, pp. 405–426.

21. Stokes, R. W., R. Norris-Jones, D. E. Brooks, T. J. Beveridge, D. Doxsee, andL. M. Thorson. 2004. The glycan-rich outer layer of the cell wall of Mycobac-terium tuberculosis acts as an antiphagocytic capsule limiting the association ofthe bacterium with macrophages. Infect. Immun. 72: 5676–5686.

22. Gagliardi, M. C., A. Lemassu, R. Teloni, S. Mariotti, V. Sargentini, M. Pardini,M. Daffe, and R. Nisini. 2007. Cell wall-associated alpha-glucan is instrumentalfor Mycobacterium tuberculosis to block CD1 molecule expression and disable

the function of dendritic cell derived from infected monocyte. Cell. Microbiol. 9:2081–2092.

23. Zlotta, A. R., J. P. van Vooren, O. Denis, A. Drowart, M. Daffe, P. Lefevre,L. Schandene, M. de Cock, J. de Bruyn, P. Vandenbussche, et al. 2000. What arethe immunologically active components of bacille Calmette-Guerin in therapy ofsuperficial bladder cancer? Int. J. Cancer 87: 844–852.

24. Sauton, B. 1912. Sur la nutrition minerale du bacille tuberculeux. C. R. Acad. Sci.155: 860–863.

25. Zahringer, U., B. Lindner, S. Inamura, H. Heine, and C. Alexander. 2008. TLR2:promiscuous or specific?: a critical re-evaluation of a receptor expressing appar-ent broad specificity. Immunobiology 213: 205–224.

26. Morr, M., O. Takeuchi, S. Akira, M. M. Simon, and P. F. Muhlradt. 2002. Dif-ferential recognition of structural details of bacterial lipopeptides by Toll-likereceptors. Eur. J. Immunol. 32: 3337–3347.

27. Baba, O. 1993. Production of monoclonal antibody that recognizes glycogen andits application for immunohistochemistry. Kokubyo Gakkai Zasshi 60: 264–287.

28. Verreck, F. A., T. de Boer, D. M. Langenberg, M. A. Hoeve, M. Kramer,E. Vaisberg, R. Kastelein, A. Kolk, R. de Waal-Malefyt, and T. H. Ottenhoff.2004. Human IL-23-producing type 1 macrophages promote but IL-10-producingtype 2 macrophages subvert immunity to (myco)bacteria. Proc. Natl. Acad. Sci.USA 101: 4560–4565.

29. Geijtenbeek, T. B., D. S. Kwon, R. Torensma, S. J. van Vliet,G. C. F. van Duijnhoven, J. Middel, I. L. M. H. Cornelissen, H. S. L. M. Nottet,V. N. KewalRamani, D. R. Littman, et al. 2000. DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells. Cell 100:587–597.

30. Mambula, S. S., K. Sau, P. Henneke, D. T. Golenbock, and S. M. Levitz. 2002.Toll-like receptor (TLR) signaling in response to Aspergillus fumigatus. J. Biol.Chem. 277: 39320–39326.

31. Bovin, N. V., E. Y. Korchagina, T. V. Zemlyanukhina, N. E. Byramova,O. E. Galanina, A. E. Zemlyakov, A. E. Ivanov, V. P. Zubov, andL. V. Mochalova. 1993. Synthesis of polymeric neoglycoconjugates based onN-substituted polyacrylamides. Glycoconj. J. 10: 142–151.

32. Geijtenbeek, T. B., G. Koopman, G. C. van Duijnhoven, S. J. van Vliet,A. C. van Schijndel, A. Engering, J. L. Heeney, and Y. van Kooyk. 2001. Rhesusmacaque and chimpanzee DC-SIGN act as HIV/SIV gp120 trans-receptors, sim-ilar to human DC-SIGN. Immunol. Lett. 79: 101–107.

33. Kakutani, R., Y. Adachi, H. Kajiura, H. Takata, T. Kuriki, and N. Ohno. 2007.Relationship between structure and immunostimulating activity of enzymaticallysynthesized glycogen. Carbohydr. Res. 342: 2371–2379.

34. van Die, I., S. J. van Vliet, A. K. Nyame, R. D. Cummings, C. M. Bank,B. J. Appelmelk, T. B. Geijtenbeek, and Y. van Kooyk. 2003. The dendriticcell-specific C-type lectin DC-SIGN is a receptor for Schistosoma mansoni eggantigens and recognizes the glycan antigen Lewis x. Glycobiology 13: 471–478.

35. Steele, C., R. R. Rapaka, A. Metz, S. M. Pop, D. L. Williams, S. Gordon,J. K. Kolls, and G. D. Brown. 2005. The �-glucan receptor dectin-1 recognizesspecific morphologies of Aspergillus fumigatus. PLoS Pathog. 1: e42.

36. Martinez-Pomares, L., D. M. Reid, G. D. Brown, P. R. Taylor, R. J. Stillion,S. A. Linehan, S. Zamze, S. Gordon, and S. Y. Wong. 2003. Analysis of mannosereceptor regulation by IL-4, IL-10, and proteolytic processing using novel mono-clonal antibodies. J. Leukocyte Biol. 73: 604–613.

37. Gringhuis, S. I., J. den Dunnen, M. Litjens, B. van het Hof, Y. van Kooyk, andT. B. Geijtenbeek. 2007. C-type lectin DC-SIGN modulates Toll-like receptorsignaling via Raf-1 kinase-dependent acetylation of transcription factor NF-�B.Immunity 26: 605–616.

38. Tailleux, L., O. Schwartz, J. L. Herrmann, E. Pivert, M. Jackson, A. Amara,L. Legres, D. Dreher, L. P. Nicod, J. C. Gluckman, P. H. Lagrange, B. Gicquel,and O. Neyrolles. 2003. DC-SIGN is the major Mycobacterium tuberculosis re-ceptor on human dendritic cells. J. Exp. Med. 197: 121–127.

39. Geijtenbeek, T. B., S. J. van Vliet, E. A. Koppel, M. Sanchez-Hernandez,C. M. J. E. Vandenbroucke-Grauls, B. J. Appelmelk, and Y. van Kooyk. 2003.Mycobacteria target DC-SIGN to suppress dendritic cell function. J. Exp. Med.197: 7–17.

40. Feinberg, H., D. A. Mitchell, K. Drickamer, and W. I. Weis. 2001. Structuralbasis for selective recognition of oligosaccharides by DC-SIGN and DC-SIGNR.Science 294: 2163–2166.

41. Appelmelk, B. J., I. van Die, S. J. van Vliet, C. M. J. E. Vandenbroucke-Grauls,T. B. Geijtenbeek, and Y. van Kooyk. 2003. Cutting edge: carbohydrate profilingidentifies new pathogens that interact with dendritic cell-specific ICAM-3-grab-bing nonintegrin on dendritic cells. J. Immunol. 170: 1635–1639.

42. Guo, Y., H. Feinberg, E. Conroy, D. A. Mitchell, R. Alvarez, O. Blixt,M. E. Taylor, W. I. Weis, and K. Drickamer. 2004. Structural basis for distinctligand-binding and targeting properties of the receptors DC-SIGN and DC-SIGNR. Nat. Struct. Mol. Biol. 11: 591–598.

43. Hitchen, P. G., N. P. Mullin, and M. E. Taylor. 1998. Orientation of sugars boundto the principal C-type carbohydrate-recognition domain of the macrophage man-nose receptor. Biochem. J. 333: 601–608.

44. Weis, W. I., K. Drickamer, and W. A. Hendrickson. 1992. Structure of a C-typemannose-binding protein complexed with an oligosaccharide. Nature 360:127–134.

45. Mitchell, D. A., A. J. Fadden, and K. Drickamer. 2001. A novel mechanism ofcarbohydrate recognition by the C-type lectins DC-SIGN and DC-SIGNR: sub-unit organization and binding to multivalent ligands. J. Biol. Chem. 276:28939–28945.

46. Su, S. V., P. Hong, S. Baik, O. A. Negrete, K. B. Gurney, and B. Lee. 2004.DC-SIGN binds to HIV-1 glycoprotein 120 in a distinct but overlapping fashioncompared with ICAM-2 and ICAM-3. J. Biol. Chem. 279: 19122–19132.

5230 MYCOBACTERIAL �-GLUCAN: A NOVEL LIGAND FOR DC-SIGN

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

47. Gadikota, R. R., C. S. Callam, B. J. Appelmelk, and T. L. Lowary. 2003. Syn-thesis of oligosaccharide fragments of mannosylated lipoarabinomannan appro-priately functionalized for neoglycoconjugates preparation. J. Carbohydr. Chem.22: 459–480.

48. Koppel, E. A., I. S. Ludwig, M. S. Hernandez, T. L. Lowary, R. R. Gadikota,A. B. Tuzikov, C. M. J. E. Vandenbroucke-Grauls, Y. van Kooyk,B. J. Appelmelk, and T. B. Geijtenbeek. 2004. Identification of the mycobacterialcarbohydrate structure that binds the C-type lectins DC-SIGN, L-SIGN andSIGNR1. Immunobiology 209: 117–127.

49. Nair, P. K., S. Rodriguez, R. Ramachandran, A. Alamo, S. J. Melnick,E. Escalon, P. I. Garcia, Jr., S. F. Wnuk, and C. Ramachandran. 2004. Immunestimulating properties of a novel polysaccharide from the medicinal plant Tino-spora cordifolia. Int. Immunopharmacol. 4: 1645–1659.

50. Okamoto, S., Y. Terao, H. Kaminishi, S. Hamada, and S. Kawabata. 2007. In-flammatory immune responses by water-insoluble �-glucans. J. Dent. Res. 86:242–248.

51. Bittencourt, V. C., R. T. Figueiredo, R. B. da Silva, D. S. Mourao-Sa,P. L. Fernandez, G. L. Sassaki, B. Mulloy, M. T. Bozza, and E. Barreto-Bergter.2006. An �-glucan of Pseudallescheria boydii is involved in fungal phagocytosisand Toll-like receptor activation. J. Biol. Chem. 281: 22614–22623.

52. Wetzler, L. M. 2003. The role of Toll-like receptor 2 in microbial disease andimmunity. Vaccine 21(Suppl. 2): S55–S60.

53. Travassos, L. H., S. E. Girardin, D. J. Philpott, D. Blanot, M. A. Nahori, C. Werts,and I. G. Boneca. 2004. Toll-like receptor 2-dependent bacterial sensing does notoccur via peptidoglycan recognition. EMBO Rep. 5: 1000–1006.

54. Hashimoto, M., K. Tawaratsumida, H. Kariya, K. Aoyama, T. Tamura, andY. Suda. 2006. Lipoprotein is a predominant Toll-like receptor 2 ligand in Staph-ylococcus aureus cell wall components. Int. Immunol. 18: 355–362.

55. Ogawa, T., Y. Asai, Y. Makimura, and R. Tamai. 2007. Chemical structure andimmunobiological activity of Porphyromonas gingivalis lipid A. Front. Biosci.12: 3795–3812.

56. Hirschfeld, M., Y. Ma, J. H. Weis, S. N. Vogel, and J. J. Weis. 2000. Cuttingedge: repurification of lipopolysaccharide eliminates signaling through both hu-man and murine Toll-like receptor 2. J. Immunol. 165: 618–622.

57. Hanks, J. H. 1961. Capsules in electron micrographs of Mycobacterium leprae.Int. J. Lepr. 29: 84–87.

58. Thornton, B. P., V. Vetvicka, M. Pitman, R. C. Goldman, and G. D. Ross. 1996.Analysis of the sugar specificity and molecular location of the �-glucan-bindinglectin site of complement receptor type 3 (CD11b/CD18). J. Immunol. 156:1235–1246.

59. van Vliet, S. J., J. den Dunnen, S. I. Gringhuis, T. B. Geijtenbeek, andY. van Kooyk. 2007. Innate signaling and regulation of dendritic cell immunity.Curr. Opin. Immunol. 19: 435–440.

60. Pearce, E. J., C. M. Kane, and J. Sun. 2006. Regulation of dendritic cell functionby pathogen-derived molecules plays a key role in dictating the outcome of theadaptive immune response. Chem. Immunol. Allergy 90: 82–90.

61. van Kooyk, Y., A. Engering, A. N. Lekkerkerker, I. S. Ludwig, andT. B. Geijtenbeek. 2004. Pathogens use carbohydrates to escape immunity in-duced by dendritic cells. Curr. Opin. Immunol. 16: 488–493.

62. Schlesinger, L. S. 1993. Macrophage phagocytosis of virulent but not attenuatedstrains of Mycobacterium tuberculosis is mediated by mannose receptors in ad-dition to complement receptors. J. Immunol. 150: 2920–2930.

63. Yadav, M., and J. S. Schorey. 2006. The �-glucan receptor dectin-1 functionstogether with TLR2 to mediate macrophage activation by mycobacteria. Blood108: 3168–3175.

64. Rothfuchs, A. G., A. Bafica, C. G. Feng, J. G. Egen, D. L. Williams,G. D. Brown, and A. Sher. 2007. Dectin-1 interaction with Mycobacterium tu-berculosis leads to enhanced IL-12p40 production by splenic dendritic cells.J. Immunol. 179: 3463–3471.

65. Sun, L., and Y. Zhao. 2007. The biological role of dectin-1 in immune response.Int. Rev. Immunol. 26: 349–364.

66. Apostolopoulos, V., and I. F. McKenzie. 2001. Role of the mannose receptor inthe immune response. Curr. Mol. Med. 1: 469–474.

67. Fiete, D., M. C. Beranek, and J. U. Baenziger. 1997. The macrophage/endothelialcell mannose receptor cDNA encodes a protein that binds oligosaccharides ter-minating with SO4–4-GalNAc�1,4GlcNAc� or Man at independent sites. Proc.Natl. Acad. Sci. USA 94: 11256–11261.

68. Largent, B. L., K. M. Walton, C. A. Hoppe, Y. C. Lee, and R. L. Schnaar. 1984.Carbohydrate-specific adhesion of alveolar macrophages to mannose-derivatizedsurfaces. J. Biol. Chem. 259: 1764–1769.

69. Jo, E. K., C. S. Yang, C. H. Choi, and C. V. Harding. 2007. Intracellular sig-nalling cascades regulating innate immune responses to mycobacteria: branchingout from Toll-like receptors. Cell. Microbiol. 9: 1087–1098.

70. Hodges, A., K. Sharrocks, M. Edelmann, D. Baban, A. Moris, O. Schwartz,H. Drakesmith, K. Davies, B. Kessler, A. McMichael, and A. Simmons. 2007.Activation of the lectin DC-SIGN induces an immature dendritic cell phenotypetriggering Rho-GTPase activity required for HIV-1 replication. Nat. Immunol. 8:569–577.

71. Tailleux, L., N. Pham-Thi, A. Bergeron-Lafaurie, J. L. Herrmann, P. Charles,O. Schwartz, P. Scheinmann, P. H. Lagrange, J. de Blic, A. Tazi, et al. 2005.DC-SIGN induction in alveolar macrophages defines privileged target host cellsfor mycobacteria in patients with tuberculosis. PLoS Med. 2: e381.

72. Pitarque, S., J. L. Herrmann, J. L. Duteyrat, M. Jackson, G. R. Stewart,F. Lecointe, B. Payre, O. Schwartz, D. B. Young, G. Marchal, et al. 2005. De-ciphering the molecular bases of Mycobacterium tuberculosis binding to the lec-tin DC-SIGN reveals an underestimated complexity. Biochem. J. 392: 615–624.

73. Torrelles, J. B., A. K. Azad, and L. S. Schlesinger. 2006. Fine discrimination inthe recognition of individual species of phosphatidyl-myo-inositol mannosidesfrom Mycobacterium tuberculosis by C-type lectin pattern recognition receptors.J. Immunol. 177: 1805–1816.

74. Jin, M. S., S. E. Kim, J. Y. Heo, M. E. Lee, H. M. Kim, S. G. Paik, H. Lee, andJ. O. Lee. 2007. Crystal structure of the TLR1-TLR2 heterodimer induced bybinding of a tri-acylated lipopeptide. Cell 130: 1071–1082.

75. Sambou, T., P. Dinadayala, G. Stadthagen, N. Barilone, Y. Bordat, P. Constant,F. Levillain, O. Neyrolles, B. Gicquel, A. Lemassu, et al. 2008. Capsular glucanand intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and im-pact on the persistence in mice. Mol. Microbiol. 70: 762–774.

5231The Journal of Immunology

by guest on April 1, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from