an exploration into the molecular recognition of signal ... · synthesis of several final...

An Exploration into the Molecular Recognition of Signal Transducer and Activator of Transcription 3 Protein Via

Rationally Designed Small Molecule Binders

by

Vijay M. Shahani

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Department of Chemistry University of Toronto

© Copyright by Vijay M. Shahani 2013

ii

An Exploration into the Molecular Recognition of Signal

Transducer and Activator of Transcription 3 Protein Using

Rationally Designed Small Molecule Binders

Vijay M. Shahani

Doctor of Philosophy

Department of Chemistry

University of Toronto

2013

Abstract

Signal transducer and activator of transcription 3 (STAT3) is a cancer-driving proto-oncoprotein

that represents a novel target for the development of chemotherapeutics. In this study, the

functional requirements to furnish a potent STAT3 inhibitor was investigated. First, a series of

peptidomimetic inhibitors were rationally designed from lead parent peptides. Prepared

peptidomimetics overcame the limitations normally associated with peptide agents and displayed

improved activity in biophysical evaluations. Notably, lead peptidomimetic agents possessed

micromolar cellular activity which was unobserved in both parent peptides. Peptidomimetic

design relied on computational methods that were also employed in the design of purine based

STAT3 inhibitory molecules. Docking studies with lead STAT3-SH2 domain inhibitory

molecules identified key structural and chemical information required for the construction of a

pharmacophore model. 2,6,9-heterotrisubstituted purines adequately fulfilled the pharmacophore

model and a library of novel purine-based STAT3 inhibitory molecules was prepared utilizing

Mitsunobu chemistry. Several agents from this new library displayed high affinity for the STAT3

protein and effectively disrupted the STAT3:STAT3-DNA complex. Furthermore, these agents

displayed cancer-cell specific toxicity through a STAT3 dependant mechanism. While purine

agents elicited cellular effects, the dose required for cellular efficacy was much higher than those

observed for in vitro STAT3 dimer disruption. The diminished cellular activity could be

attributed to the apparent poor cell permeability of the first generation purine library; thus, a

second library of purine molecules was constructed to improve cell penetration. Unfortunately,

iii

2nd

generation purine inhibitors failed to disrupt phosphorylated STAT3 activity and suffered

from poor cell permeability. However, a lead sulfamate agent was discovered that showed potent

activity against multiple myeloma cancer cells. Investigations revealed potential kinase

inhibitory activity as the source of the sulfamate purine’s biological effect. Explorations into the

development of a potent STAT3 SH2 domain binder, including the creation of salicylic purine

and constrained pyrimidine molecules, are ongoing. Finally, progress towards the creation of a

macrocyclic purine combinatorial library has been pursued and is reported herein.

iv

Acknowledgments

First, I would like to thank Professor Patrick T. Gunning, this thesis would not have been

possible if it wasn’t for his support. My five-year long intellectual journey began with a single

question asked in a crowded third year organic chemistry class; thank you Patrick, for seeing

potential in that question. You have encouraged and fostered my creativity, and your scientific

artistry has been an inspiration and will be fundamental in my future. Thank you for everything.

To the Gunning Lab, it has been an incredible experience working alongside all of you. I doubt I

will ever find another amazing group of people to have as peers. Though it saddens me to leave, I

am comforted knowing that you all have successful lives in front of you. I will miss all of our

interactions: the jokes, the stories, the loving-insults, and the laughter (yes, even the ridiculous

laughter). To Professor Steven Fletcher, thank you for all of your guidance, you were absolutely

key for my success, especially within a chemistry lab. I couldn’t have asked for a better teacher.

To my brothers, Glenn, Sina and Dan, I truly don’t know how I would have made it through

these five years without your support. Glenn, you’ve kept me grounded and sane, you were

always there for me and I cannot thank you enough for all you’ve done for me. Dan and Sina, I

am incredibly lucky to have found two lifelong friends in such a small span of time. I look

forward to the inevitable adventures we will share together in the future.

To my big sister Mumta, you have been, and always will be, my greatest friend. Thank you for

always listening to my long winded stories, for providing me with just the right advice, and for

being my biggest defender and fan. You were able to pick me up at my lowest and I am thankful

for the experiences that have brought us closer together. You are a huge part of shaping me into

the person I am today and I owe a large portion of my success to you. Thanks Mumt!

Lastly, to my mom and dad – the love you have shown me is beyond words. I cannot thank you

enough for encouraging me to be the best that I could be and always doing everything in your

power to foster my curiousity and growth. You showed me how to respect, how to care, and how

to love, and you did it by displaying those same qualities in everything you did for me and

others. You are truly the greatest parents that a person could have. The person I am today is

simply a reflection of your loving guidance over the years. It is only fitting that this thesis, which

is ultimately the result of everything you’ve done for me, be dedicated to you.

v

Contributions of Authors

The work described within this dissertation has been reported in five peer-reviewed publications.

The introduction is an original composition, including the latter portions of Chapter 1.2, which

used a review paper authored by the Gunning lab as a main reference. Chapters 2, 3, and 4, are

based heavily on my own authored and published manuscripts. Chapters 5 describes ongoing,

collaborative work that will be the basis of future publications. The final chapter consists of my

own concluding thoughts and reflections.

Chapter 2: The molecular design described within this chapter was the collaborative work

between Professor Steven Fletcher, Professor Patrick Gunning and myself. I provided the

validation of the molecular dimensions and the proposed binding modes via computational

methods. The synthesis of the chemical library was performed primarily by myself. Diana Luu

synthesized an aryl precursor that was further functionalized to final peptidomimetic molecules.

Professor Steven Fletcher provided essential synthetic guidance for the completion of this

chemical library. Sumaiya Sharmeen and Dr. Mahadeo Sukhai of the Dr. Aaron Schimmer’s lab

provided key biological experiments. Sumaiya was generous enough to teach me the basics of

the MTS assay and allowed me to partake in cell counting and plating procedures. Dr. Mahadeo

Sukhai was aware of the 2fTGH cell line mutants and suggested its use in establishing STAT3

dependency, he also aided in the design and completion of the combination studies. Dr. Ahmed

Aman of the OICR is necessarily credited for performing the pharmacological Caco-2 cell study.

Lastly, the members of Turkson lab (Peibin Yue, Xiaolei Zhang, Wei Zhao) provided the EMSA

and CyQuant data.

Chapter 3: The synthetic methodology employed within this chapter relied heavily on the

Mitsunobu chemistry delineated in a publication authored by Professor Steven Fletcher and

myself. Prof. Fletcher and I established the modified procedures used for the assembly of the

purposed purine inhibitor library. Computational docking, pharmacophore development, and the

design of potential inhibitory molecules was conducted by myself. Sina Hafchenary and Dr. Julie

Lukkarila aided in the synthesis of purine inhibitors. Daniel Ball and Christina Nona provided

key characterization of several members of the purine library. Members of the Turkson lab,

Peibin Yue, Wei Zhao, and Xiaolei Zhang, provided the results of the SPR, EMSA, and

vi

Immunoblotting and CyQuant experiments. Dr. Ahmed Aman generously provided the

pharmacological Caco-2 cell study and liver microsome studies for lead agents.

Chapter 4: The design and synthetic methodologies presented within this chapter was developed

by myself. Daniel Ball is necessarily credited for synthesizing the vast majority of the sulfamates

purines. He also aided in producing the publication that described the 2nd

generation purine

results. Allan Ramos was a diligently working undergraduate student who completed the

synthesis of several final molecules. Sina Haftchenary provided significant synthetic advice and

helped produce commonly used precursor molecules. Dr. Aaron Schimmer and Dr. Paul

Spagnuolo helped coordinate and perform the initial MTS Assay. Dr. Rima Al-awar and Dr.

Ahmed of the OICR were responsible for investigating purine’s ADME profile. Dr. Zhihua Li of

Dr. Suzanne Trudel’s lab was critical in performing multiple myeloma assays, including the

MTT, Annexin and Phospho-flow experiments. Lastly, kinase and kinome screens are credited to

the companies Reaction Biology and DiscoverX, respectively.

Chapter 5: Discussions between myself and Sina Haftchenary led to the formulation of the

salicylic acid purine project. Sina was fundamental in getting the project established and will see

the project through to its completion. Next, I developed the concept of conformationally

constraining pyrimidines and Prof. Mark Nitz provided the key suggestion to explore the

relationship between flexibility and binding affinity. Finally, I would like to thank Prof. Gunning

for suggesting that the creation of macrocyclic purines may be an interesting synthetic avenue for

me to explore.

vii

Table of Contents

Acknowledgments .......................................................................................................................... iv

Contributions of Authors ................................................................................................................ v

Table of Contents .......................................................................................................................... vii

List of Tables ............................................................................................................................... xiii

List of Figures .............................................................................................................................. xiv

List of Schemes ........................................................................................................................... xvii

List of Abbreviations ................................................................................................................. xviii

1 Introduction ................................................................................................................................ 1

1.1 Cell Signaling and Human Disease ..................................................................................... 3

1.1.1 A Brief History of Signal Transduction and its Components ................................. 3

1.1.2 Oncogenes and Signal Transduction ..................................................................... 12

1.1.3 Selective Inhibitors of Oncogenic Kinases ........................................................... 13

1.2 The JAK/STAT Pathway .................................................................................................. 14

1.2.1 Janus Kinases are Critical in Myeloproliferative Diseases ................................... 15

1.2.2 Signal Transducers and Activators of Transcription Proteins are Cell

Regulating Transcription Factors .......................................................................... 17

1.2.3 STAT3 Structure and Domain Function ............................................................... 19

1.2.4 STAT3’s Critical Role in Pro-carcinogenic Inflammatory Responses and

Oncogenesis .......................................................................................................... 22

1.2.5 Validation of STAT3 as a Therapeutic Target ...................................................... 24

1.2.6 Molecular Attempts to Modulate STAT3 ............................................................. 25

1.2.7 Concluding Remarks ............................................................................................. 31

1.3 Central Aims for this Research ......................................................................................... 31

2 Rational Design of Biphenyl Peptidomimetic Inhibitors of Stat3 ........................................... 32

2.1 Introduction ....................................................................................................................... 32

viii

2.2 Results and Discussion ..................................................................................................... 33

2.2.1 Computational Assessment of Peptidomimetic .................................................... 33

2.2.2 Synthesis of Biphenyl Peptidomimetics ............................................................... 35

2.2.3 STAT3-STAT3:DNA Complex Disruption as Determined by EMSA ................ 38

2.2.4 Competitive FP Assay ........................................................................................... 40

2.2.5 Surface Plasmon Resonance Results .................................................................... 41

2.2.6 Caco-2 Influx and Efflux Analysis ....................................................................... 42

2.2.7 Intracellular STAT3 Inhibition and Cell Assay Results ....................................... 43

2.2.8 Evaluation of Adjuvant Therapy Potential ........................................................... 45

2.3 Conclusions ....................................................................................................................... 46

2.4 Experimental Methods ...................................................................................................... 47

3 Quantitative Structure Activity Relationship Methodology for the Producing of 2,6,9-

Heterotrisubstituted STAT3 inhibitors ..................................................................................... 48

3.1 Introduction ....................................................................................................................... 48

3.1.1 Pharmacophore Development and Inhibitor Design ............................................. 49


3.2.1 The Mitsunobu Reaction and its use in Synthesizing 2,6,9-Heterotrisubstituted

Purines ................................................................................................................... 51

3.2.2 Surface Plasmon Resonance and QSAR Discussion ............................................ 54

3.2.3 EMSA for Determining STAT3-STAT3:DNA Dimer Disruption in Cell

Nuclear Extracts .................................................................................................... 57

3.2.4 Immunoblotting Analysis ...................................................................................... 58

3.2.5 CyQuant Proliferation Assay ................................................................................ 60

3.2.6 ADME Profiling: Liver Mouse Microsomes and Caco-2 Cell Proliferation ........ 61

3.2.7 Competitive FP Assay and Fluorescence Excitation and Emmission

Characterization Of Purine Agents ....................................................................... 63

3.3 Conclusion ........................................................................................................................ 64


ix

4 Second Generation 2,6,9-Heterotrisubstituded Purines: An Effort to Increase Cellular

Potency Leads to the Discovery of Alternative Intracellular Targets ...................................... 65

4.1 Introduction ....................................................................................................................... 65

4.1.1 Inhibitor Design .................................................................................................... 65


4.2.1 Synthesis of 2nd Generation Purine Agents ......................................................... 67

4.2.2 ADME Profiling: Liver Mouse Microsomes and Caco-2 Cell Permeability

Assay ..................................................................................................................... 71

4.2.3 MTS and MTT Cytoxicity Assay ......................................................................... 74

4.2.4 Annexin Cell Results ............................................................................................ 75

4.2.5 Competitive FP Assay ........................................................................................... 76

4.2.6 Phospho-Flow Cytometry ..................................................................................... 77

4.2.7 Initial Kinase Panel Screen ................................................................................... 78

4.2.8 Kinome Screen ...................................................................................................... 79

4.3 Conclusion ........................................................................................................................ 81


5 Current Projects: Salicylic and Benzoic Purine Derivatives, Constrained Cyclic

Pyrimidines, and Macrocylic Purines ...................................................................................... 83

5.1 Chapter Introduction ......................................................................................................... 83

5.2 Salicylic Acid Trisubstituted Purines: an Exploration into Salicylics Acid’s Affinity

for STAT3’s SH2 domain’s Phosphotyrosine Binding Pocket Inhibitors ........................ 83

5.2.1 Introduction ........................................................................................................... 83

5.2.2 Proposed Synthesis ............................................................................................... 84

5.2.3 Potential Future Directions ................................................................................... 86

5.3 Constraining Lead 2nd

Generation Purine Agents ............................................................. 87

5.3.1 Introduction ........................................................................................................... 87

5.3.2 Proposed Retro-Synthesis and Synthetic Progress ............................................... 88

5.3.3 Potential Future Work ........................................................................................... 91

x

5.4 Macrocyclic Purines: Further Investigation into Mitsunobu Chemistry and Potential

Application in Combinatorial Chemistry .......................................................................... 91

5.4.1 Introduction ........................................................................................................... 91

5.4.2 Synthesis ............................................................................................................... 92

5.4.3 Future Directions .................................................................................................. 94

6 Concluding Remarks ................................................................................................................ 96

References ................................................................................................................................... 101

7 Appendix 1: Introduction to Computationally Aided Drug-Design ...................................... 130

7.1 An Introduction to Ligand Docking Through the Description of GOLD Docking

Software .......................................................................................................................... 131

8 Appendix 2: Experimental Methods For Peptidomimetics .................................................... 135

8.1 Computational Investigation into Peptidomimetics ........................................................ 135

8.2 Biophysical Evaluations of Peptidomimetics ................................................................. 135

8.2.1 Competitive FP Experiments .............................................................................. 135

8.2.2 Surface Plasmon Resonance Experiments .......................................................... 136

8.3 Biological Evaluation of Peptidomimetics ..................................................................... 136

8.3.1 Permeability and Efflux Analysis in Caco-2 models .......................................... 136

8.3.2 Cells and Reagents .............................................................................................. 136

8.3.3 Cloning and Protein Expression .......................................................................... 137

8.3.4 EMSA for Determining STAT3-STAT3:DNA Dimer Disruption in Cell

Nuclear Extracts .................................................................................................. 137

8.3.5 Cell Cytotoxicity Assay Using MTS dye, Associated Combination Studies,

and Cyquant Assay ............................................................................................. 138

8.4 General Synthetic Methods and Characterization of Molecules ..................................... 138

8.4.1 Chemical Methods for Peptidomimetics ............................................................. 138

8.4.2 General Procedures ............................................................................................. 139

8.4.3 Detailed Synthetic Procedures for Peptidomimetics ........................................... 142

9 Appendix 3: Experimental Methods For Purines ................................................................... 176

xi

9.1 Computational Probing of the SH2 domian for the Production of a Pharamcophore

Model and Establishment of a QSAR ............................................................................. 176

9.2 Biophysical Evaluations of 2,6,9-heterotrisubstituted STAT3 Inhibitors ...................... 177

9.2.1 Surface Plasmon Resonance Experiments .......................................................... 177

9.2.2 Competitive FP Assay ......................................................................................... 177

9.2.3 Fluorescence Excitation and Emmision Profile of Purine Inihibitors ................ 177

9.3 Biological Evaluation of 2,6,9-Heterotrisubstituted STAT3 Inhibitors .......................... 177

9.3.1 Cells and Reagents .............................................................................................. 177

9.3.2 Cloning and Protein Expression .......................................................................... 177

9.3.3 Nuclear Extract Preparation, EMSA and Densitometric Analysis ..................... 178

9.3.4 Immunoblotting Assay ........................................................................................ 178

9.3.5 CyQuant Proliferation Assay .............................................................................. 178

9.3.6 Liver Mouse Microsomes ................................................................................... 178

9.3.7 Permeability Assessed through Caco-2 Monolayers ......................................... 178


9.4.1 Chemical Methods for Purines ............................................................................ 179

9.4.2 General Procedures ............................................................................................. 179

9.4.3 Detailed Synthetic Procedures for Purines ......................................................... 181

10 Appendix 4: Experimental Methods For 2nd Generation Purines ......................................... 249

10.1 Biophysical Evaluations of 2,6,9-Heterotrisubstituted STAT3 Inhibitors ...................... 249

10.1.1 Competitive FP Experiments .............................................................................. 249

10.1.2 Phospho-Flow Cytometry ................................................................................... 250

10.1.3 Kinase Screen Initial ........................................................................................... 250

10.1.4 Kinome Screen .................................................................................................... 251

10.2 Biological Evaluation of 2,6,9-Heterotrisubstituted STAT3 Inhibitors .......................... 251

10.2.1 Liver Mouse Microsomes ................................................................................... 251

xii

10.2.2 Caco-2 Cell Permeability Determination ............................................................ 252

10.2.3 MTT and MTS Assay ......................................................................................... 252


10.3.1 Chemical Methods for Purines ............................................................................ 252

10.3.2 General Procedures for 2nd Generation Purines ................................................. 252

10.3.3 Detailed Synthetic Procedures for 2nd Generation Purines ................................ 256

xiii

List of Tables

Chapter 1

Table 1.1. A non-exhaustive list of extracellular signalling molecules and their biological effect. 5

Table 1.2. Activated STAT isoforms found in primary cancer cell lines ..................................... 19

Table 1.3. STAT3, RELA and REL target genes and their role in STAT3 activation ................. 23

Chapter 2

Table 2.1. IC50 inhibitory potencies of hybrid peptidomimetic family, 2.12aa-bf. ...................... 39

Chapter 3

Table 3.1. The structure and activities of the purine library as assessed by SPR and EMSA. ..... 55

Table 3.2. Caco-2 Permeability and Efflux Determination and Mouse Liver Microsome

(Metabolic) Stability. .................................................................................................................... 62

Chapter 4

Table 4.1. Summary and coding system for the 2nd

generation library of purine inhibitors of

STAT3. .......................................................................................................................................... 71

Table 4.2. ADME Profiling of 2nd

Generation Purine Inhibitors .................................................. 72

xiv

List of Figures

Chapter 1

Figure 1.1. Early cancer chemotherapeutics. .................................................................................. 2

Figure 1.2. The crystal structure of the β2-adrenergic receptor-Gs protein complex. β2-adrenergic

receptor (red) is complexed with G-protein subunits Gα (blue), Gβ (yellow) and Gγ (purple). ...... 6

Figure 1.3. (A) Symbolic representation of GPCR receptor prior to ligand binding (B) GPCR

after ligand binding (C) Representative example of enzyme-linked receptor using MAPK

signalling pathway. ......................................................................................................................... 8

Figure 1.4. Schematic representation of the predicted active site for protein kinase A. .............. 10

Figure 1.5. Schematic representation of the reaction mechanism of PTP1B. ............................... 11

Figure 1.6. A generic MAPK kinase signalling pathway and highlight specific incidences of

cross-talk between pathways ......................................................................................................... 13

Figure 1.7. The Computed 3D structure of the JAK1 kinase adapted to show its domains. ........ 16

Figure 1.8. Canonical JAK/STAT3 signalling pathway, displaying STAT3 activation and

deactivation. .................................................................................................................................. 18

Figure 1.9. Crystal structure of STAT3 with its domains highlighted and function of specific

protein regions. (pdb: 1BG1). ....................................................................................................... 20

Figure 1.10. (A) STAT3 homo-dimer in complex with DNA (B) The phosphorylated native

binding of one protein occupying the SH2 domain of another (pdb: 1BG1). ............................... 21

Figure 1.11. Two major avenues for STAT3 disruption: DNA-decoy oligonucleotides and SH2-

domain binders for PPI disruption. ............................................................................................... 25

Figure 1.12. Peptide and peptidomimetics based on native sequence pTyr-Leu-Lys-Thr-Lys .... 26

Figure 1.13. Peptide and peptidomimetics based on gp130 receptor STAT3 binding sequence .. 28

xv

Figure 1.14. Small molecule inhibitors of STAT3. ...................................................................... 30

Chapter 2

Figure 2.1. Parent peptides combinations for the production of hybrid peptidomimetics. ........... 33

Figure 2.2. (A) Proposed binding mode of 2.12aa versus that of peptide 1.13 (B) Comparison of

peptidomimetic regioisomers 2.12aa and 2.12ba ......................................................................... 34

Figure 2.3. (A) STAT3 vs STAT1 binding as assessed by FP for agent 2.12aa (B) Agent’s

2.12ba’s FP curves for STAT1 and STAT3. ................................................................................ 41

Figure 2.4. SPR binding analysis of peptidomimetics 2.12aa and 2.12ba for STAT3 protein

binding .......................................................................................................................................... 42

Figure 2.5. Intracellular disruption of phosphorylated STAT3 levels as measured by EMSA. ... 44

Figure 2.6. MTS assay measuring viability of 2fTGH and its mutants when treated with agent

2.12aa. ........................................................................................................................................... 45

Chapter 3

Figure 3.1. (A) Key residues and pocket identification (B) Assembly of docked SH2 domain

inhibitors accessing three subpockets (C) The pharmacophore dimensions and functional group

requirements (D) 2,6,9-heterotrisubstituted purine docked and fulfilling pharmacophore

requirements .................................................................................................................................. 50

Figure 3.2. Immunoblotting analysis for the effects of agents on intracellular STAT3, ErkMAPK,

Src, and STAT1 activation ............................................................................................................ 59

Figure 3.3. Lead purine agents suppress viability of malignant cells that harbour constitutively

activated STAT3. .......................................................................................................................... 61

Figure 3.4. (A) STAT3 FP calibration curve (B) Resentative results from purine agents subjected

to the FP assay. ............................................................................................................................. 64

xvi

Chapter 4

Figure 4.1. The lead carboxylate purine agents and their respective ClogP values. ..................... 66

Figure 4.2. Western blot and the differential cellular response observed in the MTT assay when

multiple myeloma cells are treated with 4.12e. ............................................................................ 75

Figure 4.3. Annexin assay output developed using Flowo software following 48 hour treatment

with 4.12e alongside positive control, mephalan. ......................................................................... 76

Figure 4.4. Representative purine agents performed poorly in a competitive FP assay. .............. 77

Figure 4.5. Phosphorylated STAT3 levels measured by phospho-flow cytometry. ..................... 78

Figure 4.6. Agent 4.12e’s inhibition of JAK family members kinase activity. ............................ 79

Figure 4.7. A complete kinome scan highlights insensitivity to treatment with 4.12e. ................ 80

Chapter 5

Figure 5.1. (A) Established STAT3 Inhibitory molecules featuring salicylates and benzoic acid.

(B) Proposed purine inhibitory moleulces. ................................................................................... 84

Figure 5.2. Proposed cyclizations of lead agent 4.12e .................................................................. 88

Figure 5.3. (A) Proposed anti-parallel and parallel macrocyclic purines (B) Front and side views

of macrocycles (C) Potential modifications for future macrocyclic purines. ............................... 92

xvii

List of Schemes

Chapter 2

Scheme 2.1. Proposed synthesis of 2.1 to 2.3 peptidomimetic precursors .................................. 35

Scheme 2.2. Synthesis of peptidomimetic precursors 2.1 to 2.5 .................................................. 37

Scheme 2.3. Synthesis of peptidomimetic precursors 2.6 to 2.8. ................................................. 37

Scheme 2.4. Synthesis of final molecules 2.12 starting from 2.5 and 2.8 to 2.12. ....................... 38

Chapter 3

Scheme 3.1. Complete synthesis of purine final molecules 3.11 .................................................. 53

Chapter 4

Scheme 4.1. Synthesis of precursor molecules prodrugs 4.5 ........................................................ 67

Scheme 4.2. Synthesis of sulfamate purines 4.12 ......................................................................... 68

Scheme 4.3. Synthesis of tetrazole purines 4.19 ........................................................................... 70

Chapter 5

Scheme 5.1. Proposed synthesis of salicylic purines 5.11 ............................................................ 85

Scheme 5.2. Proprosed synthesis of phosphotyrosyl control purines. .......................................... 86

Scheme 5.3. Retrosynthetic analysis of cyclic pyrimidines. ......................................................... 89

Scheme 5.4. Synthesis of cyclic pyrimidines 5.19 to 5.24. .......................................................... 90

Scheme 5.5. Synthesis of 5.28 to 5.30. ......................................................................................... 93

Scheme 5.6. Synthesis of 5.30. ..................................................................................................... 93

Scheme 5.7. Route currently being pursued for the production of parallel and anti-parallel purine

macrocycles. .................................................................................................................................. 94

xviii

List of Abbreviations

AcOH Acetic acid IFNR IFN receptor

ALL Acute lymphoblastic leukemia JAK Janus Kinase

AML Acute myeloid leukemia JH JAK homology domain

AMP Adenosine monophosphate LRMS Low-resolution mass spectrometry

ATP Adenosine triphosphate MAPK Mitogen activating protein kinase

BCR-ABL Philadelphia chromosome MPN Myeloproliferative neoplasm

BDPA Bis-dipicolylamine MS Mass spectrometry

BOC t-butoxycarbonyl protecting group MTS

3-(4.5-dimethylthiazol-2-yl)-5-(3-

carboxymethoxyphenyl)-2-(4-

sulfophenyl)-2H-tetrazolium

BPO Benzoyl peroxide MTT 3-(4,5-dimethylthiazol)-2,5-

diphenyl tetrazolium

CI Combination index NBS N-bromosuccinimide

CML Chronic myelogenous leukemia NF-κB Nuclear factor κB

CPB CREB-binding protein Papp Apparent permeability rate

coefficient

DCM Dichloromethane PDGF Platelet derived growth factor

DIPEA Diethyl isopropylamine PDGFR PDGF receptor

DMAP Dimethylaminopyridine PPI Protein-protein interaction

DMF Dimethylformamide pSTAT pSTAT

DMSO Dimethyl sulfoxide PTB Protein tyrosine binding (domain)

DNA Deoxyribonucleic acid PTP Protein tyrosine phosphatases

EGFRs Epidermal growth factor receptors pTyr Phosphotyrosine

EMSA Electrophoretic mobility shift assay PV Polycythemia vera

ERK extracellular signal-regulated kinase RAS Rat sarcoma

EtOAc Ethyl acetate RNA Ribonucleic acid

FAM 5-carboxyfluorescein SH2 Src Homology 2

FMOC Fluorenylmethyloxycarbonyl SHP-2 SH2 domain containing protein

tyrosine phosphatase

FP Fluorescence polarization SIE sis inducible element

gp130 Glycoprotein 130 (peptide) SOCS suppressor of cytokine signalling

GDP Guanosine diphosphate src Sarcoma gene

GTP Guanosine triphosphate STAT Signal transducer and activator of

transcription

HER2 Human epidermal growth factor

receptor TBAF Tetrabutylammonium fluoride

HBTU

O-Benzotriazole-N,N,N’,N’-

tetramethyl-uronium-hexafluoro-

phosphate

TFA Trifluoroacetic acid

HRMS High-resolution mass spectrometry THF Tetrahydrofuran

IR Infrared spectroscopy TLC Thin layer chromatography

IFN Interferon v- src viral sarcoma gene

1

1 Introduction

The first documented report of cancer was found in the Egyptian 'Ebers papyrus', a document

dating back to 1500 BC. This incredible document describes the identification of tumour masses

and subsequent attempts by early surgeons to excise them1. Nearly a thousand years later

Hippocrates, an ancient Greek physician hailed as the father of western-medicine, recognized

that the danger of “carcinos” (cancer) lay in its ability to spread - or metastasize - to other parts

of the body2. This understanding of the pathophysiology of cancer remained relatively

unchanged until the 19th

century whereby increases in life-expectancy led to more reports of

cancer. Observations in the mid-to-late 1800s linked certain work environments to higher

incidences of cancer, a representative example being the many, poor chimney sweepers that

succumbed to scrotal cancer because of the toxic soot that was deposited on their skin. These

observations were amongst the first to hint at the potential for chemical agents to promote cancer

formation, a fact that would prove critical to our understanding of cancer biology.

Experiments by Japanese scientists in 1915 were the first to scientifically link cancer with

chemical stimulants when they induced malignant epithelial tumours by administering coal tar on

the ears of rabbits3. The realization that non-natural chemical entities could also be used to treat

cancers would take another 30 years. In a twist of fate a chemical weapon used in the World

Wars was repurposed into one of the earliest cancer therapeutics. Researchers at Yale University

evaluated the biological effects of nitrogen-containing mustards in 1942, where it was quickly

discovered that the nitrogen containing bifunctional alkylating mustards regressed tumours in

diseased mice4. The efficacy of these compounds led to the first human trial in May of 1942

5,

where application of tris-(2-chloroethyl)amine (1.1) in a terminal ill patient led to a period of

remission (Figure 1.1). The therapeutic potential of nitrogen mustards were highlighted in a

landmark paper by Gilman and Philips6 in 1946, leading to the testing and characterization of

other chemotherapeutic mustard agents. The most successful of all of the mustards was

cyclophosphamide (1.2), conceived as a prodrug that was activated within the cancer cell

(studies later showed that its activation was actually accomplished through liver metabolism)7.

Employment of a prodrug strategy highlighted the desire to develop targeted therapeutics even at

this early stage of chemotherapeutic usage. While these drug molecules were revolutionary, their

mechanism of action was poorly understood and suffered from dose-limiting toxicities.

2

An empirical approach led to the development of the anti-metabolites for the treatment of cancer.

Sulfonamide inhibitors of dihydropteroate synthase, a critical enzyme in folate synthesis, were

amongst the first antibiotics8. A clinical researcher, Farber, observed acceleration of disease

progression in leukemia patients following injections with folic acid9. This led Farber and his

colleagues to hypothesize that sulfonamide drugs that were capable of disrupting normal folic

acid production would also possess anti-cancer activity in addition to their anti-bacterial effects.

Farber screened sulfonamide agents produced in drug development programs that were capable

of disrupting the biosynthesis of folic acid and its derivatives for anti-cancer effects. In 1948,

Farber identified aminopterin (1.3), which disrupted the formation of deoxyribonucleic acid

(DNA) precursor tetrahydrofolate, and was the first anti-metabolite successfully used for treating

acute lymphoblastic leukemia (ALL)10

. Researchers continued to develop novel tetrahydrofolate

anti-metabolites without truly understanding their underlying inhibitory mechanism of

suppressing DNA synthesis. In addition, purine and pyrimidine nucleotide analogues were

identified as another class of anti-metabolites, capable of producing potent anti-tumour affects.

Knowing that nucleic acids are a fundamental component of DNA, Elion and Hitchins11

rationalized that unnatural pyrimidine and purine analogues could disrupt DNA function and thus

lead to antineoplastic effects. In 1952, the Wellcome Group researchers reported successful

treatment of ALL with 6-mercaptopurine (1.4)12

. Since these early successes, hundreds of

modified purine and pyramidine agents have been described as both cancer and anti-viral

therapeutics even to present day. Key to the increased efficacy of pharmaceutical agents are the

many advancements made in the fields of molecular biology and cancer biology over the last few

decades.

Figure 1.1. Early cancer chemotherapeutics.

Common elements in the discovery of early cancer therapeutics was a reliance on observation,

perspicacity and serendipity. The cytotoxic mechanisms employed by early chemotherapeutics

3

were utilized by many subsequently developed anti-cancer agents, which eventually lead to a

plateau in the efficacy of cancer therapies4. Major scientific developments in cell biology from

the 1960s through to the 1990s facilitated the development of the targeted chemotherapeutic

approach13

. Of paramount importance for the establishment of targeted therapies was the

discovery that erroneous cell signalling pathways promote cancer development14

. Drugs that

target the molecular components of cancer-linked signalling pathways promise to be safer

alternatives to cytotoxic agents15

. In particular, the Janus kinases (JAK) and Signal transducers

and activators of transcription (STAT) signalling pathway has been associated with a wide range

of neoplasms, marking it as a prime candidate for the production of new cancer therapeutics 16, 17

.

1.1 Cell Signaling and Human Disease

Prototypic multi-cellular organisms faced challenges in maintaining adhesion between its

neighbouring cells and, perhaps even more importantly, coordinating cellular behaviour18

.

Examination of extant single celled protozoa suggested that previously evolved signalling

systems can respond to external environment and would have provided the basis for intercellular

and intracellular signalling in higher ordered organisms. As organisms evolved, advancements in

cell-to-cell communication were essential for controlled development and growth. As such, the

signalling pathways have filled the necessary regulatory role that is essential for the

development, growth and homeostasis of complex organisms19

. In humans and other animals,

misregulation of these signalling pathways leads to a variety of disease states including

metabolic diseases, autoimmune diseases, neurological disorders and cancer20, 21

.

1.1.1 A Brief History of Signal Transduction and its Components

Francis Crick formally stated the central dogma of molecular biology in 1958, formalizing that

genetic information flows from DNA to ribonucleic acid (RNA) to protein. This simplified

picture overlooked several important mechanisms, including the regulatory role proteins play in

the initiation of transcription. Examples of gene expression regulatory systems that are protein

mediated include DNA methylation, modulation of DNA histone code, and the up-regulation of

transcription factors through signal transduction22

. Though all forms of gene expression control

are vastly important, signal transduction has been hailed as a favourable therapeutic target.

Signal transduction describes the biological phenomenon of controlled cellular responses to

external messaging. Briefly, signal transduction begins when extracellular ligands bind to

4

transmembrane receptors resulting in major conformational changes extending to the

cytoplasmic receptor domains. Cytosolic conformational changes triggers cellular events

stimulated by cellular effectors, most commonly this entails the addition or removal of inorganic

phosphate to target proteins catalyzed by kinases and phosphatases, respectively. The signalling

cascade will eventually activate intended final messengers, usually transcription factors, resulting

in the expression of certain gene products. An introduction to select signal transduction pathways

will follow, including historical studies leading to their discovery and comments on their

therapeutic potential.

In 1894, the hormone adrenaline was identified by two independent research groups as being the

first extracellular signalling molecule23

. As a result, investigations uncovered a plethora of other

endogenous chemicals produced in the body which were capable of producing physiological

effects24, 25

. A short list of common extracellular signals and their biological effects are listed in

Table 1.1. The molecular structure of extracellular signals has been found to be highly varied

including amino acids (adrenaline), peptide sequences (insulin), steroids (estrogen), and lipids

(prostaglandins). While extracellular signals play a critical role in the progression of human

disease, designing artificial receptors to bind these molecules is an inefficient method to impede

their signalling given how ubiquitous they are in nature. Rather, a more effective strategy is the

utilization of therapeutics that target the biological components responsible for the release or

production of signalling molecules.

5

Table 1.1. A non-exhaustive list of extracellular signalling molecules and their biological effect.

Adapted from ref23

.

Messenger Origin Target Major Effects

Adrenaline Adrenal Medulla Heart, smooth muscle,

liver, muscle adipose

tissue

Increases pulse rate and blood pressure

contraction or dilation, glycogenolysis,

lipolysis

Insulin Pancreatic β cells Multiple tissues Glucose uptake into cells and

carbohydrate catabolism

Secretin Small intestine Pancrease Digestive enzyme secretion

Thyroid- stimulating

hormone

Anterior pituitary Thyroid Release of thyroid generated hormones

Epidermal growth

factor

Multiple cell types Epidermal and other cells Growth

Interleukins Multiple cell types

(including leukocytes)

Multiple tissues Immune function

Interferons Multiple cell types

(leukocytes, fibroblasts,

etc.)

Multiple tissues Immune function; particularly antiviral

and tumour-suppressing

Vascular endothelial

growth factor

Multiple cell type

(hypoxic cells)

Multiple tissues Vasculogenesis, angiogenesis,

lymphangiogenesis

Platelet-derived

growth factor

Multiple cell types

(platelets, smooth

muscle, etc.)

Multiple tissues Tissue remodeling , Angiogenesis

The exact molecular component responsible for recognizing hormones and triggering

physiological responses was elusive for many years. However, the concept of a necessary

cellular component (i.e. receptor) that recognizes ligands pre-dates the discovery of hormones. In

187826

, Langley reported on the mutual antagonism of the toxic compounds atropine and

pilocarpine in target tissues, he suggested that these poisons formed 'compounds' with substances

found on target tissues. In 1905, Langley formalized the role of a receptor as a receptive

substance that merges with stimulating molecules to transmit an effect27, 28

. From 1920 to 1970,

the classical receptor theory was developed based on the law of mass action and dose-response

data.

Chemically labelling ligands was a first step to proving the existence of receptors and

visualizating them in the membrane29

. Radiolabelling ligands aided in the elucidation of

receptor-ligand binding affinities in crude systems. Isolation of receptors into simplified systems

proved difficult given that receptors are transmembrane proteins, making their incorporation into

6

lipid systems non-trivial. The photosensitive protein receptor, rhodopsin, aided researchers in the

discovery of receptor structure. The 3D structure of bacterial rhodopsin was crudely mapped in

1975, and the seven trans-membrane helixes structure was adopted for receptor complexes due to

their sequence homology30, 31

. Confirmation of the accuracy of this model in mammals came

when bovine rhodopsin’s structure was first resolved by X-ray diffraction in 200032

.

Overshadowing this achievement was Kobilka's accomplishment in 201133

, which helped win

him a Nobel prize, when his group resolved a crystal structure of human β2-adrenergic receptor

bound to its agonist ligand and key regulatory proteins (Figure 1.2). The magnificent crystal

structure gave key insights into how ligand binding triggers the necessary conformational change

in receptors that lead to activation. However, long before these structures became available,

scientists explored how extracellular agonist binding could lead to intracellular signalling.

Figure 1.2. The crystal structure of the β2-adrenergic receptor-Gs protein complex 33

. β2-

adrenergic receptor (red) is complexed with G-protein subunits Gα (blue), Gβ (yellow) and Gγ

(purple).

It was not until 1957, and the discovery of the secondary messenger signal cyclic AMP (cAMP)

by Sutherland, however, that the mechanism by which receptor binding led to signal transduction

7

was elucidated34

. It was discovered that treatment with the hormone glucogon led to increased

levels of cAMP in certain cell types. It was postulated that adenylate cyclase was directly

activated by ligand-receptor complexes and could even be a part of the receptor complex itself.

However, in 1971, Rodbell and researchers dispelled the notion that adenylate cyclase was

directly linked with receptors when they made the critical discovery that guanosine triphosphate

(GTP) was a necessary component in activating adenylyl cyclase during their studies on the

effect of glucagon in hepatic tissues35

. Further experimentation in Gillman's group implicated

that an undiscovered intermediary protein was required to mediate the activation of adenylate

cyclase36

. This led to the discovery of the stimulatory and inhibitory G-proteins37, 38

.

Heterotrimeric G-proteins consist of three subunits, α, β, and γ, which bind guanosine

diphosphate (GDP) in its inactive form39

. Upon interaction with activated receptor, GTP

exchanges with GDP causing the dissociation of α subunit from the β-γ subunit of the g-protein.

It is the α subunit that then activates an effector enzyme to transmit the signal. GTPases cleave

the bound GTP into GDP, causing re-association of the ternary G protein and inactivation of the

pathway (Figure 1.3A and B). The discovery of the G proteins prompted the designation of these

receptor types as G protein-coupled receptors (GPCR). GPCRs and the mechanism by which

they transmit extracellular binding events led to the formalization of signal transduction, a highly

significant achievement leading to a Nobel Prize jointly awarded to Rodbell and Gillman. The

discovery of GPCRs has had an major impact on human health. Almost 30% of all marketed

drugs function through their interaction GPCRs40

. Historically known receptor targets include

muscarinic acetylcholine (Parkinson’s disease), the alpha and beta adrenergic (cardiac

discorders), dopaminergic (neurological disorders), histaminergic (allergies) and opioid

(depression) receptors 21

. GPCRs have a major role in regulating various physiological

responses, and may present a potential target for novel cancer therapeutics41

. The crosstalk

between GPCR and other transduction pathways42

could be a benefit or detriment to the success

of potential therapeutics.

8

Figure 1.3. (A) Symbolic representation of GPCR receptor prior to ligand binding (B) GPCR

after ligand binding (C) Representative example of enzyme-linked receptor using MAPK

signalling pathway43

.

GPCRs are not the only membrane receptors capable of transducing extracellular signals.

Enzyme-linked receptors were first identified in the study of cell growth signalling43-46

. Unlike

GPCR signal transduction that requires three distinct proteins, enzyme-linked receptors bind

extracellular ligands, modify their conformation, and activate cytosolic effectors, all at separate

domains of a single protein (Figure 1.3B). Several classes of these receptors exist, the most

common being the receptor tyrosine kinases47

. Receptor tyrosine kinases have single

transmembrane domains that form dimers or higher oligomers upon ligand binding. This results

in significant alterations in the structure of these proteins and initiates autophosphorylation or

enzyme-associated phosphorylation. The initial phosphorylation event triggers a cascade of

phosphorylation or dephosphorylation events that lead to the transduction of an extracellular

9

signal. Like GPCRs, enzyme-linked proteins have been associated with the progression of

cancers47, 48

. Though inhibition of these proteins, particularly the often implicated receptor

tyrosine kinases, may successfully inhibit cancer, their potential for propagating deleterious side

effects is large given its numerous downstream effectors49, 50

.

Though first believed to be an oddity of glycogen metabolism51

, the reversible phosphorylation

of enzymes and proteins would play a critical role in understanding how cell regulation occurs.

Additional examples of regulatory phosphorylation led to the formalization of phosphorylation

as a critical, dynamic process that had particular significance in signal transduction and cell

regulation52

. The most common signalling effector molecules are the kinases and phosphatases,

which add or remove phosphate groups from their protein targets, respectively. Protein kinases,

together with their co-substrate adenosine triphosphate (ATP), transfer a single inorganic

phosphate group from ATP's gamma phosphate to the hydroxyl group found on one of three

amino acids: serine, threonine and tyrosine53-55

. A divalent metal, usually Mg2+

, is a necessary

co-factor that facilitates the transfer reaction by stabilizing the transition state and/or reducing

electrostatic repulsion of the gamma phosphate towards the incoming substrate. Additionally,

there exists a conserved aspartate residue found in the catalytic site of all kinases that is essential

for enzyme function56-58

.

Though its proposed role as a general base is still debated, several resolved structures depict the

conserved aspartate anion acting as a hydrogen bond accepter to the hydroxyl group thereby pre-

organizing the substrate for nucleophilic attack on the gamma-phosphodiester linkage. A generic

figure outlying the key residues involved with phosphate transfer and ATP and substrate binding

is given in Figure 1.459, 60

. The core of the catalytic site for kinases are conserved due to a

common ancestor, with major structural differences occurring at the periphery of these sites to

confer substrate specificity. Their key regulatory roles in cells place the human kinases at the

center of many diseases61

. Analogous inhibitory agents of kinases often suffer from off-target

effects due to the inability of these compounds to discriminate against the similar active sites of

related kinases50, 62

.

10

Figure 1.4. Schematic representation of the predicted active site for protein kinase A. ATP is

highlighted in red, the nucleophilic serine residue is shown in blue, and Mg+2

and its chelating

residues are shown in green. (A) Shows the residue configuration prior to phosphate transfer (B)

The predicted product complex is shown (Mg+2

is removed from this image for clarity). Adapted

from ref 59, 60

.

Unlike the protein kinases, the protein phosphatases have evolved from separate families that are

structurally and mechanistically distinct63-66

. Among these families are the serine/threonine

phosphatases which exist in vivo as holoenzymes composed of variable combinations of catalytic

and regulatory subunits key for cellular regulation. Two families of serine/threonine exist which

are distinguished by sequence homology and catalytic ion dependence67

. The phosphoprotein

phosphatase (PPP) family are Zn/Fe-dependent enzymes while the protein phosphatase Mg2+

- or

Mn2+

-dependant (PPM) are Mn/Mg-dependent enzymes. In both families, the bi-nuclear metal

center stimulates reaction by metal mediated polarization of the H-O bond in water leading to its

increased nucleophilicity and resulting in the hydrolysis of the phosphate monoester. Another

major phosphatase family is comprised of protein tyrosine phosphatases (PTP)68

. Common to all

PTPs is the metal-independent dephosphorylation initiated by the formation of a phospho-

cysteine intermediate that is subsequently hydrolyzed by a localized water molecule. The active

site of these phosphatases possess the shared sequence motif, HCXXGXXR(S/T), which

contains the reactive cysteine residue69

. Active site residues involved in the catalytic function of

protein tyrosine phosphate 1B are outlined in Figure 1.5. Though implicated in several diseases,

the literature has yet to describe inhibitory molecules that target phosphatases. All agents

proposed thus far have lacked isoform selectivity and require better physico-chemical properties

to successfully enter the clinics70, 71

.

11

Figure 1.5. Schematic representation of the reaction mechanism of PTP1B. (A) Formation of the

cysteinyl-phosphate intermediate. Nucleophilic cysteine shown in blue, phosphorylated tyrosine

in red, and key aspartate resisdue shown in green. (B) The hydrolysis of the cysteinyl-phosphate

intermediate. Nucleophilic water is coloured orange. Adapted from ref63

.

In signal transduction pathways kinases and phophatases often tune the activation levels of

transcription factors. Transcription factors account for 10% of all the genes in the human

genome72-74

. All transcription factors possess DNA binding domains which they use to bind

promoter or enhancer regions and initiate gene expression. Depending on their cellular role,

transcription factors can be constitutively or conditionally active, with the majority of

transcription factors falling into the latter category. The localization of transcription factors in the

cytoplasm following their translation provides a convenient mechanism to regulate their

transcriptional potential. Transcription factors require nuclear localization signals that are often

obscured until being activated by ligand binding or phosphorylation. In other cases,

phosphorylation is required for the proper binding of co-activators and other proteins involved in

the transcriptional machinery. Transcription factors are the last messengers before gene

expression in signal transduction pathways. Their lack of characterized binding sites have led to

12

the transcription factors being dubbed as “undruggable” biological targets75, 76

. However,

transcription factors present an attractive therapeutic target as their inhibition potentiates fewer

off-target effects due to their localization at the end of signal transduction72

.

In summary, signal transduction begins with extracellular ligand binding to the appropriate

receptor. The binding event triggers a major conformational change in the receptor that may

result in oligermization, depending on the receptor type. The induced conformational change

facilitates receptor interaction with the cytosolic components of the signalling pathway, for

example, the G proteins or receptor-associated kinases. Ultimately, conformational changes in

the receptor lead to the activation of downstream effector enzymes typically mediated by

phosphoryation and dephosphorylation events which result in changes in gene and protein

expression. Transcription factors are critically dependent on their activation by kinases and

phophatases to complete the signalling cascade. Ultimately, signal transduction pathways play a

vital role in cellular control and thus deregulation of these cascades is intimately tied to human

health and disease.

1.1.2 Oncogenes and Signal Transduction

Signalling pathways are one of the most elaborate systems in the animal kingdom, with nearly

20% of our genome dedicated to genes linked to signal transduction47

. Given the complicated

and interconnected nature of signalling systems, errors often lead to disease initiation. Key to

uncovering the extent that genes play in the formation of cancer was the retrovirus, rous sarcoma

virus, which induced sarcomas - a cancer of the connective tissue - in healthy chickens77

. In

1970, genetic investigations of the virus led to the discovery of the first oncogene, termed src

(short for sarcoma), which was believed to be a uniquely viral gene78

. Further exploration

debunked this belief, when the discovery of a gene homologous to the viral-src (v-src) gene was

found in the host organism’s genome79

. Recognition that the genes causing cancer were found in

the host genome linked human gene mutations to cancer. Further evidence that genetic changes

can result in human cancer was the discovery of Philadelphia chromosome by Nowell and

Hungerford80

.

It is believed that most, if not all, proto-oncogenes (genes that have the potential of becoming

oncogenes either through mutation or increased levels of expression), are involved in the

signalling cascades, particularly in responses to growth factors and cell division. In fact, it is

13

common for oncogenes to cluster around certain signalling pathways81

. For example, in the

classical mitogen activating protein kinase (MAPK)/extracellular signal-regulated kinase (ERK)

pathway, there are numerous mutations found throughout the signalling pathway including the

up-stream receptor tyrosine kinases and downstream cytoplasmic components (Figure 1.6)82

. As

of 2004, 291 oncogenes have been reported, more than 1% of the human genome, with the

majority of these genes coding for protein kinases83

. Thus, inhibitors capable of modulating the

action of mutant protein kinases were hailed as the future of cancer chemotherapeutics.

Figure 1.6. A generic MAPK kinase signalling pathway and highlight specific incidences of

cross-talk between pathways. Adapted from ref 84

.

1.1.3 Selective Inhibitors of Oncogenic Kinases

A major success in the field of cancer therapeutics was rationally designed protein tyrosine

kinase inhibitor imantinib (glivec) for the treatment of chronic myelogenous leukemia (CML)85-

87. CML is a disease caused by a reciprocal translocation between chromosomes 9 and 22

14

resulting in the fusion protein BCR-ABL. The mutation resulting in the fusion protein was found

to be sufficient for transformation of healthy cells, with BCR-ABL’s unregulated kinase activity

crucial for carcinogenesis. Given its key role in CML, researchers began the search for potent

inhibitory molecules. Starting from a lead compound that bound Protein Kinase C, rationalized

and systematic modifications led to the creation of STI571 (later named imatinib and then

redubbed as glivec or gleevac). Even following optimization, imatinib, like many kinase

inhibitors, bound several kinases including BCR-ABL, c-KIT, ARG, and platelet-derived growth

factor (PDGF) receptor85

. However, promising in vivo data led to imatinib’s use in the clinics,

where its success in treating CML resulted in one of the quickest FDA approvals. Unfortunately,

secondary resistance to imatinib has emerged often attributed to mutation of the BCR-ABL

active site88, 89

. Furthermore, imatinib and other multi-target kinsases, have been reported as

causing cardiotoxicity90

. Though the success of imatinib has provided merit to targeted

approaches, targeting oncogenic tyrosine kinases still has to pass substantial hurdles, which may

or may not be surmountable, before it can be deemed an entirely safe therapeutic avenue.

1.2 The JAK/STAT Pathway

A significant portion of this Chapter has been published in the article listed below91

.

Unpublished information is also included:

Fletcher, S.F.S., Drewry, J.A., Shahani, V.M., Page, B.D.G. & Gunning, P.T. Molecular

disruption of oncogenic signal transducer and activator of transcription 3 (STAT3) protein.

Biochemistry and Cell Biology 87, 825-833 (2009).

The JAK/STAT pathway constitutes the major signalling cascade downstream of cytokine,

chemokine, and growth factor receptor activation92-96

. The pathway consists of the JAK non-

receptor tyrosine kinases and the STAT family of transcription factors. JAK/STAT signalling is

critical for cellular developmental regulation, growth control, and homeostasis with particular

importance in supporting immune function and hematological control. Aberrant JAK/STAT

signalling has been implicated in many human diseases, including cancer, because of its

significance in cellular regulatory systems and will be discussed in detail below.

15

1.2.1 Janus Kinases are Critical in Myeloproliferative Diseases

The Janus kinases, discovered in 1989, were abbreviated to JAK for “Just Another Kinase”93

.

JAKs are also named after the Roman God Janus, the two faced God, for they possess two kinase

“faces” or kinase domains. The JAK family consists of four kinases: JAK1, JAK2, JAK3 and

TYK2. All members contain 7 distinct domains, the JAK Homology domains 1-7 (JH1-7). JH1

denotes the active tyrosine kinase site. The JH2 domain has been labelled the pseudokinase

domain, which has limited catalytic activity and serves as a regulator for JAK’s JH-1 site

activity. JH3-JH4 are similar in structure to SRC-homology 2 (SH2) domains, but are incapable

of binding phosphotyrosine (pTyr) sequences and their roles are still poorly understood. The last

portion of the protein JH5-JH7, located at the amino-terminal portion of the molecule contains

the FERM motif, responsible for JAK-receptor binding as well as maintaining receptor

expression at the cell surface (Figure 1.7). JAKs are associated with the cytosolic portion of

cytokine and hematopoietic growth factor receptors that lack intrinsic tyrosine kinase activity

like the interferon receptor (IFNR), epidermal growth factor receptors (EGFRs), human

epidermal growth factor receptor (HER2), and platelet-derived growth factor receptors

(PDGFRs). Receptors are activated upon extra-cellular ligand binding either through ligand-

induced dimerization of the receptor or a conformational change, resulting in

transphosphorylation of the receptor by the JAK kinases. These receptors or kinases are now

capable of phosphorylating the downstream targets of JAK primarily the STAT proteins.

However, crosstalk activation of MAPK pathway through Ras(Rat sarcoma)-dependant

mechanisms and phosphatidylinositol-3-kinase (PI3K) is also documented with receptor

activation. In association with the STAT proteins, JAK has been implicated in having an

important role in the control of myeloid cell development, proliferation and survival, as well as

in immune responses.

16

Figure 1.7. The Computed 3D97

structure of the JAK1 kinase adapted to show its domains.

While all isoforms have been investigated for their therapeutic potential, the JAK2 isoform has

had the largest impact on human health. JAK2 has been associatied with myeloproliferative

neoplasms (MPN), including polycythemia vera (PV), essential thrombocythemia (ET), and

primary myelofibrosis (PMF). These myeloprofilferative diseases are clinically characterized by

symptoms like splenomegaly, leukocytosis, and thrombocytosis. Additionally, patients with

MPNs are reported as having increased risk of developing acute myeloid leukemia (AML). The

JAK2 V617F mutation, discovered in 2005, was identified in patients with PV (90-97%), ET

(60%) and PMF (50%), with detection also occurring in rare cases of chronic myelomonocytic

leukemia, atypical chronic myelogenous leukemia, myelodysplastic syndrome and AML98

.

V617F mutation produces a constitutively activated JAK2 independent of the cytokine signalling

normally needed for activation. Studies suggest that the V617F mutation, located in the JH2

domain, hyperstabilizes the active conformation of the JAK2 JH1 catalytic site and destabilizes

the catalytic regulatory JH2 site99

. In addition, constitutively activated forms of JAK2 are not

de-activated by their primary regulatory proteins, suppressor of cytokine signalling (SOCS) and

the SH2 domain-containing protein tyrosine phosphatase (SHP-2). Normally, SOCS inhibits JAK

activity through direct binding to JAK protein, binding to the receptor, or competing with STAT

for receptor binding sites. SHP-2 proteins are capable of dephosphorylating the active receptor,

JAK or STAT proteins themselves. Restoring regulation of mutant JAK2 proteins by inhibitory

molecules were postulated to be a possible treatment for MPNs.

17

To date, only one drug targeting JAK2 has been FDA approved for the treatment of

myelofibrosis (ruxolitinib)100

. Inhibitors that target JAK2’s JH1 catalytic domain

indiscriminately binds both wild-type and mutant kinase which leads to harmful anemia,

thombocytopenia, gastrointestinal disturbances and hyperacute relapse of symptoms when

treatment is discontinued101

. Another significant concern is the inability of JAK2 inhibitors to

engender histological, cytogentic, or molecular remissions in treated patients; thus, identified

JAK2 inhibitors only address symptoms and not the disease state102, 103

. Given these concerns, it

is uncertain that JAK2 inhibitors in their current state improves upon traditional treatments for

MPNs.

No other JAK isoform has been successfully targeted leading to an approved drug treatment.

Major drawbacks to the development of JAK inhibitors is the significant side effects linked to

targeting upstream kinases. Also, the shared homology of the kinase active site makes the design

of selective inhibitors inherently difficult resulting in therapeutic agents that bind off-target

kinases leading to additional side effects. Lastly, attempting to inhibit JAK to silence

downstream targets, like the STAT proteins, is complicated due to redundancies in signalling

whereby proteins can be phosphorylated by other kinases, common examples of these kinases

include SRC, ABL, and EGFR kinases104

.

1.2.2 Signal Transducers and Activators of Transcription Proteins are Cell Regulating Transcription Factors

Where the therapeutic focus for JAK inihibitors has been on treating myeloproliferative disease,

its associated signalling pathway partners, the STAT transcription factors, have been implicated

in a wide range of cancer types105-109

. In the canonical description of the JAK/STAT pathway,

receptor phosphorylation by JAK kinases result in two STAT monomers binding the receptors

via their SH2 domains110

. STAT monomers are subsequently phosphorylated on a critical

tyrosine residue in their SH2 domains. Phosphorylation triggers ejection of the monomers and

their subsequent dimerization through a reciprocal pTyr/SH2 domain interaction, forming a

symmetrical dimer. Phosphorylated STAT dimers translocate to the nucleus where they bind to

specific DNA promoter sequences and thus regulate gene transcription (Figure 1.8).

18

Figure 1.8. Canonical JAK/STAT3 signalling pathway, displaying STAT3 activation and

deactivation.

Seven isoforms of STAT have been identified, (STAT1, STAT2, STAT3, STAT4, STAT5A,

STAT5B, STAT6), each playing a distinct regulatory role in healthy cells111

. STAT1 has been

linked to anti-viral and anti-bacterial responses and plays an active role in growth inhibition,

apoptosis, and tumour suppression. STAT2 plays a key role in anti-viral activity and helps

propagate type I IFN signalling. In opposition of STAT1’s function as an inhibitor of growth,

STAT3 is involved in cell mitogenesis, survival, inflammatory responses and anti-apoptosis.

STAT3 is also the only STAT required for early development (embryonic lethality observed in

gene knockouts). Both STAT4 and STAT6 are important for immunology responses by

facilitating helper T cell development, particularly T helper 1 and T helper 2 cells, respectively.

Lastly, STAT5A and STAT5B are involved in the regulation of mammary tissue and are critical

for proper lactation control and growth hormone signalling.

Under normal circumstances, STAT protein activation is a temporary event with inactivation

occurring after a few minutes to several hours. In numerous studies, there has been substantial

evidence of constitutively activated STAT1, STAT3, STAT5 and more recently STAT6, in a

19

large number of cancer types (Table 1.2). As previously mentioned, STAT1 serves as a tumour

suppressor, suggesting that its over-activation is not responsible for the observed

tumourogenesis. Both STAT3 and STAT5 have been shown to actively participate in

oncogenesis with mounting evidence establishing them as prime targets for novel cancer

therapeutics109

.

Table 1.2. Activated STAT isoforms found in primary cancer cell lines. Adapted from 112

Cancer Type Activated STAT

Blood Tumours

Multiple myeloma STAT1, STAT3

Leukemias

Acute lympocytic leukemia STAT1, STAT5

Acute myelogenous leukemia STAT1, STAT3

Chronic myelogenous leukemia STAT5

Lymphomas

Cutaneous T-cell lymphoma STAT3

Hodkin’s disease STAT3

Solid Tumours

Breast cancer STAT1, STAT3

Ovarian carcinoma STAT3

Melanoma STAT3

Lung cancer STAT3

Prostate carcinoma STAT3

Pancreatic adeoncarcinoma STAT3

1.2.3 STAT3 Structure and Domain Function

STAT3 shares the overall structure of other STAT isoforms as implicated by the nearly

overlapping crystal structures of STAT1 and STAT3 that share 78% homology113

. The STATs

consist of the following domains: N-terminal domain consisting of a 4-helix-bundle coil-coil

domain, an eight-stranded beta-barrel domain that contains the DNA binding domain, a small

helical domain consisting of a two helix-loop-helix module dubbed the connector domain, an

SH2 domain (three stranded anti-parallel beta-pleated sheet flanked by two alpha helices), and a

trans-activation domain that is flexible in nature and was un-resolved in the crystal structure

(Figure 1.9). Four major isoforms of STAT3 exist including the full-length isoform STAT3α and

the alternatively spliced or truncated isoforms STAT3β, STAT3γ, and STAT3δ114

. There exists

functional redundancy within these isoforms with any observed differences in their activity

falling within STAT3’s established role as a key regulator in immune responses.

20

Figure 1.9. Crystal structure of STAT3 with its domains highlighted and function of specific

protein regions. The N-terminal domain and TAD domain are truncated on this crystal structure

(pdb: 1BG1)113

.

Critical to STAT3s promotion of DNA transcription is its localization into the nucleus. STAT

proteins lack conventional nuclear localization domains; thus, nuclear transport of STAT3 is still

under investigation115

. Evidence suggests that STAT3’s N-terminal domain plays a critical role

in its nuclear transport via transporter complexes116

. Contrary to the canonical STAT3 pathway

description, studies suggest that unphosphorylated monomers and dimers are capable of

traversing the nuclear membrane independent of phosphorylation (unphosphorylated STAT3

dimers are distinct from conventional phosphorylated dimers and are aptly named anti-parallel

dimers whose formation relies on N-terminal interactions similar to previously reported STAT1

dimers). Unlike the unphosphorylated species, transport of active, phosphorylated STAT3 dimer

is fully dependent on having intact N-terminus residues for its accumulation in the nucleus. The

presence of phosphorylated dimers in the nucleus is of greater biological significance compared

to the readily transported, anti-parallel, unphosphorylated STAT3 dimers that weakly bind DNA

promoters and have limited potential for causing gene expression117, 118

. Evidence that active

phosphorylated STAT3 depends on its N-terminal domain for nuclear transport has elicited

interest for designing new inhibitory molecules119

.

The DNA binding portion of STAT3 consists of residues from the beta-barrel and the connector

region. Each monomer possesses three loops from the beta-barrel domain and a forth loop

21

derived from both the beta-barrel and connector domains that recognize specific bases in the

major groove of DNA as well as bind the sugar-phosphate DNA backbone. The resulting

dimer:DNA complex resembles a symmetric STAT3 dimer straddling the DNA molecule (Figure

1.10A). STAT3 monomers are capable of binding to their promoter sequences at a much lower

affinity as compared to fully active phosphorylated dimers. The major STAT3 promoter

sequences include the sis-inducible element (SIE) of the c-fos promoter or the g-activated site

(GAS) element120

. The observed specificity of STAT3 protein for these DNA promoter

sequences present an opportunity for creating STAT3 specific binders121

.

Figure 1.10. (A) STAT3 homo-dimer (monomers coloured gold and blue for clarity) in complex

with DNA (B) The phosphorylated native binding of one protein occupying the SH2 domain of

another (pdb: 1BG1)122

.

STAT3 possesses a SH2-domain that is critical for its activation. Recognition of specific pTyr-

containing peptide sequences by STAT3’s SH2-domain adheres to the structural and functional

properties of other known SH2-domains91, 123

. For potent peptide binding, the SH2 domain

possesses a conserved cationic hydrophilic pocket consisting of lysine, arginine and serine

residues. Hydrophobic residues make up the shallow grooves that compromise the relatively

large surface area of the SH2-domain. The SH2-domains of related proteins, including other

STAT isoforms, bind distinct pTyr peptides due to the differences in the structural morphology

of this region. The SH2-domain contains a tyrosine residue (Tyr705) that is phosphorylated upon

receptor binding and is critical for active dimer formation. Linking the critical tyrosine residue to

the rest of the proteins are residues 689 and 701 consisting mainly of hydrophobic residues

believed to be flexible and suitably sized for occupying the SH2 domain of another STAT

monomer, but insufficient for accommodating its own domain. The STAT3 SH2 domain

mediates its interaction with receptor peptide sequences and within STAT homo- and hetero-

22

dimers. Active, phosphorylated STAT3 dimers rely on a reciprocal SH2-domain pTyr

interaction, whereby the Tyr705 of one monomer occupies the cationic region of another SH2

domain (Figure 1.10B). The SH2 domain serves as protein-protein interaction (PPI) hot-spot for

STAT3, many potential STAT3 inhibitory molecules are engineered to bind within this protein

domain 124, 125

.

Lastly, the transactivation domain of STAT3 serves as a binding interface for transcriptional co-

activators. The structure of this particular region is highly flexible because of its highly acidic

and Pro-rich composition. The first coactivator of STAT3 identified was the CREB-binding

Protein (CPB)/p300, shown to interact with STAT3’s transactivation domain126

. Another major

coactivator of STAT3 function with confirmed affinity for the STAT3 transactivation domain is

steroid receptor coactivator 1, NcoA/SRC1a127

. Together these enzymes can initiate the

transcription of STAT3s target genes, including genes that promote cancer progression.

Furthermore, a serine residue (Ser727) is found within the transactivation domain. The exact

biological role of serine phosphorylation is still unclear, with studies suggesting a regulatory role

for this residue128-130

. Evidence has established that serine phosphorlyation is insufficient to

completely activate the STAT3 dimer complex. Due to poor resolution in the crystal structures

and given that the exact role of serine phosphorylation has yet to be described, designer drugs

that bind to the transactivation domain have not been revealed in the literature, though inhibition

through this site may be feasible.

1.2.4 STAT3’s Critical Role in Pro-carcinogenic Inflammatory Responses and Oncogenesis

Bromberg et. al. conclusively established Stat3 as an oncogene in their 1999 paper, which

utilized a constitutively activated STAT3 construct to generate tumours in mice107

. Since then,

STAT3 has been linked to several cancer hallmarks including: uncontrolled proliferation,

apoptotic resistance, maintenance of angiogenesis and evasion of immune response131, 132

. These

cancerous attributes can be linked to STAT3’s critical involvement in inflammatory responses

and its promotion of oncogenes. Inflammatory conditions are known to initiate and promote

transformation, with many malignant cells generating an inflammatory microenvironment that

further supports tumour progression. Convincing evidence that inflammation stimulates cancer

development is observed in chronic inflammatory diseases, like chronic hepatitis, chronic

23

gastritis, Crohn’s colitis and ulcerative colitis, all of which lead to dramatic incidences of organ

specific cancers133

. Interconnected with STAT3 is nuclear factor κB (NF-κB) signalling, a major

pathway responsible for inflammation-induced carcinogenesis, which is also highly upregulated

in cancer. An important NF-κB protein is RELA that, together with STAT3, has been linked to

maintaining a pro-carcinogenic inflammatory microenvironment at both the onset and

progression of the disease134

. NF-κB signalling is also mediated by family member REL, which

promotes anti-tumour effects in cancer microenvironments. Thus, while NF-κB signalling has

dual function by causing both pro-carcinogenic inflammation (RELA) and anti-tumour responses

(REL), STAT3 solely promotes cancer and impedes anti-cancer immune responses (Table 1.3).

Furthermore, RELA up-regulates factors that promote the expression of STAT3 and in turn,

STAT3 maintains the continued nuclear presence of tumourogenic RELA while antagonizing the

potential anti-tumour effects of REL.

Table 1.3. STAT3, RELA and REL target genes and their role in STAT3 activation. Adapted

from 131, 135, 136

.

Gene Regulated by

RELA

Regulated

by REL

Up-regulated by

STAT3

Downregulated

by STAT3

STAT3

Activators

BCL-XL ✓ ✓

MYC ✓ ✓

BIRC5 (surviving) ✓ ✓

TWIST1 ✓ ✓

HSP70 and HSP90 ✓ ✓

IL-10 ✓

MCL1 ✓

FGF2* ✓ ✓ ✓

COX2* ✓ ✓ ✓

VEGF* ✓ ✓ ✓

IL-23* ✓ ✓ ✓

IL-6* ✓ ✓ ✓ ✓

IL-12A ✓ ✓

IFNγ ✓ ✓

IFNβ ✓ ✓

IL-8 ✓ ✓ ✓

*STAT3 and RELA activate genes which in turn, further activate STAT3 expression, resulting in a positive- feedforward loop that further

activates STAT3 in tumour microenvironments.

24

Additionally STAT3 promotes the expression of cytokines, growth factors, and angiogenic

factors and their associated receptors, leading to a feedfoward loop that further reinforces the

STAT3 expression. Along with promoting factors that enhance its own expression, STAT3 also

induces the expression of known oncogenes that result in tumour cell evasion of apoptosis,

insensitivity to cancer therapeutics and cellular proliferation. STAT3 upregulated oncogenes are

found in Table 1.3. Lastly, STAT3 is a direct transcription activator of vascular endothelial

growth factor, a key signalling factor in angiogenesis, leading to the establishment of the

vasculature necessary for tumour progression137

. Thus, STAT3 weakens the natural anti-tumour

response in immune cells, enhances the pro-carcinogenic inflammatory microenvironment, and

ensures the survival of tumours by providing them apoptotic escape, proliferative properties and

essential vasculature.

1.2.5 Validation of STAT3 as a Therapeutic Target

Genetic studies implicated that ablation of STAT3 activity can lead to reversal of cancer. The

gene bearing the non-transcriptionally active dominant-negative form of STAT3, STAT3β, was

electro-injected into tumours possessing constitutively activated STAT3138

. Expression of

STAT3β disrupted constitutively activated STAT3 and resulted in growth inhibition and tumour

regression. Treatment of cancers not bearing constitutively activated STAT3 were unresponsive

to treatment with STAT3β. Likewise, healthy cells were insensitive to treatment with STAT3β,

which was further supported by Stat3 ablation studies in healthy tissues that showed undisturbed

survival and proliferation139

. Investigations explored ablation of the Stat3 gene in mice tumour

cells under chronic inflammatory conditions and subsequently demonstrated inhibition of

tumourogenesis and growth impairment in established tumours. Additionally, mice that were

provided with immune cells deficient in the Stat3 gene had increased anti-tumour immunity.

Unfortunately, prolonged Stat3 ablation in these cells led to the onset of autoimmunity.

Furthermore, evidence that prolonged disruption of STAT3 in humans can be harmful is found in

patients with hyper-IgE syndrome, where a gene mutation leading to a dominant-negative form

of STAT3 was found in many patients140

. However, these negative responses came after

prolonged periods of STAT3 disruption, establishing the existence of a therapeutic window that

would safely allow interference of the protein. Inhibitory molecules of STAT3 are limited by

their half life, allowing for intermittent activity of the protein. Modulation of STAT3 that allows

limited activity of the protein could be beneficial as it will still garner therapeutic effects in

25

sensitive tumour cells without causing deleterious side effects in healthy ones. Thus, potent

inhibitory molecules of STAT3 can be of significant worth in the clinic.

1.2.6 Molecular Attempts to Modulate STAT3

Thus far, there have been two main avenues for disrupting STAT3. Main approaches include the

disruption of STAT3’s protein-protein-DNA121

interface or the interruption of the protein-protein

interaction mediated by the reciprocal pTyr-SH2 domain interaction141, 142

(Figure 1.11). A

recent study suggests that disruption of the N-terminal domain is a potential avenue for inhibiting

STAT3, however, successes using this approach have been limited119

. Research groups have

used decoy-DNA oligonucleotides and small interfering RNA to bind STAT3 and prevent its

cellular function. This approach has led to potent anti-tumour effects, and has resulted in the first

phase 0 clinical trial of a therapeutic agent that targets STAT3, a transcription factor143

. The

success of this approach supported the notion that transcription factors are not in fact

“undruggable” targets, and that modulators of transcription factors are viable therapeutic options.

Of particular interest to this thesis are the early successes in the molecular interruption of the

STAT3-STAT3 active dimer complex via direct disruption of the reciprocal pTyr-SH2 domain

PPI.

Figure 1.11. Two major avenues for STAT3 disruption: DNA-decoy oligonucleotides and SH2-

domain binders for PPI disruption.

26

1.2.6.1 Latent STAT3 Binding Sequence Derived Peptide and Peptidomimetic Inhibitors

The first report of the molecular inhibition of STAT3 was provided by Jove et al. in 2001144

. The

authors showed disruption of the STAT3-STAT3:DNA ternary complex using a truncated

phosphorylated peptide, Pro-pTyr-Leu-Lys-Thr-Lys (1.5), which corresponded to residues 704-

709 from the STAT3 SH2-domain native binding sequence (Figure 1.12). An electrophoretic

mobility shift assay (EMSA) was utilized to establish the efficacy of the phospho-peptide in

disrupting the Protein:DNA complex, which calculated an IC50 of 235 μM; an unphosphorylated

analogue of the peptide sequence proved ineffective in disrupting the complex at concentrations

greater than 1 mM, indicative of the critical role pTyr play in mediating SH2 domain interaction.

Briefly, EMSA assays utilize a radiolabeled DNA oligomer (based on the SIE promoter region)

possessesing high STAT3 affinity to visualize STAT3-STAT3:DNA complex. Normal mouse

fibroblast (NIH3T3) cells were transformed by v-src leading to constitutively activated STAT3

levels and were then subjected to nuclear extraction. Nuclear extracts were treated with

radiolabelled probe, incubated with inhibitory molecules and separated by gel electrophoresis.

Disruption of the ternary complex liberates the radio-nucleotide from the complex, resulting in a

change in molecular weight that is readily recognized by band shifting. Further studies using

alanine scanning mutagenesis identified pTyr-Leu as being critical for disruption, with

tripeptides Pro-pTyr-Leu (1.6) and Ala-pTyr-Leu (1.7) displaying slightly improved IC50’s of

182 and 217 μM, respectively (Figure 1.12). However, peptide inhibitors proved to be poor

cellular agents due to their low membrane permeability and metabolic susceptibility.

Figure 1.12. Peptide and peptidomimetics based on native sequence pTyr-Leu-Lys-Thr-Lys.

27

Peptidomimetic agents aimed to overcome these failings by introducing unnatural components to

escape degradation and aid cell penetration. Beginning from the pTyr-Leu dipeptide, the N-

terminal residue Pro was replaced by a series of aryl groups, including a 4-cyanobenzoyl moiety

that resulted in lead compound ISS610 (1.8). ISS610 disrupted STAT3 dimers with an activity

IC50 value of 42 ± 23 μM, as evaluated by EMSA, and discriminated between the STAT

isoforms (STAT1 IC50 = 310 ± 145 μM c.f. STAT5 IC50 = 285 μM) (Figure 12)145

. The agent

was also capable of suppressing cancer cell growth while having no effect on healthy cells.

Gunning et al. reported modification of the 4-cyanobenzoyl lead peptidomimetic at the C-

terminus with a collection of functional groups. These modifications failed to produce improved

STAT3 inhibitor agents, but some agents possessed selectivity for disrupting the STAT1:STAT1

homodimer, with top agent (1.9) inhibiting the dimer with IC50 concentrations of 31 ± 22 μM

(Figure 1.12)146

. Further modifications of the native sequence were detailed by Wang and co-

workers who synthesized a cyclic peptidomimetic analogue of the native peptide by replacing the

native lysine residues, pTyr + 2, and pTyr + 4, with the appropriate alkyl azide and alkyl alkyne

needed to accomplish click-chemistry mediated cyclization (1.10)147

. The cyclic peptide mimic

harboured enhanced binding potency as assessed by a competitive fluorescence polarization (FP)

assay (Ki = 7.3 μM). Peptidomimetic agents still possessed sub-optimal activities in whole cell

studies requiring 1 mM concentrations for observed activity (Figure 1.12).

1.2.6.2 Peptide Sequence and Subsequent Peptidomimetics Derived from the IL-6 Receptor gp130

McMurray and coworkers identified their lead peptide after surveying a collection of known

receptor-derived protein sequences that bind STAT3’s SH2 domain. The peptide sequence, Ac-

pTyr-Leu-Pro-Gln-Lys-Thr-Val-NH2 (1.11) originating from glycoprotein 130 (gp130), a known

receptor for the IL-6 cytokine, showed a substantially improved IC50 of 150 nM in the EMSA

assay148

(Figure 1.13). Truncation experiments and alanine scanning mutagenesis identified the

leucine residue at pTyr + 1 to moderately aid binding, the proline at pTyr + 2 garnered increased

potency, while the glutamine at pTyr + 3 was critical for the witnessed potency. Also, not

surprisingly, removal of the phosphoryl group abolished the activity of the protein. As was the

case for the native STAT3 binding peptide, the gp130 sequence identified by McMurray’s group

failed to elicit a cellular response, which prompted the systematic modification of the lead

peptide. A modification that was unrelated to increasing cellular potency was performed by Berg

28

when he appended a 5-carboxyfluorescein (FAM) to the N-terminal of the gp130 peptide

sequence (1.12)149

. Berg recognized the potential in the binding potency of the gp130 sequence,

and utilized this fluorescent peptide probe as the basis of a competitive FP assay. Displacement

of the fluorescent probe from the STAT3 SH2 domain provided a qualitative and quantitative

measure needed for the establishment of rapid high-throughput screening of potential STAT3

inhibitory molecules and the determination of binding parameters. In this way, the gp130

sequence has greatly aided in the discovery of STAT3 inhibitory molecules.

Figure 1.13. Peptide and peptidomimetics based on gp130 receptor STAT3 binding sequence.

To develop increasingly “drug-like” peptidomimetic inhibitors, McMurray and colleagues

modified the amino acids comprising their peptide. In agreement with Turkson’s study,

modification of the N-terminus adjacent to the pTyr with small hydrophobic moieties was a

favourable modification. Furthermore, replacement of the C-terminal residues, Thr-Val, with an

assortment of lipophillic groups was well tolerated, including benzyl replacement 1.13,

suggesting the presence of an additional hydrophobic sub-pocket. Both the leucine residue at

pTyr + 1 and the glutamine at pTyr + 3 were retained as the ideal residues at the given

locations150

. The culmination of these investigations was the peptidomimetic PhCH2CH2CO-

pTyr-Leu-(cis-3,4-methanoPro)-Gln-NHBn (1.14)151

, exhibiting an IC50 of 125 nM as

determined by FP assay. A subsequent study produced pCinn-Haic(5S)-Gln-NHBn (1.15)151

,

which possessed less peptidic character and maintained binding affinity (IC50 = 162 nM) (pCinn

29

= 4-Phosphoryloxycinnamate; Haic = 5-[(S)-amino]-1,2,4,5,6,7- hexahydroazepino[3,2,1-

hi]indole-4-one-2-(S)-carboxylate).

Concurrently, McMurray and associates set out to determine the stereochemistry of the Leu-Pro

peptide bond, as proline is capable of adopting both cis and trans isomers. NMR spectroscopy of

cis-constraining pseudoproline anologues ascertained that trans is the likely conformation when

phosphopeptides bind the STAT3-SH2 domain (1.16)152

. In each of the aforementioned studies,

cellular activity was left unreported, leading to the supposition that poor cell permeability,

attributed to the anionic phosphate group, diminished cellular activity. A follow up paper

confirmed the permeability issue of these peptides and addressed them via a prodrug strategy. In

place of cleavable pTyr, McMurray and co-workers employed a non-hydrolizable

phosphonodifluoromethyl group to mimic the pTyr, and disguised its polarity using

pivaloyloxymethyl (POM) groups to vastly increase the overall hydrophobicity of their molecule

(1.17)153

. These compounds successfully permeated the membrane and were shown to

successfully knock-down phosphorylated STAT3 expression. McMurray’s group has continued

to explore the potential of their gp130 peptidomimetic molecules, but have yet to publish potent

cellular activity.

1.2.6.3 Small Molecule Inhibitors of STAT3

Researchers have employed several methods to produce potent, non-peptidic STAT3 inhibitory

molecules, including the use of high throughput in silico and in vitro screening and de novo drug

design to identify new hits. These methodologies have identified several potential therapeutic

molecules. Of particular relevance was the rational design of an inhibitory molecule possessing

an oxazole-core, S31-M2001 (1.18)124

, designed by Gunning et al. that exploited the

functionality possessed by previously mentioned lead peptidomimetic ISS610 (Figure 14). The

heterotrisubstituted oxazole suppressed STAT3 dimerization activity (IC50 = 79 μM (EMSA))

and was selective for the STAT3 isoform. The oxazole showed promising activity in mice

xenograft models and cellular in vitro data, prompting additional derivatization by Gunning et

al.123

An array of hydrophobic appendages and substituted cores were explored with two notable

iterations resulting in improved activity, namely a thiazole bearing naphthyl and n-hexyl groups

(1.19) and an oxazole possessing phenyl and p-cyclohexylphenyl moieties (1.20) (Figure 14). It

was rationalized that additional hydrophibic interaction conferred the observed increased

30

potency, with lead agent 1.20 producing whole cell inhibition of MDA-MB-231 cell at improved

concentrations (EC50 =180 μM).

Figure 1.14. Small molecule inhibitors of STAT3.

Utilization of an in silico screen followed by in vitro validation led to the identification of hit

compound S3I-201 (1.21)154

. A structure based screen of the NCI chemical library using docking

software GLIDE (Grid-based Ligand Docking from Energentics) fitted the salicylic acid of S3I-

201 to the known cationic pTyr binding pocket of the SH2 domain. EMSA analysis supported

S3I-201 as a hit compound with disruption of the STAT3-STAT3:DNA complex at IC50

concentrations of 86 μM with promising selectivity for the STAT3 iso-form. Fletcher et al.

elected to develop an SAR for the S3I-201 core scaffold through the introduction of diverse

functionality off the amide nitrogen155

. Also, Fletcher and co-workers reasoned that the tosylate

group’s inherent electrophilicity could pose challenges in developing an accurate SAR and thus

replaced the oxygen with a nitrogen atom rendering the group chemically stable. This study

produced lead compound SF-1-66 (1.22), which possessed a cyclohexylbenzyl group projecting

from the amide nitrogen similar to the aforementioned lead oxazole agent 1.20. 1.22 was

determined by EMSA to have an IC50 of 35 μM and produced potent cell inhibition (<36 μM) in

prostate (DU-145), breast (MDA-MB-468), and leukemia (OCI-AML-2) cancer cell lines.

31

Genetic Optimization for Ligand Docking (GOLD) docking studies consistently ranked a SH2

domain three-subpocket binding mode for 1.22 as its optimum binding conformation. Gunning

and coworkers have continued the functionalization of 1.22 with great success156

.

1.2.7 Concluding Remarks

The significance of the JAK/STAT pathway in human health is easily recognized by the growing

numbers of publications on the subject. While direct JAK enzyme targeting has merit in the

treatment of MPNs, it is a poor choice for modulating the phosphorylation levels of its

downstream proteins, particularly STAT3. Direct mediation of STAT3 activity through potent

binding molecules is increasingly supported as an effective means to combat oncogenic

progression. Given the complex nature of PPIs, the molecular requirements for the development

of selective and effective STAT3 agents are still being explored. The work summarized herein

has provided insight into the necessary requirements for STAT3 binding and may aid in the

eventual design of clinically relevant STAT3 inhibitory agents.

1.3 Central Aims for this Research

Transcription factors are a critical component of signal transduction. As such, their roles in the

onset and progression of disease make them highly desirable molecular targets for novel

therapeutics. However, transcription factors lack traditional targetable domains, like the

enzymatic active sites of kinases, making the design of specific binding agents particularly

challenging and prompting these proteins to be deemed “undruggable”. Given its significance as

an oncogenic transcription factor driving cancer formation and proliferation, STAT3 inhibition

has been pursued by several research groups attempting to surmount the challenges of targeting

the un-targetable. This body of research builds upon the work set forth by Jove, Darnell,

Turkson, McMurray, and Berg, to produce a highly selective STAT3 SH2 domain inhibitors that

disrupt a key PPI. Specifically, following computationally aided rational design, we synthesized

several series of inhibitory molecules that probed the functional requirements of STAT3 SH2

domain binders. The results from these investigations have aided in substantiating STAT3 as a

relevant and druggable target for cancer treatment.

32

2 Rational Design of Biphenyl Peptidomimetic Inhibitors of Stat3

Portions of the material in this Chapter has been published in the article listed below141

.

Segments below were not published in the referenced manuscript. The work performed by each

of the authors are noted in the Contributions of Authors section.

Shahani, V. M., Yue, P., Fletcher, S., Sharmeen, S., Sukhai, M. A., Luu, D. P., Zhang, X.,

Sun, H.; Zhao, W., Schimmer, A. D., Turkson, J., & Gunning, P. T. 2011 “Design,

synthesis and in vitro characterization of novel hybrid peptidomimetic inhibitors of

STAT3 protein.” Bioorganic and Medicinal Chemistry, vol. 19, no. 5, pp.1823-1838.

2.1 Introduction

STAT3’s significance in driving carcinogenesis in a wide range of cancer types makes it a prime

target for molecular disruption. The overall goal of this project was to produce peptidomimetic

molecules that possessed key structural components from previously identified peptide-based

STAT3 inhibitory molecules. Proposed peptidomimetics also featured novel modifications that

were incorporated to engender intracellular activity. Furthermore, a peptidomimetic inhibitor

would overcome the poor cell penetration of peptide-based agents and resist activity-limiting

protease degredation. In addition, phosphorylated peptidomimetics could better evade

dephosphorylation by native phosphatases, thereby preventing the loss of their biological

efficacy as observed in their phosphopeptide counterparts. Crucial to the design of our

peptidomimetic was the work of Turkson et al. and McMurray et al. who independently

identified two STAT3 binding peptides described in detail in Chapter 1.2.6.1. Briefly, Turkson

and associates focused on the cognate binding sequence of STAT3, Pro-pTyr-Leu-Lys-Thr-Lys.

This work led to the identification of STAT3 isoform specific peptidomimetic inhibitor ISS-610

(1.8)144

. McMurray and co-workers designed a lead peptidomimetic (1.13) based on the

truncated STAT SH2 domain binding sequence, Ac-pTyr-Leu-Pro-Gln-Lys-Thr-Val-NHBn,

derived from the gp130 interleukin receptor148

. While, McMurray’s high affinity peptidomimetic

STAT3 binder and Turkson’s ISS-610 showed promising in vitro activity against STAT3, they

both lacked the cellular activity needed to advance molecules further. We rationalized that a

hybrid peptidomimetic incorporating key structural facets from both these parent

peptidomimetics would furnish an improved STAT3 inhibitor (Figure 2.1). The N-terminal

33

portion of 1.8 was fused with the C-terminus of McMurray’s peptidomimetic via a functionalized

biphenyl linker. The biphenyl confers increased drug-likeness and delivers derivatization

potential while mimicking the proline and glutamine residues in the pTyr + 2 and pTyr + 3

positions of agent 1.13. Peptidomimetics were evaluated using a computationally driven critique

of the biphenyl binding mode, several in vitro STAT3 binding assays, and comprehensive testing

to confirm that STAT3 disruption generated the observed cellular effects. Inhibitory agents will

also be assessed for their potential use in adjuvant therapies given STAT3’s significance in

apoptotic evasion.

Figure 2.1. Parent peptides combinations for the production of hybrid peptidomimetics.

2.2 Results and Discussion

2.2.1 Computational Assessment of Peptidomimetic

Our proposed peptidomimetic features a biphenyl moiety that replaces both pTyr + 2 Pro and

pTyr + 3 Gln residues of McMurray’s lead peptide. McMurray and associates established that

pTyr + 2 Pro maintains a trans conformation when bound to STAT3 and demonstrated that the

carboxamide hydrogens of the glutamine are crucial for maximum binding150, 152

. We

34

hypothesized that the biphenyl appendage would adopt a twist conformation that approximated

the trans conformation of the Leu-Pro peptide bond and project functionality in the same region

as pTyr + 3 Gln. Further, we reasoned that a biphenyl moiety would reduce the entropic cost of

binding by limiting structural freedom via rigidification of the peptidomimetic’s core. To assess

our peptidomimetics ability to replicate 1.13’s binding conformation we utilized computational

analysis. Firstly, the dimensions of a representative peptidomimetic 2.12aa and 1.13 were

measured and compared utilizing ArgusLab and PyMol157

visualization software. Distances were

measured between the functional groups of both agents and were found to be promisingly

similar. Further analysis utilized GOLD158

ligand docking of peptidomimetics 2.12aa and 2.12ba

to the STAT3 SH2 domain. Top solutions of 2.12aa showed accurate replication of the binding

motifs in the structural components it shared with 1.13 (Figure 2.2A). Our structural

investigation centered on the diversification of the biphenyl moiety, which featured regioisomers

on both the upper (para = 4’, meta = 3’) and the lower (para = 2, meta = 3) rings of the biphenyl

system. The benzylcarbamoyl group present on the lower phenyl ring was predicted to bind in an

alternative fashion when placed in the 2 (2.12aa) and 3 (2.12ba) positions (Figure 2.2B), though

the majority of the peptidomimetic appeared to bind similarly. Alteration of both the position and

functionality present on the upper ring resulted in poorer GOLD docking scores and increased

the variability in predicted ligand-protein interactions. Thus, computational analysis predicted

2.12aa to most closely replicate the binding mode of 1.13159

, with the remaining

peptidomimetics adopting altered and potentially weaker binding conformations.

Figure 2.2. (A) Proposed binding mode of 2.12aa versus that of peptide 1.13 (B) Comparison of

peptidomimetic regioisomers 2.12aa and 2.12ba

35

2.2.2 Synthesis of Biphenyl Peptidomimetics

Our proposed peptidomimetics centered on the functionalizing of a core bromophenyl ring using

Suzuki coupling procedures and classical peptide coupling. Synthesis of peptidomimetic agents

was initiated by the modification of two substituted, aromatic rings to produce regioisomers

possessing amino, benzylcarbamoyl, and bromo substituents. Original synthetic plans called for

chain lengthening in the N-terminal direction using traditional peptide coupling procedures.

Attempts to couple N-fluorenylmethyloxycarbonyl (FMOC) leucine using standard peptide

coupling regeants O-benzotriazole-N,N,N’,N’-tetramethyluroniumhexafluorophosphate (HBTU),

1-ethyl-3-(3-dimetylaminopropyl)carbodiimide, and 1,1’-carbonyldiimidazole failed to effect the

desired transformation. Seemingly, the nucleophilicity of the aniline was dampened by the pair

of electron withdrawing groups present on the aromatic ring. Oxalyl chloride mediated

transformation of FMOC leucine’s free carboxy acid to the acyl chloride aimed to overcome the

aniline’s weak nucleophilicity by increasing the electrophilicity of its reactive partner. Though

initial results seemed promising, poor yields and overlapping retention times in column

chromatography purification led to the abandonment of this synthetic route (Scheme 2.1).

Scheme 2.1. (a) KMnO4, Pyridine:H2O (1:2), 90 °C, 54 %; (b) NBS, Sulfuric acid, 60 °C, 4 h,

81%; (c) (i) Benzylamine, HBTU, DIPEA, DMF, 25 °C, 4 h, 74 %; (ii) SnCl2, EtOAc, 70 °C, 2

h, 95 %; (d) (i) Oxalyl chloride, N-FMOC leucine, DCM, cat. DMF, 25 °C, 30 min, 92 %; (ii)

2.3a, DIPEA, DCM, 25 °C, 15 min, 13 %.

36

A proposed convergent synthesis improved yield efficiency and overcame the aforementioned

synthetic challenges (outlined in Scheme 2.2). Starting from the C-terminal portion, two

distinctive routes were used to prepare lower aromatic ring regioisomers. Preparation of a single

regiosomer was initiated by the oxidation of starting material 4-nitro-2-bromotoluene using

potassium permanganate (2.1a), which was subsequently coupled to benzyl amine using peptide

coupling reagent HBTU in dimethylformamide (DMF) (2.2a). The convenient chemoselective

reduction of 2.2a was facilitated by tin chloride (SnCl2) refluxed in ethyl acetate (EtOAc) to

produce 2.3a. The alternative regioisomer required treatment of highly deactivated 3-

nitrobenzoic acid with N-bromosuccinimide (NBS) in sulfuric acid160

to accomplish meta-

selective bromination (2.1b). A subsequent peptide coupling with the brominated product using

HBTU gave benzylcarbamoyl 2.2b. SnCl2 mediated reduction of the nitro group was achieved in

good yield to afford the aniline 2.3b. The troublesome coupling of N-FMOC protected leucine to

aniline was overcome by switching protecting groups for an acid-labile, N-t-butoxycarbonyl (N-

BOC) protected leucine. Pre-activation of the amino acid’s carboxy group to a mixed anhydride

was accomplished using isobutyl-chloroformate in dichloromethane(DCM):tetrahydrofuran

(THF) (1:1) and n-methylmorpholine (NMM), a non-nucelophilic base. The anhydride proved to

be an acceptable electrophilic partner to both aniline regioisomers, readily forming peptide

linkages under basic conditions; both isomers, 2.4a-b, were easily isolatable by column

chromatography. The coupled aromatic unit was liberated from its BOC protecting group using 4

M HCl in dioxanes mixed with an equivalent volume of methanol to form 2.5a-b.

37

Scheme 2.2. (a) KMnO4, Pyridine:H2O (1:2), 90 °C, 54 %; (b) NBS, Sulfuric acid, 60 °C, 4h,

81%; (c) Benzylamine, HBTU, DIPEA, DMF, 25 °C, 4 h, 74 %; (d) SnCl2, EtOAc, 70 °C, 2 h,

95 %; (e)(i) N-Boc-Leu-OH, isobutyl chloroformate, DCM, NMM, 25 °C, 10 min; (ii) (6a, 6b)

NMM, DCM/THF (1:1), 25 °C, 1.5 h, 89 – 96 %; (f) 2 M HCl, dioxane/methanol (1:1), 25 °C, 1

h, 99 %.

Assembly of the N-terminal module began with esterification of tyrosine’s caroxylic acid with

benzyl alcohol under acid-catalyzed conditions (2.6) (Scheme 2.2). 4-cyanobenzoic acid was

converted to a mixed anhydride using isobutylchloroformate and was then chemo-selectively

coupled to tyrosine’s free amino group under mildly basic conditions, producing 2.7. Catalytic

hydrogenolysis cleanly afforded subunit 2.8 for coupling with both regioisomers.

Scheme 2.3. (a) benzyl alcohol, p-TsOH·H2O, 110 °C, 24 h; 95 %; (b) (i) p-cyanobenzoic acid,

isobutyl chloroformate, NMM, 25 °C, 15 min; (ii) 8, NMM, DCM/THF (1:1), 25 °C, 30 min,

84%; (c) H2, Pd/C, THF/Methanol (1:1) 25 °C, 1 h, 95 %.

38

C-terminal amine 2.5a-b and the N-terminal acid 2.8 were linked using traditional peptide

coupling agent HBTU in good yields 2.9a-b (Scheme 2.3). With the peptidomimetic chain

completed, derivitization using Suzuki transmetallation couplings could now be accomplished.

Meta and para functionalized aryl boronic acids were treated with 2.9a-b, K2CO3 and catalytic

tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4) under an inert nitrogen atmosphere in

DMF. Initially, reaction mixtures were heated to 100 °C in oil baths and left for 16 hours. Access

to a Biotage Microwave Reactor greatly accelerated reaction times whereby increased heating161

drove reactions to completion within 17 minutes (2.10aa-bf). A surprisingly simple modification

of crushing K2CO3 prior to reaction using pestle and mortar led to moderate increases in yield (5-

10%) attributed to increased surface area of the basic salt in the heterogeneous reaction mixture.

Finally, phosphorylation of the tyrosyl phenol was accomplished using bis(dimethylamino)-

phosphoramidic chloride (2.11aa-bf), which, following purification, was hydrolyzed to the free

phosphate ester in a trifluoroacetic acid(TFA)/water(H2O) solution overnight in near quantitative

yields (2.12aa-bf).

Scheme 2.4.(a) HBTU, DIPEA, DMF, 25 °C, 4 h, 76 %; (b) ArB(OH)2, Pd(PPh3)4, K2CO3,

DMF, 170 °C, 17 min, 35-55 %; (c) bis(dimethylamino)phosphoramidic chloride, DMAP, DBU,

THF/CH2Cl2 (1:1) 25 °C, 16 h, 62 %; (d) TFA/H2O (9:1), 25 °C, 16 h, 99 %.

2.2.3 STAT3-STAT3:DNA Complex Disruption as Determined by EMSA

Synthesized peptidomimetics were examined for inhibitor-mediated disruption of STAT3-

STAT3:DNA complexation in nuclear extracts collected from NIH3T3/v-SRC162

transfected

cells that harboured constitutively active STAT3 protein. Nuclear extracts were treated with

inhibitory molecules at increasing concentrations and incubated with STAT3-specific

39

radiolabelled high affinity SIE oligonucleotide. An EMSA, quantified using densitometry,

determined the extent of inhibition (Table 2.1, Column 5). Notably, agent 2.12ba showed

significant disruption (IC50 = 5 ± 1 µM), with the other agents in the family possessing

significantly lower inhibitory levels. Given its similarity to the gp130-derived peptide, it was

surprising that compound 2.12aa lacked potency, with median inhibitory concentrations greater

that 50µm.

Table 2.1. IC50 inhibitory potencies of hybrid peptidomimetic family, 2.12aa-bf.

Inhibitor R Group R Group

Position

Benzylcarbamoyl

Position

EMSA (µM) FP (µM)

2.12aa Amide 4’ 2 73.1 ± 6 5 ± 1

2.12ab Cyano 4’ 2 33 ± 2 11 ± 4

2.12ac Ester 4’ 2 >200 26 ± 5

2.12ad Amide 3’ 2 62 ± 2 15 ± 2

2.12ae Cyano 3’ 2 64 ± 6 13 ± 1

2.12af Ester 3’ 2 40 ± 2 10 ± 2

2.12ba Amide 4’ 3 5 ± 1 9 ± 2

2.12bb Cyano 4’ 3 60 ± 2 36 ± 8

2.12bc Ester 4’ 3 112 ± 12 25 ± 6

2.12bd Amide 3’ 3 188 ± 48 38 ± 16

2.12be Cyano 3’ 3 92 ± 10 18 ± 3

2.12bf Ester 3’ 3 66 ± 1 23 ± 2

SH2 domain-binding peptides have been reliant on possessing the essential pTyr moiety to make

key contacts with the cationic sub-pocket of the SH2 domain. Two agents, 2.12aa-OH and

2.12ba-OH, possessing an unphosphorylated tyrosine residue, were prepared as likely

intracellular metabolites to determine whether hybrid peptidomimetics were reliant on the

presense of a pTyr group. EMSA analysis of these two species led to an interesting result.

40

2.12aa-OH and 2.12ba-OH still retained inhibitory activity, with a STAT3 dimer disrupting IC50

value of 103 ± 11 µM and 190 ± 8 µM, respectively. Of relevance, a report by Dourlat et al.

showed that the STAT3-binding sequence, RNRpYRRQYRY, possessed equipotency with its

non-phosphorylated analogue163

. However, their non-phosphorylated peptide was conjugated to

the cell-penetrating Antennapedia sequence from the Drosophile Antennapedia homeodomain164

.

The authors suggest that inhibition may result from additional contacts made by the antennapedia

sequence or that the fusion peptide could be binding sites other than the SH2 domain dimer

interface. The latter case seems a likely possibility for 2.12aa-OH and 2.12ba-OH.

2.2.4 Competitive FP Assay

Next, we investigated the binding of inhibitory molecules to the STAT3-SH2 domain using the

FP assay as described by Berg and Schust (Table 2.1, Column 6)149

. A FAM labelled gp130

phosphopeptide is bound to the STAT3-SH2 and is treated with increasing concentrations of

inhibitor. Diminished polarized fluorescence signal would correlate with the liberated fluorescent

probe’s rapid tumbling in solution. IC50 values were determined by generating dose-dependent

curves by plotting FP signal against inhibitory concentration. A modification of the Cheung-

Prusoff165

equation conveniently converts IC50’s to binding constants (Ki). FP screening

highlighted 2.12aa and 2.12ba as the most potent inhibitors (2.12aa: Ki = 5 µM; 2.12ba: Ki = 9

µM) (Figure 2.3 A and B). Both lead peptidomimetics possessed biphenyl’s appended with para-

carboxamides, lending credence to docking studies that suggested that these agents adequately

mimicked the Pro-Gln dipeptide of 1.13. A consistent trend in the FP results was the reduction of

binding potency for the 3-benzylcarbamoyl derivatives when compared to the corresponding 2-

isomer. This may be attributed to increased steric hindreance of the 2-benzylcarbamoyl isomer

leading to a greater aryl-aryl twist. It was postulated that the 2-benzycarbamoyl isomers were

energetically predisposed to project upper ring functionality perpendicular to the lower ring and

rendered them superior mimics of the trans Leu-Pro peptide bond and thereby elicited

moderately higher potency. Finally, non-phosphorylated analogues 2.12aa-OH and 2.12ba-OH

were subjected to an FP assay. At their highest concentrations (200 µM), agents failed to

displace the fluorescent probe, indicating that these agents occupied protein regions other than

the SH2 domain.

41

Figure 2.3. (A) STAT3 vs STAT1 binding as assessed by FP for agent 2.12aa (B) Agent’s

2.12ba’s FP curves for STAT1 and STAT3.

To assess STAT isoform selectivity, top agents 2.12aa and 2.12ba were evaluated in a series of

analogous FP experiments against STAT1 and STAT5. Both agents possessed roughly

equipotent activity against STAT1 and STAT3, with IC50 values of 6.3 µM and 16.5 µM for

2.12aa and 2.12ba, respectively (Figure 2.3 A and B). The STAT1 isoform shares much

structural homology with STAT3 (78 % sequence homology), though they possess opposing

cellular roles. Inhibitors 2.12aa and 2.12ba were found to have no effect against the structurally

distinct STAT5 isoform (53 % sequence homology). In general, lower inhibitory activity was

observed in the EMSA assay as compared to FP. Given the presence of other protein

transcription factors in nuclear extracts, including STAT1, diminished activity in EMSA could

be attributed to binding off-target STAT proteins.

2.2.5 Surface Plasmon Resonance Results

To complement data obtained from the FP and EMSA experiments, a Surface Plasmon

Resonance (SPR) binding assay was conducted on lead inhibitors 2.12aa and 2.12ba. A His-

Tagged STAT3 protein was immobilized on a Biacore Nickle-NTA sensor chip and was utilized

on a SensiQ system to measure the interaction between peptidomimetic and STAT3 protein.

Qdat analysis software (ICX Technologies) determined the protein and ligand binding affinities.

The positive control peptide (gp130 sequence, Gly-pTyr-Leu-Pro-Gln-Thr-Val-NH2), was run

alongside 2.12aa and 2.12ba and their KDs were calculated: 1.11, KD = 24 nM; 2.12aa, KD = 900

nM; 2.12ba, KD = 205 nM (Figure 2.4). These values taken in conjunction with FP and EMSA

42

results indicated that peptidomimetics 2.12aa and 2.12ba are potent STAT3 binders in vitro that

are capable of disrupting STAT3 complexation events. Compounds 2.12aa-OH and 2.12ba-OH

were subsequently tested via SPR analysis. KD values of 12 µM and 17 µM were obtained for

2.12aa-OH and 2.12ba-OH, respectively; indicating that potential metabolites of lead agents

could bind STAT3 to a lesser degree. The diminished potencies of these agents in vitro,

particularly the FP assay, heavily hinted towards protein binding outside the SH2 domain.

Figure 2.4. SPR binding analysis of peptidomimetics 2.12aa and 2.12ba for STAT3 protein

binding

2.2.6 Caco-2 Influx and Efflux Analysis

Traditionally, phosphorylated inhibitors suffer from pharmacokinetic challenges, particularly

absorption attributed to limited cell permeability. We examined both influx and efflux rates

across a surface of Caco-2 human epithelial cells, a system that effectively imitates the intestinal

mucosa 166, 167

. Permeability was measured by apparent permeability rate coefficient (Papp) values

from the apical (donor) chamber, A, to basolateral (receiving) chamber, B. Rates were classified

as follows: low (Papp <2), medium (Papp 2-10), and high (Papp>10) ×10-6

. In summary, narrow

window mass extraction LC/MS (Waters Xevo quadrupole time-of-flight MS) analysis indicated

that both 2.12aa and 2.12ba were predominately dephosphorylated by the end of the 90-min

43

experiment (only 1-2% recovery), with both agents displaying poor intestinal penetration

(Papp(A-B) values <0.5). Unphosphorylated derivatives 2.12aa-OH and 2.12ba-OH also

displayed low cell permeability (Papp(A-B) values < 2), yet a significantly greater portion of

compound was recovered following experimentation (52% and 36% post-assay recovery).

Recovery of 2.12aa-OH and 2.12ba-OH following experimentation suggested that

peptidomimetics are fairly stable to metabolic processes with the exception of

dephosphorylation.

2.2.7 Intracellular STAT3 Inhibition and Cell Assay Results

While poor cell penetration was observed in Caco-2 cell permeability studies, we reasoned that

investigations with other whole cells were still warranted as there could be variation in cellular

uptake. Supporting this reasoning are severeral reports on phophorylated compounds that target

STAT3 and elicited potent anti-proliferative effects within whole cells 123, 124, 168

. Initial studies

evaluated 2.12aa, 2.12ba, 2.12aa-OH and 2.12ba-OH in v-src transfected NIH3T3 cells for the

suppression of STAT3-STAT3:DNA binding activity. Following 6 and 24 hour treatments with

100 µM inhibitor concentrations, nuclear content was extracted and subjected to an EMSA assay.

Any nuclear pSTAT3 remaining after inhibitor treatment would bind to the applied radiolabelled

probe, thereby signifying its nuclear presence and the absence of STAT3 inhibition. Following 6

hour treatments, both 2.12aa and 2.12ba suppressed active STAT3 by 80% and 50%,

respectively. However, 24 hour exposure to inhibitors showed recovery of pSTAT3 levels,

suggesting temporary suppression of STAT3 activation. Interestingly, dephosphorylated agent

2.12aa-OH also suppressed STAT3-STAT3:DNA binding activity at a level comparable to its

phosphorylated analogue. Whether 2.12aa is dephosphorylated upon entering the cell by

phosphatases or whether 2.12aa-OH is being phosphorylated by kinases is unclear; however, it

is likely that one of the forms of the inhibitor is responsible for the observed effect given their

similar potencies (Figure 2.5). Surprisingly, 2.12ba-OH elicited no cellular effect unlike its

phosphorylated analogue 2.12ba. Unphosphorylated agent 2.12ba-OH’s lack of activity lends

credence to the possibility that 2.12aa-OH is phosphorylated by a cytosolic kinases; however,

the assertion that 2.12aa-OH is being phosphorylation is purely speculative and would require

further evidence to confirm its intracellular activation.

44

Figure 2.5. Intracellular disruption of phosphorylated STAT3 levels as measured by EMSA.

Two whole cell tumour models were utilized to evaluate the cellular efficacy of our

peptidomimetics. The first study utilized a colorimetric assay that quantifies the cellular

reduction of 3-(4.5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-

tetrazolium (MTS) dye to a purple formazan metabolite169

. The MTS assay provided a

convenient method for quantifying the cellular efficacy of inhibitory molecules by directly

measuring levels of cellular metabolism, which is an indirect measure of cell survivability.

Peptidomimetics were incubated with MTS dye in 96-well plates pre-treated with STAT3 reliant

cell lines, including, DU-145170

(prostate cancer), MDA-MB-468171

(breast cancer) and a control

cell line, human promyelocytic leukemia (HL-60)172

, not harbouring constitutively activated

STAT3. Of all the agents tested, only 2.12aa showed appreciable biological effects. Specifically,

in DU-145 cells, 2.12aa was shown to have an EC50 of 19.5 ± 5.6 µM. A CyQuant cell viability

assay validated the activity of 2.12aa observed in the MTS study. Additional STAT3 dependant

tumour lines were tested, including pancreatic cancer cells (Panc-1)173

and NIH3T3/v-SRC

fibroblasts, and HL-60 was utilized as a control line. The activity of 2.12aa performed similarly

in these cell lines, showing 50% suppression of all cells at 50 µM concentrations, with the

exception of the control, which showed no response at 200 µM. CyQuant assay quantifies DNA

levels, thus allowing for a direct measure of cellular proliferation. Discrepancies between the

results of the above assays may be attributed to the different mechanisms used to establish

cellular inhibition. Minor discrepancies aside, previously reported peptide based inhibitors

45

required millimolar concentrations to elicit similar cellular effects, indication that hybrid

peptidomimetics are significantly improved cellular inhibitors.

Thus far, evidence suggested that agent 2.12aa was acting through a STAT3 dependent pathway

to elicit cellular activity. While in vitro binding and disruption assays indicate STAT3 affinity

and cellular activity is limited to STAT3 dependant cell lines, 2.12aa may still bind to an

alternative protein target to garner the witnessed cellular responses. A collection of cell line

mutants were assembled to support the claim that 2.12aa is a whole-cell active STAT3

suppressor. 2fTGF174

, a bladder cancer cell line, and its two mutants U5A and U4A were chosen

to confirm STAT3 dependence due to unique mutations causing the mutants to be deficient in

STAT2 (U5A) and STAT3 (U4A). A cell line devoid of STAT3, like U4A, should be resistant to

anti-tumour agents specific for STAT3. The model system reinforced the hypothesis that 2.12aa

acts as STAT3-dependant cellular agent, whereby both 2fTGH and U5A cell lines were inhibited

at relevant concentrations (50% inhibition at 75µM) and U4A was unresponsive (no activity >

200 µM) (Figure 2.6).

Figure 2.6. MTS assay measuring viability of 2fTGH and its mutants when treated with agent

2.12aa.

2.2.8 Evaluation of Adjuvant Therapy Potential

Given the promising evidence that suggested 2.12aa is a STAT3-dependent anti-tumour agent,

we initiated preliminary studies investigating its use in adjuvant therapies. Given STAT3s

significant role in tumour proliferation, apoptotic evasion, and drug resistance, it is anticipated

that a STAT3 inhibitor could synergize with established anti-cancer chemotherapeutics. Critical

46

to accurate determination of synergy is the condition that the cellular action of tested drug pairs

are independent of each other. Given that STAT3 inhibition is a novel drug modality the above

condition is satisfied, and thus agent 2.12aa was combined with therapeutics etoposide175

,

docetaxol176

, mitoxantrone177

, and ivermectin178

. The results were analyzed using CalcuSyn’s179,

180 (Biosoft, Cambridge) median effect model and each pairing was given a combination index

(CI); CI value of < 0.9 is indicative of synergy. Most notably, the combination of 2.12aa and

ivermectin elicited impressive synergism with a CI value 0.0734 at its median effective dose. By

comparison, combination experiments with mitoxantrone and docetaxol were approximately

additive (CI ~ 1). Ivermectin, a known anti-parasitic agent, was discovered during a drug

repurposing screen to be a potential treatment for leukemia181

. The mechanism by which

ivermectin confers cyotoxity is linked to chloride ion influx and the generation of reactive

oxygen species (ROS), which is further attributed to the up-regulation of pro-apoptotic STAT1

protein. We speculated that the derived synergy was due to the increased propensity of cells to

undergo apoptosis. Unfortunately, following this very promising initial result, follow-up studies

failed to elicit the same synergistic response. It was suggested that previously observed activity

could have been due to accumulated mutations in an old cell line that rendered these particular

cells susceptible to treatment. Given the inconsistencies of the data obtained, conclusions cannot

be drawn as to whether a STAT3 agent is a suitable synergistic partner to conventional therapies.

2.3 Conclusions

Our library of novel STAT3-targeting peptidomimetic molecules have shown promising

biological activity through a series of investigations. The novel biphenyl moiety, when

substituted correctly, adopted a similar binding mode to a potent STAT3 SH2 domain inhibitor

in silico, validating its use as a mimic for the dipeptide Pro-Gln. Agent 2.12aa boasted the most

promising in silico docking and outperformed the other peptidomimetics in binding and

disruption assays. 2.12aa improved upon the cellular potency of previously reported peptide

based inhibitors but, lacked the activity of STAT3 small molecule inhibitors like Fletcher et al.

salicylic inhibitor 1.22. 2.12aa’s dependence on STAT3 inhibition for its observed cellular

effects was supported through several cellular assays, with strong evidence derived from studies

using STAT3 deficient lines. Finally, a study probing 2.12aa’s synergistic potential with other

known therapeutics was attempted. However, the results obtained were inconclusive. The

47

cellular activity of 2.12aa may be improved if issues of cell permeability and metabolic stability

are addressed through rationalized substitutions or prodrug strategies.

2.4 Experimental Methods

Experimental methods for peptidomimetics are available in Section 8: Appendix 2.

48

3 Quantitative Structure Activity Relationship Methodology for the Producing of 2,6,9-Heterotrisubstituted STAT3 inhibitors

A significant portion of the material covered within this Chapter has been published in the

articles listed below182, 183

. Included within this chapter are experiments not presented in the

manuscript. Assistance and contributions of other individuals are highlighted in the

Contributions of Authors section.

Shahani, V.M., Yue, P., Haftchenary, S., Zhao, W., Lukkarila, J.L., Zhang, X., Ball, D.,

Nona, C., Gunning, P.T. & Turkson, J. 2011, "Identification of purine-scaffold small-

molecule inhibitors of STAT3 activation by QSAR studies", ACS Medicinal Chemistry

Letters, vol. 2, no. 1, pp. 79-84.

Fletcher, S.; Shahani, V. M.; Gunning, P. T. Facile and efficient access to 2,6,9-tri-

substituted purines through sequential N9, N2 Mitsunobu reactions. Tetrahedron Lett.

2009, 50, 4258-4261.

3.1 Introduction

This project explored the topology of STAT3’s SH2 domain using rationally designed, small

molecule inhibitors that maximize molecular interactions to increase protein binding. Insight into

the molecular requirements for potent binding was garnered through a thorough examination of

potent STAT3 SH2 domain inhibitors available in the literature. STAT3’s crystal structure was

utilized for ligand docking experiments and was essential for precise SH2 domain mapping. A

pharmacophore model was constructed based on the predicted binding modes of lead inhibitory

molecules123, 124, 144-146, 148, 154, 168, 184-189

. Furthermore, the STAT3-SH2 domain residues that

interacted with bound inhibitors were recorded and utilized in the pharmacophore construction.

Scaffolds satisfying the pharmacophore model were constructed in silico and docked to confirm

their complementarity to the SH2 domain. Next, scaffolds were ranked upon their individual

docking score as well as their potential for molecular diversification. 2,6,9-heterotrisubstituted

purines were selected as ideal occupants of the SH2 domain as they ranked highly amongst

tested scaffolds and were amenable to dervitization. In addition, the purine scaffold has been

deemed a privileged scaffold because of its incorporation in many therapeutic agents190

. Thus, a

49

library of purine molecules was assembled and subjected to a Quantitative Structure Activity

Relationship (QSAR) investigation. STAT3 affinity was established through a series of in vitro

experiments, including FP, EMSA, and SPR analysis. Further studies investigated the small

molecules ability to elicit cellular effects, a potentially significant accomplishment for a

molecule designed primarily in silico. Additional pharmacokinetic investigations examined the

limits of first generation purine molecules and highlighted changes that could lead to improved

potencies.

3.1.1 Pharmacophore Development and Inhibitor Design

To identify the chemical requirements of STAT3 inhibitory molecules a pharmacophore model

was constructed. Aiding the construction of the model was the utilization of GOLD ligand

docking software that surveyed the theoretical binding modes of a collection of leading STAT3

dimerization-disruption molecules to STAT3’s SH2 domain. The solutions obtained from the

docking studies pinpointed the existence of three solvent accessible sub-pockets (labelled A, B

and C) within the SH2 domain that actively contributed to potent ligand binding (Figure 3.1A).

Each docking solution bound to one, if not all three, sub-pockets within the domain. Located

centrally to these three sub-pockets is a serine residue (Ser636), recognized as a critical hydrogen

bond acceptor (carbonyl oxygen) for binding the native peptide, which was utilized as the

pharmacophores point of origin (Figure 3.1A & C). One region that was consistently occupied by

SH2 domain inhibitors was sub-pocket A, the region attributed to binding the pTyr residues of

peptides, which was composed of polar residues Lys591, Ser611, Ser613, and Arg609 and

predominantly engaged in hydrogen bonding with inhibitory molecules. Chemical entities

isolated in this pocket include tetrazoles, phosphates, phosphonates, salicylic acids or malonates.

In contrast to A, both sub-pockets B and C consisted primarily of non-polar residues, with van

der Waals interactions driving inhibitor binding. The molecular architecture of sub-pocket B is

primarily derived from the tetramethylene portion of the side chains of Lys592, Arg595, Ile597

and Ile634. Ligands generally accessed sub-pocket B through lipophilic, hydrophobic groups,

such as tosylates, phenyl rings, alkyl groups and heterocycles. Sub-pocket C is framed by several

hydrophobic residues including: Trp623, Val637, Ile659, Phe716 and the hydrophobic

tetramethylene side chain of Lys626. Though sub-pocket C is predominantly hydrophobic in

nature and interfaces with hydrophobic substituents (isopropyl, hexyl, benzyl and

50

cyclohexylbenzyl), the presence of the hydrophilic amine on Lys626 residue could potentiate a

terminal hydrogen bond with inhibitors bearing receptive functionality (Figure 3.1B).

Figure 3.1. (A) Key residues and pocket identification (B) Assembly of docked SH2 domain

inhibitors accessing three subpockets (C) The pharmacophore dimensions and functional group

requirements (D) 2,6,9-heterotrisubstituted purine docked and fulfilling pharmacophore

requirements. (Blue residues denote polar residues, red residues are non-polar, and white

residues denote intermediary polarities).

The overall morphology of the SH2 domain is predominantly planar, with the notable exception

of sub-pocket A, which features a pronounced cavity needed to accommodate the pTyr moiety.

Given the SH2 domains relatively flat landscape it was anticipated that a pharmacophore model

consisting of a relatively rigid central scaffold that adequately positions functionality would

facilitate suitable binding and occupation of the three sub-pockets. Thus, a series of potential

inhibitory molecules were designed that satisfied the pharmacophore model, featuring tripodal

rigid cores of differing sizes and substituents. These molecules were docked using GOLD and

ranked for compatibility with the SH2 domain. 2,6,9-heterotrisubstituted scaffolds were singled-

51

out as a promising structural skeleton that projected functionality into the three vertices of the

pharmacophore plot (Figure 3.1 D ). A single, diverse set of purine molecules were assembled

and screened in silico to determine the ideal chemical composition needed to optimally occupy

SH2 domain sub-pockets B and C. A hydrophilic ethylene carboxylate was kept constant to

anchor purine molecules to the SH2 domain via intermolecular contacts with the cationic sub-

pocket A.

Purines were appended with either an n-pentyl or cyclohexylbenzyl moiety at the exocyclic N2

position in order to occupy sub-pocket B. We selected the n-pentyl group because of its high in

silico docking scores, which suggested good complementarity with the B sub-pocket. Also,

linear alkyl chains have been incorporated into previously reported STAT3 inhibitory molecules

that bind the STAT3-SH2 domain121,122

. Alternatively, a cyclohexylbenzyl was used in place of

the n-pentyl to explore the optimal flexibility for groups in the N2 position. Also, the success of

the cyclohexylbenzyl group on other STAT3 inhibitory agents warranted its utilization with the

purine scaffold122,153

. Next, a range of hydrophobics were chosen to explore the N9 position,

which were limited to functional groups containing eight or fewer carbons as computational

studies suggested that larger groups would become solvent exposed. Simple linear and branched

alkyl chains of varying sizes helped determine the size of the sub-pocket C. Differences in

binding affinities between secondary and tertiary nitrogen centers at the C6 position would aid in

determining whether hydrogen bonding at this position contributed to inhibitor binding. Ether

linkages at the C6 position also helped to explore the potential for hydrogen bonding. Cyclic

alkyl groups and aromatics helped to determine the level of rigidity that best suited occupation of

sub-pocket C. Functional groups appended to the aromatic rings, as well as heterocycles, were

employed to determine the potential for further intermolecular intereaction. Aromatics featuring

both electron rich and deficient rings were utilized to explore potential pi-stacking interactions.


3.2.1 The Mitsunobu Reaction and its use in Synthesizing 2,6,9-Heterotrisubstituted Purines

The Mitsunobu reaction consists of an oxidizing azo reagent, usually diethyl azodicarboxylate

(DEAD), and a reducing phosphine reagent, commonly triphenylphosphine (TPP), to facilitate

the coupling reaction of alcohols to acids/acidic-nucleophiles in mild conditions191

. The

52

pronucleophilic functionality present on purine and pyramidine bases render them amenable to

reaction using Mitsunobu chemistry. As such, researchers have utilized Mitsunobu conditions to

make a wide-breadth of novel purine, pyrimidine, and nucleoside analogues192-194

. In particular,

Fletcher and Shahani et al. reported the preparation of 2,6,9-triheterosubstituted purines starting

from commercially available 2-amino-6-chloropurine. Their synthetic procedure featured two

mild, consecutive Mitsunobu reactions as key steps and efficiently addressed the synthetic

requirements for making 2,6,9-heterotrisubstituted purine-based STAT3 inhibitors. The reported

procedure was adapted and utilized to construct a library of anti-STAT3 purine agents.

2-amino-6-chloropurine was BOC protected on its exocyclic N2 amino group prior to successive

Mitsunobu reactions. In their report, Fletcher and coworkers described an alternative, economical

methodology for the mono BOC-protection of the amino group compared to a previously

reported route195

. As such, 2-amino-6-chloropurine was treated with a single equivalent of di-

tertbutyl dicarbonate in dimethyl sulfoxide (DMSO) then placed on ice prior to the portion-wise

addition of nucleophilic catalyst 4-dimethylaminopyridine (DMAP) to produce N9-BOC purine

3.1. Isolated product was subjected to strong, non-nucleophilic base, NaH, to initiate the so-

called “BOC-transfer” reaction, whereby deprotonation of the exocyclic N2 position generates an

anionic nucleophile that is readily acylated. Given the inaccessibility of the BOC group to

nucleophilic attack it is postulated that the purine ring functions similarly to imidazole, a reliable

nucleophilic catalyst in acylation reactions196

, to facilitate transfer of the protecting group (3.2).

The protection of N2 group using BOC substantially increased solubility in THF, the preferred

solvent for Mitsunobu reactions, leading to efficient N9 alkylation using ethyl glycolate and

stoichiometric amounts of Mitsunobu reagents (3.3). Increased solubilities produced superior

yields and required less reagent as compared to previously reported methods197, 198

. Next, The N2

position provided an opportunity for derivitization that was realized through Mitsunobu-type

alkylation or an acylation that followed acid-mediated BOC deprotection. The N2-BOC group

facilitated Mitsunobu-type alkylation by lowering the amino groups pKa and thus rendering it

pronucleophilic. Hydrophobic n-pentyl alcohol and cyclohexylbenzyl alcohol, both of which

have been featured in previous STAT3 inhibitors, reacted smoothly with 3.3 and Mitsunobu

agents TPP and DIAD to form N2 functionalized purines 3.4a and 3.4b, respectively. BOC

deprotection was achieved using TFA in an equal volume of DCM (3.8), solvent was removed

53

under reduced pressure and was subsequently treated with acyl chlorides in pyridine to produce

3.9a-c.

Scheme 3.1. (a) BOC2O, cat. DMAP, DMSO, 25 °C, 30 min, 75%; (b) NaH, THF, 0-25 °C, 2 h,

95%; (c) (i) ethylene glycol, PPh3, THF, 25 °C, 10 min (ii) DIAD, 25 °C, 15 min, 83%; (d) (i)

Y-OH, PPh3, THF, 25 °C, 10 min (ii) DIAD, 25 °C, 30 min – 2 h, 83%; (e) NHR’R”, DIPEA,

DMF, 135 °C, 30 min, 65-97%; (f) TFA:DCM (1:1), 25 °C, 30 – 1 h, 65-95%; (g) LiOH,

THF:H2O (3:1), 25 °C, 15 min; (h) TFA:DCM (1:1), 25 °C, 30 min, 90%; (i) A-COCl, pyridine,

25 °C, 15 min, 63-74%;

Next, nucleophilic aromatic substitution at the purine’s 6 position was used to introduce

molecular diversity. A number of linear and cyclic alkyl amines, anilines, and phenols were

heated in the presence of purine (3.4a-b) and diisopropylethylamine (DIPEA) in DMF.

Conversion was readily observed for amines following several hours of treatment while anilines

required increased heating and reaction times (3.5aa-bx &3.10aa-c). Phenols were unreactive

under these conditions even after periods of prolonged, increased heating. To overcome this

issue, the C6 position was first activated with caged tertiary diamine 1,4-

diazabicylo[2.2.2]octane (DABCO), forming a reactive salt intermediate. The cationic salt

54

smoothly reacted with the appropriate phenol upon moderate heating. BOC-groups were

maintained on final molecules for several derivatives, however, challenges in solubilising these

agents in aqueous environments made their removal desirable. A global deprotection to expose

both the carboxylate and remove the BOC group from purine intermediates was attempted in

heated aqueous acid solutions but proved poor yielding. This led to the adoption of a step-wise

deprotection procedure that produced final molecules in near quantitative yields. Saponification

of the resultant ethyl esters using lithium hydroxide (LiOH) in a solution of THF:H2O (3:1)

afforded agents 3.6aa-bx, which were BOC de-protected using a solution of TFA:DCM (1:1),

and then purified to afford final molecules 3.7aa-bx and 3.11aa-ca.

Utilizing the above procedures, fourty-seven pharamacophore directed 2,6,9-heterotrisubstituted

purine were synthesized in a single iteration and subjected to a host of tests discriminating their

STAT3 binding affinity and cellular potency.

3.2.2 Surface Plasmon Resonance and QSAR Discussion

SPR analysis assessed binding to full-length STAT3 protein. A SensiQ SPR instrument used in

conjunction with STAT3 protein immobilized on Biacore’s NTA nickel chips evaluated drug

molecules for their association and dissociation kinetics. Binding affinities were established and

related to the chemical requirements of STAT3 inhibitors set forth by the pharmacophore model

to establish our QSAR (Table 3.1). In accordance to the pharmacophore, we installed a lipophilic

pentyl group on the exocyclic N2 position (X position) to afford van der Waals interactions with

sub-pocket B’s Ile634 and Ile597 residue side chances, and the tetramethylene portion of

Lys592. Keeping the pentyl constant at position X, we incorporated a focused set of

aliphatic/aromatic amine, aniline and phenol substituents to probe sub-pocket C. The carboxylate

at the N9 position anchored the molecule to the SH2-domain sub-pocket A through its interaction

with the regions highly polar residues.

55

Table 3.1. The structure and activities of the purine library as assessed by SPR and EMSA.

56

Purines decorated with aromatic compounds at position Y, outperformed their aliphatic

counterparts, displaying promising KD values of 2.2, and 2.5 µM for compounds 3.7aa and

3.7ac, respectively. GOLD dockings of these aromatic analogues featured a t-shaped π-π

stacking between the benzene moiety and the nearby aromatic side change of Trp623, an

interaction capable of confering additional binding energy. Also, a noticeable trend was the

success of small cyclic aliphatics and heterocycles (cyclopentyl, cyclohexyl, furfuryl, and

morpholine), which, taken together with the benzene derivatives success, suggested that the

lipophilic cavity was adequately occupied by constrained groups of 5 to 6 carbons in size.

Additionally, morpholine derivative success may be attributed to hydrogen bonding contacts

made within the sub-pocket. Small aliphatics (2-3 carbons) displayed limited affinity for the

STAT3 protein with obtained KD values greater than 50 µM.

For consistency, agents that incorporated a larger hydrophobic, cyclohexylbenzyl unit at position

X were also diversified at position Y and evaluated for binding. In general, cyclohexylbenzyl

purines outperformed pentyl derivatives that shared identical functionality at the Y position;

particularly, medium sized aliphatics isobutyl (3.7bj) and isoamyl (3.7bl) had significantly

lowered KD’s of 7.9 and 1.2 µM, respectively. Potentially, the increased bulk of the

cyclohexylbenzyl group re-positioned medium sized aliphatics to better engage with sub-pocket

C, thereby increasing potency. Aromatics substituent’s showed comparable binding affinities,

and small cyclic aliphatics and heterocycles presented slightly increased affinities for the STAT3

protein. In summary, purines appended with small alkyl chains (2-3 carbons) at the Y position

failed to elicit potent binding. Next, medium sized chains (4-5 carbon) showed appreciatable

binding to STAT3. Finally, aromatics, cyclic aliphatics and heterocycles produced the tightest

binding observed in SPR analysis. Computational dockings with lead cyclohexylbenzyl

inhibitors showed these agents as consistently projected functional groups within the proposed

pharmacophore plot. Rigidifying the cyclohexylbenzyl at position X through an amide linkage

(cyclohexylbenzamide), conferred minimal benefits to binding. Other peptide linked derivatives

performed well, particularly cyclohexylamide with a morpholine in the Y position (3.11ca, KD =

1.3 µM). Molecules that were not liberated from their BOC protecting groups showed both

favorable and disfavourable changes in affinity. Given the inconsistencies within these results, it

is speculated that the bulky BOC group elicited enhanced hydrophobic interaction in cases of

57

increased affinity or prevented inclusion into one or more sub-pockets when diminished binding

was observed.

A representative group of synthesized purine agents were docked to the STAT3-SH2 domain

using GOLD software. Globally, agents that featured the cyclohexylbenzyl group in the N2

position possessed higher docking scores than analogues bearing n-pentyl group. This was in

agreement with SPR results where cyclohexylbenzyl agents outperformed most of their n-pentyl

counterparts. Also, agents appended with small hydrophobic groups in the N9 position scored

poorly in both GOLD docking and in vitro experiments. Aromatic moieties in the N9 position

scored slightly better than equivalently sized cyclic alkyl groups in docking experiments, which

matched the in vitro SPR results. Also, both aromatic and cyclic alkyl groups were correctly

predicted to outperform small sized hydrophobics. Lastly, medium-sized branched aliphatic

groups in the N9 position performed better when coupled with N2 cyclohexylbenzyl derivatives

in both in silico and in vitro experiments. It should be noted that GOLD scoring functions are

optimized for determining the correct binding position and are therefore unable to predict

accurate binding affinities. Thus, while reliable binding modes were predicted, the lack of

calculated binding affinities made it impossible to determine a meaningful correlation with in

vitro data. Overall, GOLD docking produced meaningful information for pharmacophore

development and provided usable predictions for group sizes used in purine functionalization.

Thus, the SPR results supported the proposed pharmacophore model and computational results.

Specifically, the cyclohexylbenzyl appendage best satisfied the binding requirements at position

X and constrained moieties that contained 5-7 carbons at position Y elicited the tightest binding

affinities.

3.2.3 EMSA for Determining STAT3-STAT3:DNA Dimer Disruption in Cell Nuclear Extracts

Next, we evaluated the purine agents’ ability to disrupt STAT3-STAT3:DNA binding in vitro

through EMSA analysis. NIH3T3 cells were exposed to transforming agent, v-src, to initiate

constitutively activated levels of STAT3. Nuclear extracts were isolated and incubated with

purine inhibitors before treatment with radiolabelled, hSIE oligonucleotide, a potent binder of the

STAT DNA binding domain. Gel-electrophoresis separated the incubated extracts into its

component parts, radio-labelled bands were identified, and the extent of disruption to STAT3-

58

STAT3:DNA complex was quantified. Several agents showed potent interruption of the ternary

complex (Table 3.1) including agents 3.7bq, 3.7bp, 3.7bl, 3.7bj, 3.7bo, and 3.11ca that also

displayed promising binding in SPR analysis. However, much of the data from the EMSA assay

correlated poorly with that obtained from the SPR, with many compounds possessing IC50’s

greater than 100 µM. It has been noted previously that agents possessing potent STAT3

disruption when determined by FP or SPR analysis often display weaker disruption of STAT3-

STAT3:DNA complex in EMSA analysis189

. Nuclear extracts contain a range of proteins which

may interfere with purine molecules interaction with STAT3, leading to poor activity in the

EMSA assay. Alternatively, the favorable binding energy of the protein:protein and protein:DNA

interactions lock STAT3-STAT3:DNA complexes together and produce an additional barrier to

disruption 144, 145

. Another possibility which cannot be discounted is the potential for these

compounds to bind STAT3 in an alternative fashion than described by the pharmacophore plot.

3.2.4 Immunoblotting Analysis

Purine agents were engineered to specifically bind STAT3 SH2 domain, thereby preventing their

phosphorylation by receptor tyrosine kinases and subsequent dimerization. In order to show that

select agents were capable of inducing cellular knock-down of STAT3, the contents from two

cell lines that both harbour constitutively activated STAT3 were subjected to immunoblotting

analysis (Figure 3.2). NIH3T3/v-SRC and human breast cancer (MDA-MB-231) were exposed

to agents 3.7bj, 3.7be, 3.7bl, and 3.11ca at a constant concentration of 50 µM for varying

treatment times (12, 24, and 48 hours) and displayed moderate inhibition of STAT3

phosphorylation (lanes, 2, 3, 5, 6, 8, 9, 11, 12, 14, 15, 17, and 18) as compared to control lanes

(1, 4, 7, 10, 13, and 16) (Figure 3.2A(i) and Figure 3.2A(ii)). In contrast, intracellular levels had

no impact on the constitutive levels of phospho-ERK:MAPK (pERK1/2) or phosphor-SRC

(pSRC). The biological effects elicited by purine compounds was time dependant, suggesting

differential kinetics for each of the compounds tested. Additional time course experiments

explored the lead agents’ temporal dependencies and showed that 3.7be and 3.7bl elicited rapid

responses within 15-60 minutes in NIH3T3/v-SRC cells (Figure 3.2A(iii), right two panels). The

data also suggested that STAT3 phosphorylation rebounded after 60 minutes in these cells

(Figure 3.2A(iii), NIH3T3/v-SRC). Similarly, in the MDA-MB-231 line, 3.7be inhibited STAT3

phosphorylation 15-30 minutes into treatment (Figure 3.2A(iii), left, top two panels), however,

levels were restored after 6 hours. In contrast, 3.7bl showed strong inhibition 6 hours into

59

cellular treatment (Figure 3.2A(iii), left, bottom two panels). In all cases, STAT3

phosphorylation levels were not fully recovered 48 hours following treatment (Figure 3.2A(ii)).

Figure 3.2. Immunoblotting analysis for the effects of agents on intracellular STAT3,

ErkMAPK, Src, and STAT1 activation. (A)(i) (ii) Immunoblotting analysis of whole-cell lysates

of equal total protein prepared from NIH3T3/v-SRC and MDA-MB-231 cells; (iii) Expanded

time course experiments prepared from NIH3T3/v-SRC and MDA-MB-231 cells; (B)(i) EGF-

stimulated NIH3T3/hEGFR fibroblasts; (B)(ii) STAT1 immune complexes prepared from EGF-

stimulated NIH3T3/hEGFR fibroblasts. Treatments occured at 50µM unless otherwise stated.

Moreover, agents 3.7bj and 3.11ca were studied for their effects on ligand-stimulated STAT3

activation and were shown to prevent epidermal growth factor signalling induced STAT3

phosphorylation. Mouse fibroblasts overexpressing the human EGF receptor (NIH3T3/hEGFR)

were assessed through the immunoblotting of whole cell lysates following their stimulation by

EGF and treatment with inhibitory agents. This particular result suggested that purines molecules

interacted with inactive STAT3 monomers, presumably through their SH2 domains, and

prevented STAT3 binding to receptor sites, thereby blocking the protein’s phosphorylation. Once

again, no effect was observed for the phosphorylation of ERK (pERK1/2) and SRC (pSRC) in

the same experiment. Lastly, prevention of EGF-mediated STAT1 phosphorylation by purine

agents was not observed in immunoblotting analysis within the same experiment (Figure 3.2B(i),

pSTAT1). Confirmation of STAT1’s unresponsiveness to purine treatment was accomplished by

examining STAT1 immune complex precipitation with general pTyr immunoblotting anaylsis

60

(Figure 3.2B(ii)). Both results supported a STAT3 dependent mechanism for the observed

phosphorylation disruption. Also, lack of inhibition of any kinase activity supported the

hypothesis that hydrophobically decorated tri-substituted purines lack chemical similarity to ATP

and were therefore occluded from ATP sites.

3.2.5 CyQuant Proliferation Assay

Promising immunoblotting results eluded that purine agents could possess cellular potency. A

CyQuant proliferation assay was performed using select purine agents on DU-145, MDA-MB-

231, Panc-1, and NIH3T3/v-SRC cells all harbour constitutively active STAT3. Agents 3.7bp,

3.7be, 3.7bj, 3.7bl, 3.11ca, decreased malignant cell viability with EC50 concentrations ranging

from 41 to 80 µM following 48 hour treatments (Figure 3.3). NIH3T3 and thymic epithelial

stromal cells (TE-71), neither of which possess constitutively active STAT3, were insensitive to

treatment with these agents. Though immunoblotting results suggested recovery of

phosphorylated STAT3 levels following treatment, initial disruption of activated pTyr proteins

seemingly promoted a loss of viability in malignant cells. Thus, purine-scaffold small molecules

may selectively inhibit STAT3 driven cancers.

61

Figure 3.3. Lead purine agents suppress viability of malignant cells that harbour constitutively

activated STAT3.

3.2.6 ADME Profiling: Liver Mouse Microsomes and Caco-2 Cell Proliferation

Nearly two orders of magnitude separate the binding affinities of purine inhibitors according to

SPR analysis (KD = 0.8 µM) and the cellular potency observed in CyQuant proliferation assay

(EC50 = 41 µM). Though it is normal for cellular activity to fall short of the potencies observed

in isolated binding experiments, the disparity observed between these measures required further

inquiry. A common barrier to garnering potent intracellular activities are poor pharmacokinetic

properties. We set about to investigate both metabolic stability and cellular permeability of

62

agents. Purine inhibitors were exposed to mouse liver microsomes for a single time course (30

minutes) at 37 °C and were evaluated for levels of degradation. A Waters Xevo quadrapole time-

of-flight MS coupled with an ACQUITY UPLC system was utilized to quantify levels of phase I

and phase II metabolism of purine inhibitors (Table 3.2). As can be seen from Table 3.2, purine

agents were not subject to enzymatic modification, thus, an alternative mechanism was required

to explain poor cell activity.

Table 3.2. Caco-2 Permeability and Efflux Determination and Mouse Liver Microsome

(Metabolic) Stability.

The study determined that purine agents were incapable of traversing the differentiated Caco-2

cell layer (Papp(A-B) values < 0.5). Furthermore, their efflux ratio (Papp(B-A)/Papp(A-B)) was

classified as high (>8) for several agents, indicative of rapid evacuation of purine agents from

acceptor wells. Fully differentiated and polarized caco-2 cell monolayers express a variety of

transporters, including P-glycoprotein 1 (Pgp), a well characterized ATP-binding cassette

transporter often attributed to multidrug resistance199

. Purine agents may be a suitable Pgp

substrate accounting for its rapid efflux from the acceptor well. Pgp’s are primarily found in the

body’s clearance systems200

, including the intestinal epithelium, hepatocytes, and renal proximal

tubular cells, and are therefore not solely implicated as the source of poor agent activity in our

whole cell studies as none of the cells tested should express high levels of Pgp. Of greater

concern to our cellular investigations was the discovery of purine compound’s poor cell

63

penetration. Addressing compounds poor permeability could be a potential avenue to garner

increased cellular effects.

3.2.7 Competitive FP Assay and Fluorescence Excitation and Emmission Characterization Of Purine Agents

Purified full-length STAT3 protein and fluorescent gp130 peptide probe were incubated with

increasing concentrations of purine inhibitory molecules, and scanned for FP on the Tecan

M1000 polarimeter. A calibration curve performed before drug molecule treatments confirmed

that normal probe response was observed as shown in Figure 3.4A. Normally, dose-dependent

response curves are generated and used to calculate IC50 values for all compounds tested. Two

FP assays were performed with purine molecules, with results from both screens showing

insufficient dependency between inhibitor concentration and fluorescence polarization. Not only

did the FP values between concentrations fail to produce a meaningful relationship, more

interestingly, differences at single concentration point (experiments were run in triplicate)

produced exceedingly large standard deviations (Figure 3.4B). The noise obtained in these

experiments were suggestive of signal interference. Given the conjugation present within the

purine scaffold, the inhibitory agents may fluoresce at the wavelengths relevant to those used in

the excitation and emission of fluorescein labelled probe201

. To explore the validity of this

conjecture, a representative sample of purine compounds were subjected to a fluorescence

intensity scan. At a wavelength of 470 nM, the same excitation wavelength used in FP

experiments, some purine inhibitors displayed fluorescent activity. The emission wavelength for

purine compounds possessed a minor stokes shift of around 10 nM, with emission occurring

primarily at 480 nM. Purine compounds showed no emission wavelength when excited at 520

nM (the emission wavelength of fluorescein). Evidence of fluorescent excitation and emission

for purine compounds highlights its potential for absorption at a relevant wavelength to cause

interference with fluorescent polarization experiments. Thus, evaluation of purine agents for

STAT3 binding affinity was established through SPR analysis.

64

Figure 3.4. (A) STAT3 FP calibration curve (B) Resentative results from purine agents

subjected to the FP assay.

3.3 Conclusion

We have reported the computationally driven design of successful STAT3 inhibitory agents.

Pharmacophore modelling promoted the generation of a heterotrisubstituted purine inhibitor

molecule which was the basis of an QSAR study. The QSAR study highlighted particular

appendages that infer increased STAT3 affinity, which could be utilized in the design of future

STAT3 inhibitory molecules. We discovered several lead agents that adequately bound the

STAT3 protein and disrupted both DNA binding and STAT3 phosphorylation levels within cells.

Furthermore, purine agents were capable of suppressing the viability of tumour cells dependant

on oncogenic STAT3 signalling, an impressive feat for an inhibitory molecule designed

primarily in silico. Excitingly, this was the first example of an inhibitory agent bearing the so-

called privileged purine scaffold capable of tuning a transcription factors activity. Success of

purine agents outside their common usage as ATP-pocket binders could stimulate the creation of

purine and pyrimidine core molecules that target novel biological components. The success of

2,6,9-heterotrisubstituted purines suggests that they are a suitable platform to develop optimized

STAT3 inhibitory molecules.


Experimental methods for purines are available in Section 9: Appendix 3.

65

4 Second Generation 2,6,9-Heterotrisubstituded Purines: An Effort to Increase Cellular Potency Leads to the Discovery of Alternative Intracellular Targets

Portions of the material in this Chapter can be found in the accepted manuscript listed below202

.

This chapter also includes material that was not included in the accepted publication. Exact

contributions from individual authors are noted in the Contributions of Authors section.

Shahani, V.M., Ball, D.P., Ramos, A.V., Zhihua, L., Spagnuolo, P.A., Haftchenary, S.,

Schimmer, A.D., Trudel, S. & Gunning, P.T. 2013, "A 2,6,9- hetero-trisubstituted purine

inhibitor exhibits potent biological effects against multiple myeloma cells", Bioorganic

and Medicinal Chemistry, DOI: http://dx.doi.org/10.1016/j.bmc.2013.04.080.

4.1 Introduction

Our previous study set the precedent for using purine small molecules as STAT3 inhibitors to

elicit anti-tumour cellular effects. The described agents possessed poor cell permeability, which

was suggested to be the main impediment to achieving the same, high levels of potency observed

in in vitro binding experiments. Accordingly, synthetic efforts to prepare second-generation anti-

STAT3, purine-based inhibitors with improved cell permeability and enhanced cancer

cytotoxicity were undertaken. Specifically, the N9-carboxylic acid, present on all poorly cell-

penetrating purines, was elected to be rationally modified to mask its anionic character. Prodrug

and biosostere strategies were employed to furnish a new library of purine inhibitory molecules

with greater cellular efficacy than was observed in previous agents. Testing of the newly

synthesized library revealed that prepared non-carboxylate containing analogues failed to exhibit

STAT3 binding. However, compound 4.12e, a sulfamate appended compound, displayed potent

cytoxicity in multiple myeloma (MM) whole cell tumour studies. A preliminary screening of a

select panel of oncogenic kinases revealed 4.12e’s potential affinity for these aberrant proteins.

A comprehensive kinome screen was performed to identify intracellular kinases that may

account for 4.12e cellular potency.

4.1.1 Inhibitor Design

To begin, the carboxylic acid substituent was masked using prodrug strategies203

. Given the

polarity of parent carboxylate compounds (Figure 4.1), 4.1a-h (CLogP = -0.2 - 4.1), we

66

hypothesized that masking the charge would significantly reduce water solubility. Thus, we

prepared several analogues to circumvent possible inhibitor aggregation. In addition, we

reasoned that a successful prodrug approach would facilitate inhibitor cell membrane

penetration, improve inhibitor half-life, and increase cellular potency. Developed prodrug

purines included ethyl, acetoxymethyl and pivaloyloxymethyl esters, which have been

documented to confer increased lipophilicity, stability and oral activity204, 205

. Second, a

bioisostere of the carboxylic acid and an alternative polar functionality were introduced for

purposes of increasing inhibitor lipophilicity. These replacements aimed to reduce anionic

character of agents to facilitate improved binding potency via intermolecular interactions and to

bestow greater cell permeability. We elected to replace the N9-carboxylic acid appendage with

both a tetrazole or sulfamate moiety. Tetrazole, while possessing comparable acidity to

carboxylic acid, harbours significantly greater lipophilicity that would be predicted to potentiate

cell penetrative properties206

. Next, a neutral, hydrogen bond acceptor-rich sulfamate group was

selected to make additional contacts with the pTyr binding pocket of STAT3's SH2 domain. The

synthesis of these molecules would build upon the procedures used to develop previous purine

inhibitory molecules.

Figure 4.1. The lead carboxylate purine agents and their respective ClogP values.

67


4.2.1 Synthesis of 2nd Generation Purine Agents

Access to final molecules was achieved through four synthetic routes each starting from 2-

amino-6-chloropurine (Scheme 4.1). Preparation of prodrugs, 4.2a-g, was analogous to the

synthetic protocols reported in the previous chapter (Chapter 3.2.1) starting with 4.1a-g. To

produce acyloxymethyl esters of carboxylic acid, prodrug ethyl ester compounds 4.2a-g were

hydrolysed using LiOH mediated saponification to give carboxylic acids 4.3a-g. Intermediate

acids were subjected to treatment with either acetoxymethyl chloride to yield the acetoxymethyl

ester prodrugs (4.4a-g), or pivaloyloxymethyl bromide to yield the pivaloyloxymethyl ester

prodrugs (4.5a-g). Esterification of the carboxylic acid was facilitated through the use of

catalytic sodium iodide and gentle heating. Prolonged reaction times resulted in poorer yields

hinting towards an inherent instability in these prodrug molecules. Confirmation of prodrugs

poor stability was observed during analytical HPLC analysis. All prodrug analogues were used

immediately after HPLC purification and lyophilization for diagnostic purposes, with their purity

ascertained through analytical HPLC.

Scheme 4.1. (a) TFA:DCM (1:1), 25 °C, 1 h, 63-95%; (b) LiOH, THF:H2O(3:1), 25 °C, 15 min,

75-93%; (c) acetoxymethyl chloride, cat. NaI, DIPEA, DMF, 40 °C, 6 h; or for 10a-g; (c)

pivoyloxymethyl bromide, cat. NaI, DIPEA, DMF, 40 °C, 6 h.

Preparation of N9-sulfamate-containing purine inhibitors was mediated by the installation of an

ethylene glycol linker (Scheme 4.2). Ethylene glycol was selected for its short chain length, as

longer chain lengths would introduce undesirable flexibility. Chemistry for installing the

sulfamate was previously utilized in our research group207

. Freshly prepared monosilyated

ethylene glycol208

(4.6) was reacted under Mitsunobu conditions with compound 3.2 to

68

selectively alkylate its N9 position to produce 4.7 in good yields. Next, Mitsunobu reaction

conditions with 4.7 and cyclohexylbenzyl alcohol yielded the N2 alkylated product 4.8.

Analogous to previous procedures, nucleophilic aromatic substitution was used to incorporate

alkylamines at C6 yielding compounds 4.9a-g. TBDMS deprotection using tetra-n-

butylammonium fluoride (TBAF) in THF afforded the free alcohol 4.10a-g in excellent yields.

Finally, primary alcohols 4.11a-g were exposed to NaH and treated with sulfamoyl chloride (as

prepared from chlorosulfonyl isocyante209

4.14) to produce the sulfamate products 4.12a-g in

good yields (35-66 %). Prepared sulfamoyl chloride was contaminated with p-toluenesulfonic

acid following its formation from chlorosulfonyl isocyanate, which led to partial BOC

deprotection. Attempts to append the sulfamate moiety and simultaneously deprotect in a one pot

synthetic procedure proved to be poor yielding. This was attributed to partial BOC deprotection

and potential side reactions resulting in a mixture of products poorly resolved by flash

chromatography. Thus, care was taken to ensure sulfamoyl chloride was sufficiently basic prior

to mixing to ensure conversion without loss of the protecting group. Lastly, BOC deprotection

using TFA in DCM provided final molecules 4.13a-g in excellent yields (73-89%).

Scheme 4.2. (a) (i) monosilyated ethylene glycol, PPh3, THF, 25 °C, 2 min; (ii) DIAD, 25 °C, 15

min, 83%; (b) (i) 4-cyclohexylbenzyl alcohol, PPh3, THF, 25 °C, 10 min; (ii) DIAD, 25 °C, 15

min, 82-74%; (c) X (HNR'R"), DIPEA, DMSO, 105 C, 40 min, microwave assisted, 65-97%;

(d) TBAF, THF, 25°C, 20 min, 80-88%; (e) sulfamoyl chloride, NaH, THF, 25 °C, 30 min, 75-

89%; (f) TFA:CH2Cl2 (1:1), 25 °C, 1 h, 63-95%; (g) formic acid, N2, 0 – 25 °C, 81%.

69

Derivatives that featured the lipophilic tetrazole bioisostere was alkylated in an alternative

fashion. Precursor 3.2 was treated with trityl protected tetrazole 4.13 using standard Mitsunobu

conditions. Surprisingly, no conversion to desired the product was observed. We reasond that the

steric bulk of the proximal trityl group could have prevented association with triphenylphosphine

(cone angle = 145°), thereby prohibiting reactivity. Alternatively, given that the tetrazole trityl

groups was exceedingly labile, an acidic species could potentially displace the trityl group and

disrupt desired transformation.

Trityl cleavage was found to occur during purification procedures, whereby a nearly quantitative

addition of a trityl group to tetrazole (as determined by thin-layer chromatography) produced

exceedingly poor yields following its purification by silica gel column chromatography. Trityl-

protected tetrazole was initially purified by first adsorbing the crude mixture to silica’s surface

using mild heating and under reduced pressure. Switching to a wet-loading procedure drastically

improved trityl protection yields, suggesting that heating in silica de-protected tritylated

tetrazoles. Although not utilized in our synthetic procedure, this gentle deprotection procedure

may allow for the chemoselective removal of trityl protecting groups in the presence of other

acid label groups. A related reaction was reported in the literature whereby silica gel supported

sodium hydrogen sulfate was used catalytically to remove a trityl group210

. It would be

interesting to investigate the substrate diversity to which silica gel-mediated deprotection of

tritylated-tetrazoles could be utilized. This has yet to be explored in the literature.

Tosylating tritylated tetrazoles on its pendant alcohol (4.14) allowed for the convenient

alkylation of the N9 position proceeding through an SN2 reaction in the presence of a non-

nucleophilic nitrogenous base (Scheme 3). Reaction through the SN2 mechanism unfortunately

decreased regioselectivity, with an approximate 2:1 mixture of N9:N7 being obtained. The

regioisomers were separated by column chromatography, with the N9 product isolated in good

yields providing 4.15. Formation of 4.16 was achieved by N2 alkylation under Mitsunobu

chemistry conditions. 4.17a-g were formed using aromatic substitution diversification. Global

deprotection of BOC and trityl groups using TFA produced final molecules 4.18a-g in good

yield.

70

Scheme 4.3. (a) trityl chloride, DBU, DCM, 25° C, 16 h, 96%; (b) tosylchloride, DMAP,

DIPEA, DCM, 0 → r.t., 16 h, 85%; (c) 14, DMF, K2CO3, 60 C, 62%; (d) (i) cyclohexylbenzyl

alcohol, PPh3, THF, 25 °C, 10 min; (ii) DIAD, r.t., 3 h, 68%; (e) X (HNR'R"), DIPEA, DMSO,

65 C, 40 min, 32-86 %; (f) TFA:CH2Cl2 (1:1), 25 °C, 1 h, 67-79%.

A lead derivative of the previous purine library (3.11ca) possessed a cyclohexyl carbonyl moiety

on the N2 position. To facilitate the acylation of these molecules, the N2 nitrogen was

deprotected using TFA or a Lewis acid (AlCl3). The remaining steps followed logically from the

methods described above. A summary of all synthesized agents can be found in Table 4.1.

71

Table 4.1. Summary and coding system for the 2nd

generation library of purine inhibitors of

STAT3.

4.2.2 ADME Profiling: Liver Mouse Microsomes and Caco-2 Cell Permeability Assay

Modified, 2nd

generation purines were explicitly designed to acheive improved pharmacokinetic

profiles. ADME profiling was performed on a comprehensive subset of the new purine library;

particularly, metabolic stability was determined through exposure to mouse liver microsomes

and a caco-2 cell mono-layer assay quantified agents permeability. Purine-based molecules were

incubated at 37 oC with pooled mouse microsomes before being quenched in acetonitrile,

centrifuged to removed protein debris, and then analyzed for stability using narrow-window

mass extraction LC/MS. Percent recovery for each compound was determined and compound

72

stability was classified based on the percentage remaining (Table 4.2). The synthesized

compounds possessed a variable response to enzymatic degradation, with the greatest variation

observed between different N9 functional groups. Purines appended with sulfamate and tetrazole

moieties showed moderate to high levels of stability (47% to 84% recovery). As anticipated, the

majority of prodrug purines were classified as unstable or moderately stable when subjected to

enzymatic degradation, attributed to their interaction with carboxylesterases found in mouse

microsomes. Agents that are acylated on the N2 with cyclohexyl carbonyl showed remarkably

low stability in liver microsomes. Surprisingly, it was noticed that several ester prodrugs were

stable to the 30 minute microsome treatment. Mouse microsome assays simulate first pass

metabolism; however, tolerance to liver enzymes is not necessarily detrimental to prodrug

inhibitor activity. In fact, it would beneficial for prodrugs to possess reasonable stability before

entering target cancer cells whereby intracellular esterases would expose the active drug.

Overall, purines that featured carboxylic acid replacements possessed reasonable stability while,

as anticipated, the majority of prodrug esters were readily degraded by carboxylesterases.

Table 4.2. ADME Profiling of 2nd

Generation Purine Inhibitors

73

The next step of the ADME profiling called for permability assessment of modified purines by a

caco-2 cell monolayer assay. Caco-2 monolayers were allowed to fully polarize and differentiate

before subjected to permeability analysis. With the exception of a single prodrug, 4.22, second

generation purine drugs were classified as membrane impermeable given their low influx

(Papp(A-B)) and efflux Papp(B-A)) rates. The result is surprising given the significantly

hydrophobic nature of newly developed inhibitors that should facilitate passive diffusion; in

particular, the prodrug esters which possess calculated log P (log transformed partition

coefficients) between 6-7 and should readily traverse the membrane. Given their hydrophobicity,

prodrug molecules could potentially aggregate in the required buffer solution thereby preventing

well migration. Care was taken to ensure test compounds were solubilised during experimental

procedures dispelling the notion that aggregation is acting as an impediment to diffusion across

cell membranes. To accurately determine solubility of prodrugs “shake-flask” methodologies

could be utilized, but, limited quantities of final product prevented evaluations using this method.

Additionally, if prodrug permeability could be correlated to poor aqueous solubility, it fails to

explain why tetrazole and sulfamate inhibitory molecules, which also solubilised in assay media,

failed to traverse the caco-2 monolayer. Post-assay recovery of purine molecules refutes

arguments that purine inhibitors are maintained within the lipophilic interior of the lipid bi-layer.

It is interesting that reducing polarity and removing the anionic character of purine agents failed

to facilitate passive diffusion through the cellular membrane. A recent school of thought opposes

the notion that the majority of drugs enter cells through passive diffusion, suggesting instead that

undiscovered transport proteins are responsible for mediating drug import211

. In this model

increasing hydrophobicity, would not necessarily confer greater permeability if the substrate is

unrecognized by transport proteins. However, the assertion that drug transport is essentially

always carrier-mediated is rather contentious, with several rebuttals published that strongly

oppose the notion212

. A less controversial scenario suggests the coexistence of diffusion and

carrier-mediated processes in drug transport213

. In the case of our purines, reduced or missing

drug transport carriers in caco 2 cells may result in their poor import. While purine agents

exhibited poor cell permeability in the caco-2 cell evaluations, other cancer cells may possess the

transporters necessary to import these inhibitory compounds. As such, 2nd

generation compounds

were surveyed for cellular and STAT3 inhibitory activity.

74

4.2.3 MTS and MTT Cytoxicity Assay

To quantify cellular efficacy, cell lines known to harbour elevated STAT3 levels including,

MDA-MB-468, DU-145, and OCI-AML2214

were treated with purine analogues and assessed for

inhibitor-induced cytotoxicity using an MTS colorimetric assay. In agreement with the observed

ADME profiling, biological activity was not observed across the library with the exception of

4.12e, an N9 sulfamate substituted purine. While agent 4.12e possessed poor cell permeability as

assessed by Caco-2 cell permeability assay, it did exhibit resistance to enzymatic Phase I

metabolic degradation. The greatest biological cell activity was observed in MDA-MB-468 cells

(EC50 = 19.9 ± 0.9 μM) with other cell lines possessing lesser potencies. To further evaluate

4.12e, 48 hour incubation with a panel of eleven multiple myeloma (MM) primary cancer cell

lines were assessed for levels of cell death using an MTT (3-(4,5-dimethylthiazol)-2,5-diphenyl

tetrazolium) cytotoxicity assay. 4.12e demonstrated potent, dose-dependant cytotoxic effects in

several cell lines, whilst being completely ineffective to others (Figure 4.2). Western blot

analysis determined the levels of activated STAT3 in each cell type. The most sensitive cell line,

XG6215

, possessed high levels of activated STAT3 and was shown to be completely inhibited at

10 μM of 4.12e. However, expected correlation to pSTAT3 levels was not universal. Inhibitor

4.12e proved effective against SKMM2 cells though they do not harbour pSTAT3. Conversely,

JJN3 cells possess elevated pSTAT3 levels but were insensitive to 4.12e. Thus, inconsistencies

in pSTAT3 expression and cellular potencies suggest that purine 4.12e’s activity is independent

of STAT3 signalling. Alternatively, given that MTT assays directly measure cell metabolism

rather than cellular death, 4.12e may be acting as a cellular metabolism suppressor. Thus, a

confirmatory investigation to measure apoptotic levels in MM cells was performed.

75

Figure 4.2. Western blot and the differential cellular response observed in the MTT assay when

multiple myeloma cells are treated with 4.12e.

4.2.4 Annexin Cell Results

An Annexin V Apoptosis216

assay qualified 4.12e as an apoptotic inducer by directly visualizing

the markers of cell death. XG6 and JJN3 MM cells were chosen as representative cell lines due

to their sensitivity to inhibitor treatment. Both cell lines were incubated with 4.12e in parallel to

positive control (anti-tumour mustard mephalan) for 48 hours and examined for cellular

apoptosis indicators. Annexin results paralleled that of the MTT, with XG6 experiencing

complete late-stage apoptosis following exposure to 4.12e at a concentration of 15 µM (Figure

4.3). JJN3 cells also mirrored the previous result, possessing a limited response to prolonged

treatment with 4.12e. With promising EC50 values against lethal multiple myeloma patient cancer

cell lines obtained, we set out to validate whether or not STAT3 served as the intracellular target

responsible for 4.12e's cytotoxicity.

76

Figure 4.3. Annexin assay output developed using Flowo software following 48 hour treatment

with 4.12e alongside positive control, mephalan. Bottom left quadrant indicates healthy cells,

bottom right quadrant visualizes early stage apoptosis, and top quadrants display late stage

apoptosis. Signal strength increases from blue to red.


We elected to perform a FP assay with next generation purines, rationalizing that the chemical

modifications made to molecules would attenuate previously observed interference (see Chapter

3.2.7). Binding affinities were determined utilizing non-phosphorylated, full-length STAT3

monomers incubated with fluorescently labelled STAT3 SH2 domain binding peptide, FAM-

GpYLPQTV-NH2, and treated with inhibitors and positive control, pYLPQTV. Inhibitory agents

commonly appended with 4-fluoroaniline at the C6 position and belonging to each family of

compounds, including MM cell active compound 4.12e, were tested at increasingly higher

concentrations (Figure 4.4). Unlike previous purine molecules that showed inconsistent FP signal

and abnormal levels of standard deviation, the curves generated by 2nd

generation purine

molecules were consistant and possessed acceptable deviations at the concentrations tested.

77

Dose-dependant decreases in polarization signal resulting from the inhibitor-mediated

displacement of the fluorescent peptide usually facilitates IC50 determination; however, we

observed negligible disruption of the STAT3-phosphopeptide complex at inhibitor

concentrations of up to 400 µM. Specifically, lead anti-cancer compound, 4.12e, also failed to

displace the fluorescent peptide even at the highest concentrations tested, suggesting that it does

not occupy the STAT3 SH2 domain.

Figure 4.4. Representative purine agents performed poorly in a competitive FP assay.

4.2.6 Phospho-Flow Cytometry

It is feasible that agent 4.12e, may bind elsewhere on the STAT3 protein preventing its

receptor/kinases association and thereby inhibiting its intracellular phosphorylation. Thus, a

phospho-flow experiment was utilized to rule out a STAT3-related mode of inhibitory action for

compound 4.12e. MM tumour cells, XG6 and OPM2, were starved overnight before treatment

with various concentrations of 4.12e (Figure 4.5)217

. Starved OPM2 cells were stimulated with

human interleukin-6, a potent stimulator of the STAT3 signalling pathway. After 30 mins, the

test cells were fixed and stained with mouse anti-pSTAT3-PE(BD). Samples were loaded onto a

FACSCalibur(BD) flow cytometer and then analysed using FlowJo software. Purine 4.12e failed

to inhibit STAT3 phosphorylation at concentrations cytotoxic to MM cells. Phospho-flow results

coupled with the obtained FP data is indicative of an agent working independently of STAT3.

78

Figure 4.5. Phosphorylated STAT3 levels measured by phospho-flow cytometry.

4.2.7 Initial Kinase Panel Screen

Given 4.12e's absence of in vitro activity against STAT3, we elected to explore other possible

cellular targets to delineate its observed potency in MM cells. Traditionally, purine therapeutics

have been successfully utilized in inhibiting protein kinases by occupying their ATP binding

sites. Many cellular kinases are oncogenic (Chapter 1.1.3), intracellular factors that promote the

cancer phenotype. As such, we explored 4.12e's potency toward many recognized tumour-

promoting kinases via a kinase filtration binding assay218

. Briefly, ten cancer related kinases,

ABL1, AKT1, c-Src, CDK1/cyclin B, CDK2/cyclin A, ERK2/MAPK1, FLT3, JAK2, JAK3, and

LCK were tested at a single concentration of 4.12e (50 μM). The assay measures performance of

target kinases in the presence of 32

P-γ-ATP or 33

P-γ-ATP. Only two kinases, JAK2 and JAK3,

displayed any significant inhibitory effects, showing 50% and 85% reduction of enzyme activity,

respectively (JAK tyrosine kinases are discussed in chapter 1.2.1). JAK, due to its association

with IL-6 receptors, has been implicated in MM and many other tumours219

. IC50 concentrations

for 4.12e in the JAK kinases were established through multi-dose experiments. As shown in

Figure 4.6, 4.12e exhibited activity against TYK1, JAK2 and JAK3 kinases with IC50's of 10.6,

79

16.6, and 10.5 μM, respectively, while JAK1 was negligibly inhibited (IC50 = 100 μM). Given

the potency of 4.12e in MM whole cells, the observed levels of JAK inhibition could contribute

to biological effect but are unlikely the only target. Furthermore, observed cellular inhibition of

JAKs should disrupt of pSTAT3 levels, which was not observed in phospho-flow studies.

Figure 4.6. Agent 4.12e’s inhibition of JAK family members kinase activity.

4.2.8 Kinome Screen

Given the response of the JAK family kinase and the structural homology observed in all kinases

catalytic sites, we reasoned that the assessment of greater kinome family may reveal other targets

that are strongly inhibited by 4.12e. To screen 4.12e's inhibitory activity, we employed

competitive qPCR screening to identify activity against a comprehensive "DiscoveRx

KINOMEscan" library of 456 human kinases. In this assay, kinases labelled with DNA were

treated with 4.12e (2.5 µM single concentration) and incubated with an immobilized ligand

designed to capture its target kinase. Ultra-sensitive quantitative PCR (qPCR) measured levels of

immobilized kinases when treated with 4.12e. These levels were compared to that of control

samples and hits were designated when captured kinase levels fell below a normalized 30 %

threshold. Images were generated using TREEspot software tool (Figure 4.7).

80

Figure 4.7. A complete kinome scan highlights insensitivity to treatment with 4.12e. Highlighted

in red are ABL1and AAK1. Images were generated using TREEspot software tool and reprinted

with permission from KINOMEscan, a division of DiscoveRx Corporation, Discoverx

Corporation 2010.

81

Surprisingly, kinases treated with 4.12e did not drop below the critical range needed for hit

designation. JAK families kinases, as expected, were untouched at the tested concentrations.

Mutant abelson murine leukemia viral oncogene homolog 1 (ABL1 (F317L)) and Adapter-

associated protein kinase 1 (AAK1) were the only kinases substantially inhibited at 50% and

52%, respectively. ABL1 is one half of the chimeric protein, BCR-ABL, which results from a

reciprocal translocation between chromosome 9 and 2280

. The discovery that fusion oncoprotein

BCR-ABL drives the formation and proliferation of chronic myeloid leukemia (CML) produced

potent tyrosine kinase inhibitors (TKI), specifically the blockbuster drug imatinib (Chapter

1.1.3)87

. Unfortunately, 20% of patients treated with imatinib develop mutations leading to drug-

resistance220

. One such mutant is ABL1 (F317L), a variant which demonstrated sensitivity to

treatment with 4.12e221

. Agents that bind ABL1 mutants and prevent their activity are potential

CML treatments.88

However, third generation TKIs in development boast binding affinities 100-

fold stronger than that of 4.12e. Additionally, aberrant ABL activity is unrelated to the

progression of multiple myeloma and is therefore not the biological target that elicits the

response in MM cells. An interesting line of research would be to test 4.12e for its potency in

imatinib resistant CML tumour cell lines.

The other kinase inhibited by 4.12e is AAK1. Early work suggests AAK1 plays an up-regulatory

role in the Notch pathway222

. Studies have shown that dysregulation of Notch signalling can lead

to various human diseases, including cancer223

. A recent study demonstrated that Dll1/Notch

interaction increases MM cell proliferation224

, suggesting that 4.12e is a Notch signalling

inhibitor that may hold additional off target effects on JAK. Exploration into AAK1's role in

MM development, as well as clarification of 4.12e impact on Notch signalling in MM cells, is

needed before assignment of 4.12e’s cellular activity is attributed to this kinase.

4.3 Conclusion

Success of carboxylic acid purines provided a platform for the creation of novel, N9 modified

purines. Next generation purines failed to improve the cell penetration limitations observed in

first generation molecules and had slightly decreased stability in comparison to their parent

molecules. The lack of cell permeability in lead hydrophobic purine agents gives credence to the

notion that a significant portion of drug transport is carrier mediated. A single agent, 4.12e,

possessed cellular potency, particularly in MM cell lines. Though new purines were modified

82

from STAT3 inhibiting molecules, next generation purines failed to display any affinity for

STAT3 in FP assay and failed to disrupt STAT3 phosphorylation in phospho-flow analysis. A

comprehensive kinome screen identified mutant ABL and AAK1 kinases as potential

intracellular targets. 4.12e inhibits a mutant ABL kinase that is found to induce resistence in

CML to imatinib treatment. Investigation into 4.12e’s use in imatinib-resistant CML lines

presents an opportunity for additional, interesting study. AAK1 relation to Notch signalling

could potentially explain 4.12e activity in MM, however, further studies would be needed to

confirm this assertion. Even with these two leads, there is still potential for 4.12e to be acting

against another cellular target. Further investigation is needed to truly isolate lead agents 4.12e’s

key cellular target.


Experimental methods for 2nd

generation purines are available in Section 10: Appendix 4.

83

5 Current Projects: Salicylic and Benzoic Purine Derivatives, Constrained Cyclic Pyrimidines, and Macrocylic Purines

5.1 Chapter Introduction

The following subsections summarize the progress I have made on three separate projects. Each

project has unique goals designed to explore different aspects of drug design, both in general and

specific to STAT3 SH2 domain. In these sections, I will address the current state of each project

and highlight challenges faced thus far. Troubleshooting efforts will be discussed and potential

solutions for unresolved issues will be postulated. Lastly, I will sketch where I foresee these

projects are headed.

5.2 Salicylic Acid Trisubstituted Purines: an Exploration into Salicylics Acid’s Affinity for STAT3’s SH2 domain’s Phosphotyrosine Binding Pocket Inhibitors

5.2.1 Introduction

N9-modified purines failed to reproduce the STAT3 binding affinity possessed by predecessor

compounds. These purine agents were decorated with a variety of hydrophilic groups to achieve

enhanced interaction with the STAT3 SH2 domain by accessing the cationic, pTyr binding sub-

pocket. Several potent small molecule inhibitors of STAT3 (5.1-5.3) were reported to be

functionalized with salicylates that successfully bound to the cationinc pTyr pocket (Figure

5.1A)155, 225, 226

. Additionally, Haftchenary et al. (unpublished) has recently reported that agents

furnished with 4-methylbenzoic acid bound to STAT3 with affinity equivalent or more portent

than analogous salicylic agents (5.4). These lead small molecules displayed potent STAT3

binding, cellular potency, and tumour suppression in vivo. To re-establish the purine molecule’s

affinity for the STAT3 SH2 domain, a series of N9 appended salicylic and benzoic acid

derivatives will be synthesized (Figure 5.1B).

84

Figure 5.1. (A) Established STAT3 Inhibitory molecules featuring salicylates and benzoic acid.

(B) Proposed purine inhibitory moleulces.

The successful application of salicylic acid containing purines would support the hypothesis that

this proposed functional group is well tolerated within the cationic pTyr binding region of

STAT3’s SH2 domain. In addition, we propose to prepare a set of purines decorated with a

phosphotyrosyl side chain appendage as well as the metabolically stable difluoro(phenyl)-

methylphosphonic acid analogue. This approach has been successfully used by McMurray et al.

in STAT3 peptidomimetics153

. The activity of substituted phosphotyrosyl purine agents would

serve as a standard for evaluating salicylic acid derivative activity. Thus far, synthesis of several

benzoic and salicylic acid derivatives have been accomplished, while work on pTyr and

phosphonic acid agents is on going.

5.2.2 Proposed Synthesis

Synthesis of salicylic and benzoic acid purine analogues followed previously described

procedures (Scheme 5.1). First, 4-methyl salicylic acid was suitably protected as its acetonide

(5.5). Radical-mediated bromination using benzyl peroxide and N-bromosuccinimide in carbon

tetrachloride afforded both the mono-brominated (5.6) and di-brominated material. An SN2

85

reaction featuring 5.6 as the bromo-electrophile with previously described purine pre-cursor 3.2

conveniently afforded N9-alkylated product 5.7a. N2 alkylation (5.8a) and nucleophilic

substitution (5.9a) at C6 were afforded in good yield using established methods. Global

deprotection of acetonide and BOC groups were achieved using a 1:1 mixture of TFA:DCM

generating final molecule 5.10a in excellent yield.

Scheme 5.1. (a) Acetone, H2SO4, 50 °C, 62%; (b) NBS, BPO, CCl4, 50 °C, 38%; (c) Br-Y,

DIPEA, DMF, 55 °C, 66%; (d) (i) cyclohexylbenzylalcohol, PPh3, THF, 25 °C, 10 min (ii)

DIAD, 25 °C, 1 h, 73%; (e) X = HNR’R’’, DIPEA, DMF, 130 °C, 30 min, 66-86%; (f) TFA:H2O

(9:1), 25 °C, 85%; (g) LiOH, THF: H2O:MeOH (3:1:0.1), 60 °C, 50%.

Benzoic acid derivatives were developed using an analogous procedure starting from 4-

(bromomethyl)benzoic acid. Attempted global deprotection of agent 5.9b using a 2 M HCl

aqueous solution heated at 60 °C overnight readily removed BOC group but failed to expose

benzoic acid (5.10b). Ester hydrolysis was achieved using excess LiOH in a THF:H2O:MeOH

86

(3:1:0.1) mixture heated overnight at 60 °C to produce 5.11b, after attempts using milder

saponification conditions failed.

5.2.3 Potential Future Directions

Proposed synthesis of pTyr and phosphonic acid would likely follow the conventional 2,6,9-

heterotrisubtituted purine procedures featuring the appropriate modifications to expose free

phosphonic acids at the final steps (Scheme 5.2). Pathway A shows a heterotrisubstituted purine

that is furnished with an 4-iodobenzyl group, which is an acceptable partner for a copper-

cadmium cross coupling with diethyl bromodifluoromethylphosphonate. Treatment with TMSI

would efficiently expose the free phosphate. Dietrich227

and Kennedy228

have published

alternative procedures towards the development di-fluorinated phosphonic acids if the proposed

synthetic methodology fails. The 4-methylphenol purine shown in Pathway B would be treated

with an analogous procedure to those used in the development of phosphorylated

peptidomimetics (outlined in section 2.2.2).

Scheme 5.2. Proprosed synthesis of phosphotyrosyl control purines.

The major goal of this project is to establish salicylic and benzoic acids functional groups as

potent of SH2 domain binders. As such, the FP assay will be critical in the evaluation of STAT3

SH2 domain affinity. Comparisons between the salicylic and phosphate agents will strengthen or

potentially weaken the argument that salicylic acids are functional pTyr mimics. To confirm

potency observed in FP assay analysis, isothermal titration calorimetry (ITC) and 2D NMR

87

experiments with STAT3 SH2 domain will be conducted. All synthesized agents will be

subjected to cancer cell screening and assessed for STAT3-reliant activity.

5.3 Constraining Lead 2nd

Generation Purine Agents

5.3.1 Introduction

While exploration into lead purine agent 4.12e’s activity was still underway, a plan for garnering

increased cellular potency was developed under our original assumption that 4.12e’s cellular

activity was STAT3 specific. Rigidification of drug molecules is a common strategy employed

by medicinal chemists to impart favorable energetics by reducing the entropic penalties of

binding229

. We proposed that cyclizations aimed to rigidify lead agent 4.12e that resulted in a

novel scaffold featuring a 7-membered ring, would be improved protein binders. Ligand docking

of proposed cyclized-molecules to the STAT3 SH2 domain using GOLD docking software

displayed a consistent binding mode, with fewer deviations in top solution orientations as

compared to un-constrained 4.12e. To generate cyclized-pyramidine cores we proposed the

conversion of 5-methyluracil (thymine) to the conjugated pyrrole via a modified Leimburger-

Batcho230

indole synthetic protocol; further commentary on the preparation of these molecules

will be discussed below. Concurrently, computational analysis would be used to quantify the

level of conformational freedom231

in agent 4.12e as compared to constrained cyclic-

pyrimidines. Results from the comprehensive in silico study will be compared to in vitro

experiments to qualify whether limiting conformational freedom resulted in increased binding

affinity in this system.

88

Figure 5.2. Proposed cyclizations of lead agent 4.12e

5.3.2 Proposed Retro-Synthesis and Synthetic Progress

A proposed retrosynthetic analysis of the conformationally restrained novel 5-methyluracil

analogues is shown in Scheme 5.3. Addition of the sulfamate appendage (5.12) was selected as

the final step to avoid complications due to its ability to act as a leaving group and its weakly

nucleophilic nitrogen. Installation of sulfamate would likely follow procedures for 2nd

generation

purines (Chapter 4.2.1). The preceding terminal alcohol would be afforded by the anti-

markovnikov addition to the olefin (5.13). Deoxyfluorination of the phenol could be achieved

through a novel pathway described by Tang and Ritter et al. whereby a newly developed

fluorinating agent would deliver aryl fluorides in a one-step ipso substitution of phenols (5.14).

We reasoned that fluoride transfer would be best initiated after the harsh conditions of the

nucleophilic aromatic substitution step needed to install the cyclohexylisoquinoline substituenty

(5.15). Alternatively, cyclohexylisoquinoline substitution at position X using a Buchwald-

Hartwig amination procedure could be a viable alternative.

89

Scheme 5.3. Retrosynthetic analysis of cyclic pyrimidines.

Cyclization to form the proposed 7-membered heterocycle could occur through several

mechanisms. The simplest of which would be to utilize an SN2 type reaction (5.16). A 2-methyl-

aniline featuring a protected oxygen species at the 4 position could be incorporated through

Buchwald-Hartwig amination or harsher aromatic nucleophilic substitution reactions (5.17). The

benzylic position of the aniline would provide the chemical potential for subsequent cyclization

procedures. Access to the BOM-iodinated pyrrole (5.18) follows directly from the procedure set

forth by Bambuch and Holý et al232

and Guimarães and Cardozo et al233

. Progress made along

this synthetic route is outlined in Scheme 5.4.

Cardozo and co-workers described the nitration of 5-methyluracil using a solution of nitric and

sulfuric acid, which was reproduced to affect clean conversion to 5.19 (Scheme 5.4). We

deviated from the reported isolation procedure, electing instead to carefully neutralize the cooled

acid solution with 1 M NaOH solution and extracted nitrated product (5.19) from the resulting

aqueous layer using EtOAc. The purified product was reacted with dimethylformamide

dimethylacetal, to produce the enamine, 5.20, in good yield. A reaction analogous to

Leimgruber-Batcho indole synthesis using Zn metal as a reducing agent and acetic acid solvent,

produced cyclized pyrrole, 5.21, in appreciable yield.

90

Scheme 5.4. (a) HNO3, H2SO4, 25 °C, 16 h, 78 %; (b) DMA-DMF, DMF, 100 °C, 4 h, 48 %; (c)

Zn, AcOH, 100 °C, 16 h, 89 %; (d) PhPOCl2, 180 °C, 1 h, 75% (e) NIS, THF, 25 °C, 1 h, 87 %;

(f) BOM-Cl, NaH, THF, 25°C, 85 %.

The next step called for the chlorination of 5.21 in neat phenylphosphonic dichloride while

heating at 180 °C for 1 hour. Progress in the synthesis of macrocylic pyrimidines stalled at this

step. Product 5.21 was isolated and purified in accordance to the published procedure, whereby

the product was concentrated, washed with water and dried with ether. However, it was observed

that reaction with this material under chlorination conditions rapidly turned black upon heating

creating an extremely viscous solid yielding no desired product. Alteration of the chlorination

procedure included the use of different heating temperatures and methods, increasing volumes of

phenylphosphonic dichloride, and substitution of reagents (phosphorous chloride was used in

place of phenyphonic dichloride), all of which failed to generate product. Thus, we switched our

focus to the starting material, postulating that residual zinc or water found within the product

may be reacting with the chlorinating reagent and abolishing reactivity. Extraction procedures

proved to be inefficient for recovering product from an aqueous environment. The use of

relatively polar tert-butyl alcohol as the organic, non miscible solvent worked appreciably better

than EtOAc. The limited amounts of 5.21 recovered from the EtOAc extraction reacted

efficiently with phenylphosphonic dichloride using the published conditions to produce 5.22.

However, reactions with tert-butylalcohol recovered material did not result in chlorination.

Iodination procedures using N-iodosuccinimide produced agent 5.23, which was effectively

protected using benzyl chloromethyl ether (BOM-Cl) in THF to produce agent 5.24, as

documented by Bambuch and Holý et al.

91

In order to produce the starting material needed to explore novel chemical transformation,

reactions were scaled up. Reactions once again proceeded smoothly until reaching the

deoxychlorination step. Given the impracticality of the EtOAc extraction, alternative

purifications of 5.14 were explored to ensure compatibility with chlorination reagent. The crude

pyrrole product was dissolved in alkaline NaOH solution and vacuum filtered through filter

agent Celite to remove zinc particulate. Filtrate was neutralized using HCl and solvent was

removed in vacuo. Recovered solid material was washed with distilled water at 0 °C, dried with

ether, and incubated at 120 °C for 24 hours. The purified and dried material was poorly

converted to the chlorinated product (<10%) under the same conditions which successfully

converted the extracted product.

5.3.3 Potential Future Work

Currently, synthesis of cyclic pyrimidines is still ongoing. In order for the reaction to proceed

further an efficient purification procedure is required for 5.21 following its reaction in acetic acid

and zinc. Given the comprehensive purification procedures undertaken, there may be an as yet

unrecognized source for the un-reactivity of pyrrole 5.21. Alternative reducing procedures

should be investigated for the cyclization of 5.20 to circumvent issues with purfication. Also,

reducing agents that have shown compatibility with Leimgruber-Batcho indole synthesis should

be explored for pyrrole conversion and convenient purification.

5.4 Macrocyclic Purines: Further Investigation into Mitsunobu Chemistry and Potential Application in Combinatorial Chemistry

5.4.1 Introduction

We have shown that Mitsunobu chemistry can be used to efficiently furnish 2,6,9-

heterotrisubstituted purines. We aimed to expand the scope of existing Mitsunobu-mediated

purine transformations by synthesizing novel purine macrocycles by joining two purines via an

ethylene linker (5.25a-b) (Figure 5.3A). Furthermore, we pursued the development of a synthetic

procedure amenable to derivatization. The convergent synthetic route would allow for the rapid

development of a macrocyclic purine library. Macrocyclic purines represent a novel chemical

entity that are conformationally constrained and potentially suitable for metal chelation. A

promising feature of macrocyclic purine chelators are their inherent biological compatibility that

92

could potentiate increased cellular uptake of these compounds. Alternatively, non-chelating

macrocyclic purines could access two distinct protein binding sites (likely ATP sites), which

could lead to increased binding affinity and biological activity.

Energy minimization of proposed anti-parallel macrocycles (5.25a) produced a novel

comformation of non-overlapping, planar structures (Figure 5.3B). Parallel macrocycles (5.25b)

produced non-symmetric orientations when energy minimized. Both macrocyclic structures have

a high potential for chemical diversification, with the resulting chemical library potentially

yielding biologically significant molecules. For example, the proposed macrocylic purines could

have a number of important intracellular targets including ATP-site binders or DNA intercalators

based on structure similarity. Following explorations into combinatorial chemistry, rationalized

modifications to linker molecules could potentiate the creation of macrocyclic purine metal

chelators (5.26) and dual nucleotide anti-metabolites (5.27) (Figure 5.3C).

Figure 5.3. (A) Proposed anti-parallel and parallel macrocyclic purines (B) Front and side views

of macrocycles (C) Potential modifications for future macrocyclic purines.

5.4.2 Synthesis

Initially, a linear synthetic procedure was pursued for the synthesis of parallel macrocyclic

purines (Scheme 5.5). Mono-silyl protected ethylene glycol alkyalted the N9 position of (3.2)

under conventional Mitsunobu conditions to form (5.28). TBAF efficiently liberated the silane

93

exposing the free alcohol 5.29, which was subsequently reacted with another equivalent of 3.2

using Mitsunobu procedures to form linked product (5.30). Heightened reactivity of the N9

position and the insufficient chain length of the ethylene linker prevented both intermolecular

and intramolecular reactions at the N2 position. Attempts to link the N2 positions using

Mitsunobu chemistry has yet to yield macrocyclic product (5.25b).

Scheme 5.5. (a)(i) PPh3, THF, 25 °C, 10 min; (ii) DIAD, 30 min, 25 °C, 85%; (b) TBAF, THF,

25 °C, 30min, 89%; (c)(i) PPh3, THF, 25 °C, 10 min; (ii) DIAD, 30 min, 25 °C, 85%.

The need for larger quantities of cyclization precursor 5.30, in order to investigate

macrocyclization conditions, stimulated the pursuit of an improved method to produce 5.30. It

was postulated that the rapid kinetics of N9 versus the N2 Mitsunobu-mediated alkylation would

allow ethylene glycol and two equivalents of 3.2 to be readily converted to ethylene linked

product 5.30 (Scheme 5.6). The conjecture proved correct and 5.23 was cleanly obtained using

the Mitsunobo method. With 5.30 in hand, pursuit of macrocylic ring closure is now underway.

Scheme 5.6. (a)(i) PPh3, THF, 25 °C, 10 min; (ii) DIAD, 30 min, 25 °C, 79%.

A limitation in the synthetic method discussed above was the lack of diversification potential.

Nucleophilic aromatic substitution on symmetric macrocycles would likely result in homo-

functionalized macrocycles. As such, we developed a synthetic method that would allow for the

convenient synthesis of either homo or hetero substituted macrocycles (Scheme 5.7).

Futhermore, this synthetic protocol could be utilized to make parallel or antiparallel macrocyclic

purines. Purine 5.31 is decorated with two orthogonally protected ethylene glycol linkers in its

94

N9 and N2 positions using Mitsunobu procedures. Next a diverse set of nucleophiles will be

appended to the purines C6 position (5.32). A second diverse set of pronucleophile purines

(5.33) would be created to act as acceptors of alkylation in the N9 and N2 positions. Selective

deprotection of ethylene linkers (5.34a = acetyl protected, 5.34b = silyl protected) would allow

the creation of parallel (5.35a) and anti-parallel (5.35b) macrocyclic precursors. Next, when the

remaining ethylene linker alcohol is exposed, the system is preorganized for the intramolecular

ring closing to form heterosubstituted purine macrocycles (5.29a-b). A one-pot procedure

consisting of equal portions of the diverse purine 5.25 and 5.26 would allow for the rapid

expansion of the macrocyclic purine library.

Scheme 5.7. Route currently being pursued for the production of parallel and anti-parallel purine

macrocycles.

5.4.3 Future Directions

Before a convergent approach can be established, the formation of an individual macrocycle

using the above synthetic protocol must be validated. As such, primary focus should be placed

on forming both parallel and anti-parallel macrocycles using C6 substituted purines as alkylation

acceptors. C6 susbtituted purines could significantly change the electronics of the system,

leading to the incompatibility of the N2 position to Mitsunobu conditions. Once derivatives are

95

assembled, validation of these compounds as bi-modal DNA intercalators can be achieved

through fluorescent intercalator (ethidium bromide) displacement assays. Alternatively, they can

be examined for affinity for ATP dependant proteins. More sophisticated macrocycles, like

proposed nucleotides and nitrogen-rich cation chelators could also be pursued using similar

synthetic methodologies. In particular, metal-ion chelating nucleotides could be of significant

interest in phosphate-peptide recognition studies, an interesting field of research that is ongoing

within our lab. It is the opinion of this author that potential applications for macrocyclic purines

is very rich, with the pursuit of their efficient synthesis of immediate relevance to the chemistry

community.

96

6 Concluding Remarks

The projects discussed in this thesis explored the structural requirements of STAT3 SH2 domain

inhibitors. Disruption of the STAT3 complex was accomplished through two distinct molecular

families. The peptidomimetics described in Chapter 2 were rationally designed to incorporate

structural components used successfully to mimic parent peptides. A comprehensive in silico

screening process and pharmacophore development was utilized to develop STAT3 purine

agents. Each class of compounds and the methodologies employed to furnish them have their

limitations which require further discussion. The 2nd

generation purines described in Chapter 4

highlighted the unpredictable nature of functional group replacement, whereby changes in a

single group elicited a loss of affinity for the STAT3 protein. The lessons learned about the

structural requirements of a STAT3 inhibitory molecule will be utilized to re-engineer purine

molecules to potently bind STAT3. Success of STAT3 inhibitory agents will be related to other

transcription factors and the notion that transcription factors are undruggable targets will be

revisited.

Overall, the rationally designed peptidomimetic library showed moderate STAT3 affinity, with

select compounds displaying potent STAT3 binding. The success of the lead agent 2.12aa

established that the usage of a properly substituted biphenyl ring could simulate proline

containing di-peptides, as was proposed by in silico docking experiments. A major limitation of

this agent was the pTyr moiety, which made these compounds poorly cell permeable and

metabolically unstable. To overcome this limitation, research groups have employed the use of

phosphatase stable derivatives coupled with enzymatic cleavable protecting groups.

Incorporation of such functionality could improve upon the cellular activity of lead

peptidomimetic agents.

An alternative approach to garner increased activity may have been alluded to by the success of a

non-phosphorylated species (2.12aa-OH) in cell studies. There have been reports of selective

phosphorylation of antiviral agents by viral thymidine kinases234

, which could promote the

discovery of highly selective inhibitors. An analogous approach for use in cancer treatment may

be a viable therapeutic strategy. Given the significance of aberrant tyrosine kinase activity in

many tumour types it may be possible that phenol agents, like 2.12aa-OH, could be

phopshorylated within the cell. Designing a phenol prodrug to interact with an aberrant cancer

97

promoting tyrosine kinase would be a challenge, but there would be many benefits of developing

such an agent. Phenol prodrugs lack a polar phosphate group, which will improve cell

penetration. Additionally, cells overexpressing cancer-promoting kinases will result in drug

phosphorylation and will specifically sequester the active drug in diseased cells. Lastly, these

novel prodrugs will have limited off target effects in healthy cells where aberrant kinase activity

absent.

Furthermore, enchancement of peptidomimetic agents activity may lie in the observeation when

both phosphorylated and non-phosphorylated analogues were subject to metabolic degradation

when exposed to ADME profiling. To prevent degredation, the peptidic character of the tyrosine

and leucine residues should be replaced by stereochemical analogues. The usage of a non-

hydrolyzable phosphate group and the incorporation of unnatural stereochemistry could furnish

superior peptidomimetic inhibitors. Given the limited successes of peptidomimetics as drug

molecules, these molecules may better serve as structural guidelines for the development of non-

peptidic small molecule inhibitors.

First generation purines were designed purely in silico to fit a developed pharmacophore model.

The constructed pharmacophore model highlighted that tripodal agents would properly

accommodate the STAT3-SH2 domain. A library of diverse 2,6,9-heterotrisubstitued purines

explored the chemical space set forth by the pharmacophore. Of the many compounds

synthesized, it was found that several displayed strong binding affinity for the STAT3 protein

and possessed cellular activity. Not suprisingly, all of the successful STAT3 inhibitory

compounds were appended with the cyclohexylbenzyl derivatives. Given the presence of this

functional group on other proposed STAT3 SH2 domain binders, it is this author’s opinion that a

clinically relevant STAT3 agent will bear the cyclohexylbenzyl or a nearly equivalent chemical

moiety. Whether purine agents are the ideal platforms for STAT3 inhibition is uncertain.

However, the potencies observed by first generation agents supports the use of docking

algorithms and pharmacophore modelling in protein inhibitor design.

Rational and in silico design methodologies were utilized for the development of structurally

distinct STAT3 inhibitory molecules. The design of peptidomimetics relied heavily on the

structural requirements set forth by established STAT3 inhibitory peptides. The library designed

using this approach benefited from being based on established STAT3 binders, as most

98

peptidomimetic agents possessed affinity for the STAT3 protein. However, while molecules that

are designed from known binders have an increased likelihood of reproducing potent activity, the

molecules are limited in their structural scope. Proposed modifications to hit molecules are

restricted to the structural framework set forth by that lead compound. In contrast, in silico

design of purine molecules allowed for the full exploration of the STAT3-SH2 domain. Without

having a parent structure that limits design, any number of chemical entities can be assembled to

satisfy the protein surface. This is summarized in the constructed pharmacophore plot. We

selected to expand off of a rigid purine core scaffold given the planarity of the SH2 domain and

its alignment with the pharmacophore model. However, a number of core scaffolds could have

been chosen in place of the purine. Often, it is the discretion of the designer on which scaffold is

choosen to pursue. While in silico design leads to unique inhibitory molecules, there is a chance

that developed molecules, which lack the established binding elements of a lead compound,

would fail to bind target proteins. Lack of predicted agent potency can be attributed to nature of

the protein-ligand interface where an induced fit is difficult to predict. Thus, while in silico

methods allow for diverse structural exploration, there is no guarantee of their activity.

It is the opinion of this author that the combined usage of in silico and rational design can furnish

potent inhibitory molecules against a wide-range of biological targets. The methodology

employed in Chapter 3 could be the basis for in silico design, whereby protein surface

investigation and the development of a pharmacophore model can be utilized to produce

inhibitor compounds. Molecules that are designed to fit a pharmacophore model should possess a

greater chance of displaying binding potency as opposed to molecules identified through the in

silico screening of assorted chemical libraries. The development of a synthesized inhibitory

library can then be tested for in vitro activity. Once active molecules are discovered, rational

design principles can then be applied on molecules that have already benefited from exploration

of the protein surface. While rational design aimed to increase potency is often successful, the

flexibility of ligand-protein interaction can lead to unexpected results. Therefore, it is this

author’s opinion that serendipity is still a welcome element in inhibitor discovery.

The 2nd

generation purine library highlighted the unpredictability of rational modifications.

Proposed purine molecules aimed to increase lipophilicity and maintain STAT3 activity.

Unfortunately, these agents were found to be poorly cell permeable and lacked affinity for

STAT3. Both the tetrazole and sulfamate purines were designed to partake in interaction with the

99

cationic binding pocket of STAT3. Their lack of affinity for STAT3 are an indication that these

functional groups are incompatible with the STAT3 SH2 domain. A single sulfamate compound,

4.12e, displayed activity in MM cell lines, a serendipitous result. The subsequent discovery that

compound 4.12e inhibited ABL mutant requires further exploration. Imatinib resistant CML

should be tested with 4.12e to reveal whether there is therapeutic potential in these cell lines.

Chapter 5 outlined projects that are currently being investigated. Proposed salicylic and benzoic

purine molecules are rationally designed based on the success of known STAT3-SH2 domain

binders. The salicylic group has been shown to adequately accommodate the cationic pTyr

binding pocket found the SH2 domain. Should salicyclic purines fail to elicit STAT3 disruption

it can be concluded that the purine scaffold is sensitive to substitution at its N9 position. Smaller

hydrophillic groups can be explored in this position to see if they are better tolerated by the

STAT3 SH2 domain. Next, cyclic pyrimidines were designed to constrain lead agent 4.12e and

thereby increase their binding affinities. Unfortunately, the exact biological target of 4.12e has

yet to be discovered. However, these proposed cyclic pyrimidines should be pursued, as they

present a novel chemical entity and their structural similarity to known inhibitory molecules

could engender them with potent biological activity. Lastly, we purposed an extension to the

Mitsunobu chemistry utilized to produce heterotrisubsitituted purines for use in the creation of

macrocylic purines. A convergent synthetic methodology has been pursued which will allow for

the rapid development of a chemical library. Macrocyclic purines are potential metal ions

chelators that will be evaluated for specific metal ion affinity. The presense of purine

functionality could potentiate biological compatability, particularly, interaction with ATP

binding sites or DNA.

A significant portion of the work described in this thesis sought to develop agents that recognize

and inhibit STAT3. There has been increasing evidence, within our group and others, that dispels

the notion that transcription factors are undruggable targets. While PPIs are difficult regions to

target with designed molecules, the suggestion that they are impossible to target seems

counterintuitive when contemplating cellular biology. PPIs are necessarily specific and

controlled, otherwise, the protein complexes critical to cellular survival would be unable to

function. Given that protein specificity is observed in nature, it is reasonable to conclude that

scientists should be able to reproduce these interactions. As our understanding of the critical

features of molecules that target PPI continues to grow, so will our successes in disrupting this

100

interaction. Furthermore, if we couple molecular insights with the ongoing identification of new

biological targets and better resolved protein structures, prospects for the successful disruption

of these interfaces will continue to increase.

The impact that the successful inhibition of STAT3, or other transcription factors, will have on

medicinal chemistry is difficult to predict. Proponents of targeting oncogenic transcription

factors suggest that these agents would reverse cancer cell malignancy, thereby leading to cancer

cell specific death with limited toxic side-effects. In support of this notion is a phase 0 clinical

trial of STAT3 oligonucleotide which did not exhibit dose-limiting toxicities. While it is exciting

that these agents failed to elicit toxic effects, further studies will have to be conducted to

establish the drugs proposed downregulation of gene expression and any anti-tumorogenic

effects. If this study can be paralleled to other transcription factors, it suggests that drugs that

target transcription factors would have improved drug-safety profiles as compared to clinically

approved kinase inhibitors. However, though transgenic and gene knockout studies validate

transcription factors as cancer targets235, 236

, it remains to be seen if selective agents will be

capable of causing an anti-tumour effect independant of other therapeutics. It is this author’s

opinion that targeted inhibition of transcription factors will have a significant role in the future of

cancer treatments and the question as to whether these agents are potent enough to stand alone or

act as critical components in cancer drug cocktails will be answered in the not so distant future.

101

References

1. Mann, J. 2004, Life saving drugs : the elusive magic bullet, Royal Society of Chemistry,

Cambridge.

2. Hippocrates. 1849, The genuine works of Hippocrates; Printed for the Sydenham society.

London Printed for the Sydenham society 1849.

3. Yamagiwa, K. & Ichikawa, K. 1915, "Experimentelle Studie über die Pathogenese der

Epithelialgeschwülste", Mitt.Med.Fak.Univ.Tokyo, vol. 15, pp. 295.

4. Chabner, B. & Roberts, T. 2005, "Timeline - Chemotherapy and the war on cancer", Nature

Reviews Cancer, vol. 5, no. 1, pp. 65-72.

5. Gilman, A. 1963, "The Initial Clinical Trial of Nitrogen Mustard", American Journal of

Surgery, vol. 105, no. 5, pp. 574-578.

6. Gilman, A. & Philips, F.S. 1946, "The Biological Actions and Therapeutic Applications of the

B-Chloroethyl Amines and Sulfides", Science, vol. 103, no. 2675, pp. 409-&.

7. Coggins, P., Ravdin, R. & Eisman, S. 1960, "Clinical Evaluation of a New Alkylating Agent -

Cytoxan (Cyclophosphamide)", Cancer, vol. 13, no. 6, pp. 1254-1260.

8. Lesch, J.E. 2007, The first miracle drugs : how the sulfa drugs transformed medicine, Oxford

University Press, New York.

9. Farber, S., Cutler, E., Hawkins, J., Harrison, J., Peirce, E. & Lenz, G. 1947, "The Action of

Pteroylglutamic Conjugates on Man", Science, vol. 106, no. 2764, pp. 619-621.

10. Farber, S., Diamond, L., Mercer, R., Sylvester, R. & Wolff, J. 1948, "Temporary Remissions

in Acute Leukemia in Children Produced by Folic Acid Antagonist, 4-Aminopteroyl-

Glutamic Acid (Aminopterin)", New England Journal of Medicine, vol. 238, no. 23, pp. 787-

793.

11. Elion, G. 1989, "The Purine Path to Chemotherapy", Science, vol. 244, no. 4900, pp. 41-47.

102

12. Burchenal, J., Murphy, M., Ellison, R., Sykes, M., Tan, T., Leone, L., Karnofsky, D., Craver,

L., Dargeon, H. & Rhoads, C. 1953, "Clinical Evaluation of a New Antimetabolite, 6-

Mercaptopurine, in the Treatment of Leukemia and Allied Diseases", Blood, vol. 8, no. 11,

pp. 965-999.

13. Targeted therapies in cancer: myth or reality? 2008, Springer, New York.

14. Signal transduction: pathways, mechanisms, and diseases, 2010, Springer, Heidelberg.

15. Molecular pharmacology: from DNA to drug discovery, 2012, Wiley-Blackwell, Chichester,

West Sussex.

16. Verma, A., Kambhampati, S., Parmar, S. & Platanias, L.C. 2003, "Jak family of kinases in

cancer", Cancer and metastasis reviews, vol. 22, no. 4, pp. 423-434.

17. Yu, H. & Jove, R. 2004, "The stats of cancer - New molecular targets come of age", Nature


18. King, N. 2004, "The unicellular ancestry of animal development", Developmental Cell, vol.

7, no. 3, pp. 313-325.

19. Pawson, T. 1995, "Protein Modules and Signaling Networks", Nature, vol. 373, no. 6515, pp.

573-580.

20. Imming, P., Sinning, C. & Meyer, A. 2006, "Opinion - Drugs, their targets and the nature and

number of drug targets", Nature Reviews Drug Discovery, vol. 5, no. 10, pp. 821-834.

21. Landry, Y. & Gies, J. 2008, "Drugs and their molecular targets: an updated overview",

Fundamental & clinical pharmacology, vol. 22, no. 1, pp. 1-18.

22. van Driel, R., Fransz, P. & Verschure, P. 2003, "The eukaryotic genome: a system regulated

at different hierarchical levels", Journal of cell science, vol. 116, no. 20, pp. 4067-4075.

23. Gomperts, B.D. 2009, Signal transduction, 2nd ed., Elsevier/Academic Press, Boston.

24. Bayliss, W. & Starling, E. 1902, "The mechanism of pancreatic secretion.", Journal of

Physiology-London, vol. 28, no. 5, pp. 325-353.

103

25. Banting, F.G., Best, C.H., Collip, J.B., Campbell, W.R. & Fletcher, A.A. 1922, "Pancreatic

Extracts in the Treatment of Diabetes Mellitus.", Canadian Medical Association journal, vol.

12, no. 3, pp. 141-6.

26. Triggle, D.J. 2000, "Pharmacological receptors: A century of discovery - and more",

Pharmaceutica acta Helvetiae, vol. 74, no. 2-3, pp. 79-84.

27. Langley, J. 1901, "Observations on the physiological action of extracts of the supra-renal

bodies.", Journal of Physiology-London, vol. 27, no. 3, pp. 237-256.

28. Langley, J.N. 1905, "On the reaction of cells and of nerve endings to certain poisons, chiefly

as regards the reaction of striated muscle to nicotine and to curari", Journal of Physiology-

London, vol. 33, no. 4/5, pp. 374-413.

29. Cuatrecasas, P. 1974, "Membrane Receptors", Annual Review of Biochemistry, vol. 43, pp.

169-214.

30. Henderson, R. & Unwin, P.N.T. 1975, "Three-dimensional model of purple membrane

obtained by electron microscopy", Nature, vol. 257, no. 5521, pp. 28-32.

31. Strader, C.D., Fong, T.M., Tota, M.R., Underwood, D. & Dixon, R.A.F. 1994, "Structure and

Function of G Protein-Coupled Receptors", Annual Review of Biochemistry, vol. 63, no. 1,

pp. 101-132.

32. Okada, T., Le Trong, I., Fox, B.A., Behnke, C.A., Stenkamp, R.E. & Palczewski, K. 2000,

"X-Ray Diffraction Analysis of Three-Dimensional Crystals of Bovine Rhodopsin Obtained

from Mixed Micelles", Journal of structural biology, vol. 130, no. 1, pp. 73-80.

33. Rasmussen, S.G.F., DeVree, B.T., Zou, Y., Kruse, A.C., Chung, K.Y., Kobilka, T.S., Thian,

F.S., Chae, P.S., Pardon, E., Calinski, D., Mathiesen, J.M., Shah, S.T.A., Lyons, J.A.,

Caffrey, M., Gellman, S.H., Steyaert, J., Skiniotis, G., Weis, W.I., Sunahara, R.K. &

Kobilka, B.K. 2011, "Crystal structure of the beta(2) adrenergic receptor-Gs protein

complex", Nature, vol. 477, no. 7366, pp. 549-U311.

34. Rall, T. & Sutherland, E. 1958, "Formation of a Cyclic Adenine Ribonucleotide by Tissue

Particles", Journal of Biological Chemistry, vol. 232, no. 2, pp. 1065-1076.

104

35. Rodbell, M., Birnbaumer, L. & Pohl, S.L. 1971, "Characteristics of glucagon action on the

hepatic adenylate cyclase system.", Biochemical Journal, vol. 125, no. 3, pp. 58P-59P.

36. Ross, E.M. & Gilman, A.G. 1977, "Resolution of some components of adenylate cyclase

necessary for catalytic activity", Journal of Biological Chemistry, vol. 252, no. 20, pp. 6966-

6969.

37. Rodbell, M. 1980, "The role of hormone receptors and GTP-regulatory proteins in membrane

transduction", Nature, vol. 284, no. 5751, pp. 17-22.

38. Gilman, A. 1984, "G-Proteins and Dual Control of Adenylate-Cyclase", Cell, vol. 36, no. 3,

pp. 577-579.

39. Gilman, A.G. 1987, "G Proteins: Transducers of Receptor-Generated Signals", Annual

Review of Biochemistry, vol. 56, no. 1, pp. 615-649.

40. Overington, J.P., Al-Lazikani, B. & Hopkins, A.L. 2006, "How many drug targets are

there?", Nature Reviews Drug Discovery, vol. 5, no. 12, pp. 993-996.

41. Lappano, R. & Maggiolini, M. 2011, "G protein-coupled receptors: Novel targets for drug

discovery in cancer", Nature Reviews Drug Discovery, vol. 10, no. 1, pp. 47-60.

42. Liebmann, C. & Böhmer, F.-. 2000, "Signal transduction pathways of G protein-coupled

receptors and their cross-talk with receptor tyrosine kinases: Lessons from bradykinin

signaling", Current medicinal chemistry, vol. 7, no. 9, pp. 911-943.

43. Eyster, K.M. 1998, "Introduction to Signal Transduction", Biochemical pharmacology, vol.

55, no. 12, pp. 1927-1938.

44. Hunter, T. & Cooper, J.A. 1985, "Protein-tyrosine kinases", Annual Review of Biochemistry,

vol. 54, pp. 897-930.

45. Seger, R. & Krebs, E.G. 1995, "The MAPK signaling cascade", FASEB Journal, vol. 9, no.

9, pp. 726-735.

105

46. Pawson, T. 1995, "Protein modules and signalling networks", Nature, vol. 373, no. 6515, pp.

573-580.

47. Blume-Jensen, P. & Hunter, T. 2001, "Oncogenic kinase signalling", Nature, vol. 411, no.

6835, pp. 355-365.

48. Vogelstein, B. & Kinzler, K.W. 2004, "Cancer genes and the pathways they control", Nature

medicine, vol. 10, no. 8, pp. 789-799.

49. Morabito, A., De Maio, E., Di Maio, M., Normanno, N. & Perrone, F. 2006, "Tyrosine

kinase inhibitors of vascular endothelial growth factor receptors in clinical trials: Current

status and future directions", Oncologist, vol. 11, no. 7, pp. 753-764.

50. Torino, F., Corsello, S.M., Longo, R., Barnabei, A. & Gasparini, G. 2009, "Hypothyroidism

related to tyrosine kinase inhibitors: An emerging toxic effect of targeted therapy", Nature

Reviews Clinical Oncology, vol. 6, no. 4, pp. 219-228.

51. Krebs, E.G. & Fischer, E.H. 1956, "The phosphorylase b to a converting enzyme of rabbit

skeletal muscle", BBA - General Subjects, vol. 20, no. 3, pp. 150-157.

52. Rubin, C.S. & Rosen, O.M. 1975, "Protein phosphorylation.", Annual Review of

Biochemistry, vol. 44, pp. 831-887.

53. Adams, J.A. 2001, "Kinetic and catalytic mechanisms of protein kinases", Chemical reviews,

vol. 101, no. 8, pp. 2271-2290.

54. Manning, G., Whyte, D.B., Martinez, R., Hunter, T. & Sudarsanam, S. 2002, "The protein

kinase complement of the human genome", Science, vol. 298, no. 5600, pp. 1912-1934.

55. Edelman, A.M., Blumenthal, D.K. & Krebs, E.G. 1987, "Protein serine/threonine kinases.",

Annual Review of Biochemistry, vol. 56, pp. 567-613.

56. Xu, W., Harrison, S.C. & Eck, M.J. 1997, "Three-dimensional structure of the tyrosine

kinase c-Src", Nature, vol. 385, no. 6617, pp. 595-602.

106

57. Olah, G.A., Mitchell, R.D., Sosnick, T.R., Walsh, D.A. & Trewhella, J. 1993, "Solution

structure of the cAMP-dependent protein kinase catalytic subunit and its contraction upon

binding the protein kinase inhibitor peptide", Biochemistry, vol. 32, no. 14, pp. 3649-3657.

58. Sowadski, J.M. 1993, "Crystal structure of the catalytic subunit of cAMP-dependent protein

kinase complexed with MgATP and peptide inhibitor", Biochemistry, vol. 32, no. 9, pp.

2154-2161.

59. Madhusudan, Trafny, E.A., Xuong, N., Adams, J.A., Ten Eyck, L.F., Taylor, S.S. &

Sowadski, J.M. 1994, "cAMP-dependent protein kinase: Crystallographic insights into

substrate recognition and phosphotransfer", Protein Science, vol. 3, no. 2, pp. 176-187.

60. Drennan, D. & Ryazanov, A. 2004, "Alpha-kinases: analysis of the family and comparison

with conventional protein kinases", Progress in Biophysics & Molecular Biology, vol. 85,

no. 1, pp. 1-32.

61. Greenman, C., Stephens, P., Smith, R., Dalgliesh, G.L., Hunter, C., Bignell, G., Davies, H.,

Teague, J., Butler, A., Stevens, C., Edkins, S., O'Meara, S., Vastrik, I., Schmidt, E.E., Avis,

T., Barthorpe, S., Bhamra, G., Buck, G., Choudhury, B., Clements, J., Cole, J., Dicks, E.,

Forbes, S., Gray, K., Halliday, K., Harrison, R., Hills, K., Hinton, J., Jenkinson, A., Jones,

D., Menzies, A., Mironenko, T., Perry, J., Raine, K., Richardson, D., Shepherd, R., Small,

A., Tofts, C., Varian, J., Webb, T., West, S., Widaa, S., Yates, A., Cahill, D.P., Louis, D.N.,

Goldstraw, P., Nicholson, A.G., Brasseur, F., Looijenga, L., Weber, B.L., Chiew, Y.,

DeFazio, A., Greaves, M.F., Green, A.R., Campbell, P., Birney, E., Easton, D.F., Chenevix-

Trench, G., Tan, M., Khoo, S.K., Teh, B.T., Yuen, S.T., Leung, S.Y., Wooster, R., Futreal,

P.A. & Stratton, M.R. 2007, "Patterns of somatic mutation in human cancer genomes",

Nature, vol. 446, no. 7132, pp. 153-158.

62. Zhang, X., Crespo, A. & Fernandez, A. 2008, "Turning promiscuous kinase inhibitors into

safer drugs", Trends in biotechnology, vol. 26, no. 6, pp. 295-301.

63. Barford, D., Das, A.K. & Egloff, M. 1998, “The structure and mechanism of protein

phosphatases: Insights into catalysis and regulation”, Annual Reviews in Biophysics and

Biomolecular Structure, vol. 27, pp. 133-164.

107

64. Alonso, A., Sasin, J., Bottini, N., Friedberg, I., Friedberg, I., Osterman, A., Godzik, A.,

Hunter, T., Dixon, J. & Mustelin, T. 2004, "Protein Tyrosine Phosphatases in the Human

Genome", Cell, vol. 117, no. 6, pp. 699-711.

65. Tonks, N.K. 2006, "Protein tyrosine phosphatases: From genes, to function, to disease",

Nature Reviews Molecular Cell Biology, vol. 7, no. 11, pp. 833-846.

66. Cohen, P. 1989, "The structure and regulation of protein phosphatases", Annual Review of

Biochemistry, vol. 58, pp. 453-508.

67. Shenolikar, S. 1994, "Protein serine/threonine phosphatases - New avenues for cell

regulation", Annual Review of Cell Biology, vol. 10, pp. 55-86.

68. Burke T.R., J. & Zhang, Z. 1998, "Protein-tyrosine phosphatases: Structure, mechanism, and

inhibitor discovery", Biopolymers - Peptide Science Section, vol. 47, no. 3, pp. 225-241.

69. Denu, J.M. & Dixon, J.E. 1998, "Protein tyrosine phosphatases: Mechanisms of catalysis and

regulation", Current opinion in chemical biology, vol. 2, no. 5, pp. 633-641.

70. Johnson, T.O., Ermolieff, J. & Jirousek, M.R. 2002, "Protein tyrosine phosphatase 1B

inhibitors for diabetes", Nature Reviews Drug Discovery, vol. 1, no. 9, pp. 696-709.

71. van Huijsduijnen, R.H., Bombrun, A. & Swinnen, D. 2002, "Selecting protein tyrosine

phosphatases as drug targets", Drug discovery today, vol. 7, no. 19, pp. 1013-1019.

72. Darnell Jr., J.E. 2002, "Transcription factors as targets for cancer therapy", Nature Reviews

Cancer, vol. 2, no. 10, pp. 740-749.

73. Babu, M.M., Luscombe, N.M., Aravind, L., Gerstein, M. & Teichmann, S.A. 2004,

"Structure and evolution of transcriptional regulatory networks", Current opinion in

structural biology, vol. 14, no. 3, pp. 283-291.

74. Babu, M.M. 2010, "Structure, evolution and dynamics of transcriptional regulatory

networks", Biochemical Society transactions, vol. 38, no. 5, pp. 1155-1178.

108

75. Koehler, A.N. 2010, "A complex task? Direct modulation of transcription factors with small

molecules", Current opinion in chemical biology, vol. 14, no. 3, pp. 331-340.

76. Yan, C. & Higgins, P.J. 2013, "Drugging the undruggable: Transcription therapy for cancer",

Biochimica et Biophysica Acta - Reviews on Cancer, vol. 1835, no. 1, pp. 76-85.

77. Vogt, P.K. 2012, "Retroviral oncogenes: A historical primer", Nature Reviews Cancer, vol.

12, no. 9, pp. 639-648.

78. Martin, G.S. 1970, "Rous sarcoma virus: A function required for the maintenance of the

transformed state", Nature, vol. 227, no. 5262, pp. 1021-1023.

79. Stehelin, D., Varmus, H.E., Bishop, J.M. & Vogt, P.K. 1976, "DNA related to the

transforming gene(s) of avian sarcoma viruses is present in normal avian DNA", Nature, vol.

260, no. 5547, pp. 170-173.

80. Nowell, P.C. & Hungerford, D.A. 1960, "Minute Chromosome in Human Chronic

Granulocytic Leukemia", Science, vol. 132, no. 3438, pp. 1497-1497.

81. Stratton, M.R., Campbell, P.J. & Futreal, P.A. 2009, "The cancer genome", Nature, vol. 458,

no. 7239, pp. 719-724.

82. Johnson, G.L. & Lapadat, R. 2002, "Mitogen-activated protein kinase pathways mediated by

ERK, JNK, and p38 protein kinases", Science, vol. 298, no. 5600, pp. 1911-1912.

83. Futreal, P.A., Coin, L., Marshall, M., Down, T., Hubbard, T., Wooster, R., Rahman, N. &

Stratton, M.R. 2004, "A census of human cancer genes", Nature Reviews Cancer, vol. 4, no.

3, pp. 177-183.

84. Roux, P. & Blenis, J. 2004, "ERK and p38 MAPK-activated protein kinases: a family of

protein kinases with diverse biological functions", Microbiology and Molecular Biology

Reviews, vol. 68, no. 2, pp. 320-344.

85. Capdeville, R., Buchdunger, E., Zimmermann, J. & Matter, A. 2002, "Glivec (ST1571,

Imatinib), a rationally developed, targeted anticancer drug", Nature Reviews Drug

Discovery, vol. 1, no. 7, pp. 493-502.

109

86. Druker, B.J., Tamura, S., Buchdunger, E., Ohno, S., Segal, G.M., Fanning, S., Zimmermann,

J. & Lydon, N.B. 1996, "Effects of a selective inhibitor of the Ab1 tyrosine kinase on the

growth of Bcr-Ab1 positive cells", Nature medicine, vol. 2, no. 5, pp. 561-566.

87. Deininger, M., Buchdunger, E. & Druker, B.J. 2005, "The development of imatinib as a

therapeutic agent for chronic myeloid leukemia", Blood, vol. 105, no. 7, pp. 2640-2653.

88. Quintás-Cardama, A. & Cortes, J. 2008, "Therapeutic options against BCR-ABL1 T315I-

positive chronic myelogenous leukemia", Clinical Cancer Research, vol. 14, no. 14, pp.

4392-4399.

89. Branford, S., Rudzki, Z., Walsh, S., Grigg, A., Arthur, C., Taylor, K., Herrmann, R., Lynch,

K.P. & Hughes, T.P. 2002, "High frequency of point mutations clustered within the

adenosine triphosphate-binding region of BCR/ABL in patients with chronic myeloid

leukemia or Ph-positive acute lymphoblastic leukemia who develop imatinib (STI571)

resistance", Blood, vol. 99, no. 9, pp. 3472-3475.

90. Dasanu, C.A., Padmanabhan, P., Clark BA. III, & Do, C. 2012, "Cardiovascular toxicity

associated with small molecule tyrosine kinase inhibitors currently in clinical use", Expert

Opinion on Drug Safety, vol. 11, no. 3, pp. 445-457.

91. Fletcher, S., Drewry, J.A., Shahani, V.M., Page, B.D.G. & Gunning, P.T. 2009, "Molecular

disruption of oncogenic signal transducer and activator of transcription 3 (STAT3) protein",

Biochemistry and Cell Biology, vol. 87, no. 6, pp. 825-833.

92. Shuai, K. & Liu, B. 2003, "Regulation of JAK-STAT signalling in the immune system",

Nature Reviews Immunology, vol. 3, no. 11, pp. 900-911.

93. Kisseleva, T., Bhattacharya, S., Braunstein, J. & Schindler, C. 2002, "Signaling through the

JAK/STAT pathway, recent advances and future challenges", Gene, vol. 285, no. 1-2, pp. 1-

24.

94. Levy, D.E. & Darnell Jr., J.E. 2002, "STATs: Transcriptional control and biological impact",

Nature Reviews Molecular Cell Biology, vol. 3, no. 9, pp. 651-662.

110

95. Heinrich, P.C., Behrmann, I., Müller-Newen, G., Schaper, F. & Graeve, L. 1998,

"Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway", Biochemical

Journal, vol. 334, no. 2, pp. 297-314.

96. Pellegrini, S. & Dusanter-Fourt, I. 1997, "The Structure, Regulation and Function of the

Janus Kinases (JAKs) and the Signal Transducers and Activators of Transcription (STATs)",

European Journal of Biochemistry, vol. 248, no. 3, pp. 615-633.

97. Lupardus, P.J., Skiniotis, G., Rice, A.J., Thomas, C., Fischer, S., Walz, T. & Garcia, K.C.

2011, "Structural snapshots of full-length Jak1, a transmembrane gp130/IL-6/IL-6Rα

cytokine receptor complex, and the receptor-Jak1 holocomplex", Structure, vol. 19, no. 1,

pp. 45-55.

98. Jelinek, J., Oki, Y., Gharibyan, V., Bueso-Ramos, C., Prchal, J.T., Verstovsek, S., Beran, M.,

Estey, E., Kantarjian, H.M. & Issa, J.-.J. 2005, "JAK2 mutation 1849G>T is rare in acute

leukemias but can be found in CMML, Philadelphia chromosome-negative CML, and

megakaryocytic leukemia", Blood, vol. 106, no. 10, pp. 3370-3373.

99. Bandaranayake, R.M., Ungureanu, D., Shan, Y., Shaw, D.E., Silvennoinen, O. & Hubbard,

S.R. 2012, "Crystal structures of the JAK2 pseudokinase domain and the pathogenic mutant

V617F", Nature Structural and Molecular Biology, vol. 19, no. 8, pp. 754-759.

100. Mesa, R.A. 2010, "Ruxolitinib, a selective JAK1 and JAK2 inhibitor for the treatment of

myeloproliferative neoplasms and psoriasis", IDrugs, vol. 13, no. 6, pp. 394-403.

101. Tefferi, A. 2012, "JAK inhibitors for myeloproliferative neoplasms: Clarifying facts from

myths", Blood, vol. 119, no. 12, pp. 2721-2730.

102. Pardanani, A., Gotlib, J.R., Jamieson, C., Cortes, J.E., Talpaz, M., Stone, R.M., Silverman,

M.H., Gilliland, D.G., Shorr, J. & Tefferi, A. 2011, "Safety and efficacy of TG101348, a

selective JAK2 inhibitor, in myelofibrosis", Journal of Clinical Oncology, vol. 29, no. 7, pp.

789-796.

103. Verstovsek, S., Kantarjian, H., Mesa, R.A., Pardanani, A.D., Cortes-Franco, J., Thomas,

D.A., Estrov, Z., Fridman, J.S., Bradley, E.C., Erickson-Viitanen, S., Vaddi, K., Levy, R. &

111

Tefferi, A. 2010, "Safety and efficacy of INCB018424, a JAK1 and JAK2 inhibitor, in

myelofibrosis", New England Journal of Medicine, vol. 363, no. 12, pp. 1117-1127.

104. Yu, H., Kortylewski, M. & Pardoll, D. 2007, "Crosstalk between cancer and immune cells:

Role of STAT3 in the tumour microenvironment", Nature Reviews Immunology, vol. 7, no.

1, pp. 41-51.

105. Jackson, C., Ruzevick, J., Amin, A.G. & Lim, M. 2012, "Potential Role for STAT3

Inhibitors in Glioblastoma", Neurosurgery clinics of North America, vol. 23, no. 3, pp. 379-

389.

106. Hirano, T., Ishihara, K. & Hibi, M. 2000, "Roles of STAT3 in mediating the cell growth,

differentiation and survival signals relayed through the IL-6 family of cytokine receptors",

Oncogene, vol. 19, no. 21, pp. 2548-2556.

107. Bromberg, J.F., Wrzeszczynska, M.H., Devgan, G., Zhao, Y., Pestell, R.G., Albanese, C. &

Darnell Jr., J.E. 1999, "Stat3 as an oncogene", Cell, vol. 98, no. 3, pp. 295-303.

108. Song, J.I. & Grandis, J.R. 2000, "STAT signaling in head and neck cancer", Oncogene, vol.

19, no. 21, pp. 2489-2495.

109. Yu, H. & Jove, R. 2004, "The stats of cancer - New molecular targets come of age", Nature


110. Li, W.X. 2008, "Canonical and non-canonical JAK–STAT signaling", Trends in cell

biology, vol. 18, no. 11, pp. 545-551.

111. Lim, C.P. & Cao, X. 2006, "Structure, function, and regulation of STAT proteins",

Molecular BioSystems, vol. 2, no. 11, pp. 536-550.

112. Buettner, R., Mora, L.B. & Jove, R. 2002, "Activated STAT signaling in human tumors

provides novel molecular targets for therapeutic intervention", Clinical Cancer Research,

vol. 8, no. 4, pp. 945-954.

113. Becker, S., Groner, B. & Müller, C.W. 1998, "Three-dimensional structure of the Stat3β

homodimer bound to DNA", Nature, vol. 394, no. 6689, pp. 145-151.

112

114. Hevehan, D., Miller, W. & Papoutsakis, E. 2002, "Differential expression and

phosphorylation of distinct STAT3 proteins during granulocytic differentiation", Blood, vol.

99, no. 5, pp. 1627-1637.

115. Ma, J., Zhang, T., Novotny-Diermayr, V., Tan, A.L.C. & Cao, X. 2003, "A novel sequence

in the coiled-coil domain of Stat3 essential for its nuclear translocation", Journal of

Biological Chemistry, vol. 278, no. 31, pp. 29252-29260.

116. Vogt, M., Domoszlai, T., Kleshchanok, D., Lehmann, S., Schmitt, A., Poli, V., Richtering,

W. & Müller-Newen, G. 2011, "The role of the N-terminal domain in dimerization and

nucleocytoplasmic shuttling of latent STAT3", Journal of cell science, vol. 124, no. 6, pp.

900-909.

117. Yang, J., Liao, X., Agarwal, M.K., Barnes, L., Auron, P.E. & Stark, G.R. 2007,

"Unphosphorylated STAT3 accumulates in response to IL-6 and activates transcription by

binding to NF kappa B", Genes & development, vol. 21, no. 11, pp. 1396-1408.

118. Timofeeva, O.A., Chasovskikh, S., Lonskaya, I., Tarasova, N.I., Khavrutskii, L., Tarasov,

S.G., Zhang, X., Korostyshevskiy, V.R., Cheema, A., Zhang, L., Dakshanamurthy, S.,

Brown, M.L. & Dritschilo, A. 2012, "Mechanisms of Unphosphorylated STAT3

Transcription actor Binding to DNA", Journal of Biological Chemistry, vol. 287, no. 17, pp.

14192-14200.

119. Timofeeva, O.A., Gaponenko, V., Lockett, S.J., Tarasov, S.G., Jiang, S., Michejda, C.J.,

Perantoni, A.O. & Tarasova, N.I. 2007, "Rationally designed inhibitors identify STAT3 N-

domain as a promising anticancer drug target", ACS Chemical Biology, vol. 2, no. 12, pp.

799-809.

120. Wagner, M., Kleeff, J., Friess, H., Büchler, M.W. & Korc, M. 1999, "Enhanced expression

of the type II transforming growth factor-β receptor is associated with decreased survival in

human pancreatic cancer", Pancreas, vol. 19, no. 4, pp. 370-376.

121. Koppikar, P. & Bromberg, J. 2012, "STATe-of-the-art approach: Using oligonucleotide

decoys to target the "undruggable"", Cancer Discovery, vol. 2, no. 8, pp. 670-672.

113

122. Becker, S., Groner, B. & Müller, C.W. 1998, "Three-dimensional structure of the Stat3β

homodimer bound to DNA", Nature, vol. 394, no. 6689, pp. 145-151.

123. Gunning, P.T., Glenn, M.P., Siddiquee, K.A.Z., Katt, W.P., Masson, E., Sebti, S.M.,

Turkson, J. & Hamilton, A.D. 2008, "Targeting Protein-Protein Interactions: Suppression of

Stat3 Dimerization with Rationally Designed Small-Molecule, Nonpeptidic SH2 Domain

Binders", Chembiochem, vol. 9, no. 17, pp. 2800-2803.

124. Siddiquee, K.A.Z., Gunning, P.T., Glenn, M., Katt, W.P., Zhang, S., Schroeck, C., Sebti,

S.M., Jove, R., Hamilton, A.D. & Turkson, J. 2007, "An oxazole-based small-molecule Stat3

inhibitor modulates Stat3 stability and processing and induces antitumor cell effects", ACS

Chemical Biology, vol. 2, no. 12, pp. 787-798.

125. Auzenne, E.J., Klostergaard, J., Mandal, P.K., Liao, W.S., Lu, Z., Gao, F., Bast, R.C.J.,

Robertson, F.M. & McMurray, J.S. 2012, "A phosphopeptide mimetic prodrug targeting the

SH2 domain of Stat3 inhibits tumor growth and angiogenesis", Journal of Experimental

Therapeutics and Oncology, vol. 10, no. 2, pp. 155-162.

126. Nakashima, K., Yanagisawa, M., Arakawa, H., Kimura, N., Hisatsune, T., Kawabata, M.,

Miyazono, K. & Taga, T. 1999, "Synergistic signaling in fetal brain by STAT3-Smad1

complex bridged by p300", Science, vol. 284, no. 5413, pp. 479-482.

127. Giraud, S., Bienvenu, F., Avril, S., Gascan, H., Heery, D.M. & Coqueret, O. 2002,

"Functional interaction of STAT3 transcription factor with the coactivator NcoA/SRC1a",

Journal of Biological Chemistry, vol. 277, no. 10, pp. 8004-8011.

128. Wen, Z., Zhong, Z. & Darnell Jr., J.E. 1995, "Maximal activation of transcription by Stat1

and Stat3 requires both tyrosine and serine phosphorylation", Cell, vol. 82, no. 2, pp. 241-

250.

129. Lim, C.P. & Cao, X. 1999, "Serine phosphorylation and negative regulation of Stat3 by

JNK", Journal of Biological Chemistry, vol. 274, no. 43, pp. 31055-31061.

130. Lufei, C., Koh, T.H., Uchida, T. & Cao, X. 2007, "Pin1 is required for the Ser727

phosphorylation-dependent Stat3 activity", Oncogene, vol. 26, no. 55, pp. 7656-7664.

114

131. Yu, H., Pardoll, D. & Jove, R. 2009, "STATs in cancer inflammation and immunity: a

leading role for STAT3", Nature Reviews Cancer, vol. 9, no. 11, pp. 798-809.

132. Colotta, F., Allavena, P., Sica, A., Garlanda, C. & Mantovani, A. 2009, "Cancer-related

inflammation, the seventh hallmark of cancer: Links to genetic instability", Carcinogenesis,

vol. 30, no. 7, pp. 1073-1081.

133. Mantovani, A., Allavena, P., Sica, A. & Balkwill, F. 2008, "Cancer-related inflammation",

Nature, vol. 454, no. 7203, pp. 436-444.

134. Lee, H., Herrmann, A., Deng, J., Kujawski, M., Niu, G., Li, Z., Forman, S., Jove, R.,

Pardoll, D.M. & Yu, H. 2009, "Persistently Activated Stat3 Maintains Constitutive NF-κB

Activity in Tumors", Cancer Cell, vol. 15, no. 4, pp. 283-293.

135. Yue, P. & Turkson, J. 2009, "Targeting STAT3 in cancer: How successful are we?", Expert

opinion on investigational drugs, vol. 18, no. 1, pp. 45-56.

136. Bassères, D.S. & Baldwin, A.S. 2006, "Nuclear factor-κB and inhibitor of κB kinase

pathways in oncogenic initiation and progression", Oncogene, vol. 25, no. 51, pp. 6817-

6830.

137. Kujawski, M., Kortylewski, M., Lee, H., Herrmann, A., Kay, H. & Yu, H. 2008, "Stat3

mediates myeloid cell-dependent tumor angiogenesis in mice", Journal of Clinical

Investigation, vol. 118, no. 10, pp. 3367-3377.

138. Niu, G., Heller, R., Catlett-Falcone, R., Coppola, D., Jaroszeski, M., Dalton, W., Jove, R. &

Yu, H. 1999, "Gene therapy with dominant-negative Stat3 suppresses growth of the murine

melanoma B16 tumor in vivo", Cancer research, vol. 59, no. 20, pp. 5059-5063.

139. Kortylewski, M., Kujawski, M., Wang, T., Wei, S., Zhang, S., Pilon-Thomas, S., Niu, G.,

Kay, H., Mule, J., Kerr, W., Jove, R., Pardoll, D. & Yu, H. 2005, "Inhibiting Stat3 signaling

in the hematopoietic system elicits multicomponent antitumor immunity", Nature Medicine,

vol. 11, no. 12, pp. 1314-1321.

140. Milner, J.D., Brenchley, J.M., Laurence, A., Freeman, A.F., Hill, B.J., Elias, K.M., Kanno,

Y., Spalding, C., Elloumi, H.Z., Paulson, M.L., Davis, J., Hsu, A., Asher, A.I., O'Shea, J.,

115

Holland, S.M., Paul, W.E. & Douek, D.C. 2008, "Impaired T(H)17 cell differentiation in

subjects with autosomal dominant hyper-IgE syndrome", Nature, vol. 452, no. 7188, pp.

773-777.

141. Shahani, V.M., Yue, P., Fletcher, S., Sharmeen, S., Sukhai, M.A., Luu, D.P., Zhang, X.,

Sun, H., Zhao, W., Schimmer, A.D., Turkson, J. & Gunning, P.T. 2011, "Design, synthesis

and in vitro characterization of novel hybrid peptidomimetic inhibitors of STAT3 protein",

Bioorganic and Medicinal Chemistry, vol. 19, no. 5, pp. 1823-1838.

142. Mandal, P.K., Limbrick, D., Coleman, D.R., Dyer, G.A., Ren, Z., Birtwistle, J.S., Xiong, C.,

Chen, X., Briggs, J.M. & McMurray, J.S. 2009, "Conformationally Constrained

Peptidomimetic Inhibitors of Signal Transducer and Activator of Transcription 3: Evaluation

and Molecular Modeling", Journal of medicinal chemistry, vol. 52, no. 8, pp. 2429-2442.

143. Sen, M., Thomas, S.M., Kim, S., Yeh, J.I., Ferris, R.L., Johnson, J.T., Duvvuri, U., Lee, J.,

Sahu, N., Joyce, S., Freilino, M.L., Shi, H., Li, C., Ly, D., Rapireddy, S., Etter, J.P., Li, P.,

Wang, L., Chiosea, S., Seethala, R.R., Gooding, W.E., Chen, X., Kaminski, N., Pandit, K.,

Johnson, D.E. & Grandis, J.R. 2012, "First-in-human trial of a STAT3 decoy oligonucleotide

in head and neck tumors: Implications for cancer therapy", Cancer Discovery, vol. 2, no. 8,

pp. 694-705.

144. Turkson, J., Ryan, D., Kim, J.S., Zhang, Y., Chen, Z., Haura, E., Laudano, A., Sebti, S.,

Hamilton, A.D. & Jove, R. 2001, "Phosphotyrosyl Peptides Block Stat3-mediated DNA

Binding Activity, Gene Regulation, and Cell Transformation", Journal of Biological

Chemistry, vol. 276, no. 48, pp. 45443-45455.

145. Turkson, J., Kim, J.S., Zhang, S., Yuan, J., Huang, M., Glenn, M., Haura, E., Sebti, S.,

Hamilton, A.D. & Jove, R. 2004, "Novel peptidomimetic inhibitors of signal transducer and

activator of transcription 3 dimerization and biological activity", Molecular Cancer

Therapeutics, vol. 3, no. 3, pp. 261-269.

146. Gunning, P.T., Katt, W.P., Glenn, M., Siddique, K., Kim, J.S., Jove, R., Sebti, S.M.,

Turkson, J. & Hamilton, A.D. 2007, "Isoform selective inhibition of STAT1 or STAT3

116

homo-dimerization via peptidomimetic probes: Structural recognition of STAT SH2

domains", Bioorganic and Medicinal Chemistry Letters, vol. 17, no. 7, pp. 1875-1878.

147. Chen, J., Nikolovska-Coleska, Z., Yang, C., Gomez, C., Gao, W., Krajewski, K., Jiang, S.,

Roller, P. & Wang, S. 2007, "Design and synthesis of a new, conformationally constrained,

macrocyclic small-molecule inhibitor of STAT3 via 'click chemistry'", Bioorganic and

Medicinal Chemistry Letters, vol. 17, no. 14, pp. 3939-3942.

148. Ren, Z., Cabell, L.A., Schaefer, T.S. & McMurray, J.S. 2003, "Identification of a high-

affinity phosphopeptide inhibitor of Stat3", Bioorganic and Medicinal Chemistry Letters,

vol. 13, no. 4, pp. 633-636.

149. Schust, J. & Berg, T. 2004, "A high-throughput fluorescence polarization assay for signal

transducer and activator of transcription 3", Analytical Biochemistry, vol. 330, no. 1, pp.

114-118.

150. Mandal, P.K., Heard, P.A., Ren, Z., Chen, X. & McMurray, J.S. 2007, "Solid-phase

synthesis of Stat3 inhibitors incorporating O-carbamoylserine and O-carbamoylthreonine as

glutamine mimics", Bioorganic and Medicinal Chemistry Letters, vol. 17, no. 3, pp. 654-

656.

151. Coleman, D.R., Ren, Z., Mandal, P.K., Cameron, A.G., Dyer, G.A., Muranjan, S.,

Campbell, M., Chen, X. & McMurray, J.S. 2005, "Investigation of the binding determinants

of phosphopeptides targeted to the Src homology 2 domain of the signal transducer and

activator of transcription 3. Development of a high-affinity peptide inhibitor", Journal of

Medicinal Chemistry, vol. 48, no. 21, pp. 6661-6670.

152. Coleman, D.R., Kaluarachchi, K., Ren, Z., Chen, X. & McMurray, J.S. 2008, "Solid Phase

Synthesis of Phosphopeptides Incorporating 2,2-Dimethyloxazolidine Pseudoproline

Analogs: Evidence for trans Leu-Pro Peptide Bonds in Stat3 Inhibitors", International

Journal of Peptide Research and Therapeutics, vol. 14, no. 1, pp. 1-9.

153. Mandal, P.K., Gao, F., Lu, Z., Ren, Z., Ramesh, R., Birtwistle, J.S., Kaluarachchi, K.K.,

Chen, X., Bast, R.C., Liao, W.S. & McMurray, J.S. 2011, "Potent and selective

phosphopeptide mimetic prodrugs targeted to the Src homology 2 (SH2) domain of signal

117

transducer and activator of transcription 3", Journal of medicinal chemistry, vol. 54, no. 10,

pp. 3549-3563.

154. Siddiquee, K., Zhang, S., Guida, W.C., Blaskovich, M.A., Greedy, B., Lawrence, H.R., Yip,

M.L.R., Jove, R., McLaughlin, M.M., Lawrence, N.J., Sebti, S.M. & Turkson, J. 2007,

"Selective chemical probe inhibitor of Stat3, identified through structure-based virtual

screening, induces antitumor activity", Proceedings of the National Academy of Sciences of

the United States of America, vol. 104, no. 18, pp. 7391-7396.

155. Fletcher, S., Singh, J., Zhang, X., Yue, P., Page, B.D.G., Sharmeen, S., Shahani, V.M.,

Zhao, W., Schimmer, A.D., Turkson, J. & Gunning, P.T. 2009, "Disruption of

transcriptionally active stat3 dimers with non-phosphorylated, salicylic acid-based small

molecules: Potent in vitro and tumor cell activities", ChemBioChem, vol. 10, no. 12, pp.

1959-1964.

156. Fletcher, S., Page, B.D.G., Zhang, X., Yue, P., Li, Z.H., Sharmeen, S., Singh, J., Zhao, W.,

Schimmer, A.D., Trudel, S., Turkson, J. & Gunning, P.T. 2011, "Antagonism of the Stat3-

Stat3 Protein Dimer with Salicylic Acid Based Small Molecules", ChemMedChem, vol. 6,

no. 8, pp. 1459-1470.

157. Schrodinger, L. 2010, The PyMOL Molecular Graphics System, Version~1.3r1.

158. Jones, G., Willett, P., Glen, R., Leach, A. & Taylor, R. 1997, "Development and validation

of a genetic algorithm for flexible docking", Journal of Molecular Biology, vol. 267, no. 3,

pp. 727-748.

159. McMurray, J.S. 2008, "Structural basis for the binding of high affinity phosphopeptides to

Stat3", Biopolymers - Peptide Science Section, vol. 90, no. 1, pp. 69-79.

160. Rajesh, K., Somasundaram, M., Saiganesh, R. & Balasubramanian, K.K. 2007,

"Bromination of deactivated aromatics: A simple and efficient method", Journal of Organic

Chemistry, vol. 72, no. 15, pp. 5867-5869.

118

161. Herrero, M.A., Kremsner, J.M. & Kappe, C.O. 2008, "Nonthermal microwave effects

revisited: On the importance of internal temperature monitoring and agitation in microwave

chemistry", Journal of Organic Chemistry, vol. 73, no. 1, pp. 36-47.

162. Turkson, J., Bowman, T., Garcia, R., Caldenhoven, E., De Groot, R.P. & Jove, R. 1998,

"Stat3 activation by Src induces specific gene regulation and is required for cell

transformation", Molecular and cellular biology, vol. 18, no. 5, pp. 2545-2552.

163. Dourlat, J., Liu, W., Sancier, F., Edmonds, T., Pamonsinlapatham, P., Cruzalegui, F. &

Garbay, C. 2009, "A novel non-phosphorylated potential antitumoral peptide inhibits STAT3

biological activity", Biochimie, vol. 91, no. 8, pp. 996-1002.

164. Thorén, P.E.G., Persson, D., Karlsson, M. & Nordén, B. 2000, "The Antennapedia peptide

penetratin translocates across lipid bilayers - The first direct observation", FEBS letters, vol.

482, no. 3, pp. 265-268.

165. Yung-Chi, C. & Prusoff, W.H. 1973, "Relationship between the inhibition constant (KI) and

the concentration of inhibitor which causes 50 per cent inhibition (IC50) of an enzymatic

reaction", Biochemical pharmacology, vol. 22, no. 23, pp. 3099-3108.

166. Artursson, P. 1990, "Epithelial transport of drugs in cell culture. I: A model for studying the

passive diffusion of drugs over intestinal absorptive (Caco-2) cells", Journal of

pharmaceutical sciences, vol. 79, no. 6, pp. 476-482.

167. Yee, S. 1997, "In vitro permeability across Caco-2 cells (colonic) can predict in vivo (small

intestinal) absorption in man - Fact or myth", Pharmaceutical research, vol. 14, no. 6, pp.

763-766.

168. Chen, J., Bai, L., Bernard, D., Nikolovska-Coleska, Z., Gomez, C., Zhang, J., Yi, H. &

Wang, S. 2010, "Structure-based design of conformationally constrained, cell-permeable

STAT3 inhibitors", ACS Medicinal Chemistry Letters, vol. 1, no. 2, pp. 85-89.

169. Malich, G., Markovic, B. & Winder, C. 1997, "The sensitivity and specificity of the MTS

tetrazolium assay for detecting the in vitro cytotoxicity of 20 chemicals using human cell

lines", Toxicology, vol. 124, no. 3, pp. 179-192.

119

170. Alimirah, F., Chen, J., Basrawala, Z., Xin, H. & Choubey, D. 2006, "DU-145 and PC-3

human prostate cancer cell lines express androgen receptor: Implications for the androgen

receptor functions and regulation", FEBS letters, vol. 580, no. 9, pp. 2294-2300.

171. Filmus, J., Trent, J.M., Pollak, M.N. & Buick, R.N. 1987, "Epidermal growth factor

receptor gene-amplified MDA-468 breast cancer cell line and its nonamplified variants",

Molecular and cellular biology, vol. 7, no. 1, pp. 251-257.

172. Collins, S.J. 1987, "The HL-60 promyelocytic leukemia cell line: Proliferation,

differentiation, and cellular oncogene expression", Blood, vol. 70, no. 5, pp. 1233-1244.

173. Lieber, M., Mazzetta, J.A., Nelson Rees, W., Kaplan, M. & Todaro, G. 1975,

"Establishment of a continuous tumor cell line (PANC-1) from a human carcinoma of the

exocrine pancreas", International Journal of Cancer, vol. 15, no. 5, pp. 741-747.

174. Sandhya Rani, M.R., Foster, G.R., Leung, S., Leaman, D., Stark, G.R. & Ransohoff, R.M.

1996, "Characterization of β-R1, a gene that is selectively induced by interferon β (IFN-β)

compared with IFN-α", Journal of Biological Chemistry, vol. 271, no. 37, pp. 22878-22884.

175. Hande, K.R. 1998, "Etoposide: Four decades of development of a topoisomerase II

inhibitor", European journal of cancer, vol. 34, no. 10, pp. 1514-1521.

176. Tannock, I.F., De Wit, R., Berry, W.R., Horti, J., Pluzanska, A., Chi, K.N., Oudard, S.,

Théodore, C., James, N.D., Turesson, I., Rosenthal, M.A. & Eisenberger, M.A. 2004,

"Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer",

New England Journal of Medicine, vol. 351, no. 15, pp. 1502-1512.

177. Osborne, C.K., Drelichman, A., Von Hoff, D.D. & Crawford, E.D. 1983, "Mitoxantrone:

Modest activity in a phase II trial in advanced prostate cancer", Cancer Treatment Reports,

vol. 67, no. 12, pp. 1133-1135.

178. Campbell, W.C., Fisher, M.H., Stapley, E.O., Albers-Schönberg, G. & Jacob, T.A. 1983,

"Ivermectin: A potent new antiparasitic agent", Science, vol. 221, no. 4613, pp. 823-828.

179. Chou, T. & Talalay, P. 1983, "Analysis of Combined Drug Effects - a New Look at a very

Old Problem", Trends in pharmacological sciences, vol. 4, no. 11, pp. 450-454.

120

180. Chou, T. & Talalay, P. 1984, "Quantitative-Analysis of Dose-Effect Relationships - the

Combined Effects of Multiple-Drugs Or Enzyme-Inhibitors", Advances in Enzyme

Regulation, vol. 22, pp. 27-55.

181. Sharmeen, S., Skrtic, M., Sukhai, M.A., Hurren, R., Gronda, M., Wang, X., Fonseca, S.B.,

Sun, H., Wood, T.E., Ward, R., Minden, M.D., Batey, R.A., Datti, A., Wrana, J., Kelley,

S.O. & Schimmer, A.D. 2010, "The antiparasitic agent ivermectin induces chloride-

dependent membrane hyperpolarization and cell death in leukemia cells", Blood, vol. 116,

no. 18, pp. 3593-3603.

182. Shahani, V.M., Yue, P., Haftchenary, S., Zhao, W., Lukkarila, J.L., Zhang, X., Ball, D.,

Nona, C., Gunning, P.T. & Turkson, J. 2011, "Identification of purine-scaffold small-

molecule inhibitors of STAT3 activation by QSAR studies", ACS Medicinal Chemistry

Letters, vol. 2, no. 1, pp. 79-84.

183. Fletcher, S., Shahani, V.M. & Gunning, P.T. 2009, "Facile and efficient access to 2,6,9-tri-

substituted purines through sequential N9, N2 Mitsunobu reactions", Tetrahedron letters,

vol. 50, no. 29, pp. 4258-4261.

184. Lin, L., Hutzen, B., Zuo, M., Ball, S., Deangelis, S., Foust, E., Pandit, B., Ihnat, M.A.,

Shenoy, S.S., Kulp, S., Li, P., Li, C., Fuchs, J. & Lin, J. 2010, "Novel STAT3

phosphorylation inhibitors exhibit potent growth-suppressive activity in pancreatic and

breast cancer cells", Cancer Research, vol. 70, no. 6, pp. 2445-2454.

185. Bhasin, D., Cisek, K., Pandharkar, T., Regan, N., Li, C., Pandit, B., Lin, J. & Li, P. 2008,

"Design, synthesis, and studies of small molecule STAT3 inhibitors", Bioorganic and

Medicinal Chemistry Letters, vol. 18, no. 1, pp. 391-395.

186. Song, H., Wang, R., Wang, S. & Lin, J. 2005, "A low-molecular-weight compound

discovered through virtual database screening inhibits Stat3 function in breast cancer cells",

Proceedings of the National Academy of Sciences of the United States of America, vol. 102,

no. 13, pp. 4700-4705.

121

187. Schust, J., Sperl, B., Hollis, A., Mayer, T.U. & Berg, T. 2006, "Stattic: A Small-Molecule

Inhibitor of STAT3 Activation and Dimerization", Chemistry and Biology, vol. 13, no. 11,

pp. 1235-1242.

188. McMurray, J.S., Mandal, P.K., Liao, W.S., Ren, Z. & Chen, X. 2009, "Inhibition of Stat3

by cell-permeable peptidomimetic prodrugs targeted to its SH2 domain.", Advances in

Experimental Medicine and Biology, vol. 611, pp. 545-546.

189. Zhang, X., Yue, P., Fletcher, S., Zhao, W., Gunning, P.T. & Turkson, J. 2010, "A novel

small-molecule disrupts Stat3 SH2 domain-phosphotyrosine interactions and Stat3-

dependent tumor processes", Biochemical Pharmacology, vol. 79, no. 10, pp. 1398-1409.

190. Legraverend, M. & Grierson, D.S. 2006, "The purines: Potent and versatile small molecule

inhibitors and modulators of key biological targets", Bioorganic and Medicinal Chemistry,

vol. 14, no. 12, pp. 3987-4006.

191. Mitsunobu, O. , Yamada, M. & Mukaiyam, T. 1967, "Preparation of Esters of Phosphoric

Acid by Reaction of Trivalent Phosphorus Compounds with Diethyl Azodicarboxylate in

Presence of Alcohols", Bulletin of the Chemical Society of Japan, vol. 40, no. 4, pp. 935-

937.

192. Véliz, E.A. & Beal, P.A. 2006, "Mitsunobu reactions of nucleoside analogs using

triisopropyl phosphite-DIAD", Tetrahedron letters, vol. 47, no. 18, pp. 3153-3156.

193. Yamada, K., Sakata, S. & Yoshimura, Y. 1998, "Synthesis of novel iso-4 '-thionucleosides

using the Mitsunobu reaction", Journal of Organic Chemistry, vol. 63, no. 20, pp. 6891-

6899.

194. Maruyama, T., Yorikane, A. & Kozai, S. 2001, "Synthesis of N2-alkylguanosine using

mitsunobu reaction as a key step", Nucleosides, Nucleotides and Nucleic Acids, vol. 20, no.

4-7, pp. 935-936.

195. Dey, S. & Garner, P. 2000, "Synthesis of tert-butoxycarbonyl (Boc)-protected purines",

Journal of Organic Chemistry, vol. 65, no. 22, pp. 7697-7699.

122

196. Tiwari, P., Kumar, R., Maulik, P.R. & Misra, A.K. 2005, "Efficient Acetylation of

Carbohydrates Promoted by Imidazole", European Journal of Organic Chemistry, vol. 2005,

no. 20, pp. 4265-4270.

197. Choo, H., Beadle, J.R., Chong, Y., Trahan, J. & Hostetler, K.Y. 2007, "Synthesis of the 5-

phosphono-pent-2-en-1-yl nucleosides: A new class of antiviral acyclic nucleoside

phosphonates", Bioorganic and Medicinal Chemistry, vol. 15, no. 4, pp. 1771-1779.

198. Tang, Y., Muthyala, R. & Vince, R. 2006, "Synthesis and biological evaluation of

carboacyclic nucleosides with (Z) and (E)-9-[4,4-bis(hydroxymethyl)]-2-butenyl side chain",

Bioorganic and Medicinal Chemistry, vol. 14, no. 17, pp. 5866-5875.

199. Taipalensuu, J., Törnblom, H., Lindberg, G., Einarsson, C., Sjöqvist, F., Melhus, H.,

Garberg, P., Sjöström, B., Lundgren, B.O. & Artursson, P. 2001, "Correlation of gene

expression of ten drug efflux proteins of the atp-binding cassette transporter family in

normal human jejunum and in human intestinal epithelial Caco-2 cell monolayers", Journal

of Pharmacology and Experimental Therapeutics, vol. 299, no. 1, pp. 164-170.

200. Thiebaut, F., Tsuruo, T., Hamada, H., Gottesman, M.M., Pastan, I. & Willingham, M.C.

1987, "Cellular localization of the multidrug-resistance gene product P-glycoprotein in

normal human tissues.", Proceedings of the National Academy of Sciences of the United

States of America, vol. 84, no. 21, pp. 7735-7738.

201. Hammud, H.H., Bouhadir, K.H., Masoud, M.S., Ghannoum, A.M. & Assi, S.A. 2008,

"Solvent effect on the absorption and fluorescence emission spectra of some purine

derivatives: Spectrofluorometric quantitative studies", Journal of Solution Chemistry, vol.

37, no. 7, pp. 895-917.

202. Shahani, V.M., Ball, D.P., Ramos, A.V., Zhihua, L., Spagnuolo, P.A., Haftchenary, S.,

Schimmer, A.D., Trudel, S. & Gunning, P.T. 2013, "A 2,6,9- hetero-trisubstituted purine

inhibitor exhibits potent biological effects against multiple myeloma cells", Bioorganic and

Medicinal Chemistry, DOI: http://dx.doi.org/10.1016/j.bmc.2013.04.080.

123

203. Rautio, J., Kumpulainen, H., Heimbach, T., Oliyai, R., Oh, D., Järvinen, T. & Savolainen, J.

2008, "Prodrugs: Design and clinical applications", Nature Reviews Drug Discovery, vol. 7,

no. 3, pp. 255-270.

204. Bundgaard, H. & Nielsen, N.M. 1987, "Esters of N,N-disubstituted 2-hydroxyacetamides as

a novel highly biolabile prodrug type for carboxylic acid agents [1]", Journal of medicinal

chemistry, vol. 30, no. 3, pp. 451-454.

205. He, G., Massarella, J. & Ward, P. 1999, "Clinical pharmacokinetics of the prodrug

oseltamivir and its active metabolite Ro 64-0802", Clinical pharmacokinetics, vol. 37, no. 6,

pp. 471-484.

206. Herr, R.J. 2002, "5-Substituted-1H-tetrazoles as carboxylic acid isosteres: Medicinal

chemistry and synthetic methods", Bioorganic and Medicinal Chemistry, vol. 10, no. 11, pp.

3379-3393.

207. Lukkarila, J.L., Da Silva, S.R., Ali, M., Shahani, V.M., Xu, G.W., Berman, J., Roughton,

A., Dhe-Paganon, S., Schimmer, A.D. & Gunning, P.T. 2011, "Identification of NAE

inhibitors exhibiting potent activity in leukemia cells: Exploring the structural determinants

of NAE specificity", ACS Medicinal Chemistry Letters, vol. 2, no. 8, pp. 577-582.

208. McDougal, P.G., Rico, J.G., Oh, Y. & Condon, B.D. 1986, "A convenient procedure for the

monosilylation of symmetric 1.n-diols", Journal of Organic Chemistry, vol. 51, no. 17, pp.

3388-3390.

209. Appel, R. & Berger, G. 1958, "Hydrazinsulfonsaure-Amide .1. Uber Das

Hydrazodisulfamid", Chemische Berichte-Recueil, vol. 91, no. 6, pp. 1339-1341.

210. Das, B., Mahender, G., Sunil Kumar, V. & Chowdhury, N. 2004, "Chemoselective

deprotection of trityl ethers using silica-supported sodium hydrogen sulfate", Tetrahedron

letters, vol. 45, no. 36, pp. 6709-6711.

211. Kell, D.B., Dobson, P.D. & Oliver, S.G. 2011, "Pharmaceutical drug transport: the issues

and the implications that it is essentially carrier-mediated only", Drug discovery today, vol.

16, no. 15-16, pp. 704-714.

124

212. Di, L., Artursson, P., Avdeef, A., Ecker, G.F., Faller, B., Fischer, H., Houston, J.B., Kansy,

M., Kerns, E.H., Kraemer, S.D., Lennernas, H. & Sugano, K. 2012, "Evidence-based

approach to assess passive diffusion and carrier-mediated drug transport", Drug Discovery

Today, vol. 17, no. 15-16, pp. 905-912.

213. Sugano, K., Kansy, M., Artursson, P., Avdeef, A., Bendels, S., Di, L., Ecker, G.F., Faller,

B., Fischer, H., Gerebtzoff, G., Lennernaes, H. & Senner, F. 2010, "Coexistence of passive

and carrier-mediated processes in drug transport", Nature Reviews Drug Discovery, vol. 9,

no. 8, pp. 597-614.

214. Wang, C., Curtis, J.E., Minden, M.D. & McCulloch, E.A. 1989, "Expression of a retinoic

acid receptor gene in myeloid leukemia cells", Leukemia, vol. 3, no. 4, pp. 264-269.

215. Zhang, X.G., Gaillard, J.P., Robillard, N., Lu, Z.Y., Gu, Z.J., Jourdan, M., Boiron, J.M.,

Bataille, R. & Klein, B. 1994, "Reproducible obtaining of human myeloma cell lines as a

model for tumor stem cell study in human multiple myeloma", Blood, vol. 83, no. 12, pp.

3654-3663.

216. Vermes, I., Haanen, C., Steffens-Nakken, H. & Reutelingsperger, C. 1995, "A novel assay

for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic

cells using fluorescein labelled Annexin V", Journal of Immunological Methods, vol. 184,

no. 1, pp. 39-51.

217. Krutzik, P.O. & Nolan, G.P. 2003, "Intracellular Phospho-protein Staining Techniques for

Flow Cytometry: Monitoring Single Cell Signaling Events", Cytometry Part A, vol. 55, no.

2, pp. 61-70.

218. Ma, H., Deacon, S. & Horiuchi, K. 2008, "The challenge of selecting protein kinase assays

for lead discovery optimization", Expert Opinion on Drug Discovery, vol. 3, no. 6, pp. 607-

621.

219. Lucet, I., Fantino, E., Styles, M., Bamert, R., Patel, O., Broughton, S., Walter, M., Burns,

C., Treutlein, H., Wilks, A. & Rossjohn, J. 2006, "The structural basis of Janus kinase 2

inhibition by a potent and specific pan-Janus kinase inhibitor", Blood, vol. 107, no. 1, pp.

176-183.

125

220. Shah, N.P., Nicoll, J.M., Nagar, B., Gorre, M.E., Paquette, R.L., Kuriyan, J. & Sawyers,

C.L. 2002, "Multiple BCR-ABL kinase domain mutations confer polyclonal resistance to the

tyrosine kinase inhibitor imatinib (STI571) in chronic phase and blast crisis chronic myeloid

leukemia", Cancer Cell, vol. 2, no. 2, pp. 117-125.

221. Quintás-Cardama, A., Kantarjian, H. & Cortes, J. 2010, "Third-Generation Tyrosine Kinase

Inhibitors and Beyond", Seminars in Hematology, vol. 47, no. 4, pp. 371-380.

222. Gupta-Rossi, N., Ortica, S., Meas-Yedid, V., Heuss, S., Moretti, J., Olivo-Marin, J.-. &

Israël, A. 2011, "The adaptor-associated kinase 1, AAK1, is a positive regulator of the notch

pathway", Journal of Biological Chemistry, vol. 286, no. 21, pp. 18720-18730.

223. Leong, K.G. & Karsan, A. 2006, "Recent insights into the role of Notch signaling in

tumorigenesis", Blood, vol. 107, no. 6, pp. 2223-2233.

224. Xu, D., Hu, J., Xu, S., De Bruyne, E., Menu, E., Van Camp, B., Vanderkerken, K. & Van

Valckenborgh, E. 2012, "Dll1/Notch activation accelerates multiple myeloma disease

development by promoting CD138 + MM-cell proliferation", Leukemia, vol. 26, no. 6, pp.

1402-1405.

225. Zhang, X., Sun, Y., Pireddu, R., Yang, H., Urlam, M.K., Lawrence, H.R., Guida, W.C.,

Lawrence, N.J. & Sebti, S.M. 2013, "A novel inhibitor of STAT3 homodimerization

selectively suppresses STAT3 activity and malignant transformation", Cancer research, vol.

73, no. 6, pp. 1922-1933.

226. Zhang, X., Yue, P., Page, B.D.G., Li, T., Zhao, W., Namanja, A.T., Paladino, D., Zhao, J.,

Chen, Y., Gunning, P.T. & Turkson, J. 2012, "Orally bioavailable small-molecule inhibitor

of transcription factor Stat3 regresses human breast and lung cancer xenografts",

Proceedings of the National Academy of Sciences of the United States of America, vol. 109,

no. 24, pp. 9623-9628.

227. Wrobel, J. & Dietrich, A. 1993, "Preparation of L-(phosphonodifluoromethyl)phenylalanine

derivatives as non-hydrolyzable mimetics of O-phosphotyrosine", Tetrahedron Letters, vol.

34, no. 22, pp. 3543-3546.

126

228. Han, Y., Belley, M., Bayly, C.I., Colucci, J., Dufresne, C., Giroux, A., Lau, C.K., Leblanc,

Y., McKay, D., Therien, M., Wilson, M.-., Skorey, K., Chan, C., Scapin, G. & Kennedy,

B.P. 2008, "Discovery of [(3-bromo-7-cyano-2-naphthyl)(difluoro)methyl]phosphonic acid,

a potent and orally active small molecule PTP1B inhibitor", Bioorganic and Medicinal

Chemistry Letters, vol. 18, no. 11, pp. 3200-3205.

229. Irudayam, S.J. & Henchman, R.H. 2009, "Entropic cost of protein-ligand binding and its

dependence on the entropy in solution", Journal of Physical Chemistry B, vol. 113, no. 17,

pp. 5871-5884.

230. Batcho, A.D. & Leimgruber, W. 1985, "Indoles from 2-methylnitrobenzenes by

condensation with formamide acetals followed by reduction: 4-benzyloxyindole", Organic

Syntheses, vol. 63, pp. 214-225.

231. Becker, O.M., Levy, Y. & Ravitz, O. 2000, "Flexibility, Conformation Spaces, and

Bioactivity", Journal of Physical Chemistry B, vol. 104, no. 9, pp. 2123-2135.

232. Bambuch, V., Otmar, M., Pohl, R., Masojídková, M. & Holý, A. 2007, "C-

Functionalization of 9-deazapurines by cross-coupling reactions", Tetrahedron, vol. 63, no.

7, pp. 1589-1601.

233. Guimarães, C.R.W., Kopecky, D.J., Mihalic, J., Shen, S., Jeffries, S., Thibault, S.T., Chen,

X., Walker, N. & Cardozo, M. 2009, "Thermodynamic analysis of mRNA cap binding by the

human initiation factor eIF4E via free energy perturbations", Journal of the American

Chemical Society, vol. 131, no. 50, pp. 18139-18146.

234. Prichard, M.N., Keith, K.A., Johnson, M.P., Harden, E.A., McBrayer, A., Luo, M., Qiu, S.,

Chattopadhyay, D., Fan, X., Torrence, P.F. & Kern, E.R. 2007, "Selective phosphorylation

of antiviral drugs by vaccinia virus thymidine kinase", Antimicrobial Agents and

Chemotherapy, vol. 51, no. 5, pp. 1795-1803.

235. Nebert, D.W. 2002, "Transcription factors and cancer: An overview", Toxicology, vol. 181-

182, pp. 131-141.

127

236. Jain, M., Arvanitis, C., Chu, K., Dewey, W., Leonhardt, E., Trinh, M., Sundberg, C.D.,

Bishop, J.M. & Felsher, D.W. 2002, "Sustained loss of a neoplastic phenotype by brief

inactivation of MYC", Science, vol. 297, no. 5578, pp. 102-104.

237. Jorgensen, W. 2004, "The many roles of computation in drug discovery", Science, vol. 303,

no. 5665, pp. 1813-1818.

238. Halperin, I., Ma, B., Wolfson, H. & Nussinov, R. 2002, "Principles of docking: An

overview of search algorithms and a guide to scoring functions", Proteins: Structure,

Function, and Genetics, vol. 47, no. 4, pp. 409-443.

239. Klebe, G. 2000, "Recent developments in structure-based drug design", Journal of

Molecular Medicine, vol. 78, no. 5, pp. 269-281.

240. Guido, R.V.C., Oliva, G. & Andricopulo, A.D. 2008, "Virtual screening and its integration

with modern drug design technologies", Current medicinal chemistry, vol. 15, no. 1, pp. 37-

46.

241. Lipinski, C., Lombardo, F., Dominy, B. & Feeney, P. 1997, "Experimental and

computational approaches to estimate solubility and permeability in drug discovery and

development settings", Advanced Drug Delivery Reviews, vol. 23, no. 1-3, pp. 3-25.

242. Congreve, M., Carr, R., Murray, C. & Jhoti, H. 2003, "A rule of three for fragment-based

lead discovery?", Drug discovery today, vol. 8, no. 19, pp. 876-877.

243. Verdonk, M., Cole, J., Hartshorn, M., Murray, C. & Taylor, R. 2003, "Improved protein-

ligand docking using GOLD", Proteins-Structure Function and Genetics, vol. 52, no. 4, pp.

609-623.

244. Hartshorn, M.J., Verdonk, M.L., Chessari, G., Brewerton, S.C., Mooij, W.T.M., Mortenson,

P.N. & Murray, C.W. 2007, "Diverse, high-quality test set for the validation of protein-

ligand docking performance", Journal of medicinal chemistry, vol. 50, no. 4, pp. 726-741.

245. Ho, C.M.W. & Marshall, G.R. 1990, "Cavity search: An algorithm for the isolation and

display of cavity-like binding regions", Journal of computer-aided molecular design, vol. 4,

no. 4, pp. 337-354.

128

246. Eldridge, M.D., Murray, C.W., Auton, T.R., Paolini, G.V. & Mee, R.P. 1997, "Empirical

scoring functions: I. The development of a fast empirical scoring function to estimate the

binding affinity of ligands in receptor complexes", Journal of Computer-Aided Molecular

Design, vol. 11, no. 5, pp. 425-445.

247. Mooij, W.T.M. & Verdonk, M.L. 2005, "General and targeted statistical potentials for

protein-ligand interactions", Proteins: Structure, Function and Genetics, vol. 61, no. 2, pp.

272-287.

248. Korb, O., Stützle, T. & Exner, T.E. 2009, "Empirical scoring functions for advanced

Protein-Ligand docking with PLANTS", Journal of Chemical Information and Modeling,

vol. 49, no. 1, pp. 84-96.

249. Surles, M.C., Richardson, J.S., Richardson, D.C. & Brooks Jr., F.P. 1994, "Sculpting

proteins interactively: Continual energy minimization embedded in a graphical modeling

system", Protein Science, vol. 3, no. 2, pp. 198-210.

250. Lennard-Jones, J.E. 1931, "Cohesion", Proceedings of the Physical Society, vol. 43, no. 5,

pp. 461-482.

251. Clark, M., Cramer, R.D. & Van Opdenbosch, N. 1989, "Validation of the general purpose

tripos 5.2 force field", Journal of Computational Chemistry, vol. 10, no. 8, pp. 982-1012.

252. Cornell, W.D., Cieplak, P., Bayly, C.I., Gould, I.R., Merz Jr., K.M., Ferguson, D.M.,

Spellmeyer, D.C., Fox, T., Caldwell, J.W. & Kollman, P.A. 1995, "A second generation

force field for the simulation of proteins, nucleic acids, and organic molecules", Journal of

the American Chemical Society, vol. 117, no. 19, pp. 5179-5197.

253. Turkson, J., Zhang, S., Mora, L.B., Burns, A., Sebti, S. & Jove, R. 2005, "A novel platinum

compound inhibits constitutive Stat3 signaling and induces cell cycle arrest and apoptosis of

malignant cells", Journal of Biological Chemistry, vol. 280, no. 38, pp. 32979-32988.

254. Smith, K., Musson, A. & DeBoos, G. 1998, "A novel method for the nitration of simple

aromatic compounds", Journal of Organic Chemistry, vol. 63, no. 23, pp. 8448-8454.

129

255. Jones, F.T. & Wong, R.Y. 1975, "The optical and crystallographic properties of m

nitrobenzoic acid", Microscope, vol. 23, no. 1, pp. 1-14.

256. Rodrigues, A.D. 1994, "Use of in vitro human metabolism studies in drug development. An

industrial perspective", Biochemical pharmacology, vol. 48, no. 12, pp. 2147-2156.

257. Fisher, M.B., Campanale, K., Ackermann, B.L., Vandenbranden, M. & Wrighton, S.A.

2000, "In vitro glucuronidation using human liver microsomes and the pore- forming peptide

alamethicin", Drug Metabolism and Disposition, vol. 28, no. 5, pp. 560-566.

258. Daves, G.D., Noell, C.W., Robins, R.K., Koppel, H.C. & Beaman, A.G. 1960, "Potential

Purine Antagonists .22. the Preparation and Reactions of Certain Derivatives of 2-Amino-6-

Purinethiol", Journal of the American Chemical Society, vol. 82, no. 10, pp. 2633-2640.

130

7 Appendix 1: Introduction to Computationally Aided Drug-Design

Computers and computational methods have infused into every aspect of drug discovery237-240

.

Computation drives the critical steps needed to develop novel drug entities including hit

discovery, property prediction, and drug design. Briefly, drug discovery based on computational

virtual screening is reliant on the identification of established inhibitory molecules or the

structure of a targeted bio-molecule. Using this information chemical libraries are narrowed to

match the molecular criteria put-forth by pre-existing inhibitors or, in cases when the structure of

the target is known (X-ray crystallography, NMR or predicted by homology modelling),

molecular docking is employed to generate hit molecules. Next, Lipinski, Murcko and co-

workers at Pfizer and Vertex established the Lipinski’s “rule of five”, which highlighted

particular molecular properties that were likely to confer molecules with favorable

pharmacokinetics241

. Computational methods can predict molecular properties, allowing for their

consideration earlier in drug-design to increase the likelihood of clinical success. Also, Congreve

and associates established an analogous “rule of three” 242

, which allowed for in silico pre-

screening to identify lead-like compounds that better tolerate the modifications needed to confer

increased target specificity. Lastly, insight into the molecular interaction between target and

inhibitory entities through in silico methods can aid in the design of superior agents. Molecular

dynamic simulations or Monte Carlo statistical mechanics that feature free-energy perturbation

and thermodynamic integration analysis are the most vigorous and computationally demanding

calculations that can be performed on ligand-protein binding interactions. These calculations

include discrete water molecules that are capable of forming hydrogen bond bridges between

ligand and protein making these results very accurate; however, these calculations are laborious

and time consuming in comparison to the less computational taxing docking procedures. The

alternative docking procedures can produce remarkably consistent binding modes that are

comparable to co-crystallized protein-drug complexes found in the published literature and

protein databanks. Description of molecular docking procedures and their use in drug-design will

be addressed below.

131

7.1 An Introduction to Ligand Docking Through the Description of GOLD Docking Software

A number of docking algorithms exist that assess and visualize protein-ligand interactions.

Principle techniques include: fragment-based methods, point complementarily methods,

molecular dynamics, Monte Carlo methods, and genetic algorithms. GOLD software utilizes a

genetic algorithm to predict and explain the binding mode of novel chemical entities to protein

binding sites158, 243

. GOLD’s custom genetic algorithm employs an evolutionary strategy to

explore the viability of a given population of ligand conformations (herein referred to as

chromosomes) of flexible ligands to rigid/semi-flexible protein sites. A weighted scoring

function, derived from the parameterized energenics of protein-ligand interactions, ranks

assortments of chromosomes. GOLD’s success rate, designated by a root mean square difference

less than 2 Å between predicted and experimental binding modes, was determined to be 81%

when tested against a validation set of 85 complexes244

. In order to operate, molecular docking

programs must possess algorithms that performs the following tasks: provide a mechanism for

docking, a search algorithm and a scoring function.

GOLD’s mechanism for docking is initiated by ligand and protein parameterization. Protein

structures are prepared by selectively removing ions, water, and ligand molecules, followed by

the protonation of protein residues that accounts for physiological pH. Next, binding sites are

defined using a point of origin and a specified selection radius. A flood-fill algorithm locates all

the solvent-accessible surfaces within the radius given, a cavity-detection algorithm isolates

concave solvent accessible sites for ligand binding, and an additional flood-fill procedure

identifies protein surface within 2 Å from the isolated cavities and terminates binding site

identification245

. Hydrogen-bond donors and acceptors are identified using atom-typing and their

availability for bonding is critiqued (i.e. are they already hydrogen bonding with nearby

residues). A map of fitting points - the theoretical location in space where an appropriately place

atom could satisfy a hydrogen bond - is developed within the designated binding site.

Furthermore, GOLD generates hydrophobic fitting points located within the mapped region into

which ligand CH groups could be placed. With the fitting points assembled and atom

descriptions acquired, the entire protein surface is encoded within GOLD. Ligands are treated in

a similar fashion, with identification of hydrogen bonding potential, rotational flexibility and

atom position all encoded and their fitting points established. Mechanistically, docking is

132

achieved by matching the appropriate fitting points of a ligand to the protein (i.e. protein H-

donor to ligand H-acceptor).

The search function of GOLD utilizes a genetic algorithm that establishes a population of

chromosomes that are driven by a selection pressure to produce an accurate binding description.

Before the first round of selection begins, the rotational and translational parameters of all

ligands are scrambled to prevent bias. The chromosomes are then fitted to maximize hydrogen

bonding with the protein through their established fitting points. Additionally, the following

parameters are modified/optimized: the angles of ligand rotatable bonds, ligand ring geometries

(ie. flipping ring corners), and the dihedrals of the OH and NH3+

groups found on the protein.

Selection pressure is simulated by the application of several genetic operations termed crossover,

mutation and migration. Crossover operations combine two ‘parent’ chromosomes while the

mutation operation introduces random perturbations to pre-existing chromosomes. Both

operators select parent chromosomes based on the ‘fittest’ conformations (as determined by a

scoring function to be discussed below) using a roulette-wheel-selection method that positively

biases selection probability with increased fitness. The migration operation serves to increase

efficiency by replacing weak molecular dockings with promising chromosomes from distinct

subpopulations. Population size (ie. number of chromosomes docked) and the number of

selection cycles are the most critical parameters in determining run time and accuracy, with

increased numbers of both resulting in longer run times and improved results. Coupled with

rationalized scoring functions, the genetic algorithm operations effectively predict ligand-protein

binding.

Critical to the accuracy of the genetic operations is the fitness score attributed to each

chromosome in the population. GOLD software has several available functions for scoring,

including: GoldScore, ChemScore246

, Astex Statistical Potential (ASP)247

, CHEMPLP

(Piecewise Linear Potential)248

. The basis of the GoldScore function will serve as a

representative example for scoring algorithms and was the primary function used in this body of

work. The GoldScore fitness function is composed of four primary components, protein-ligand

hydrogen bond energy (Shb_ext), protein-ligand van der Waals energy (Svdw_ext), ligand internal

van der Waals energy(Svdw_int) and ligand torsional strain energy (Stor_int), and is summarized in

the following equation:

133

GOLD Fitness = Shb_ext + Svdw_ext + Svdw_int + Stor_int.

These energy contributions are calculated using molecular mechanics-like functions and are

weighted based on experimental optimization during algorithm development. Protein-ligand

hydrogen bond energies are determined through the virtual fitting points, with maximum weight

attributed to hydrogen bonds that possess perfect geometry and positioning. The weighted sum of

all hydrogen bonds is combined in the Shb_ext term. The van der Waal’s energy of the protein-

ligand association uses a 4-8 potential with a linear cut-off that is presented in the following

form249

:

48

ijij

ijd

B

d

AE .

In the equation, i and j represent an atom from the protein and one from the ligand, d donates the

distance between these two atoms, and A and B are constructed parameters. The basis of the 4-8

equation is the Lennard-Jones 6-12 potential250

, a formula that models the energy of the

interaction between two neutral species. The 4-8 potential used by GOLD was parameterized to

reproduce the same minimum values of the 6-12 potential while accounting for the polarizability

and ionisation potential properties of the involved atoms. Investigator’s claim that the 4-8

potential produced better docking results as it allowed for close contacts between protein surface

and ligand.

Internal energy of the ligand accounted for both steric and torsional energies. Steric energies are

determined through the 6-12 potential of the form:

612

ijij

ijd

D

d

CE ,

Where C and D are parameterized in a similar fashion to A and B, ij represents individual atoms

on the same molecule, and d denotes distance. Torsional energy is derived from the association

of four consecutively bonded atoms, the torsional angle, the periodicity, and the barrier to

rotation, in accordance to the TRIPOS 5.2 function derived by Clark et al251

.

Together with the genetic algorithm, the fitting functions utilized in GOLD docking allow for a

robust method for in silico prediction of ligand-protein interactions. GOLD docking software has

134

been used in the rational design of inhibitory agents and 3D-Quantitative structure activity

relationships. Both of these applications are of significant value to the work described herein.

135

8 Appendix 2: Experimental Methods For Peptidomimetics

8.1 Computational Investigation into Peptidomimetics

2D structures of peptidomimetic inhibitors were constructed in ChemDraw (Cambridgesoft,

Massachusetts) along with appropriate charge states anticipated at physiological pH. Structures

were converted into 3D renderings using ChemDraw3D (Cambridgesoft, Massachusetts). Atom

typing and geometry optimization was performed within ArgusLab (Thompson, Washington)

utilizing molecular mechanics with the AMBER forcefield252

. Molecular information was saved

in the MOL extension, and loaded into PyMol (Schrodinger, Oregon) for atom distance

measurements. Next, STAT3 crystal structure, 1BG1, was obtained from the RCSB Protein Data

Bank and initialized in GOLD (CCDC, Cambridge) along with the MOL files coding

peptidomimetics. Water molecules were removed from the protein file and the SH2 domain was

defined as the binding site by selecting the central serine residue (Ser636) as the point of origin

and a radius of 8 Å. Molecules were allowed complete freedom of rotation, translation, and ring

flipping, with protein residues kept rigid. Each peptidomimetic produced 50 docking solutions

that represented the top docking pose out of a population of 100 chromosomes that were evolved

over 200,000 generations. Solutions were ranked according to their GOLDScore and top poses

were criticized for similarity to control peptide. PyMOL was utilized to compare top docking

solutions to the gp130 sequence.

8.2 Biophysical Evaluations of Peptidomimetics

8.2.1 Competitive FP Experiments

A fixed concentration of fluorescently-labelled STAT-isoform specific probe (STAT1: FAM-

GpYDKPHVL-NH2; STAT3: FAM-GpYLPQTV-NH2; STAT5: FAM-GpYLVLDKW-NH2)

was incubated with increasing concentrations of the appropriate STAT (STAT1, STAT3,

STAT5) protein for 30 minutes at room temperature in the following buffer: 50mM NaCl, 10mM

Hepes, 1mM EDTA, 0.1%Nonidet P-40. Following the incubation, fluorescent polarization

measurements were taken on a M1000 TECAN Inifinite fluorescence polarimeter. Calibration

curves were analyzed using OriginPro8 (OriginLab, Northampton), and EC50’s were established

for each protein (STAT1: 80nM, STAT3:150nM, STAT5:105nM) with these concentrations used

136

for competitive binding experiements. For evaluating agents, STAT proteins at the

concentrations listed above were incubated with their respective probes (final concentration of

10nM) for 15 minutes. Perspective peptidomimetic inhibitors were added in serially diluted

concentrations and allowed to equilibrate for 15 minutes with the protein:probe solution. FP

measurements were taken using the TECAN M1000 polarimeter and dose-response curves were

plotted using OriginPro software and IC50’s were determined.

8.2.2 Surface Plasmon Resonance Experiments

Surface Plasmon resonance analysis was performed to characterize the binding of compounds to

STAT3, as previously reported189

. SensiQ and its analysis software Qdat (ICX Technologies,

Oklahoma City, OK) were used to analyze the interaction between agents and the STAT3 protein

and to determine the binding affinity. Purified STAT3 was immobilized on a HisCap Sensor

Chip by injecting 50 μg/ml of STAT3 onto the chip. Various concentrations of compounds in

running buffer (1X PBS, 0.5% DMSO) were passed over the sensor chip to produce response

signals. The association and dissociation rate constants were calculated using the Qdat software.

The ratio of the association and dissociation rate constants was determined as the affinity (KD).

8.3 Biological Evaluation of Peptidomimetics

8.3.1 Permeability and Efflux Analysis in Caco-2 models

Human, epithelial Caco-2 cells were seeded at a density of 75,000 cells/cm2, on high-density

PET membrane inserts, (1.0 µm pore size, 0.31 cm2 surface area) and utilized on day 25 (post-

seeding). At this stage of growth, cell monolayers were fully polarized and differentiated. All

compounds were tested at a final concentration of 10 µM, under non-gradient pH conditions (pH

7.4/7.4) for 90 minutes as previously described167

. Narrow-window mass extraction LC/MS

analysis was performed for all samples from this study using a Waters Xevo quadrupole time-of-

flight (QTof) mass spectrometer and an ACQUITY UPLC system, to determine relative peak

areas of parent compound. The percent of transported drug was calculated based on these peak

areas, relative to the initial, dosing concentration.

8.3.2 Cells and Reagents

NIH3T3 and counterparts transformed by v-scr (NIH3T3/v-SRC) or overexpressing the human

epidermal growth factor (EGF) receptor (NIH3T3/hEGFR), the murine thymus epithelial stromal

137

cells, and the human breast cancer (MDA-MB-231) and pancreatic cancer (Panc-1) cells have all

been previously reported144, 189

. Antibodies against STAT3, pTyr705STAT3, Erk1/2, and

pErk1/2 are from Cell Signaling Technology (Danvers, MA). Recombinant human epidermal

growth factor (rhEGF) was obtained from Invitrogen (Carlsbad, CA).

8.3.3 Cloning and Protein Expression

Coding regions for the murine STAT3 protein and STAT3 SH2 domain were amplified by PCR

and cloned into vectors pET-44 Ek/LIC (Novagen) and pET SUMO (Invitrogen), respectively.

The primers used for amplification were: STAT3 Forward:

GACGACGACAAGATGGCTCAGTGGAACCAGCTGC; STAT3 Reverse:

GAGGAGAAGCCCGGTTATCACATGGGGGAGGTAGCACACT; STAT3-SH2 Forward:

ATGGGTTTCATCAGCAAGGA; STAT3-SH2 Reverse:

TCACCTACAGTACTTTCCAAATGC. Clones were sequenced to verify the correct sequences

and orientation. His-tagged recombinant proteins were expressed in BL21(DE3) cells, and

purified on Ni-ion sepharose column.

8.3.4 EMSA for Determining STAT3-STAT3:DNA Dimer Disruption in Cell Nuclear Extracts

The EMSA assays performed differed solely in terms of inhibitor treatment order. The first

experiment called for treatment of nuclear extracts with inhibitor molecules. In the second

experiment, cells were first treated with inhibitors and were then subsequently subjected to

nuclear extraction. As the two experiments are unaltered in any other way, a general procedure is

outlined herein. NIH3T3 and the related v-src transformed analogue NIH3T3/v-SRC were

maintained as previously described162

. Nuclear extract preparation from NIH3T3/v-SRC cells

were performed in accordance to a previously reported procedure162

. Nuclear extracts with total

protein content were pre-incubated with the radiolabelled probe (in the case of the first

experiment, radioprobe was added following incubation with inhibitor molecules). The 32P-

labelled oligonucleotide probe consisted of 5’-AGCTTCATTTCCCGTAAATCCCTA, the high

affinity SIE from the c-fos gene m67 variant that binds both STAT1 and STAT3 protein. Bands

corresponding to DNA-binding activities were scanned and quantified for each compound using

ImageQuant and plotted as percent of control (vehicle) against the concentration of compound

allowing IC50 values to be derived as previously reported253

.

138

8.3.5 Cell Cytotoxicity Assay Using MTS dye, Associated Combination Studies, and Cyquant Assay

Human OCI-AML2 leukemia, DU-145 prostate, MDA-MB-468 breast cancer cells, and Human

HL-60 leukemia cells were seeded in 96 well clear flat-bottom plates. Adherent cell lines DU-

145 and MDA-MB-468 required an additional 24 hours after seeding before all of the cell lines

were treated with increasing concentrations of inhibitor molecules. Seventy-two-hours after

incubation, cell growth and viability was measured with the CellTiter 96 aqueous nonradioactive

MTS assay according to the manufacturer’s instructions (Promega, Madison, WI). Results were

normalized to control proliferation values and dose-response curves were fitted using OriginPro

8. For combination studies, approved drug concentrations were selected based on established

EC50’s against cell line DU-145. The results of the MTS assay was collected and was

subsequently analyzed using CalcuSyn (Biosoft, Cambridge), which performed drug dose-effect

calculations based on Median Effect methods described by Chou and Talalay.

CyQUANT assays were performed in accordance to the manufacturer's standard operating

instructions (Invitrogen): http://probes.invitrogen.com/media/pis/. Proliferating cells (MDA-MB-

231, Panc-1, DU-145, and NIH3TF/v-SRC) in 96-well plates were treated with peptidomimetic

inhibitors for 48 h for WST-1 assay analysis followed manufacturer’s (Roche) instructions:

www.roche-applied-science.com.

8.4 General Synthetic Methods and Characterization of Molecules

8.4.1 Chemical Methods for Peptidomimetics

Anhydrous solvents methanol, DMSO, CH2Cl2, THF and DMF were purchased from Sigma

Aldrich and used directly from Sure-Seal bottles. Molecular sieves were activated by heating to

300 °C under vacuum overnight. All reactions were performed under an atmosphere of dry

nitrogen in oven-dried glassware and were monitored for completeness by thin-layer

chromatography (TLC) using silica gel (visualized by UV light, or developed by treatment with

KMnO4 stain or phosphomolybdic acid stain). Low-resolution mass spectrometry (LRMS) was

obtained using a Waters Micromass ZQ with an ESI source in methanol. An AB/Sciex QStar

mass spectrometer with an ESI source and accurate mass capabilities was used with samples

dissolved in methanol to produce high-resolution mass spectrums.1H and

13C NMR spectra were

139

recorded on Bruker 400 MHz and a Varian 500 MHz spectrometers in either CDCl3, CD3OD or

d6-DMSO. Chemical shifts () are reported in parts per million after calibration to residual

isotopic solvent. Coupling constants (J) are reported in Hz. Before biological testing, inhibitor

purity was evaluated by reversed-phase HPLC (rpHPLC). Analysis by rpHPLC was performed

using a Microsorb-MV 300 A C18 250 mm x 4.6 mm column run at 1 mL/min, and using

gradient mixtures of (A) water with 0.1 M CH3COONH4 and (B) methanol. Ligand purity was

confirmed using linear gradients from 75 % A and 25 % B to 100 % B after an initial 2 minute

period of 100 % A. The linear gradient consisted of a changing solvent composition of either (I)

4.7 % per minute and UV detection at 254nm or (II) 1.4 % per minute and detection at 214nm,

each ending with 5 minutes of 100% B. For reporting HPLC data, percentage purity is given in

parentheses after the retention time for each condition. All biologically evaluated compounds are

> 95 % chemical purity as measured by HPLC. The HPLC traces for all tested compounds are

provided in supporting information.

8.4.2 General Procedures

General procedure A (N-benzylation of carboxylic acids):

To a stirring solution of the relevant acid (1.8g, 6.5 mmol) in anhydrous CH2Cl2 (0.1 M) was

added (COCl)2 (0.85mL, 9.8mmol) and catalytic DMF under an inert N2 atmosphere at rt. The

reaction was completed after 10 mins as assessed by TLC. The product was concentrated under

reduced pressure and the resulting residue dissolved in anhydrous CH2Cl2 (0.1 M), followed by

the step-wise addition of DIPEA (5 eq) and benzylamine (1.07mL, 9.8 mmol).The reaction was

complete after 15 mins as judged by TLC. The solution was diluted with CH2Cl2 and the

organics washed consecutively with 0.1 M HCl, saturated NaHCO3, and brine solution. The

organic layer was dried over anhydrous Na2SO4, filtered and concentrated under reduced

pressure. The resultant product was purified by flash column chromatography.

General procedure B (SnCl mediated nitro group reduction):

To a stirring solution of the appropriate nitro compound (1.7g, 5.0mmol) in EtOAc (0.1 M) was

added SnCl dihydrate (5.7g, 25.0mmol) in one portion. The resultant solution was refluxed for 2

h at 70 °C before quenching with saturated NaHCO3. The aqueous layer was extracted using

EtOAc and the combined organics were dried over anhydrous Na2SO4 and concentrated under

reduced pressure to furnish the product.

140

General procedure C (peptide couplings):

Method A: Under a N2 atmosphere, the relevant carboxylic acid (1.5 eq) (1.6g, 6.5mmol) was

added to a stirring solution of NMM (0.74mL, 5.6mmol) in anhydrous THF (0.1 M).

Isobutylchloroformate (0.61, 5.6 eq) was added in one portion and the solution was allowed to

stir at rt. After 15 mins, the appropriate amine (1.3g, 4.3mmol) was added drop-wise in a

solution of THF containing NMM (0.52mL, 4.8mmol). The reaction mixture was left to stir

overnight, concentrated and redissolved in distilled water. The water layer was then extracted

with CH2Cl2, and the combined organic layers washed with saturated NaHCO3 solution, distilled

water, and brine, dried over anhydrous Na2SO4 and concentrated.

Method B: The required carboxylic acid (340mg, 0.74mmol) was added in one portion to a

solution of HBTU (334mg, 0.88mmol) and DIPEA (0.18mL, 1.0mmol) in DMF (0.1 M), and the

resulting solution stirred at room temperature for 10 minutes. The required amine was then

dissolved in a solution of DIPEA (0.18mL, 1.0mmol) in DMF (0.1 M) and added to the activated

acid in one portion. The resulting solution was stirred for 4 hours, then diluted with EtOAc (0.1

M) and washed successively with equal volumes of: 2M HCl, saturated bicarbonate and brine.

The organic layer was dried over anhydrous Na2SO4, filtered and concentrated.

General procedure D (TFA mediated BOC deprotection):

To a stirred solution of BOC protected amine (300mg, 0.44mmol) in CH2Cl2 (2.2mL) under N2

was added TFA (2.2mL) and allowed to stir at room temperature for 3 h. The reaction was

monitored via TLC and stopped upon consumption of starting material. The solution was

concentrated and purified via silica gel chromatography to yield pure amine.

General procedure E (O-Benzylation of tyrosine)

To a stirring solution of L-tyrosine (2.0g, 13.8mmol) in toluene, was added TsOH-monohydrate

(3.2g, 15.2mmol)and benzyl alcohol (28.6mL, 276mmol). The solution was refluxed at 110 °C

for 16 h before removing the solvent under reduced pressure. The concentrates were dissolved in

diethyl ether and refrigerated. Product was precipitated out of solution, vacuumed filtered and

subsequently washed with cold ether to furnish pure product. The product was carried over to the

next step without further purification.

141

General procedure F (Hydrogenolysis of benzyl ester):

The required benzyl ester (1.6g, 4.0mmol) was dissolved in a stirred solution of MeOH:EtOAc

(1:1) and degassed thoroughly before the addition of Pd/C 10% (10 mg/mmol). H2 gas was then

bubbled through the solution for 5 mins before the solution was put under an atmosphere of H2

gas and stirred continuously for 3 h. The hydrogen gas was excluded from the reaction vessel

and the reaction mixture filtered to remove the Pd/C through glass fibre paper. The solution was

then concentrated to give pure product.

General procedure G (Suzuki cross-couplings):

A mixture of arylbromide (142mg, 0.2mmol), boronic acid (36mg, 0.22mmol), K2CO3 (69mg,

0.5mmol)and Pd(PPh3)4 (34mg, 0.03mmol) was suspended in DMF (0.1 M) in a sealed tube

vessel and irradiated in a Biotage Initiator microwave reactor (17 mins, 170 °C). After cooling to

rt, the reaction was diluted with water and repeatedly extracted with CH2Cl2. The combined

organic extracts were washed with brine, dried over anhydrous Na2SO4, filtered and concentrated

under reduced pressure.

General procedure H (phosphorylation using bis(dimethylamino)-phosphoramidic

chloride):

To a stirring solution of phenol (80mg, 0.1mmol) and DMAP (24.4mg, 0.2mmol) in

CH2Cl2:THF (0.1 M), was added DBU (22.4L, 0.15mmol) in one portion, followed by

bis(dimethylamino)-phosphoramidic chloride (18.8L, 0.13mmol).The reaction was left to stir

under an inert N2 atmosphere at rt for 6 h. The reaction was quenched with distilled water, the

product extracted using EtOAc, and the combined organics washed with a 1:1 mixture of

distilled water:NaH2PO4, distilled water, and brine. The organics were dried over anhydrous

Na2SO4, and concentrated under vacuum.

General procedure I (TFA mediated phosphoramidate hydrolysis):

Phosphoramidate (45mg, 0.051mmol) was added to a 9:1 mixture of TFA:H2O at room

temperature. The reaction mixture was left for 16 h. Complete transformation into the product

was confirmed by TLC. Reaction mixtures were co-evaporated with MeOH to near dryness, then

diluted with a mixture of HPLC grade water: acetonitrile (6:1) and lyophilized.

142

8.4.3 Detailed Synthetic Procedures for Peptidomimetics

2-bromo-4-nitrobenzoic acid (2.1a). To a stirring solution of 2-bromo-4-nitrotoluene254

(1 g,

4.6 mmol, 1 eq) in a 2:1 mixture of pyridine:H2O at a 0.1 M concentration, 1.5g (9.3mmol, 6eq)

of KMnO4 was added in three equal portions over the course of 45 min and refluxed at 90°C

overnight. The resulting crude mixture was added to a saturated NaHCO3 solution and poured

into a separatory funnel. The starting material was washed away successfully using diethylether,

leaving pure acid product in the aqueous layer. The remaining aqueous solution was acidified

using 3M HCl, and product was extracted into EtOAc. Organic layer was dried using Na2SO4,

concentrated under reduced pressure and co-evaporated with chloroform to give a pale yellow

crystal (54 %): δH (400 MHz, DMSO-d6) 7.95 (d, J = 8.4 Hz, 2H, 2 CH (Ar)), 8.27 (dd, J = 8.4

Hz and 2.2 Hz, 1H, CH, (Ar)), 8.47 (d, J = 2.2 Hz, 1H, CH, (Ar)); δC (100 MHz, DMSO-d6)

119.9, 122.8, 128.2, 131.1, 140.1, 148.7, 166.6; LRMS (MS-ES), calcd. For C7H3BrNO4 [M-H,

79Br] m/z = 243.93, fnd. 243.98 and [M-H,

81Br] m/z = 245.93, fnd. 246.04.

3-bromo-5-nitrobenzoic acid (2.1b). 16mL of concentration sulfuric acid was added to 3.0g

(18.0 mmol, 1 eq) of 3-nitrobenzoic acid255

. The solution was stirred and heated at 60°C before

the addition of NBS (3.84 g, 21.6 mmol, 1.2 eq) in three equal portions. Reaction was deemed

complete by TLC monitoring after 4 hours. The reaction mixture was diluted with H2O and

placed in a separatory funnel to extract product into diethylether. The organic layer was washed

with 0.1M HCl and brine, before it was dried over Na2SO4. Product was concentrated under

reduced pressure to obtain 4.27 g (97 % yield) of pale yellow powder; δH (400 MHz, DMSO-d6)

8.32 (t, J = 1.6 Hz, 1H, CH, (Ar)), 8.50-8.54 (m, 1H, CH, (Ar)), 8.59 (t, J=2.0 Hz, CH, (Ar)); δC

(100 MHz, DMSO-d6) 122.4, 122.8, 129.9, 164.2, 137.6, 148.7, 164.3; LRMS (MS ES), calcd.

143

For C7H3BrNO4 [M-H, 79

Br] m/z = 243.93, fnd. 244.14 and [M-H, Br-81] m/z = 245.93, fnd.

246.11.

N-benzyl-2-bromo-4-nitrobenzamide (2.2a) Reaction of 2.1a (1.8 g, 7.3 mmol) according to

procedure A, and purified by flash column chromatography (49:1 CH2Cl2:EtOAc) to furnish 5a

as a white solid (1.79 g, 5.3 mmol, 73 %): H (400MHz, DMSO-d6), 4.48 (d, J = 5.9 Hz, 2H, C-

H2Ph), 7.26-7.30 (m, 1H, CH (Ar)), 7.34-7.40 (m, 4H, 4 CH (Ar)), 7.71 (d, J = 8.5 Hz, 1H, 1

CH (Ar)), 8.28 (dd, J = 8.3 Hz and 2.2 Hz, 1H, CH (Ar)), 8.47 (d, J = 2.2 Hz, 1H, CH, (Ar)),

9.22 (t, J = 5.9 Hz, 1H, NH): C (100 MHz, DMSO-d6) 42.5, 119.5, 122.8, 127.0, 127.4, 127.5,

128.4, 129.8, 138.7, 144.8, 148.1, 166.0; LRMS (MS ES), calcd for C14H11BrN2O3 [M+H, 79

Br]

m/z = 335.00, fnd. 335.08 and [M+Na, 81

Br] m/z = 337.00, fnd. 337.05.

N-benzyl-3-bromo-5-nitrobenzamide (2.2b) Reaction of 2.1b (1.8 g, 7.3 mmol) according to

procedure A, and purified by flash column chromatography (49:1 CH2Cl2:EtOAc) to furnish 2.2b

as a white solid (1.81 g, 5.4 mmol, 74 %): δH (400 MHz, DMSO-d6) 4.51 (d, J = 5.8 Hz, 2H,

CH2), 7.26 (m, 1H, CH (Ar)), 7.34 (m, 4H, 4 CH (Ar)), 8.51 (t, J = 1.5 Hz, 1H, CH (Ar)), 8.55

(t, J = 1.9 Hz, 1H, CH (Ar)), 8.70 (t, J = 1.8 Hz, 1H, CH (Ar)) 9.49 (t, J = 5.8 Hz, 1H, NH); δC

(100 MHz, DMSO-d6) 43.1, 121.4, 122.2, 127.0, 127.5, 128.4, 128.6, 136.1, 137.1, 138.9, 148.7,

162.7; LRMS (MS ES), calcd for C14H11BrN2O3Na [M+Na, 79

Br] m/z = 357.00, fnd. 357.13 and

[M+Na, 81

Br] m/z = 359.00, fnd. 359.10.

4-amino-N-benzyl-2-bromobenzamide (2.3a) Reaction of 2.2a (1.7 g, 5.1 mmol) according to

procedure B, and purified by flash column chromatography (7:2 CH2Cl2:EtOAc) to furnish 2.3a

as a white solid (1.5 g, 4.9 mmol, 96 %): δH (400MHz, CD3Cl) 4.64 (d, J = 6.0 Hz, 2H, CH2Ph),

144

5.67 (br s, 2H, NH2), 6.54 (dd, J = 8.3 and 2.0 Hz, 1H, CH (Ar)), 6.80 (d, J = 2.0 Hz, 1H, CH

(Ar)), 7.15 (d, J = 8.3 Hz, 1H, 1 CH (Ar)), 7.23 (m, 1H, CH (Ar)), 7.33 (m, 4H, 4 CH (Ar)), 8.58

(t, J = 6.0 Hz, 1H, NHCH2); δC (100 MHz, DMSO-d6) 42.5, 112.0, 116.9, 120.2, 124.9, 126.7,

127.2, 128.2, 130.2, 139.6, 151.1, 167.5; LRMS (MS ES), calcd for C14H13BrN2O [M+H, 79

Br]

m/z = 305.03, fnd. 305.18 and [M+H, 81

Br] m/z = 307.03, fnd. 307.21.

3-amino-N-benzyl-5-bromobenzamide (2.3b) Reaction of 2.2b (1.7g, 5.1 mmol) according to

procedure B, and purified by flash column chromatography (7:2 CH2Cl2:EtOAc) to furnish 2.2b

as a white solid (1.5 g, 4.8 mmol, 95 %): δH (400 MHz, DMSO-d6) 4.42 (d, J = 6.0 Hz, 2H,

CH2Ph), 5.61 (s, 2H, NH2), 6.87 (t, J = 1.9 Hz, 1H, CH (Ar)), 7.05 (t, J = 1.8 Hz, 1H, (Ar)), 7.14

(t, J = 1.5 Hz, 1H, ArBr), 7.23(m, 1H, CH (Ar)), 7.30 (m, 4H, 4 CH (Ar)), 8.94 (t, J = 6.0 Hz,

1H, CONH); C (100 MHz, DMSO-d6) 42.6, 112.1, 116.3, 118.1, 121.9, 126.7, 127.2, 128.3,

137.2, 139.6, 150.5, 165.5; LRMS (MS ES), calcd for C14H13BrN2ONa [M+Na, 79

Br] m/z =

327.02, fnd. 327.21 and [M+Na, 81

Br] m/z = 329.02, fnd. 329.16.

(S)-4-(2-amino-4-methylpentanamido)-N-benzyl-2-bromobenzamide (2.4a). Reaction of 2.3a

(1.3g, 4.3mmol) according to procedure C (Method A) furnished 2.4a (2.1 g, 4.1 mmol, 96 %):

δH (400 MHz, DMSO-d6) 0.91-0.94 (m, 6H, 2 CH3 (Leu)), 1.37 (s, 9H, C(CH3)3), 1.66-1.77 (m,

3H, CHCH2 (Leu)), 4.12 (s, 1H, CH (Leu)), 4.43 (d, J = 6.0 Hz, 2H, CH2Ph), 7.12 (d, J = 8 Hz,

1H, BOC-NH), 7.24-7.25 (m, 1H, CH (Ar)), 7.31-7.37 (m, 4H, 4 CH (Ar)), 7.44 (d, J = 8.4 Hz,

1H, CH (Ar)), 7.71 (dd, J = 8.4 and 1.9 Hz, 1H, CH (Ar)), 8.09 (d, J = 1.9 Hz, 1H, CH (Ar)),

8.92 (t, J = 6.0 Hz, 1H, NHBn), 11.7 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 22.2, 22.6, 23.7,

28.4, 42.5, 51.7, 118.1, 119.1, 122.9, 126.8, 127.3, 128.3, 129.4, 134.1, 139.1, 140.1, 166.9,

168.5; LRMS (MS ES), calcd. For C25H32BrN3O4Na [M+Na, 79

Br] m/z = 540.16, fnd. 540.31 and

[M+Na, 81

Br] m/z = 542.16, fnd. 540.27.

145

(S)-tert-butyl 1-(3-(benzylcarbamoyl)-5-bromophenylamino)-4-methyl-1-oxopentan-2-

ylcarbamate (2.4b). Reaction of 2.3b (1.5 g, 6.4 mmol) according to procedure C (Method A)

furnished 2.4b (2.7 g, 5.7 mmol, 89.3 %): δH (400 MHz, DMSO-d6) 0.89 (dd, J= 6.4 Hz and

3.5 Hz ,6H, CH3 (Leu)), 1.35 (s, 9H, C(CH3)3), 1.61-1.68 (m, 3H, CHCH2 (Leu)), 4.10 (m, 1H,

CH (Leu)), 4.46 (d, J = 6.0 Hz, 2H, CH2Ph), 7.11 (d, J = 8 Hz, 1H, BOC-NH), 7.24 (m, 1H, CH

(Ar)), 7.32 (m, 4H, CH (Ar)), 7.76 (s, 1H, CH (Ar)), 8.00 (t, J=1.6 Hz, 1H, CH(Ar)), 8.15 (s, 1H,

CH (Ar)), 9.15 (t, J=6.0 Hz, 1H, NHBn), 10.31 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.5,

22.9, 24.4, 28.2, 42.8, 53.6, 78.1, 117.6, 121.5, 123.8, 124.1, 126.8, 127.3, 128.3, 136.9, 139.3,

140.6, 155.5, 164.7, 172.5; LRMS (MS ES), calcd. For C25H32BrN3O4Na [M+Na, 79

Br] m/z =

540.16, fnd. 540.16 and [M+Na, 81

Br] m/z = 542.16, fnd. 542.24.

(S)-4-(2-amino-4-methylpentanamido)-N-benzyl-2-bromobenzamide (2.5a). Reaction of 2.4a

(2.0g, 3.9mmol) with BOC deprotection procedure D furnished 2.5a as a white solid (1.6g,

3.8mmol, 99 %): δH (400 MHz, DMSO-d6) 0.91-0.94 (m, 6H, 2 CH3 (Leu)), 1.66-1.77 (m, 3H,

CHCH2 (Leu)), 4.12 (s, 1H, CH (Leu)), 4.43 (d, J = 6.0 Hz, 2H, CH2Ph) 7.25-7.26 (m, 1H, CH

(Ar)), 7.31-7.38 (m, 4H, 4 CH (Ar)), 7.43 (d, J = 8.4 Hz, 1H, CH (Ar)), 7.71 (dd, J = 8.4 and 1.9

Hz, 1H, CH (Ar)), 8.09 (d, J = 1.9 Hz, 1H, CH (Ar)), 8.50 (br s, 3H, NH3), 8.93 (t, J = 6.0 Hz,

1H, NHBn), 11.5 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 22.2, 22.6, 23.7, 42.5, 51.7, 118.1,

119.1, 122.9, 126.8, 127.3, 128.3, 129.4, 134.1, 139.1, 140.1, 166.9, 168.5 ; LRMS (MS ES),

calcd for C20H25BrN3O2 [M+H, 79

Br] m/z = 418.11, fnd. 418.20 and [M+H, 81

Br] m/z = 420.11,

fnd. 420.16.

146

(S)-3-(2-amino-4-methylpentanamido)-N-benzyl-5-bromobenzamide (2.5b). Reaction of 2.4b

(2.5 g, 4.8 mmol) with BOC deprotection procedure D furnished 2.5b as a white solid (2.0 g, 4.8

mmol, 99%): δH (400 MHz, DMSO-d6) 0.91-0.94 (m, 6H, 2 CH3 (Leu)), 1.66-1.73 (m, 3H,

CHCH2 (Leu)), 4.09-4.10 (m, 1H, CH (Leu)), 4.43 (d, J = 6.0 Hz, 2H, CH2Ph) 7.21-7.27 (m,

1H, CH (Ar)), 7.30-7.32 (m, 4H, 4 CH (Ar)), 7.86-7.87 (m, 1H, CH (Ar)), 8.13-8.14 (m, 1H, CH

(Ar)), 8.16-8.17 (m, 1H, CH (Ar)), 8.52 (br s, 3H, NH3), 9.24-9.26 (t, J = 6.0 Hz, 1H, NHBn),

11.43 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 22.2, 22.6, 23.8, 42.8, 51.7, 118.0, 121.5, 124.2,

124.9, 126.8, 127.3, 128.3, 137.0, 139.3, 139.9, 164.5, 168.5; LRMS (MS ES), calcd for

C20H25BrN3O2 [M+H, 79

Br] m/z = 418.11, fnd. 418.30 and [M+H, 81

Br] m/z = 420.11, fnd.

420.28.

(S)-benzyl 2-(4-cyanobenzamido)-3-(4-hydroxyphenyl)propanoate (2.6 and 2.7). Reaction of

tyrosine (1.0 g, 5.5 mmol) according to procedure E yielded benzyl ester 2.6 (not isolated) that

was immediately coupled to 4-cyanobenzoic acid according to procedure A (method A) to

furnish 2.7 as a white solid (1.7 g, 4.2 mmol, 84 %): δH (400 MHz, DMSO-d6) 2.97-3.11 (m, 2H,

CH2Ar (Tyr)), 4.61-4.67 (m, 1H, CH (Tyr)), 5.12 (s, 2H, CH2Ph), 6.65 (d, J = 8.44 Hz, 2H (Ar)),

7.08 (d, J = 8.4 Hz, 2H, 2 CH (Ar)), 7.27-7.37 (m, 5H, 5 CH (Ar)), 7.93-7.98 (m, 4H, Ar-CN),

9.14 (d, J = 7.6 Hz, 1H, NH), 9.27 (s, 1H, OH); δC (100 MHz, DMSO-d6) 35.5, 55.0, 66.1, 113.9,

115.1, 118.3, 127.4, 127.8, 128.1, 128.3, 128.4, 130.1, 135.9, 137.7, 156.1, 165.3, 171.4; LRMS

(MS ES), calcd for C24H20N2O4Na [M+Na] m/z = 423.14, fnd. 423.23.

147

(S)-2-(4-cyanobenzamido)-3-(4-hydroxyphenyl)propanoic acid (2.8). Reaction of 2.7 (1. 6g,

4.0 mmol) according to procedure F yielded the carboxylate 2.8 as a white solid in quantitiative

yield (1.2 g, 4.0 mmol, 99 %): δH (400 MHz, DMSO-d6) 2.90-2.96 (m, 1H, CH, CH2 (Tyr)),

3.06-3.11(m, 1H, CH2 (Tyr)), 4.51-4.57 (m, 1H, CH (Tyr)), 6.34 (d, J = 8.4 Hz, 2H, 2 CH (Ar)),

7.09 (d, J = 8.4 Hz, 2H, 2 CH (Ar)), 7.94 (s, 4H, Ar-CN), 8.92 (d, J = 8.1 Hz, 1H, NH); δC (100

MHz, DMSO-d6) 35.6, 54.8, 113.8, 115.0, 118.4, 128.1, 128.2, 130.0, 132.4, 138.0, 155.9,

165.0, 173.1; LRMS (MS ES), calcd for C17H13N2O4 [M-H] m/z = 309.10, fnd. 309.12.

N-benzyl-2-bromo-4-((S)-2-((S)-2-(4-cyanobenzamido)-3-(4-hydroxyphenyl)propanamido)-

4-methylpentanamido)benzamide (2.9a). Compound 2.8 (687 mg, 2.2 mmol) was coupled to

2.5a (840 mg, 2.0 mmol), according to procedure A (method B) to furnish 2.9a, and then purified

by flash chromatography (96.8:2.8:0.4 CH2Cl2:MeOH:NH4OH) to obtain a yellow solid (896

mg, 1.3 mmol, 63 %): δH (400 MHz, DMSO-d6) 0.91 (dd, J = 17.0 and 6.4 Hz, 6H, 2 CH3 (Leu)),

1.52-1.71 (m, 3H, CH2CH (Leu)), 2.82-2.88 (m, 1H, CH, CH2 (Tyr)), 3.02-3.06 (m, 1H, CH,

CH2 (Tyr)), 4.43-4.47 (m, 3H, CH (Leu) and NHCH2Ph), 4.66-4.71 (m, 1H, CH (Tyr)), 6.63 (d,

J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.15 (d, J = 8.4 Hz, 2H, 2 CH (Ar, Tyr)), 7.23-7.27 (m, 1H, CH

(Ar)), 7.32-7.42 (m, 5H, 5 CH (Ar)), 7.59 (d, J = 8.3 Hz, 1H, CH (Ar)), 7.92-7.97 (m, 4H, 4 CH

(Ar-CN)), 8.03 (d, J = 2.0 Hz, 1H, CH (Ar)), 8.37 (d, J = 8.0 Hz, 1H, CONH), 8.80 (d, J =

8.4 Hz, 1H, CONH), 8.87 (t, J = 6.0 Hz, 1H, NHBn), 9.15 (s, 1H, OH (Tyr)), 10.24 (s, 1H,

NHAr); δC (100 MHz, DMSO-d6) 21.6, 23.0, 24.3, 36.2, 40.5, 42.5, 52.3, 55.3, 113.7, 114.9,

117.8, 118.3, 119.1, 122.6, 126.8, 127.2, 128.2, 128.2, 128.3, 129.4, 130.1, 132.4, 133.5, 138.0,

148

139.2, 140.6, 155.7, 165.0, 167.0, 171.4, 171.6; LRMS (MS ES), calcd for C37H36BrN5O5 [M+H,

79Br] m/z = 710.20, fnd. 710.22 and [M+H,

81Br] m/z = 712.20, fnd. 712.24.

N-benzyl-3-bromo-5-((S)-2-((S)-2-(4-cyanobenzamido)-3-(4-hydroxyphenyl)propanamido)-

4-methylpentanamido)benzamide (2.9b). Compound 8 (512 mg, 1.6 mmol) was coupled to

2.5b (630 mg, 1.5 mmol) according to procedure A (method B) to furnish 2.9b, and then purified

by flash chromatography (3:1 CH2Cl2:(92:7:1 CH2Cl2:MeOH:NH4OH)) to obtain a white solid

(672 mg, 0.9 mmol, 50 %): δH (400 MHz, DMSO-d6) 0.91 (dd, J = 17.2 and 6.2 Hz, 6H, 2 CH3

(Leu)), 1.53-1.69 (m, 3H, CH2CH (Leu)), 2.80-2.89 (m, 1H, CH, CH2 (Tyr)), 3.02-3.05 (m, 1H,

CH, CH2 (Tyr)), 4.43-4.47 (m, 3H, CH (Leu) and NHCH2Ph), 4.65-4.71 (m, 1H, CH (Tyr)), 6.61

(d, J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.14 (d, J = 8.4 Hz, 2H, 2 CH (Ar-OH, Tyr)), 7.23-7.26 (m,

1H, CH (Ar)), 7.29-7.35 (m, 4H,4 CH (Ar)), 7.77 (t, J = 1.5 Hz, 1H, CH (Ar)), 7.90-7.96 (m, 4H,

4 CH (Ar-CN)), 8.01 (t, J = 1.5 Hz, 1H, CH (Ar)), 8.14 (t, J = 2.0 Hz, 1H, CH (Ar)), 8.37 (d, J =

7.1 Hz, 1H, CONH), 8.79 (d, J = 8.3 Hz, 1H, CONH) 9.13-9.17 (m, 2H, NHBn and Ar-OH

(Tyr)), 10.36 (s, 1H, NHArBr); δC (100 MHz, DMSO-d6) 21.6, 23.0, 24.3, 36.2, 40.7, 42.8, 52.3,

55.3, 113.7, 114.9, 117.7, 118.3, 121.5, 123.9, 124.2, 126.8, 127.3, 128.2, 128.2, 128.3, 130.1,

132.4, 136.9, 138.0, 139.3, 140.5, 155.7, 164.6, 165.0, 171.5, 171.6; LRMS (MS ES), calcd. for

C37H36BrN5O5Na [M+Na, 79

Br] m/z = 732.19, fnd. 732.08 and [M+Na, 81

Br] m/z = 734.19, fnd.

734.08.

(N2-benzyl-5-((S)-2-((S)-2-(4-cyanobenzamido)-3-(4-hydroxyphenyl)propanamido)-4-

149

methylpentanamido)biphenyl-2,4'-dicarboxamide (2.10aa). Compound 2.9a (142 mg, 0.2

mmol) was coupled to 4-aminocarbonylphenyl boronic acid according to general procedure G.

Crude material was purified by flash chromatography (92:7:1 CH2Cl2:MeOH:NH4OH) and

yielded final product 2.10aa as white solid (86 mg, 0.11 mmol, 57 %): δH (400 MHz, DMSO-d6)

0.91 (dd, J = 16.2 and 6.4 Hz, 6H, 2 CH3 (Leu)), 1.52-1.71 (m, 3H, CH2CH (Leu)), 2.82-2.89 (m,

1H, CH, CH2 (Tyr)), 3.01-3.05 (m, 1H, CH, CH2 (Tyr)), 4.27-4.28 (m, 2H, CH2Ph), 4.45-4.50

(m, 1H, CH (Leu)), 4.65- 4.71 (m, 1H, CH (Tyr)), 6.61 (d, J = 8.4 Hz, 2H, 2 CH (Ar)), 7.02 (d, J

= 6.4 Hz, 2H, 2 CH (Ar)), 7.14 (d, J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.17-7.25 (m, 3H, 3 CH (Ar)),

7.37-7.47 (m, 4H, 4 CH (Ar)), 7.67-7.69 (m, 2H, 2 CONH2), 7.86-7.95 (m, 6H, 6 CH (Ar-CN

and CH (Ar)), 8.03 (s, 1H, CH (Ar)), 8.35 (d, J = 7.7 Hz, 1H, CONH), 8.61 (t, J = 6.0 Hz, 1H,

NHBn), 8.80 (d, J = 8.4 Hz, 1H, CONH), 9.16 (s, 1H, Ar-OH (Tyr)), 10.23 (s, 1H, NHAr); δC

(100 MHz, DMSO-d6) 21.6, 23.0, 24.3, 36.2, 40.7, 42.4, 52.2, 55.3, 113.7, 114.9, 117.8, 118.3,

120.24, 126.6, 127.1, 127.4, 128.1, 128.2, 128.2, 129.6, 130.0, 132.0, 132.4, 133.0, 138.0, 139.2,


C44H42N6O6 [M+Na] m/z = 773.31, fnd. 773.33.

N-benzyl-4'-cyano-5-((S)-2-((S)-2-(4-cyanobenzamido)-3-(4-hydroxyphenyl)propanamido)-

4-methylpentanamido)-[1,1'-biphenyl]-2-carboxamide (2.10ab). Compound 2.9a (142 mg,

0.2 mmol) was coupled to 4-cyanophenylboronic-acid according to general procedure G. Crude

material was purified by flash chromatography (2:1 CH2Cl2:(92:7:1 CH2Cl2:MeOH:NH4OH))

and yield final product 2.10ab as white solid (81 mg, 0.11 mmol, 55 %): δH (400 MHz, DMSO-

d6) 0.91 (dd, J = 16.4 and 6.4 Hz, 6H, 2 CH3 (Leu)), 1.59-1.71 (m, 3H, CH2CH (Leu)), 2.81-

2.89 (m, 1H, CH2 (Tyr)), 3.00-3.05 (m, 1H, CH, CH2 (Tyr)), 4.26 (d, J = 6.0 Hz, 2H, CH2Ph),

4.43-4.50 (m, 1H, CH (Leu)), 4.65-4.71 (m, 1H, CH (Tyr)), 6.61 (d, J = 8.5 Hz, 2H, Ar-OH

(Tyr)), 7.06-7.08 (m, 2H, 2 CH (Ar)), 7.13 (d, J = 8.5 Hz, 2H, Ar-OH (Tyr)), 7.23-7.29 (m, 3H, 3

CH (Ar)), 7.45 (d, J = 8.4 Hz, 2H, 2 CH (Ar)), 7.49-7.20 (m, 1H, CH (Ar)), 7.69-7.71 (m, 2H, 2

150

CH (Ar)), 7.76-7.78 (m, 2H, 2 CH (Ar)), 7.90-7.96 (m, 4H, 4 CH (Ar-CN)), 8.33 (d, J = 7.7 Hz,

1H, CONH), 8.66 (t, J = 6.0 Hz, 1H, NHBn), 8.78 (d, J = 8.4 Hz, 1H, CONH), 9.14 (s, 1H, Ar-

OH (Tyr)), 10.25 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.6, 23.0, 24.3, 36.2, 40.6, 42.4,

52.2, 55.3, 110.0, 113.7, 114.9, 118.3, 118.8, 120.1, 126.7, 127.3, 128.1, 128.2, 128.2, 128.8,

129.2, 130.0, 131.8, 132.0, 132.4, 138.0, 138.6, 139.0, 139.9, 145.1, 145.1 155.7, 165.0, 168.1,

171.4, 171.4; LRMS (MS ES), calcd for C44H40N6O5Na [M+Na] m/z = 755.31, fnd. 755.15.

methyl 2'-(benzylcarbamoyl)-5'-((S)-2-((S)-2-(4-cyanobenzamido)-3-(4-hydroxyphenyl)-

propanamido)-4-methylpentanamido)-[1,1'-biphenyl]-3-carboxylate (2.10ac). Compound

2.9a (142 mg, 0.2 mmol) was coupled to 4-methoxycarboxyphenylboronic-acid according to

general procedure G. Crude material was purified by flash chromatography (2:1 CH2Cl2:(92:7:1

CH2Cl2:MeOH:NH4OH)) and yielded final product 2.10ac as a white solid (66 mg, 0.086 mmol,

43 %): δH (400 MHz, DMSO-d6) 0.91 (dd, J = 16.4 and 6.3 Hz, 6H, 2 CH3 (Leu)), 1.52-1.75 (m,

3H, CH2CH (Leu)), 2.82-2.88 (m, 1H, CH2 (Tyr)), 3.01-3.08 (m, 1H, CH, CH2 (Tyr)), 3.86 (s,

3H, COOCH3), 4.25 (d, J = 6.0 Hz, 2H, CH2Ph), 4.40-4.50 (m, 1H, CH (Leu)), 4.65-4.71 (m,

1H, CH (Tyr)), 6.61 (d, J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.05-7.06 (m, 2H, 2 CH (Ar)), 7.14 (d, J

= 8.4 Hz, 2H, Ar-OH), 7.20-7.22 (m, 3H, 3 CH (Ar)), 7.42-7.44 (m, 2H, 2 CH (Ar)), 7.47-7.49

(m, 1H, CH (Ar)), 7.68-7.70 (m, 2H, 2 CH (Ar)), 7.88-7.94 (m, 6H, Ar-CN and Ar), 8.36(d, J =

7.7 Hz, 1H, CONH), 8.64 (t, J = 6.0 Hz, 1H, NHBn), 8.80 (d, J = 8.4 Hz, 1H, CONH), 9.19 (s,

1H, Ar-OH (Tyr)), 10.26 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.7, 23.0, 24.4, 36.3, 40.7,

42.5, 52.2, 52.3, 55.4, 113.7, 114.9, 118.1, 118.3, 120.2, 126.7, 127.3, 128.1, 128.2, 128.3, 128.4,

128.7, 128.8, 129.1, 130.0, 132.0, 132.4, 138.0, 139.0, 139.1, 139.9, 145.2, 155.8, 165.1, 166.2,

168.5, 171.5, 171.5; LRMS (MS ES), calcd for C45H43N5O7Na [M+Na] m/z = 788.32, fnd.

788.28.

151

N2-benzyl-5-((S)-2-((S)-2-(4-cyanobenzamido)-3-(4-hydroxyphenyl)propanamido)-4-

methylpentanamido)-[1,1'-biphenyl]-2,3'-dicarboxamide (2.10ad). Compound 2.9a (142 mg,

0.2 mmol) was coupled to 3-amidocarboxyphenylboronic-acid according to general procedure G.

Crude material was purified by flash chromatography (92:7:1 CH2Cl2:MeOH:NH4OH) and

yielded final product 2.10ad as a white solid (59 mg, 0.078 mmol, 39 %): δH (400 MHz, DMSO-

d6) 0.91 (dd, J = 16.2 and 6.4 Hz, 6H, 2 CH3 (Leu)), 1.52-1.73 (m, 3H, CH2CH (Leu)), 2.83-2.89

(m, 1H, CH2 (Tyr)), 3.02-3.06 (m, 1H, CH2 (Tyr)), 4.27 (d, J = 6.0 Hz, 2H, CH2Ph), 4.46-4.51

(m, 1H, CH (Leu)), 4.66-4.71 (m, 1H, CH (Tyr)), 6.61 (d, J = 6.8 Hz, 2H, Ar-OH (Tyr)), 7.07

(m, 2H, 2 CH (Ar)), 7.14 (d, J = 8.4 Hz, 1H, CH (Ar)), 7.20-7.27 (m, 3H, 3 CH (Ar)), 7.37-7.48

(m, 4H, 4 CH (Ar)), 7.66-7.67 (m, 2H, 2 CH (Ar)), 7.69-7.72 (m, 1H, CH (Ar)), 7.87 (d, J =

7.4 Hz, 1H, CH (Ar)), 7.91-7.95 (m, 5H, Ar-CN and Ar), 8.03 (s, 1H, CH (Ar)), 8.33 (d, J =


1H, Ar-OH (Tyr)), 10.22 (s, 1H, NHAr) ); δC (100 MHz, DMSO-d6) 21.6, 23.0, 24.3, 36.2, 40.7,

42.4, 52.2, 55.3, 113.7, 114.9, 117.6, 118.3, 120.5, 126.2, 126.5, 127.0, 127.7, 127.9, 128.2,

128.2, 128.7, 128.7, 128.8, 130.0, 131.1, 131.4, 131.5, 131.9, 132.4, 134.3, 138.0, 139.7, 139.8,

140.5, 155.7, 165.0, 167.7, 168.6, 171.4. LRMS (MS ES), calcd. For C44H42N6O6Na [M+Na] m/z

= 773.32. fnd. 773.23.


4-methylpentanamido)-[1,1'-biphenyl]-2-carboxamide (2.10ae). Compound 2.9a (142 mg, 0.2

152

mmol) was coupled to 3-cyanophenylboronic-acid according to general procedure G. Crude


and yielded final product 2.10ae as a white solid (51 mg, 0.070 mmol, 35 %): δH (400 MHz,

DMSO-d6) 0.91 (dd, J = 16.4 and 6.3 Hz, 6H, 2 CH3 (Leu)), 1.51-1.71 (m, 3H, CH2CH (Leu)),

2.82-2.89 (m, 1H, CH2 (Tyr)), 3.00-3.05 (m, 1H, CH2 (Tyr)), 3.86 (s, 3H, COOCH3), 4.27 (d, J =

5.9 Hz, 2H, CH2Ph), 4.44-4.50 (m, 1H, CH (Leu)), 4.65-4.70 (m, 1H, CH (Tyr)), 6.61 (d, J =

8.4 Hz, 2H, Ar-OH (Tyr)), 7.06-7.07 (m, 2H, 2 CH (Ar)), 7.13 (d, J = 8.4 Hz, 2H, Ar-OH (Tyr)),

7.20-7.29 (m, 3H, 3 CH (Ar)), 7.50-7.60 (m, 3H, 3 CH (Ar)), 7.66-7.67 (m, 1H, CH (Ar)), 7.70-

7.72 (m, 2H, 2 CH (Ar)), 7.82 (d, J = 8.2 Hz, 1H, 1 CH (Ar)), 7.90-7.95 (m, 4H, 4 CH (Ar-CN)),

8.36 (d, J = 7.7 Hz, 1H, CONH), 8.69 (t, J = 6.1 Hz, 1H, NHBn), 8.80 (d, J = 8.2 Hz, 1H,

CONH), 9.16 (s, 1H, Ar-OH (Tyr)), 10.26 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.6, 23.0,

24.3, 36.2, 40.6, 42.4, 52.3, 55.3, 111.3, 113.7, 114.9, 118.2, 118.3, 118.7, 120.4, 126.7, 127.1,

128.2, 128.2, 128.2, 128.8, 129.4, 130.0, 131.0, 131.6, 131.7, 132.4, 133.2, 138.0, 138.2, 139.1,

139.9, 141.6, 155.7, 165.0, 168.2, 171.4, 171.4; LRMS (MS ES), calcd for C44H40N6O5Na

[M+Na] m/z = 755.31, fnd. 755.15.

methyl 2'-(benzylcarbamoyl)-5'-((S)-2-((S)-2-(4-cyanobenzamido)-3-(4-

hydroxyphenyl)propan-amido)-4-methylpentanamido)-[1,1'-biphenyl]-3-carboxylate

(2.10af). Compound 2.9a (142 mg, 0.2 mmol) was coupled to 3-methoxycarboxyphenylboronic-

acid according to general procedure G. Crude material was purified by flash chromatography

(2:1 CH2Cl2:(92:7:1 CH2Cl2:MeOH:NH4OH)) and yielded final product 2.10af as a white solid

(81 mg, 0.11 mmol, 53 %): δH (400 MHz, DMSO-d6) 0.91 (dd, J = 16.4 and 6.3 Hz, 6H, 2 CH3

(Leu)), 1.53-1.72 (m, 3H, CH2CH (Leu)), 2.83-2.89 (m, 1H, CH2 (Tyr)), 3.02-3.06 (m, 1H, CH2

(Tyr)), 3.86 (s, 3H, COOCH3), 4.25 (d, J = 6.0 Hz, 2H, CH2Ph), 4.45-4.50 (m, 1H, CH (Leu)),

4.65-4.71 (m, 1H, CH (Tyr)), 6.61 (d, J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.03-7.05 (m, 2H, 2 CH

(Ar)), 7.14 (d, J = 8.4 Hz, 2H, Ar-OH), 7.17-7.24 (m, 3H, 3 CH (Ar)), 7.47-7.51 (m, 2H, 2 CH

153

(Ar)), 7.55-7.58 (m, 1H, CH (Ar)), 7.68-7.72 (m, 2H, 2 CH (Ar)), 7.92-7.95 (m, 6H, Ar-CN and

Ar), 8.36 (d, J = 7.7 Hz, 1H, CONH), 8.62 (t, J = 6.0 Hz, 1H, NHBn), 8.81 (d, J = 8.4 Hz, 1H,

CONH), 9.15 (s, 1H, Ar-OH (Tyr)), 10.25 (s, 1H, NHAr): δC (100 MHz, DMSO-d6) 21.6, 23.0,

24.3, 36.2, 40.7, 42.4, 52.2, 52.3, 55.3, 113.7, 114.9, 117.8, 118.3, 120.2, 126.6, 127.1, 128.0,

128.1, 128.2, 128.7, 128.8, 128.9, 129.6, 130.0, 131.8, 132.3, 133.1, 138.0, 139.0, 139.1, 139.9,

140.8, 155.7, 165.0, 166.1, 168.5, 171.4, 171.4; LRMS (MS ES), calcd for C45H43N5O7Na

[M+Na] m/z = 788.32, fnd. 788.28.


methylpentanamido)-[1,1'-biphenyl]-3,4'-dicarboxamide (2.10ba). Compound 2.9b (142 mg,

0.2 mmol) was coupled to 4-aminocarbonylphenyl boronic acid according to general procedure

G. Crude material was purified by flash chromatography (92:7:1 CH2Cl2:MeOH:NH4OH) and

yielded final product 2.10ba as a white solid (63 mg, 0.084 mmol, 42 %): δH (400 MHz, DMSO-

d6) 0.90 (dd, J = 16.0 and 6.4 Hz, 6H, 2 CH3 (Leu)), 1.56-1.75 (br m, 3H, CH2CH (Leu)), 2.83-

2.89 (m, 1H, CH2 (Tyr)), 3.02-3.06 (m, 1H, CH2 (Tyr)), 4.48-4.53 (m, 3H, CH and NHCH2),

4.67-4.72 (m, 1H, CH (Tyr)), 6.51 (d, J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.14 (d, J = 8.4 Hz, 2H, Ar-

OH (Tyr)), 7.23-7.28 (m, 1H, CH (Ar)), 7.31-7.36 (m, 4H, 4 CH (Ar)), 7.43 (s, 1H, CH (Ar)),

7.77 (d, J = 8.4 Hz, 2H, Ar-COONH2), 7.93-7.95 (m, 5H, Ar-CN and Ar), 8.00 (d, J = 8.0 Hz,

2H, Ar-COONH2), 8.03 (s, 1H, CH, (Ar)), 8.16 (d, J = 5.6 Hz, 2H, COONH2), 8.36 (d, J =

7.4 Hz, 1H, CONH), 8.81 (d, J = 8.2 Hz, 1H, CONH) 9.14 (s, 1H, Ar-OH), 9.19 (t, J = 6.2 Hz,

1H, NHBn), 10.30 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 22.0, 23.6, 26.0, 37.9, 41.7, 44.7,

54.3, 57.2, 116.2, 116.3, 119.1, 119.9, 122.7, 122.8, 128.3, 128.3, 128.7, 129.0, 129.4, 129.5,

129.6, 131.4, 133.5, 134.4, 137.3, 139.4, 140.1, 140.6, 142.4, 144.7, 157.4, 168.6, 169.7, 171.9,

173.4, 174.0; LRMS (MS ES), calcd for C44H42N6O6Na [M+Na] m/z = 773.32, fnd. 773.23.

154


4-methylpentanamido)-[1,1'-biphenyl]-3-carboxamide (2.10bb). Compound 2.9b (142 mg,



and yielded final product 2.10bb as a white solid (59 mg, 0.080 mmol, 40 %): δH (400 MHz,

DMSO-d6) 0.92 (dd, J = 15.8 and 6.5 Hz, 6H, 2 CH3 (Leu)), 1.55-1.72 (br m, 3H, CH2CH (Leu)),

2.82-2.89 (m, 1H, CHCH2 (Tyr)), 3.02-3.07 (m, 1H, CHCH2 (Tyr)), 4.46-4.53 (m, 3H, CH and

NHCH2), 4.65-4.72 (m, 1H, CH (Tyr)), 6.61 (d, J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.14 (d, J =

8.4 Hz, 2H, Ar-OH), 7.22-7.27 (m, 1H, CH (Ar)), 7.31-7.34 (m, 4H, 4 CH (Ar)), 7.89-8.00 (m,

9H, Ar-CN and Ar-CN and (Ar)), 8.17 (s, 1H, CH (Ar)), 8.20 (s, 1H, CH (Ar)), 8.37 (d, J =

7.4 Hz, 1H, CONH), 8.81 (d, J = 8.2 Hz, 1H, CONH), 9.15 (s, 1H, Ar-OH (Tyr)), 9.20 (t, J = 5.7

Hz, 1H, NHBn), 10.34 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.6, 23.0, 24.3, 36.2, 40.7,

42.7, 52.3, 55.3, 110.5, 113.7, 114.9, 118.3, 118.8, 119.0, 120.2, 120.4, 126.8, 127.3, 127.7,

128.2, 128.2, 128.3, 130.1, 132.4, 133.0, 135.9, 138.0, 138.9, 139.5, 139.9, 144.0, 155.7, 165.1,

165.7, 171.4, 171.5; LRMS (MS ES), calcd for C44H40N6O5Na [M+Na] m/z = 755.31, fnd.

755.28.

methyl 3'-(benzylcarbamoyl)-5'-((S)-2-((S)-2-(4-cyanobenzamido)-3-(4-hydroxyphenyl)-

propanamido)-4-methylpentanamido)-[1,1'-biphenyl]-4-carboxylate (2.10bc). Compound

155

2.9b (142 mg, 0.2 mmol) was coupled to 4-methoxycarbonylphenylboronic-acid according to

general procedure G. Crude material was purified by flash chromatography (98:2

CH2Cl2:MeOH) and yielded final product 2.10bc as a white solid (86 mg, 0.11 mmol, 56 %): δH

(400 MHz, DMSO-d6) 0.91 (m, 6H, 2 CH3 (Leu)), 1.60-1.72 (br m, 3H, CH2CH (Leu)), 2.85-

2.91 (m, 1H, CH2 (Tyr)), 3.04-3.09 (m, 1H, CH2 (Tyr)), 3.88 (s, 3H, COOCH3), 4.49-4.54 (m,

3H, CH (Leu) and CH2 (NHCH2Ph)), 4.70-4.75 (m, 1H, CH (Tyr)), 6.63 (d, J = 8.4 Hz, 2H, Ar-

OH (Tyr)), 7.16 (d, J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.23-7.26 (m, 1H, CH (Ar)), 7.31-7.35 (m,

4H, 4 CH (Ar)), 7.86 (d, J = 8.4 Hz, 2H, Ar-COOMe), 7.92-7.98 (m, 5H, 5 CH (Ar-CN) and

(Ar)), 8.08 (d, J = 8.4 Hz, 2H, Ar-COOMe), 8.18 (s, 1H, CH, (Ar)), 8.22 (s, 1H, CH, (Ar)), 8.33

(d, J = 8.0 Hz, 1H, CONH), 8.78 (d, J = 8.4 Hz, 1H, CONH) 9.11 (s, 1H, Ar-OH (Tyr)), 9.19 (t,

J = 6.5 Hz, 1H, NHBn), 10.30 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.7, 23.0, 24.4, 36.3,

40.7, 42.8, 52.2, 52.3, 55.4, 113.7, 114.9, 118.3, 118.7, 120.2, 120.4, 126.8, 127.1, 127.3, 128.3

(2 C), 128.3, 128.9, 130.1, 132.4, 135.9, 138.1, 139.5, 139.5, 139.8, 144.1, 155.8, 165.1, 165.9,

166.0, 171.4, 171.5; LRMS (MS ES), calcd. For C45H43N5O7Na [M+Na] m/z = 788.32, fnd.

788.21.


methylpentanamido)-[1,1'-biphenyl]-3,3'-dicarboxamide (2.10bd). Compound 2.9b (142 mg,

0.2 mmol) was coupled to 3-aminocarbonylphenyl boronic acid according to general procedure

G. Crude material was purified by flash chromatography (92:7:1 CH2Cl2:MeOH:NH4OH) and

yielded final product 2.10bc as a white solid (94 mg, 0.13 mmol, 63 %): δH (400 MHz, DMSO-

d6) 0.91 (m, 6H, 2 CH3 (Leu)), 1.55-1.67 (br m, 3H, CH2CH (Leu)), 2.81-2.87 (m, 1H, CHCH2

(Leu)), 3.01-3.05 (m, 1H, CHCH2), 4.48-4.50 (m, 3H, CH (Leu) and CH2 (NHCH2Ph)), 4.66-4.70

(m, 1H, CH (Tyr)), 6.60 (d, J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.14 (d, J = 8.4 Hz, 2H, Ar-OH),

7.21-7.25 (m, 1H, CH (Ar)), 7.29-7.35 (m, 4H, 4 CH (Ar)), 7.49 (s, 1H, CH (Ar)), 7.58 (t, J = 7.7

Hz, 1H, CH (Ar)), 7.85 (d, J = 8.4 Hz, 1H, CH (Ar)), 7.93 (m, 7H, 5 CH (Ar-CN) and (Ar) and

156

CONH2), 8.13-8.17 (m, 3H, 3 CH (Ar)), 8.21 (s, 1H, CH (Ar)), 8.36 (d, J = 8.0 Hz, 1H, CONH),

8.81 (d, J = 8.4 Hz, 1H, CONH), 9.15 (s, 1H, Ar-OH), 9.21 (t, J = 6.5 Hz, 1H, NHBn), 10.31 (s,

1H, NHAr); δC (100 MHz, DMSO-d6) 21.7, 23.0, 24.4, 36.3, 40.7, 42.8, 52.2, 55.4, 113.7, 114.9,

118.3, 118.7, 120.2, 120.4, 126.8, 127.1, 127.3, 128.3 (2C), 128.3, 128.9, 130.1, 132.4, 135.9,

138.1, 139.5, 139.5, 139.8, 144.1, 155.8, 165.1, 165.9, 166.0, 171.4, 171.5; LRMS (MS ES),

calcd. For C45H42N5O7Na [M+Na] m/z = 773.32, fnd. 773.21.


4-methylpentanamido)-[1,1'-biphenyl]-3-carboxamide (2.10be). Compound 2.9b (142 mg,



and yielded final product 2.10bc as a white solid (75 mg, 0.10 mmol, 51 %): δH (400 MHz,

DMSO-d6) 0.92 (dd, J = 15.8 and 6.5 Hz , 6H, 2 CH3 (Leu)), 1.55-1.73 (br m, 3H, CH2CH

(Leu)), 2.83-2.89 (m, 1H, CHCH2 (Tyr)), 3.02-3.07 (m, 1H, CHCH2 (Tyr)), 4.47-4.58 (m, 3H,

CH (Leu) and NHCH2), 4.66-4.72 (m, 1H, CH (Tyr)), 6.61 (d, J = 8.4 Hz, 2H, Ar-OH), 7.15 (d, J

= 8.4 Hz, 2H, Ar-OH (Tyr)), 7.23-7.28 (m, 1H, CH (Ar)), 7.31-7.36 (m, 4H, 4 CH (Ar)), 7.72 (t,

J = 7.8Hz, 1H, CH (Ar)), 7.87-7.90 (m, 1H, CH (Ar)), 7.93-7.95 (m, 5H, Ar-CN and Ar), 8.01-

8.03 (m, 1H, CH (Ar)), 8.17-8.18 (m, 3H, 3CH (Ar)), 8.38 (d, J = 7.4 Hz, 1H, CONH), 8.82 (d,

J = 8.2 Hz, 1H, CONH) 9.15-9.19 (m, 2H, Ar-OH and NHBn), 10.33 (s, 1H, NHAr); δC (100

MHz, DMSO-d6) 21.6, 23.0, 24.3, 36.2, 40.7, 42.7, 52.3, 55.3, 110.5, 113.7, 114.9, 118.3, 118.8,

119.0, 120.2, 120.4, 126.8, 127.3, 127.7, 128.2, 128.2, 128.3, 130.1, 132.4, 133.0, 135.9, 138.0,


C44H40N6O5Ns [M+Na] m/z = 755.31, fnd. 755.28.

157

methyl 3'-(benzylcarbamoyl)-5'-((S)-2-((S)-2-(4-cyanobenzamido)-3-(4-hydroxyphenyl)

propanamido)-4-methylpentanamido)-[1,1'-biphenyl]-3-carboxylate (2.10bf). Compound

2.9b (142 mg, 0.2 mmol) was coupled to 4-methoxycarbonylphenylboronic-acid according to

general procedure G. Crude material was purified by flash chromatography (98:2

CH2Cl2:MeOH) and yielded final product 2.10bf as a white solid (93 mg, 0.12 mmol, 61 %): δH

(400 MHz, DMSO-d6) H (400 MHz, DMSO-d6) 0.92 (dd, J = 15.5 and 6.4 Hz, 6H, 2 CH3

(Leu)), 1.59.1.69 (br m, 3H, CH2CH (Leu)), 2.84-2.90 (m, 1H, CH2 (Tyr)), 3.05-3.08 (m, 1H,

CHCH2), 3.89 (s, 3H, COOCH3), 4.48-4.53 (m, 3H, CH (Leu) and NHCH2), 4.68-4.73 (m, 1H,

CH (Tyr)), 6.62 (d, J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.16 (d, J = 8.4 Hz, 2H, Ar-OH (Tyr)), 7.22-

7.27 (m, 1H, C6H5), 7.31-7.35 (m, 4H, 4 CH (Ar)), 7.67 (t, J = 7.8 Hz, 1H, Ar-COOMe), 7.94-

7.95 (m, 5H, Ar-CN and Ar-COOMe), 7.99-8.02 (m, 2H, 2 CH (Ar-COOMe)), 8.17-8.25 (m,

3H, 3 CH (Ar)), 8.37 (d, J = 7.6 Hz, 1H, CONH), 8.81 (d, J = 8.3 Hz, 1H, CONH) 9.15 (s, 1H,

Ar-OH (Tyr)), 9.24 (t, J = 6.0 Hz, 1H, NHBn), 10.33 (s, 1H, NHAr); δC (100 MHz, DMSO-d6)

21.7, 23.0, 24.4, 36.2, 40.7, 42.7, 52.3, 52.3, 55.3, 113.7, 114.9, 118.3, 119.9, 120.1, 126.8,

127.1, 127.2, 128.3, 128.6, 128.7, 129.7, 130.1, 130.4, 131.6, 131.7, 132.4, 135.9, 138.1, 139.6,


C45H43N5O7Na [M+Na] m/z = 788.32, fnd. 788.15.

158

4-((S)-3-(((S)-1-((6-(benzylcarbamoyl)-4'-carbamoyl-[1,1'-biphenyl]-3-yl)amino)-4-methyl-

1-oxopentan-2-yl)amino)-2-(4-cyanobenzamido)-3-oxopropyl)phenyl bis(dimethylamino)

phosphordiamidate (2.11aa). Phenol 2.10aa (50 mg, 0.067 mmol) was treated according to

general procedure H, and purified by flash column chromatography (1:1 CH2Cl2:(92:7:1

CH2Cl2:MeOH:NH4OH)) to yield final product 2.11aa as a white powder (25 mg, 0.028 mmol,


3H, CH2CH (Leu)), 2.53-2.55 (dd, J = 10.1 and 1.5 Hz, 12H, N(Me3)2), 2.88-2.97 (m, 1H, CH2

(Tyr)), 3.11-3.15 (m, 1H, CH2 (Tyr)), 4.27 (d, J = 5.9 Hz, 2H, NHCH2Ph), 4.46-4.51 (m, 1H,

CH (Leu)), 4.73-4.79 (m, 1H, CH (Tyr)), 7.00-7.03 (m, 4H, 4 CH (Ar)), 7.19-7.25 (m, 3H, CH

(Ar)), 7.31-7.33 (m, 2H, CH (Ar)), 7.37-7.41 (m, 3H, CH (Ar)), 7.45-7.47 (m, 1H, CH (Ar)),

7.68-7.70 (m, 2H, 2 CH (Ar)), 7.86-7.95 (m, 6H, 6 CH (Ar)), 8.03 (s, 1H, CH (Ar)), 8.41 (d, J =


1H, NHAr); δC (100 MHz, DMSO-d6) 21.7, 23.0, 24.4, 36.2, 36.2, 36.2, 40.7, 42.4, 52.3, 54.9,

113.7, 117.8, 118.3, 119.7, 119.7, 120.2, 126.6, 127.1, 127.4, 128.1, 128.1, 128.2, 128.6, 130.2,

132.0, 132.4, 133.0, 133.9, 138.0, 139.2, 139.4, 139.8, 143.2, 149.5, 149.6, 155.7, 165.0, 167.5,

168.6, 171.1, 171.4; LRMS (MS ES), calcd. For C48H53N8O7PNa [M+Na] m/z = 907.37, fnd.

907.48.

4-((S)-3-(((S)-1-((6-(benzylcarbamoyl)-4'-cyano-[1,1'-biphenyl]-3-yl)amino)-4-methyl-1-

oxopentan-2-yl)amino)-2-(4-cyanobenzamido)-3-oxopropyl)phenyl bis(dimethylamino)

phosphordiamidate (2.11ab). Phenol 2.10ab (50 mg, 0.068 mmol) was treated according to


CH2Cl2:MeOH:NH4OH)) to yield final product 2.11ab as a white powder (37 mg, 0.042 mmol,

62%): δH (400 MHz, DMSO-d6) 0.91 (dd, J = 16.6 and 6.4 Hz, 6H, 2 CH3 (Leu)), 1.53-1.70 (m,

3H, CH2CH (Leu)), 2.52-2.55 (dd, J = 10.1 and 1.5 Hz, 12H, N(CH3)2), 2.90-2.96 (m, 1H, CH2

(Tyr)), 3.11-3.15 (m, 1H, CH2 (Tyr)), 4.28 (d, J = 6.0 Hz, 2H, CH2Ph), 4.45-4.51 (m, 1H, CH

159

(Leu)), 4.73-4.79 (m, 1H, CH (Tyr)), 7.00 (d, J = 8.3 Hz, 2H, 2 CH (Ar)), 7.06-7.08 (m, 2H, 2

CH (Ar)), 7.23-7.32 (m, 5H, 5 CH (Ar)), 7.45 (m, 2H, 2 CH (Ar)), 7.49-7.51 (m, 1H, CH (Ar)),

7.69-7.71 (m, 2H, 3 CH (Ar)), 7.76-7.78 (m, 2H, CH (Ar)), 7.90-7.95 (m, 4H, 4 CH (Ar)), 8.42

(d, J = 7.7 Hz, 1H, CONH), 8.67 (t, J = 6.0 Hz, 1H, NHBn), 8.85 (d, J = 8.4 Hz, 1H, CONH),


52.3, 54.9, 110.0, 113.7, 118.3, 118.8, 119.7, 119.7, 120.1, 126.7, 127.3, 128.1, 128.2, 128.8,

129.2, 130.2, 131.8, 132.0, 132.3, 133.9, 138.0, 138.6, 139.0, 139.4, 145.2, 149.5, 149.6, 165.0,

168.1, 171.1, 171.4; LRMS (MS ES), calcd for C48H51N8O6PNa [M+Na] m/z = 889.37, fnd.

889.28.

methyl 2'-(benzylcarbamoyl)-5'-((S)-2-((S)-3-(4-((bis(dimethylamino)phosphoryl)oxy)-

phenyl)-2-(4-cyanobenzamido)propanamido)-4-methylpentanamido)-[1,1'-biphenyl]-4-

carboxylate (2.11ac). Phenol 2.10ac (45mg, 0.059mmol) was treated according to general

procedure H, and purified by flash column chromatography (2:1 CH2Cl2:(92:7:1

CH2Cl2:MeOH:NH4OH)) to yield final product 2.11ac as a white powder (41mg, 0.046mmol, 78

%): δH (400 MHz, DMSO-d6) 0.91 (dd, J = 16.5 and 6.4 Hz, 6H, 2 CH3 (Leu)), 1.55-1.70 (m, 3H,

CH2CH (Leu)), 2.52-2.55 (dd, J = 10.1 and 1.6 Hz, 12H, N(CH3)2), 2.90-2.96 (m, 1H, CH2

(Tyr)), 3.11-3.15 (m, 1H, CH2 (Tyr)), 3.89 (s, 3H, COOCH3), 4.26 (d, J = 6.0 Hz, 2H,

NHCH2Ph), 4.45-4.51 (m, 1H, CH (Leu)), 4.73-4.79 (m, 1H, CH (Tyr)), 7.00 (d, J = 8.4 Hz, 2H,

2 CH (Ar)), 7.04-7.06 (m, 2H, 2 CH (Ar)), 7.21-7.24 (m, 3H, 3 CH (Ar)), 7.31 (d, J = 8.4 Hz,

2H, CH (Ar)), 7.41-7.43 (m, 2H, 2 CH (Ar)), 7.47-7.49 (m, 1H, CH (Ar)), 7.68-7.70 (m, 2H, 2

CH (Ar)), 7.88-7.94 (m, 6H, 6 CH (Ar)), 8.39 (d, J = 7.7 Hz, 1H, CONH), 8.64 (t, J = 6.0 Hz,

1H, NHBn), 8.83 (d, J = 8.4 Hz, 1H, CONH), 10.28 (s, 1H, NHAr)); δC (100 MHz, DMSO-d6)

21.7, 23.0, 24.4, 36.2, 36.3, 40.7, 42.5, 52.2, 52.3, 54.9, 113.7, 118.1, 118.3, 119.7, 119.7, 120.1,

126.7, 127.3, 128.1, 128.2, 128.4, 128.7, 128.8, 129.1, 130.3, 132.0, 133.9, 138.0, 139.1, 139.1,

160


C49H54N7O8PNa [M+Na] m/z = 922.38, fnd. 922.41.



phosphordiamidate (2.11ad). Phenol 2.10ad (45 mg, 0.061 mmol) was treated according to


CH2Cl2:MeOH:NH4OH)) to yield final product 2.11ad as a white powder (24 mg, 0.028 mmol,

46 %): δH (400 MHz, DMSO-d6) H (400 MHz, DMSO-d6) 0.92 (dd, J = 16.5 and 6.4 Hz, 6H, 2

CH3 (Leu)),1.57-1.69 (m, 3H, CH2CH (Leu)), 2.52-2.55 (dd, J = 10.1 and 1.5 Hz, 12H,

N(CH3)2), 2.91-2.97 (m, 1H, CH2 (Tyr)), 3.11-3.16 (m, 1H, CH2 (Tyr)), 4.28 (d, J = 6.0 Hz, 2H,

CH2Ph) 4.45-4.51 (m, 1H, CH (Leu)), 4.73-4.79 (m, 1H, CH (Tyr)), 7.00 (d, J = 6.8 Hz, 2H, 2

CH (Ar)), 7.05 (d, J = 7.0 Hz, 2H, 2 CH (Ar)), 7.18-7.27 (m, 3H, 3 CH (Ar)), 7.31-7.33 (m, 2H,

2 CH (Ar)), 7.36-7.48 (m, 4H, 4 CH (Ar)), 7.67-7.72 (m, 2H, 2 CH (Ar)), 7.86-7.94 (m, 6H, 6

CH (Ar)), 8.04 (s, 1H, CH (Ar)), 8.42 (d, J = 7.8 Hz, 1H, CONH), 8.61 (t, J = 5.8 Hz, 1H,

NHBn), 8.79 (d, J = 8.3 Hz, 1H, CONH), 10.26 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.7,

23.0, 24.3, 36.2, 36.2, 36.2, 40.7, 42.4, 52.3, 54.9, 113.7, 117.6, 118.3, 119.7, 119.7, 120.4,

126.2, 126.6, 127.1, 127.7, 127.9, 128.2, 128.2, 128.7, 130.2, 131.1, 131.9, 132.4, 133.9, 134.3,

138.0, 139.2, 139.7, 139.8, 140.5, 149.5, 149.6, 165.0, 167.6, 168.6, 171.1, 171.3; LRMS (MS

ES), calcd for C48H53N8O7PNa [M+Na] m/z = 907.38, fnd. 907.23.

161



phosphordiamidate (2.11ae). Phenol 2.10ae (35 mg, 0.048 mmol) was treated according to


CH2Cl2:MeOH:NH4OH)) to yield final product 2.11ae as a white powder (33 mg, 0.038 mmol,


3H, CH2CH (Leu)), 2.52-2.55 (dd, J = 10.1 and 1.5 Hz, 12H, N(CH3)2), 2.90-2.96 (m, 1H, CH2

(Tyr)), 3.11-3.15 (m, 1H, CH2 (Tyr)), 4.28 (d, J = 5.9 Hz, 2H, NHCH2Ph), 4.45-4.51 (m, 1H, CH

(Tyr)), 4.73-4.79 (m, 1H, CH (Tyr)), 7.00 (d, J = 8.4 Hz, 2H, 2 CH (Ar)), 7.06-7.07 (m, 2H, 2

CH (Ar)), 7.20-7.33 (m, 5H, 5 CH (Ar)), 7.50-7.57 (m, 2H, 2 CH (Ar)), 7.60-7.62 (m, 1H, CH

(Ar)), 7.68-7.72 (m, 3H, 3 CH (Ar)), 7.81-7.83 (m, 1H, 1 CH (Ar)), 7.90-7.95 (m, 4H, 4 CH

(Ar)), 8.42 (d, J = 7.7 Hz, 1H, CONH), 8.70 (t, J = 6.0 Hz, 1H, NHBn), 8.85 (d, J = 8.2 Hz, 1H,

CONH), 10.29 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.6, 22.9, 24.3, 36.2, 36.2, 36.2, 40.6,

42.4, 52.3, 54.9, 111.2, 113.7, 118.2, 118.3, 118.7, 119.7, 119.7, 120.3, 126.7, 127.0, 128.2,

128.8, 129.4, 130.2, 131.0, 131.6, 131.7, 132.3, 133.2, 133.9, 137.9, 138.2, 139.1, 139.9, 141.6,

149.5, 149.6, 165.0, 168.1, 171.1, 171.3; LRMS (MS ES), calcd for C48H51N8O6PNa [M+Na]

m/z = 889.37, fnd. 889.22.

162



carboxylate (2.11af). Phenol 2.10af (60 mg, 0.078 mmol) was treated according to general

procedure H, and purified by flash column chromatography (2:1 CH2Cl2:[92:7:1

CH2Cl2:MeOH:NH4OH]) to yield final product 2.11af as a white powder (45 mg, 0.050 mmol,

64 %): H (400 MHz, DMSO-d6 δH (400 MHz, DMSO-d6) 0.91 (dd, J = 16.5 and 6.4 Hz, 6H, 2

CH3 (Leu)), 1.55-1.70 (m, 3H, CH2CH (Leu)), 2.52-2.55 (dd, J = 10.1 and 1.5 Hz, 12H,

N(CH3)2), 2.89-2.97 (m, 1H, CH2 (Tyr)), 3.11-3.16 (m, 1H, CH2 (Tyr)), 3.85 (s, 3H, COOCH3),

4.26 (d, J = 6.0 Hz, 2H, CH2Ph), 4.45-4.51 (m, 1H, CH (Leu)), 4.73-4.79 (m, 1H, CH (Tyr)),

6.99-7.04 (m, 4H, 4 CH (Ar)), 7.20-7.22 (m, 3H, 3 CH (Ar)), 7.32 (d, J = 8.4 Hz, 1H, CH (Ar)),

7.47-7.51 (m, 2H, 2 CH (Ar)), 7.56-7.78 (m, 1H, CH (Ar)), 7.79-7.72 (m, 2H, 2 CH (Ar)), 7.89-

7.95 (m, 6H, 6 CH (Ar)), 8.43 (d, J = 7.5 Hz, 1H, CONH), 8.65 (t, J = 6.0 Hz, 1H, NHBn), 8.86

(d, J = 8.3 Hz, 1H, CONH), 10.29 (s, 1H, NHAr)); δC (100 MHz, DMSO-d6) 21.7, 23.0, 24.4,

36.2, 36.3, 36.3, 40.7, 42.5, 52.3, 52.4, 54.9, 113.7, 117.9, 118.3, 119.7, 119.8, 120.3, 126.6,

127.1, 128.0, 128.1, 128.2, 128.7, 128.8, 129.0, 129.6, 130.3, 131.9, 132.4, 133.2, 133.9, 138.0,

139.1, 139.1, 139.9, 140.8, 149.5, 149.6, 165.1, 166.1, 168.5, 171.2, 171.4; LRMS (MS ES),

calcd for C49H54N7O8PNa [M+Na] m/z = 922.38, fnd. 922.09.



phosphordiamidate (2.11ba). Phenol 2.10ba (45 mg, 0.061 mmol) was treated according to


CH2Cl2:MeOH:NH4OH)) to yield final product 2.11ba as a white solid (34 mg, 0.039 mmol,

63%): δH (400 MHz, DMSO-d6) 0.90-0.96 (m, 6H, 2 CH3 (Leu)), 1.58-1.73 (br m, 3H, CH2CH

(Leu)), 2.52-2.55 (m, 12H, N(CH3)2), 2.92-2.98 (m, 1H, CH2 (Tyr)), 3.13-3.17 (m, 1H, CH2

163

(Tyr)), 4.48-4.53 (m, 3H, Leu-CH and NHCH2), 4.75-4.81 (m, 1H, CH (Tyr)), 7.01 (d, J =

8.4 Hz, 2H, 2 CH (Ar)), 7.23-7.27 (m, 1H, CH (Ar)), 7.32-7.35 (m, 6H, 6 CH (Ar)), 7.43 (s, 1H,

CH (Ar)), 7.77 (d, J = 8.4 Hz, 2H, 2 CH (Ar)), 7.93-7.95 (m, 5H, 5 CH (Ar)), 8.00 (d, J = 8.0 Hz,

2H, Ar-COONH2), 8.05 (s, 1H, CH (Ar)), 8.17 (m, 2H, CH (Ar)), 8.41 (d, J = 7.4 Hz, 1H,

CONH), 8.85 (d, J = 8.2 Hz, 1H, CONH), 9.20 (t, J = 6.2 Hz, 1H, NHBn), 10.32 (s, 1H, NHAr);

δC (100 MHz, MeOD-d4) 22.1, 23.6, 26.0, 36.8, 36.9, 37.9, 41.8, 44.7, 54.3, 56.7, 116.2, 119.0,

119.89, 121.3, 121.4, 122.7, 128.2, 128.3, 128.7, 129.4, 129.5, 129.9, 131.7, 132.4, 133.5, 133.7,

134.4, 135.0, 137.3, 139.3, 140.2, 140.7, 142.3, 144.6, 151.2, 151.3, 168.5, 169.4, 169.6, 171.8,

173.4, 173.7; LRMS (MS ES), calcd for C48H53N8O7PNa [M+Na] m/z = 907.38, fnd. 907.10.



phosphordiamidate (2.11bb). Phenol 2.10bb (45 mg, 0.061 mmol) was treated according to


CH2Cl2:MeOH:NH4OH)) to yield final product 2.11bb as a white solid (42 mg, 0.047 mmol, 77

%): δH (400 MHz, DMSO-d6) 0.92 (dd, J = 16 and 6.4 Hz , 6H, 2 CH3 (Leu)), 1.55-1.74 (br m,

3H, CH2CH (Leu)), 2.52-2.55 (m, 12H, (N(CH3)2), 2.91-2.97 (m, 1H, CH2 (Tyr)), 3.12-3.17 (m,

1H, CH2 (Tyr)), 4.47-4.53 (m, 3H, Leu-CH and NHCH2), 4.74-4.80 (m, 1H, CH (Tyr)), 7.00 (d, J

= 8.0 Hz, 2H, 2 CH (Ar)), 7.23-7.27 (m, 1H, CH (Ar)), 7.31-7.34 (m, 6H, 6 CH (Ar)), 7.89-8.00

(m, 9H, 9 CH (Ar)), 8.18 (s, 1H, CH (Ar)), 8.21 (s, 1H, CH (Ar)), 8.41 (d, J = 7.4 Hz, 1H,


δC (100 MHz, DMSO-d6) 21.6, 22.9, 24.3, 36.2, 36.2, 36.2, 40.6, 42.4, 52.3, 54.9, 110.0, 113.7,

118.3, 118.8, 119.7, 119.7, 120.1, 126.7, 127.3, 128.1, 128.2, 128.8, 129.2, 130.2, 131.8, 132.0,

132.3, 133.9, 138.0, 138.6, 139.0, 139.9, 145.2, 149.5, 149.6, 165.0, 168.1, 171.1, 171.4; LRMS

(MS ES), calcd for C48H51N8O6PNa [M+Na] m/z = 889.37, fnd. 889.22.

164



carboxylate (2.11bc). Phenol 2.10bc (60 mg, 0.078 mmol) was treated according to general

procedure H, and purified by flash column chromatography (2:1 CH2Cl2:(92:7:1

CH2Cl2:MeOH:NH4OH)) to yield final product 2.11bc as a white solid (48 mg, 0.053 mmol, 68

%): δH (400 MHz, DMSO-d6) 0.92 (dd, J = 16.0 and 6.0 Hz, 6H, 2 CH3 (Leu)), 1.58-1.73 (br m,

3H, CH2CH (Leu)), 2.52-2.55 (m, 12H, N(CH3)2), 2.89-2.97 (m, 1H, CH2 (Tyr)), 3.11-3.17 (m,

1H, CH2 (Tyr)), 3.88 (s, 3H, COOCH3), 4.48-4.53 (m, 3H, Leu-CH and NHCH2C6H5), 4.73-

4.81 (m, 1H, CH (Tyr)), 7.01 (d, J = 8.4 Hz, 2H, 2 CH (Ar)), 7.22-7.28 (m, 1H, CH (Ar)), 7.32-

7.34 (m, 6H, 6 CH (Ar)), 7.86 (d, J = 8.4 Hz, 2H, 2 CH (Ar-COOMe)), 7.93 (s, 4H, 4 CH (Ar-

CN)), 7.97 (s, 1H, CH, (Ar)), 8.09 (d, J = 8.4 Hz, 2H, 2 CH (Ar-COOMe)), 8.17 (s, 1H, CH

(Ar)), 8.22 (s, 1H, CH (Ar)), 8.42 (d, J = 8.0 Hz, 1H, CONH), 8.86 (d, J = 8.4 Hz, 1H, CONH),

9.22 (t, J = 6.5 Hz, 1H, NHBn), 10.35 (s, 1H, NHAr); δC (100MHz, CD3Cl) 22.3, 22.7, 24.8,

36.5, 36.5, 36.8, 40.9, 44.0, 52.1, 53.1, 55.6, 114.9, 117.9, 118.4, 120.1, 120.1, 121.3, 121.5,

127.0, 127.4, 127.6, 128.0, 128.6, 129.3, 130.0, 130.3, 132.0, 132.5, 136.0, 137.3, 138.3, 139.1,


C49H54N7O8PNa [M+Na] m/z = 922.38, fnd. 922.15.

165

(4-((S)-3-((S)-1-((5-(benzylcarbamoyl)-3'-carbamoyl-[1,1'-biphenyl]-3-yl)amino)-4-methyl-


phosphordiamidate (2.11bd). Phenol 2.10bd (70 mg, 0.09 6mmol) was treated according to


CH2Cl2:MeOH:NH4OH)) to yield final product 2.11bd as a white solid (41 mg, 0.047 mmol, 49

%): δH (400 MHz, DMSO-d6) 0.90-0.96(m , 6H, 2 CH3 (Leu)), 1.56-1.71 (br m, 3H, CH2CH

(Leu)), 2.52-2.55 (m, 12H, N(CH3)2), 2.92-2.98 (m, 1H, tyr-CHCH2), 3.14-3.16 (m, 1H, tyr-

CHCH2), 4.46-4.53 (m, 3H, Leu-CH and NHCH2), 4.76-4.80 (m, 1H, tyr-CH), 7.01 (d, J =

8.4 Hz, 2H, 2 CH (Ar)), 7.24-7.26 (m, 1H, CH (Ar)), 7.32-7.34 (m, 6H, 6 CH (Ar)), 7.47 (s, 1H,

CH (Ar)), 7.58 (t, J = 7.5 Hz, 1H, CH (Ar)), 7.84 (d, J = 8.4 Hz, 2H, Ar-COONH2), 7.90-7.94

(m, 5H, 5 CH (Ar)), 8.11-8.20 (m, 4H, CH (Ar)), 8.39 (d, J = 7.6 Hz, 1H, CONH), 8.84 (d, J =

8.2 Hz, 1H, CONH), 9.20 (t, J = 6.2 Hz, 1H, NHBn), 10.31 (s, 1H, NHAr); δC (100 MHz,

DMSO-d6) 21.7, 23.0, 24.3, 30.7, 36.2, 36.2, 36.2, 40.7, 42.7, 55.3, 113.7, 113.9, 118.1, 118.3,

119.7, 120.2, 126.0, 126.8, 127.2, 128.2, 128.2, 128.3, 128.7, 129.0, 129.5, 130.2, 132.3, 133.9,

135.1, 135.8, 138.1 139.6, 139.7, 140.2, 151.2, 151.3, 165.0, 166.0, 167.7, 171.1; LRMS (MS

ES), calcd for C48H53N8O7PNa [M+Na] m/z = 907.38, fnd. 907.36.



phosphordiamidate (2.11be). Phenol 2.10be (50 mg, 0.068 mmol) was treated according to

general procedure H, and purified by flash column chromatography (97.5:2.5 CH2Cl2:MeOH) to

yield final product 2.11be as a white solid (45 mg, 0.052 mmol, 76 %): δH (400 MHz, MeOD-

d4)0.95 (dd, J = 15.7 and 6.4 Hz, 6H, 2 CH3 (Leu)), 1.67-1.77 (br m, 3H, CH2CH (Leu)), 2.60-

2.62 (dd, J = 15.1 and 1.0 Hz, 12H, N(CH3)2), 3.02-3.08 (m, 1H, CH2 (Tyr)), 3.27-3.28 (m, 1H,

CH2 (Tyr)), 4.59-4.63 (m, 3H, CH and CH2 (Leu)), 4.89-4.92 (m, 1H, CH (Tyr)), 6.99 (d, J =

166

8.4 Hz, 2H, CH (Ar)), 7.22-7.38 (m, 7H, 7 CH (Ar)), 7.61-7.65 (m, 1H, CH (Ar)), 7.72-7.77 (m,

3H, 3 CH (Ar)), 7.82.7.87 (m, 3H, 3 CH (Ar)), 7.94-7.96 (m, 1 H, CH (Ar-COOMe)), 8.01-8.02

(m, 1H, CH (Ar)), 8.05-8.06 (m, 1H, CH (Ar)), 8.11-8.12 (s, 1H, CH (Ar)); δC (100 MHz,

MeOD-d4) 22.0, 23.5, 26.0, 36.8, 36.9, 37.9, 41.8, 44.8, 54.3, 56.7, 114.3, 126.2, 119.0, 119.6,

120.2, 121.4, 121.4, 122.5, 128.3, 128.7, 129.4, 129.6, 131.3, 131.7, 131.8, 133.5, 135.0, 137.5,

139.4, 140.1, 140.9, 141.2, 142.7, 151.2, 151.3, 168.5, 169.5, 173.4, 173.7; LRMS (MS ES),

calcd for C48H51N8O6PNa [M+Na] m/z = 889.37, fnd. 889.16.



carboxylate (2.11bf). Phenol 2.10bf (70 mg, 0.091 mmol) was treated according to general

procedure H, and purified by flash column chromatography (92:7:1 CH2Cl2:MeOH:NH4OH) to

yield final product 2.11bf as a white solid (47 mg, 0.052 mmol, 57 %): δH (400 MHz, DMSO-d6)

0.92 (dd, J = 16.0 and 6.5 Hz, 6H, 2 CH3 (Leu)), 1.59-1.71 (br m, 3H, CH2CH (Leu)), 2.52-2.55

(m, 12H, N(CH3)2), 2.91-2.98 (m, 1H, CH2 (Tyr)), 3.13-3.17 (m, 1H, CH2 (Tyr)), 3.90 (s, 3H,

COOCH3), 4.47-4.53 (m, 3H, Leu-CH and NHCH2 (Leu)), 4.74-4.80 (m, 1H, CH (Tyr)), 7.00 (d,

J = 8.4 Hz, 2H, 2 CH (Ar)), 7.23-7.27 (m, 1H, CH (Ar)), 7.31-7.34 (m, 6H, 6 CH (Ar)), 7.66-

7.70 (m, 1H, CH (Ar-CN)), 7.93-7.94 (m, 5H, 5 CH (Ar)), 7.99-8.02 (m, 2H, CH (Ar)), 8.16-

8.17 (m, 1H, CH (Ar)), 8.19-8.20 (m, 1H, CH (Ar)), 8.24-8.25 (m, 1H, CH (Ar)), 8.43 (d, J =

7.5 Hz, 1H, CONH), 8.89 (d, J = 8.4 Hz, 1H, CONH), 9.17 (t, J = 6.0 Hz, 1H, NHBn), 10.35 (s,

1H, NHAr); δC (100MHz, CD3Cl) 22.2, 22.7, 24.7, 36.5, 36.5, 36.8, 40.8, 44.0, 52.2, 53.1, 55.6,

115.0, 117.9, 117.9, 120.2, 120.2, 121.1, 121.4, 127.4, 127.7, 128.1, 128.6, 128.9, 128.9, 130.3,

130.7, 131.6, 132.1, 132.4, 135.9, 137.4, 138.2, 139.1, 140.1, 141.1, 150.1, 150.1, 166.1, 166.8,

167.5, 170.7, 171.7; LRMS (MS ES), calcd for C49H54N7O8PNa [M+Na] m/z = 922.38, fnd.

922.15.

167

4-((S)-3-((S)-1-(6-(benzylcarbamoyl)-4'-carbamoylbiphenyl-3-ylamino)-4-methyl-1-

oxopentan-2-ylamino)-2-(4-cyanobenzamido)-3-oxopropyl)phenyl dihydrogen phosphate

(2.12aa). Phosphoramidate 2.11aa (20 mg, 0.022 mmol) was treated according to general

procedure H, to yield final product 2.12aa as a white lyophilized powder (18 mg, 0.021 mmol,

95 %): m.p. 254-259 °C; δH (400 MHz, DMSO-d6) 0.91 (dd, J = 16.1 and 6.2 Hz, 6H, 2 CH3


(Tyr)), 4.27 (d, J = 5.9 Hz, 2H, NHCH2Ph), 4.44-4.50 (m, 1H, CH (Leu)), 4.68-4.73 (m, 1H, CH

(Tyr)), 7.00-7.03 (m, 4H, Ar and Ar-OH (Tyr)), 7.19-7.24 (m, 5H, 5 CH (Ar)), 7.37-7.39 (m, 3H,

CH (Ar)), 7.44-7.46 (m, 1H, CH (Ar)), 7.68-7.69 (m, 2H, 2 CH (Ar)), 7.86-7.92 (m, 6H, 6 CH

(Ar)), 8.05 (s, 1H, CH (Ar)), 8.43 (d, J = 7.6 Hz, 1H, CONH), 8.66 (t, J = 5.9 Hz, 1H, NHBn),

8.87 (d, J = 8.1 Hz, 1H, CONH), 10.27 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.6, 23.0,

24.4, 34.3, 40.6, 42.4, 52.4, 55.2, 113.7, 117.8, 118.4, 118.9, 119.5, 119.5, 120.2, 126.6, 127.1,

127.4, 128.1, 128.2, 128.2, 128.7, 129.6, 132.0, 132.4, 133.0, 138.0, 139.2, 139.4, 139.8, 143.2,

165.1, 167.6, 168.6, 171.3, 171.4. HRMS (MS- ES), calcd for C44H44N6O9P [M+H] m/z =

831.2901, fnd. 831.2866; rpHPLC tR: condition (I) 17.361 (II) 30.160 minutes, purity 97.2 % and

97.6%.


168

oxopentan-2-yl)amino)-2-(4-cyanobenzamido)-3-oxopropyl)phenyl dihydrogen phosphate

(2.12ab). Phosphoramidate 2.11ab (25 mg, 0.029 mmol) was treated according to general

procedure H, to yield final product 2.12ab as a white lyophilized powder (22 mg, 0.027 mmol,




(Tyr)), 7.00-7.07 (m, 4H, 4 CH (Ar)), 7.23-7.28 (m, 5H, 5 CH (Ar)), 7.44-7.51 (m, 3H, 3 CH

(Ar)), 7.69-7.77 (m, 4H, 4 CH (Ar)), 7.91 (m, 4H, 4 CH (Ar-CN)), 8.42 (d, J = 7.5 Hz, 1H,

CONH), 8.72 (t, J = 5.8 Hz, 1H, NHBn), 8.87 (d, J = 8.3 Hz, 1H, CONH), 10.31 (s, 1H, NHAr);

δC (100 MHz, DMSO-d6) 21.6, 22.9, 24.3, 34.3, 40.6, 42.4, 52.4, 55.2, 110.0, 113.7, 118.3,

118.8, 119.6, 119.6, 120.1, 126.7, 127.3, 128.1, 128.2, 128.8, 129.3, 129.7, 131.8, 132.0, 132.4,

138.0, 138.6, 139.1, 140.0, 145.2, 165.2, 168.2, 171.3, 171.5; HRMS (MS ES), calcd for

C44H42N6O8P [M+H] m/z = 813.2796. fnd. 813.2790; rpHPLC tR: condition (I) 19.446 (II)

35.840 minutes, purity 94.5 % and 96.3 %.

methyl 2'-(benzylcarbamoyl)-5'-((S)-2-((S)-2-(4-cyanobenzamido)-3-(4-(phosphonooxy)

phenyl)propanamido)-4-methylpentanamido)-[1,1'-biphenyl]-4-carboxylate (2.12ac).

Phosphoramidate 2.11ac (30 mg, 0.033 mmol) was treated according to general procedure H, to

yield final product 2.12ac as a white lyophilized powder (26 mg, 0.031 mmol, 94 %): m.p. 253-

259 °C; δH (400 MHz, DMSO-d6) 0.90 (dd, J = 16.5 and 6.4 Hz, 6H, 2 CH3 (Leu)), 1.55-1.69 (m,

3H, CH2CH (Leu)), 2.88-2.94 (m, 1H, CH2 (Tyr)), 3.07-3.10(m, 1H, CH2 (Tyr)), 3.88 (s, 3H,

COOCH3), 4.25 (d, J = 5.8 Hz, 2H, NHCH2Ph), 4.43-4.49 (m, 1H, CH (Leu)), 4.68-4.73 (m, 1H,

CH (Tyr)), 7.00-7.06 (m, 4H, 4 CH (Ar)), 7.20-7.24 (m, 5H, 5 CH (Ar)), 7.41-7.43 (m, 2H, 2 CH

(Ar)), 7.46-7.49 (m, 1H, CH (Ar)), 7.68-7.72 (m, 2H, 2 CH (Ar)), 7.87-7.91 (m, 6H, 6 CH (Ar)),


169


52.4, 55.3, 113.7, 118.1, 118.3, 119.6, 120.1, 126.6, 127.3, 128.1, 128.2, 128.4, 128.7, 129.0,

129.7, 131.9, 132.4, 138.0, 139.0, 139.1, 139.9, 145.2, 165.2, 166.1, 168.4, 171.3, 171.5; HRMS

(MS ES), calcd for C45H45N5O10P [M+H] m/z = 846.2898, fnd. 846.2906; rpHPLC tR: condition

(I) 19.673 (II) 36.585 minutes, purity 95.6% and 97.5%.


1-oxopentan-2-yl)amino)-2-(4-cyanobenzamido)-3-oxopropyl)phenyl dihydrogen phosphate

(2.12ad). Phosphoramidate 2.11ad (18 mg, 0.020 mmol) was treated according to general

procedure H, to yield final product 2.12ad as a white lyophilized powder (16 mg, 0.019 mmol,





(Ar)), 7.68-7.72 (m, 2H, 2 CH (Ar)), 7.86-7.94 (m, 6H, 6CH (Ar)), 8.07 (s, 1H, CH (Ar)), 8.44

(d, J = 7.4 Hz, 1H, CONH), 8.65 (t, J = 5.8 Hz, 1H, NHBn), 8.90 (d, J = 7.9 Hz, 1H, CONH),


113.7, 117.7, 118.4, 119.6, 119.6, 120.5, 126.2, 126.6, 127.1, 127.7, 128.0, 128.3, 128.7, 129.8,

131.2, 131.9, 132.4, 132.6, 134.3, 138.0, 139.3, 139.7, 140.5, 151.1, 151.1, 158.2, 158.5, 165.2,

167.8, 168.7, 171.3, 171.4; HRMS (MS ES), calcd for C44H44N6O9P [M+H] m/z = 831.2901,

fnd. 831.2870; rpHPLC tR: condition (I) 17.854 (II) 31.489 minutes, purity 95.9 % and 97.4%.

170



(2.12ae). Phosphoramidate 2.11ae (25 mg, 0.029 mmol) was treated according to general

procedure H, to yield final product 2.12ae as a white lyophilized powder (22 mg, 0.027 mmol,





(Ar)), 7.60-7.62 (m, 1H, CH (Ar)), 7.67-7.72 (m, 3H, 3 CH (Ar)), 7.80-7.82 (m, 1H, CH (Ar)),

7.91 (s, 4H, 4 CH (Ar)), 8.42 (d, J = 7.5 Hz, 1H, CONH), 8.73 (t, J = 5.9 Hz, 1H, NHBn), 8.88

(d, J = 8.0 Hz, 1H, CONH), 10.30 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.6, 22.9, 24.3,

34.3, 40.6, 42.4, 52.4, 55.2, 111.2, 113.7, 118.2, 118.3, 118.7, 119.6, 119.6, 120.3, 126.7, 127.0,

128.2, 128.8, 129.4, 129.6, 131.0, 131.6, 131.7, 132.3, 133.2, 138.0, 138.2, 139.2, 140.0, 141.6,

165.2, 168.2, 171.3, 171.4; HRMS (MS ES), calcd for C44H42N5O8P [M+H] m/z = 813.2796,

fnd. 813.2814; rpHPLC tR: condition (I) 19.314 (II) 35.499 minutes, purity 96.4 % and 97.5%.


phenyl)propanamido)-4-methylpentanamido)-[1,1'-biphenyl]-3-carboxylate (2.12af).

Phosphoramidate 2.11af (35 mg, 0.039 mmol) was treated according to general procedure H, to

171

yield final product 2.12af as a white lyophilized powder (31 mg, 0.037 mmol, 94 %): m.p. 188-


3H, CH2CH (Leu)), 2.89-2.95 (m, 1H, CH2 (Tyr)), 3.07-3.11 (m, 1H, CH2 (Tyr)), 3.85 (s, 3H,

COOCH3), 4.25 (d, J = 5.5 Hz, 2H, NHCH2Ph), 4.46-4.48 (m, 1H, CH (Leu)), 4.69-4.71 (m, 1H,

CH (Tyr)), 7.02-7.04 (m, 4H, 4 CH (Ar)), 7.19-7.25 (m, 5H, 5 CH (Ar)), 7.46-4.49 (m, 2H, 2 CH

(Ar)), 7.55-7.57 (m, 1H, CH (Ar)), 7.68-7.72 (m, 2H, 2 CH (Ar)), 7.90-7.94 (m, 6H, 6 CH (Ar)),



52.4, 55.3, 113.7, 117.9, 118.3, 119.6, 119.6, 120.3, 126.6, 127.1, 128.0, 128.1, 128.2, 128.7,

128.8, 129.0, 129.6, 129.7, 131.9, 132.4, 133.2, 138.0, 139.1, 139.1, 139.1, 139.9, 140.8, 158.0,

158.3, 165.2, 166.1, 168.5, 171.4, 171.5; HRMS (MS ES), calcd for C45H45N5O8P [M+H] m/z =


97.0%.



(2.12ba). Phosphoramidate 2.11ba (25 mg, 0.028 mmol) was treated according to general

procedure H, to yield final product 2.12ba as a white lyophilized powder (23 mg, 0.027 mmol,


(Leu)), 1.65-1.73 (br m, 3H, CH2CH (Leu)), 2.92-2.95 (m, 1H, CH2 (Tyr)), 3.07-3.11 (m, 1H,

CH2 (Tyr)), 4.46-4.51 (m, 3H, 3 CH (Leu)), 4.69-4.73 (m, 1H, CH (Tyr)), 7.01 (d, J = 8.4 Hz,

2H, 2 CH (Ar)), 7.21-7.26 (m, 3H, CH (Ar)), 7.31-7.35 (m, 5H, 5 CH (Ar)), 7.40 (s, 1H, CH,

(Ar)), 7.77 (d, J = 8.4 Hz, 2H, 2 CH (Ar)), 7.90-7.94 (m, 5H, 5 CH (Ar)), 8.01 (d, J = 8.4 Hz,

2H, 2 CH (Ar)), 8.10 (s, 1H, CH (Ar)), 8.16-8.18 (m, 2H, 2 CH (Ar)), 8.41 (d, J = 7.4 Hz, 1H,

CONH), 8.88 (d, J = 8.0 Hz, 1H, CONH), 9.20 (m, 1H, NHBn), 10.33 (s, 1H, NHAr); δC (100

172

MHz, DMSO-d6) 21.6, 23.0, 24.3, 34.3, 40.7, 42.7, 52.4, 55.2, 113.6, 118.3, 119.5, 119.9, 120.2,

126.5, 126.8, 127.2, 128.2, 128.3, 128.6, 129.5, 130.4, 131.7, 132.3, 133.5, 138.0, 139.6, 139.8,

142.0, 157.6, 157.9, 165.1, 167.0, 167.4, 171.3, 171.4; HRMS (MS ES), calcd for C44H44N6O9P

[M+H] m/z = 831.2901, fnd. 831.2897; rpHPLC tR: condition (I) 19.490 (II) 36.040 minutes,

purity 93.1% and 97.8%.



(2.12bb). Phosphoramidate 2.11bb (30 mg, 0.035 mmol) was treated according to general

procedure H, to yield final product 2.12bb as a white lyophilized powder (27 mg, 0.034 mmol,

98 %): m.p. 150-157 °C; δH (400 MHz, DMSO-d6) 0.91 (dd, J = 14.7 and 6.2 Hz), 6H, 2 CH3

(Leu)), 1.55-1.72 (br m, 3H, CH2CH (Leu)), 2.89-2.95 (m, 1H, CH2 (Tyr)), 3.07-3.11 (m, 1H,

CH2 (Tyr)), 4.46-4.52 (m, 3H, CH (Leu) and CH2 (NHCH2Ph)), 4.68-4.74 (m, 1H, CH (Tyr)),

7.01 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.22-7.24 (m, 3H, 3 CH (Ar)), 7.31-7.34 (m, 4H, 4 CH

(Ar)), 7.88-7.98 (m, 9H, 9 CH (Ar)), 8.20-8.21 (m, 2H, CH (Ar)), 8.45 (d, J = 7.8 Hz, 1H,


δC (100 MHz, DMSO-d6) 21.6, 23.0, 24.3, 34.2, 40.7, 42.7, 52.4, 55.4, 110.5, 113.6, 118.3,

118.8, 119.0, 119.5, 120.2, 120.4, 126.8, 127.3, 127.7, 128.2, 128.3, 129.5, 131.4, 132.3, 133.0,

135.9, 138.0, 138.8, 139.5, 139.9, 144.0, 157.9, 158.2, 165.1, 165.7, 171.4, 171.5; HRMS (MS

ES), calcd for C44H42N6O8P [M+H] m/z = 813.2796, fnd. 813.2774; rpHPLC tR: condition (I)

20.975 (II) 40.195 minutes, purity 73.8% and 90.3%.

173


phenyl)propanamido)-4-methylpentanamido)-[1,1'-biphenyl]-4-carboxylate (2.12bc).

Phosphoramidate 2.11bc (35 mg, 0.039 mmol) was treated according to general procedure H, to

yield final product 2.12bc as a white lyophilized powder (31mg, 0,037 mmol, 95 %): m.p. 138-


3H, CH2CH (Leu)), 2.89-2.95 (m, 1H, CH2 (Tyr)), 3.07-3.12 (m, 1H, CH2 (Tyr)), 3.89 (s, 3H,

COOCH3), 4.49-4.52 (m, 3H, CH (Leu) and CH2 (NHCH2Ph)), 4.69-4.75 (m, 1H, CH (Tyr)),

7.01-7.03 (m, 2H, 2 CH (Ar)), 7.22-7.24 (m, 3H, 3 CH (Ar)), 7.33-7.34 (m, 4H, 4 CH (Ar)),

7.65-7.69 (m, 1H, CH (Ar)), 7.89-7.94 (m, 5H, 5 CH (Ar)), 7.99-8.00 (m, 2H, 2 CH (Ar)), 8.16

(s, 1H, CH (Ar)), 8.20 (s, 1H, CH (Ar)), 8.24 (s, 1H, CH (Ar)), 8.42 (d, J = 7.3 Hz, 1H, CONH),

8.88 (d, J = 8.7 Hz, 1H, CONH), 9.25 (t, J = 6.0 Hz, 1H, NHBn), 10.38 (s, 1H, NHAr); δC (100

MHz, DMSO-d6) 21.6, 23.0, 24.4, 34.4, 40.7, 42.7, 52.3, 52.3, 55.3, 113.6, 118.3, 119.5, 119.5,

119.9, 120.1, 126.8, 127.1, 127.2, 128.2, 128.3, 129.5, 129.6, 130.4, 131.6, 132.3, 135.9, 138.0,

139.6, 139.8, 140.0 157.7, 158.0, 165.1, 165.9, 166.1, 171.4, 171.4; HRMS (MS ES), calcd. For

C45H45N5O10P [M+H] m/z = 846.2898, fnd. 846.290; rpHPLC tR: condition (I) 21.573 (II)

41.866 minutes, purity 96.5% and 96.6%.


174


(2.12bd). Phosphoramidate 2.11bd (30 mg, 0.034 mmol) was treated according to general

procedure H, to yield final product 2.12bd as a white lyophilized powder (27 mg, 0.034 mmol,

96 %): m.p. 152-157 °C; δH (400 MHz, DMSO-d6) 0.90-0.95 (m, 6H, 2 CH3 (Leu)), 1.57-1.73

(br m, 3H, CH2CH (Leu)), 2.88-2.94 (m, 1H, CHCH2 (Tyr)), 3.07-3.11 (m, 1H, CHCH2 (Tyr)),

4.47-4.52 (m, 3H, CH (Leu) and CH2 (NHCH2Ph)), 4.69-4.74 (m, 1H, CH (Tyr)), 7.01 (d, J =

8.4 Hz, 2H, 2 CH (Ar)), 7.20-7.26 (m, 3H, 3 CH (Ar)), 7.31-7.35 (m, 4H, 4 CH (Ar)), 7.47 (s,

1H, CH, (Ar)), 7.56-7.60 (m, 1H, CH (Ar)), 7.83-7.85 (m, 1H, CH (Ar)), 7.89-7.95 (m, 6H, 6 CH

(Ar)), 8.14-8.20 (m, 4H, 4 CH (Ar)), 8.40 (d, J = 7.4 Hz, 1H, CONH), 8.86 (d, J = 8.2 Hz, 1H,

CONH), 9.22-9.25 (m, 1H, NHBn), 10.35 (s, 1H, NHAr); δC (100 MHz, DMSO-d6) 21.6, 23.0,

24.4, 34.2, 40.7, 42.7, 52.4, 55.3, 113.7, 118.1, 118.8, 119.5, 119.5, 120.1, 126.0, 126.8, 126.9,

127.3, 128.2, 128.3, 129.0, 129.5, 131.3, 132.3, 132.6, 135.1, 135.8, 138.0, 139.6, 139.7, 140.2,

158.0, 158.3, 165.1, 166.0, 167.8, 171.3, 171.4; HRMS (MS ES), calcd. For C44H44N6O9P


purity 87.6 % and 88.1%.



(2.12be). Phosphoramidate 2.11be (30 mg, 0.035 mmol) was treated according to general

procedure H, to yield final product 2.12be as a white lyophilized powder (27 mg, 0.034 mmol,


(Leu)), 1.57-1.72 (br m, 3H, CH2CH (Leu)), 2.89-2.95 (m, 1H, CHCH2 (Tyr)), 3.08-3.11 (m, 1H,

CHCH2 (Tyr)), 4.46-4.53 (m, 3H, CH (Leu) and CH2 (NHCH2Ph)), 4.68-4.74 (m, 1H, CH (Ar)),

7.01 (d, J = 7.7 Hz, 2H, 2 CH (Ar)), 7.22-7.24 (m, 3H, 3 CH (Ar)), 7.31-7.36 (m, 4H, 4 CH

(Ar)), 7.68-7.73 (m, 1H, CH (Ar)), 7.86-7.94 (m, 6H, 6 CH (Ar)), 8.00-8.03 (m, 1H, CH (Ar)),

175

8.16-8.17 (m, 2H, 2 CH (Ar)), 8.21 (s, 1H, CH (Ar)), 8.46 (d, J = 7.5 Hz, 1H, CONH), 8.82 (d, J

= 8.4 Hz, 1H, CONH), 9.22 (t, J = 6.0 Hz, 1H, NHBn), 10.42 (s, 1H, NHAr); δC (100 MHz,

DMSO-d6) 21.6, 23.0, 24.3, 34.2, 40.7, 42.7, 52.4, 55.4, 112.2, 113.6, 118.3, 118.7, 119.5, 119.5,

120.1, 120.3, 126.8, 127.2, 128.2, 128.3, 129.5, 130.3, 131.3, 131.5, 131.6, 132.3, 135.8, 138.0,

138.6, 139.5, 139.9, 140.7, 157.9, 158.2, 165.1, 165.7, 171.4, 171.5; HRMS (MS ES), calcd for

C44H42N6O8P [M+H] m/z = 813.2796, fnd. 813.2777; rpHPLC tR: condition (I) 20.965 (II)

40.147 minutes, purity 93.3% and 95.9%.


phenyl)propanamido)-4-methylpentanamido)-[1,1'-biphenyl]-3-carboxylate (2.12bf).

Phosphoramidate 2.11bf (30 mg, 0.033 mmol) was treated according to general procedure H, to

yield final product 2.12bf as a white lyophilized powder (28 mg, 0.033 mmol, 98 %): m.p. 136-

144 °C; δH (400 MHz, DMSO-d6) 0.92 (dd, J = 15.7 and 6.4 Hz, 6H, 2 CH3 (Leu)), 1.59-1.71 (br

m, 3H, CH2CH (Leu)), 2.92-2.98 (m, 1H, CHCH2 (Tyr)), 3.11-3.16 (m, 1H, CH2 (Tyr)), 3.88 (s,

3H, COOCH3), 4.47-4.522 (m, 3H, CH (Leu) and CH2 (NHCH2Ph)), 4.72-4.78 (m, 1H, CH

(Tyr)), 7.03-7.05 (m, 4H, 4 CH (Ar)), 7.17 (m, 1H, CH (Ar)), 7.30-7.34 (m, 5H, 5 CH (Ar)), 7.85

(d, J = 8.4 Hz, 2H, 2 CH (Ar)), 7.92-7.93 (m, 3H, 3 CH (Ar)), 7.97 (s, 1H, CH (Ar)), 8.09 (d, J =

8.4 Hz, 2H, 2 CH (Ar)), 8.17 (s, 1H, CH (Ar)), 8.21 (s, 1H, CH (Ar)), 8.41 (d, J = 8.0 Hz, 1H,


δC (100 MHz, DMSO-d6) 21.6, 23.0, 24.4, 34.3, 40.7, 42.7, 52.2, 52.3, 55.0, 113.7, 118.3, 118.7,

119.6, 119.7, 120.1 120.3, 126.8, 127.1, 127.3, 128.2, 128.3, 128.9, 129.9, 130.0, 132.4, 133.6,

135.9, 138.0, 139.4, 139.5, 139.8, 144.0, 157.9, 158.2, 166.1, 166.8, 167.5, 170.7, 171.7; HRMS

(MS ES), calcd for C45H45N5O10P [M+H] m/z = 846.2898, fnd. 846.2911; rpHPLC tR: condition

(I) 21.525 (II) 41.764 minutes, purity 98.3% and 98.3 %.

176

9 Appendix 3: Experimental Methods For Purines

9.1 Computational Probing of the SH2 domian for the Production of a Pharamcophore Model and Establishment of a QSAR

Structures of leading STAT3 inhibitory molecules from the literature were drawn in ChemDraw

(Cambridgesoft, Massachusetts) with their expected charged states at physiological conditions.

3D renderings were assembled by transferring structures into ChemDraw3D (Cambridgesoft,

Massachusetts). Structures were loaded into ArgusLab (Thompson, Washington) and individual

atoms and bonds were checked for correct hybridization and valences. Subsequently, a geometric

optimization utilizing molecular mechanics with the AMBER forcefield was performed on all

molecules. Molecular information was saved in the MOL extension and along with the STAT3

crystal structure, 1BG1, was initialized into GOLD (CCDC, Cambridge). The 1BG1 crystal

structure was removed of water molecules and appropriately protonated before the selection of

the SH2 domain as the binding site was made by choosing the central serine residue (Ser636) as

the point of origin and picking a radius of 8 Å. All inhibitory molecules were permitted complete

freedom of rotation, translation, and ring flipping to optimally explore potential binding modes.

Protein residues were maintained in their original orientations and held rigid. Each inhibitory

molecules produced 50 individual docking solutions that represented the highest ranked

conformation out of a population of 100 chromosomes evolved over 200,000 generations. The

top solutions for each molecule were visualized using PyMol and were critiqued for significant

hydrogen bonding and hydrophobic interactions. The observed interactions were summarized

and a pharmacophore plot was constructed. A library of potential molecules fulfilling the

structural requirements of the pharmacophore were docked using the same methods listed above.

The molecules were ranked according to their docking scores and the purine scaffold was

highlighted as the lead scaffold.

Solutions were ranked according to their GOLDScore and top poses were criticized for similarity

to control peptide. PyMOL was utilized to compare top docking solutions to the gp130 sequence.

177

9.2 Biophysical Evaluations of 2,6,9-heterotrisubstituted STAT3 Inhibitors

9.2.1 Surface Plasmon Resonance Experiments

Surface Plasmon Resosnance analysis was performed as outlined in 8.2.2.


Experiments were performed as outlined in 8.2.1. Changes in the experimental procedures are

documnted below:

A calibration curve was performed using 10nM Fam-pYLPQTV and dilutions of STAT3 protein

(1.0 μL to 2.4 nM) at a final DMSO concentration of 5% (Figure 3.4A). 7.5μL of 40 nM FAM-

pYLPQTV peptide 10% DMSO solution was added to pre-plated 15μL of 300 nM STAT3

protein solution in a black 384-flat well microplate (Corning). 7.5μL of purine molecules

solution were added to the plate producing the following final inhibitory concentrations: 62 μL,

15.6 μL, 3.9 μL, 0.98 μL, 0.24 μL. The final 5% DMSO buffer solution was incubated for 15-30

minutes before the Infinite M1000 measured FP signal.

9.2.3 Fluorescence Excitation and Emmision Profile of Purine Inihibitors

Fluorescence scanning was accomplished on a Tecan M1000 fluorescence polarimeter. 5%

DMSO solutions containing purine inhibitors at concentrations of 200 µM were plated on a black

394 well plate. A fluorescence intensity scan excited samples from wavelengths 400 to 600 nm

in increments of 5 nm and measured emission at wavelengths 400 to 700nm at intervals of 5nm.

A 2D grid revealed potential fluorescent properties of purine inhibitors.

9.3 Biological Evaluation of 2,6,9-Heterotrisubstituted STAT3 Inhibitors

9.3.1 Cells and Reagents

Cells and reagents were pepared as outlined in section 8.3.2.

9.3.2 Cloning and Protein Expression

Techniques for cloning and protein expression is documented in section 8.3.3.

178

9.3.3 Nuclear Extract Preparation, EMSA and Densitometric Analysis

Experimental procedures for the EMSA assay is outlined in section 8.3.4.

9.3.4 Immunoblotting Assay

SDS/PAGE and Western blotting analysis were performed as previously described 144, 189

.

Primary antibodies used were anti-STAT3, pY705STAT3, pY416Src, Src, pErk1/2, Erk1/2,

pSTAT1, STAT1, (Cell Signaling), and antiphosphotyrosine, clone 4G10 (Upstate

Biotechnology, Lake Placid, NY). Where appropriate, cells were stimulated for 12 min by 9

ng/μl rhEGF (12 μl into 3 ml culture) prior to preparation of whole-cell lysates for

immunoblotting analysis.

9.3.5 CyQuant Proliferation Assay

Experimental procedure is performed as documented in 8.3.5.

9.3.6 Liver Mouse Microsomes

For microsome reactions performed under conditions allowing for both Phase I and Phase II

metabolism, the initial procedure and reaction conditions were followed similarly as described

for Phase I screening256

. Additional cofactors were also included in each reaction to maximize

the potential for in vitro glucuronidation to occur. UDPGA (Uridine 5′-diphosphoglucuronic

acid, Sigma cat. #U6751) was added at a final concentration of 4.0 mM. The beta-glucuronidase

inhibitor saccharolactone (Sigma cat. #S0375) was also included, at a final concentration of 5.0

mM. The pore-forming peptide alamethicin (Sigma cat. #A4665) was added to each reaction at a

final concentration of 50 µg/ml. (The active site of the membrane-bound UGT enzyme is

typically oriented toward the inside, luminal side of the microsome vesicles. As a result, UGT

activity is greatly reduced without the inclusion of a pore-forming reagent such as

alamethicin257

.. Narrow-window mass extraction LC/MS analysis was performed for all samples

from this study using a Waters Xevo quadrupole time-of-flight (QTof) mass spectrometer and an

ACQUITY UPLC system, to determine relative peak areas of parent compound.

9.3.7 Permeability Assessed through Caco-2 Monolayers

The permeability assay was performed as indicated in section 8.3.1.

179


9.4.1 Chemical Methods for Purines

The general chemical methods are found at the beginning of A2.4.1. Relevent changes for purine

inhibitors are documented here: Before biological testing, inhibitor purity was evaluated by

reversed-phase HPLC (rpHPLC). Analysis by rpHPLC was performed using a Microsorb-MV

300 A C18 250 mm x 4.6 mm column run at 1 mL/min, and using gradient mixtures of (A) water

with 0.1M CH3COONH4 and (B) methanol. Ligand purity was confirmed using linear gradients

from 75 % A and 25 % B to 100 % B after an initial 2 minute period of 100 % A. The linear

gradient consisted of a changing solvent composition of either (I) 4.7 % per minute and UV

detection at 254nm or (II) 1.4 % per minute and detection at 254nm, each ending with 5 minutes

of 100% B. For reporting HPLC data, percentage purity is given in parentheses after the

retention time for each condition. All biologically evaluated compounds are > 95 % chemical

purity as measured by HPLC.

9.4.2 General Procedures

General Procedure A. Alkylation of N2:

To a stirring solution of purine 4 (14 mmol, 1.0 eq) in THF (0.1 M) at room temperature the

desired alcohol (16.9 mmol, 1.2 eq) was added and triphenylphosphine (PPh3, 18.3 mmol, 1.3

eq). After ~2 min, diisopropylazodicarboxylate (DIAD, 18.3 mmol, 1.3 eq) was added dropwise

(over ~30 s – 1 min). Reaction mixture stirred for 0.5-2 hrs before THF was removed under

reduced pressure. Resulting residue was columned on Biotage Isolera using a gradient of EtOAc

and hexanes.

General Procedure B. Nucleophilic aromatic substitution at C6 with amine:

To a solution of the appropriate chloro-purine (0.284 mmol, 1.0 eq) in DMSO (0.15 M), the

desired amine (0.568 mmol, 2.0 eq) and DIPEA (0.852 mmol, 3.0 eq) were added. The resulting

mixture was sealed in a tube vessel and irradiated in a Biotage Initiator microwave reactor (30

mins, 135 °C). After cooling, reaction was diluted with water and repeatedly extracted with

EtOAc. The combined organics were washed with water and brine, dried over anhydrous

Na2SO4, filtered and concentrated under reduced pressure. Resulting residue was adsorbed onto

silica gel from CH2Cl2 and columned using a Biotage Isolera in a gradient of EtOAc and

180

Hexanes.

General Procedure C. Nucleophilic aromatic substitution at C6 with anilines:

To a solution of di-substituted chloro-purine (0.284 mmol, 1.0 eq) in DMSO (0.2 M), the

appropriate aniline (0.852 mmol, 3.0 eq) and DIPEA (0.852 mmol, 3.0 eq) were added. The

resulting mixture was sealed in a tube vessel and irradiated in a Biotage Initiator microwave

reactor (3 hrs, 135°C). After cooling, reaction was diluted with water and repeatedly extracted

into EtOAc. The combined organics were washed with water and brine, dried over anhydrous

Na2SO4, filtered and concentrated under reduced pressure. The resulting residue was dry-loaded

onto silica gel from CH2Cl2 and columned using a Biotage Isolera in a gradient of EtOAc and

Hexanes.

General Procedure D. Nucleophilic aromatic substitution at C6 with phenols:

To a solution of the desired chloro-purine (0.284 mmol, 1.0 eq) in DMSO (0.2 M), DABCO

(0.312 mmol, 1.1 eq) and DIPEA (1.5 eq) were added and stirred. The solution was allowed to

stir for 1 hr at room temperature before it was deemed complete, at which point a pre-made

solution of the appropriate phenol (0.568, 2.0 eq) and DIPEA (0.426, 1.5 eq) in DMSO was

combined with the chloro-purine to make a 0.1M solution. Reaction was left at room temperature

for 16 hours, then diluted with water and repeatedly extracted with EtOAc. The combined

organics were washed with water and brine, dried over anhydrous Na2SO4, filtered and

concentrated under reduced pressure. The resulting residue was columned using a Biotage

Isolera in a gradient of EtOAc and Hexanes.

General Procedure E. Ester hydrolysis with LiOH:

LiOH (1.1 eq) was added at room temperature to a stirring solution (0.1 M) of the appropriate

purine (0.17 – 0.26 mmol, 1.0 eq) in THF:H2O (3:1). Reaction was deemed complete after 30

minutes, then diluted with water acidified (pH~5.5) by KH2PO4, and continuously extracted into

EtOAc. Organic layers were washed with brine, dried over anhydrous Na2SO4 and concentrated

under reduced pressure. Reaction was purified by flash column chromatography using an

isocratic solvent system (35:7:1 DCM:MeOH:H2O) on the Biotage Isolera. Dried product was

suspended in a mixture of millicule water:acetonitrile (6:1) and lyophilized.

181

General Procedure F. BOC deprotection step:

The appropriate purine (0.09 – 0.15 mmol, 1.0 eq) was dissolved in TFA:DCM (1:1) to form a

0.1M solution. Reaction stirred for one hour at room temperature, co-evaporated with MeOH to

near dryness, and dry-loaded onto silica and columned using the Biotage Isolera using an

isocratic system (65:25:4 DCM:MeOH:H2O). Pure product was suspended in a mixture of

milicule water:acetonitrile (6:1) and lyophilized.

General Procedure G. Acylation of N6:

To a stirring solution of the required purine (8.88 mmol,1.0 eq) in pyridine (0.1M) was the

appropriate acid chloride added (9.77 mmol, 1.1eq). Reaction complete within 15 minutes,

diluted with water acidified by 1M HCl (pH ~ 2), and repeatedly extracted into EtOAc.

Combined organics were washed with several times with acidified water (pH ~ 2) and brine,

dried over anhydrous Na2SO4 and concentrated under reduced pressure. The resulting residue

was columned using the Biotage Isolera in a gradient of DCM and (92:7:1

DCM:MeOH:NH4OH) and dried under reduced pressure.

9.4.3 Detailed Synthetic Procedures for Purines

N9-BOC-2-amino-6-chloropurine (3.1). A rapidly stirred solution of 2-amino-6-chloropurine

258

(1 eq) and di-tert-butyl dicarbonate (BOC2O; 1 eq) in anhydrous DMSO (0.3M) was briefly

cooled over ice under an N2 atmosphere. After 5 min (or sooner if the DMSO begins to freeze),

the reaction flask was removed from the ice bath and catalytic DMAP (0.05 eq) was added. The

septum was then immediately equipped with a venting needle. After stirring for 30 min at room

temperature, TLC indicated the reaction was complete. The reaction mixture was diluted with

water and repetitively extracted into EtOAc. The EtOAc layers were combined and washed with

water, dried on anhydrous Na2SO4, filtered and concentrated to afford N9-BOC-2-amino-6-

chloropurine (2) as a white solid (75 %): H (400 MHz, d6-DMSO) 1.60 (s, 9H, (CH3)3), 7.19 (br

s, 2H, NH2), 8.38 (s, 1H, H-8); C (100 MHz, CDCl3) 27.9, 87.1, 125.4, 140.1, 145.5, 152.3,

182

153.3, 160.4; LRMS (ES-MS) calcd for C10H12ClN5O2Na [M + Na+] m/z = 292.06, fnd. 291.96.

tert-butyl (6-chloro-9H-purin-2-yl)carbamate (3.2). To a stirred solution of purine 3.1 (1 eq)

in anhydrous THF (0.1M) at room temperature was carefully added NaH (60% dispersion in

mineral oil; 2.25 eq) in one portion under an N2 atmosphere. After 2 h, the BOC transfer reaction

was complete. The reaction mixture was cooled to 0 °C then quenched with brine dropwise. The

solvent was concentrated down and then poured into a separatory funnel containing saturated

aqueous NaHCO3 solution. The organics were extracted into EtOAc, dried on anhydrous

Na2SO4, filtered and concentrated. The residue was dry-loaded onto silica gel from CH2Cl2, then

purified by flash column chromatography (92:7:1 CH2Cl2:MeOH:NH4OH) to afford product as a

white powder (95%): H (400 MHz, d6-DMSO) 1.47 (s, 9H, (CH3)3), 8.46 (s, 1H, H-8), 10.22 (s,

1H, NHBOC), 13.60 (br s, 1H, H-9); C (100 MHz, CDCl3) 28.0, 82.2, 127.8, 145.3, 150.8,

151.1, 151.5, 153.0; LRMS (ES-MS) calcd for C10H12ClN5O2Na [M + Na+] m/z = 292.06, fnd.

291.90.

ethyl 2-(2-((tert-butoxycarbonyl)amino)-6-chloro-9H-purin-9-yl)acetate (3.3). To a stirred

solution of purine 3.2 (1 eq) in THF (0.1M) at room temperature was added ethyl glycolate (1.1

eq) followed by triphenylphosphine (PPh3; 1.1 eq) under an N2 atmosphere. To the homogenous

solution, diisopropylazodicarboxylate (DIAD, 1 eq) was added dropwise (over 30 s). TLC

indicated the reaction was complete after 15 min and the solvent was removed in vacuo, then the

residue was dry-loaded onto silica gel from CH2Cl2, and purified by flash column

chromatography (2:1 EtOAc:Hex) to furnish 3.3 as an off-white foam (83%); mp 129–136 °C;

IR (KBr, cm−1

) 3462, 3249, 3166, 3106, 2988, 2948, 2362, 1751, 1693, 1612, 1572, 1523, 1499,

1447, 1421; δH (400 MHz, DMSO-d6) 1.22 (t, J = 7.1 Hz, 3H, CH3), 1.46 (s, 9H, C(CH3)3), 4.18

(q, J = 7.1 Hz, 2H, CH2CH3), 5.11 (s, 2H, CH2CO2Et), 8.46 (s, 1H, H-8), 10.33 (s, 1H,

183

NHBOC); δC (100 MHz, DMSO-d6) 13.9, 27.8, 44.2, 61.6, 79.7, 126.3, 146.4, 149.0, 150.8,

152.6, 152.9, 167.3; HRMS (ESI+) calcd for C14H18ClN5O4Na [M+Na

+] m/z = 378.0939, fnd.

378.0945.

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-chloro-9H-purin-9-yl)acetate (3.4a).

Purine 3.3 was treated according to general procedure A, where ROH was 1-pentanol, to yield

final product 3.4a as a white solid (82 %): IR (KBr, cm−1

) 3479, 3104, 2960, 2934, 2872, 1754,

1713, 1611, 1563, 1511, 1452, 1407, 1273, 1213, 1136, 1061, 1024; δH (400 MHz, CDCl3) 0.88

(t, J = 6.9 Hz, 3H, (CH2)4CH3), 1.25-1.34 (m, 7H, CO2CH2CH3 and (CH2)2CH2CH2CH3), 1.50 (s,

9H, C(CH3)3), 1.65 (p, J = 7.4 Hz, 2H, CH2CH2(CH2)2CH3), 3.89-3.93 (m, 2H, CH2(CH2)3CH3),

4.27 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.96 (s, 2H, CH2CO2Et), 8.07 (s, 1H, CH (H-8)); LRMS

(MS-ES) calcd for C19H29ClN5O4 [M+H] m/z = 426.18, fnd. 426.43.

ethyl 2-(2-((tert-butoxycarbonyl)(3-cyclohexylbenzyl)amino)-6-chloro-9H-purin-9-

yl)acetate (3.4b). Purine 3.3 was treated according to general procedure A, where ROH was 4-

cyclohexyl-benzyl alcohol, to yield final product 3.4a as a white solid (74%): m.p. = 66 -71 °C;

IR (KBr, cm−1

) 2981, 2927, 2852, 1752, 1713, 1564, 1514, 1448, 1405, 1368, 1295, 1278, 1220,

1158, 1109; δH (400 MHz, CDCl3) 1.20-1.38 (m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.46 (s,

9H, C(CH3)3), 1.70-1.83 (m, 5H (cyclohexyl)), 2.43-2.46 (m, 1H, CH), 4.25 (q, J = 7.2 Hz, 2H,

CO2CH2CH3), 4.93 (s, 2H, CH2Ar), 5.15 (s, 2H, CH2CO2Et), 7.10 (d, J = 7.9 Hz, 2H, 2 CH

(Ar)), 7.28 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 8.05 (s, 1H, CH (H-8)); LRMS (MS-ES) calcd for

C27H35ClN5O4 [M+H] m/z = 528.23, fnd. 528.32.

184

ethyl 2-(6-(benzylamino)-2-((tert-butoxycarbonyl)(pentyl)amino)-9H-purin-9-yl)acetate

(3.5aa). Purine 3.4a was treated with benzylamine according to general procedure B, yielding

the final product 3.5aa as a white solid (52 %): m.p. = 106-112 °C; IR (KBr, cm-1

) 3425, 3275,

2980, 2940, 2868, 1761, 1705, 1625, 1495, 1390, 1270, 1208; δH (400 MHz, CDCl3) 0.85 (t, J =

7.0 Hz, 3H, (CH2)4CH3), 1.29-1.33 (m, 7H, CO2CH2CH3 and (CH2)2CH2CH2CH3), 1.48 (s, 9H,

C(CH3)3), 1.58-1.65 (m, 2H, (CH2)3CH2CH3), 3.77-3.81 (m, 2H, CH2(CH2)3CH3), 4.25 (q, J =

7.1 Hz, 2H, CO2CH2CH3), 4.83 (bs, 2H, CH2Ar), 4.90 (s, 2H, CH2CO2Et), 6.05 (bs, 1H, NH),

7.09 (t, J = 7.5 Hz, 1H, CH (Ar)), 7.27-7.38 (m, 4H, CH (Ar)), 7.75 (s, 1H, CH (H-8)); LRMS

(MS- ES) calcd for C26H37N6O4 [M+H] m/z = 497.28, fnd. 497.27.

ethyl 2-(6-(benzyl(methyl)amino)-2-((tert-butoxycarbonyl)(pentyl)amino)-9H-purin-9-

yl)acetate (3.5ab). Purine 3.4a was treated with N-methylbenzylamine according to general

procedure B, yielding the final product 3.5ab as a clear colourless viscous oil (88 %): IR (KBr,

cm-1

) 2958, 2931, 1755, 1701, 1488, 1453, 1385, 1276, 1212, 1145; δH (400 MHz, CDCl3) 0.81-

0.85 (t, J = 7.0 Hz, 3H, (CH2)4CH3), 1.24-1.32 (m, 7H, CO2CH2CH3 and (CH2)2CH2CH2CH3),

1.46 (s, 9H, C(CH3)3), 1.57-1.67 (m, 2H, (CH2)3CH2CH3), 3.12-3.69 (m, 3H, NCH3), 3.76-3.80

(m, 2H, CH2(CH2)3CH3), 4.25 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.91 (s, 2H, CH2CO2Et), 4.99-

5.63 (bm, 2H, CH2Ar), 7.23-7.33 (m, 5H, CH (Ar)), 7.75 (s, 1H, CH (H-8)); LRMS (MS-ES)

calcd for C27H39N6O4 [M+H] m/z = 511.30, fnd. 511.39.

185

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(phenylamino)-9H-purin-9-yl)acetate

(3.5ac). Purine 3.4a was treated with aniline according to general procedure C, yielding the final

product 3.5ac as a clear viscous oil (63 %): (KBr, cm-1

) 3234, 2932, 1753, 1584, 1499, 1459,

1385, 1274, 1213, 1136; δH (400 MHz, CDCl3) 0.88 (t, J = 7.0 Hz, 3H, (CH2)4CH3), 1.29-1.33

(m, 7H, CO2CH2CH3 and (CH2)2CH2CH2CH3), 1.48 (s, 9H, C(CH3)3), 1.66-1.73 (m, 2H,

(CH2)3CH2CH3), 3.86-3.90 (m, 2H, CH2(CH2)3CH3), 4.27 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.94

(s, 2H, CH2CO2Et), 7.09 (t, J = 7.5 Hz, 1H, CH (Ar)), 7.35 (t, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.66

(bs, 1H, NH), 7.83 (d, J = 7.7 Hz, 2H, 2 CH (Ar)), 7.85 (s, 1H, CH (H-8)); LRMS (MS-ES)

calcd for C25H35N6O4 [M+H] m/z = 483.26, fnd. 483.31.

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-((furan-2-ylmethyl)(methyl)amino)-9H-

purin-9-yl)acetate (3.5ad). Purine 3.4a was treated with N-methylfurfurylamine according to

general procedure B, yielding the final product 3.5ad as a clear viscous oil (91 %): IR (KBr, cm-

1) 3538, 3475, 3400, 3225, 2925, 2860, 1750, 1700, 1600, 1435, 1380, 1210; δH (400 MHz,

CDCl3) 0.86 (t, J = 6.9 Hz, 3H, (CH2)4CH3), 1.25-1.34 (m, 7H, CO2CH2CH3 and

(CH2)2CH2CH2CH3), 1.48 (s, 9H, C(CH3)3), 1.65 (p, 2H, CH2CH2(CH2)2CH3), 3.56(vbs, 3H,

CH3(furfuryl)), 3.81 (t, J = 7.6 Hz, 2H, CH2(CH2)3CH3), 4.25 (q, J = 7.1 Hz, 2H, CO2CH2CH3),

4.93 (s, 2H, CH2CO2Et), 5.35 (vbs, 2H, CH2 (furfuryl)), 6.28-6.31 (m, 2H, CH (furfuryl)), 7.34-

7.35 (m, 1H, (furfuryl)) 7.78 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C25H37N6O5 [M+H]

m/z = 501.27, fnd. 501.30.

186

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(cyclopentylamino)-9H-purin-9-

yl)acetate (3.5ae). Purine 3.4a was treated with cyclopentanamine according to general

procedure B, yielding the final product 3.5ae as a clear viscous oil (83 %): IR (KBr, cm-1

) 3546,

3475, 3410, 3230, 2950, 2865, 1760, 1710, 1625, 1480, 1400, 1270; δH (400 MHz, CDCl3) 0.87

(t, J = 7.0 Hz, 3H, (CH2)4CH3), 1.25-1.34 (m, 7H, CO2CH2CH3 and (CH2)2CH2CH2CH3), 1.48 (s,

9H, C(CH3)3), 1.54-1.84 (m, 8H, CH2CH2(CH2)2CH3 and 3 CH2 (cyclopentyl)), 2.11 (m, 2H, CH2

(cyclopentyl)), 3.81 (t, J = 7.6 Hz, 2H, CH2(CH2)3CH3), 4.25 (q, J = 7.0 Hz, 2H, CO2CH2CH3),

4.53 (bs, 1H, CH (cyclopentyl)), 4.89 (s, 2H, CH2CO2Et), 5.68 (bs, 1H, NH), 7.76 (s, 1H, CH

(H-8)); LRMS (MS-ES), calcd for C24H39N6O4 [M+H] m/z = 475.30, fnd. 475.37.

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(cyclohexylamino)-9H-purin-9-yl)acetate

(3.5af). Purine 3.4a was treated with cyclohexanamine according to general procedure B,

yielding the final product 3.5af as a clear viscous oil (70 %): IR (KBr, cm-1

) 2940, 2586, 1760,

1390, 1150; δH (400 MHz, CDCl3) 0.88 (t, J = 6.9 Hz, 3H, (CH2)4CH3), 1.25-1.44 (m, 13H,

CO2CH2CH3, (CH2)2CH2CH2CH3 and 3 CH2 (cyclohexyl)), 1.49 (s, 9H, C(CH3)3), 1.62-1.71 (m,

2H, CH2CH2(CH2)2CH3), 1.76-1.84 (m, 2H, CH2 (cyclohexyl)), 2.06-2.13 (m, 2H, CH2

(cyclohexyl)), 3.80 (t, J = 7.7 Hz, 2H, CH2(CH2)3CH3), 4.10 (bs, 1H, CH (cyclohexyl)), 4.25 (q,

J = 7.1Hz, 2H, CO2CH2CH3), 4.88 (s, 2H, CH2CO2Et), 5.62 (bs, 1H, NH), 7.76 (s, 1H, CH (H-

8)); LRMS (MS-ES), calcd for C25H41N6O4 [M+H] m/z = 489.31, fnd. 489.34.

187

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(ethyl(methyl)amino)-9H-purin-9-yl)

acetate (3.5ag). Purine 3.4a was treated with N-methylethylamine according to general

procedure B, yielding the final product 3.5ag as a clear viscous oil (84 %): IR (KBr, cm-1

) 3530,

3475, 3413, 2970, 2950, 2880, 1760, 1700, 1600, 1475, 1440, 1390; δH (400 MHz, CDCl3) 0.87

(t, J = 7.0 Hz, 3H, (CH2)4CH3), 1.24-1.33 (m, 10H, CO2CH2CH3, (CH2)2CH2CH2CH3 and

NCH2CH3), 1.47 (s, 9H, C(CH3)3), 1.67 (p, 2H, CH2CH2(CH2)2CH3), 3.42 (bm, 3H, NCH3), 3.79

(t, J = 7.7 Hz, 2H, CH2(CH2)3CH3), 4.04 (bm, 2H, NCH2CH3), 4.24 (q, J = 7.1 Hz, 2H,

CO2CH2CH3), 4.89 (s, 2H, CH2CO2Et), 7.74 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for

C22H37N6O4 [M+H] m/z = 449.28, fnd. 449.44

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(isopropylamino)-9H-purin-9-yl)acetate

(3.5ah). Purine 3.4a was treated with isopropylamine according to general procedure B, yielding

the final product 3.5ah as a clear viscous oil (75 %): IR (KBr, cm-1

) 3546, 3475, 3410, 2975,

2925, 1775, 1700, 1615, 1475, 1380, 1370, 1225; δH (400 MHz, CDCl3) 0.87 (t, J = 7.0 Hz, 3H,

(CH2)4CH3), 1.24-1.33 (m, 13H, CO2CH2CH3, (CH2)2CH2CH2CH3 and CH(CH3)2), 1.48 (s, 9H,

C(CH3)3), 1.66 (p, 2H, CH2CH2(CH2)2CH3), 3.80 (t, J = 7.6 Hz, 2H, CH2(CH2)3CH3), 4.25 (q, J

= 7.1 Hz, 2H, CO2CH2CH3), 4.45 (bs, 1H, CH(CH3)2), 4.89 (s, 2H, CH2CO2Et), 5.56(bs, 1H,

NH), 7.76 (s, 1H, CH (H-8));LRMS (MS-ES), calcd for C22H37N6O4 [M+H] m/z = 449.28, fnd.

449.38.

188

ethyl 2-(6-(allylamino)-2-((tert-butoxycarbonyl)(pentyl)amino)-9H-purin-9-yl)acetate

(3.5ai). Purine 3.4a was treated with allylamine according to general procedure B, yielding the

final product 3.5ai as a white solid (72 %): m.p. = 67-78 °C; IR (KBr, cm-1

) 3546, 3476, 3413,

3276, 2940, 1760, 1710, 1680, 1625, 1490, 1380, 1200; δH (400 MHz, CDCl3) 0.87 (t, J = 6.8

Hz, 3H, (CH2)4CH3), 1.25-1.33 (m, 7H, CO2CH2CH3 and (CH2)2CH2CH2CH3), 1.49 (s, 9H,

C(CH3)3), 1.65 (p, 2H, CH2CH2(CH2)2CH3), 3.82 (t, J = 7.6 Hz, 2H, CH2(CH2)3CH3), 4.25 (q, J

= 7.1 Hz, 2H, CO2CH2CH3), 4.27 (vbs, 2H, CH2CHCH2), 4.90 (s, 2H, CH2CO2Et), 5.18 (d, J =

9.9Hz, 1H, CH2CHCH2), 5.31 (d, J = 17.4 Hz, 1H, CH2CHCH2), 5.85(bs, 1H, NH), 5.94-6.04

(m, 1H, CH2CHCH2), 7.80 (s, 1H, CH (H-8));. LRMS (MS-ES), calcd for C22H35N6O4 [M+H]

m/z = 447.26, fnd. 447.36.

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(isobutylamino)-9H-purin-9-yl)acetate

(3.5aj). Purine 3.4a was treated with isobutylamine according to general procedure B, yielding

the final product 3.5aj as a a white solid (83 %): m.p. = 89-93 °C; IR (KBr, cm-1

) 3425, 3290,

2960, 2925, 2885, 1760, 1670, 1630, 1580, 1380, 1249, 1200; δH (400 MHz, CDCl3) 0.87 (t, J =

6.8 Hz, 3H, (CH2)4CH3), 0.99 (s, 3H, CH(CH3)2), 1.00 (s, 3H, CH(CH3)2), 1.25-1.34 (m, 7H,

CO2CH2CH3 and (CH2)2CH2CH2CH3), 1.48 (s, 9H, C(CH3)3), 1.66 (p, 2H, CH2CH2(CH2)2CH3),

1.97 (septet, J = 6.6 Hz, 1H, CH(CH3)2), 3.43 (bs, 2H, CH2CH(CH3)2), 3.81 (t, J = 7.6 Hz, 2H,

CH2(CH2)3CH3), 4.25 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.89 (s, 2H, CH2CO2Et), 5.79 (bs, 1H,

NH), 7.76 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C23H39N6O4 [M+H] m/z = 463.30, fnd.

463.41.

189

2ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(butyl(methyl)amino)-9H-purin-9-

yl)acetate (3.5ak). Purine 3.4a was treated with N-butylmethylamine according to general

procedure B, yielding the final product 3.5ak as a clear viscous oil (63 %): IR (KBr, cm-1

) 3550,

3460, 3410, 2950, 2925, 2860, 1760, 1700, 1600, 1440, 1400, 1200; δH (400 MHz, CDCl3) 0.88

(t, J = 7.0 Hz, 3H, (CH2)4CH3), 0.96 (t, J = 7.3 Hz, 3H, (CH2)3CH3), 1.26-1.45 (m, 9H,

CO2CH2CH3, CH2CH2CH2CH3 and (CH2)2CH2CH2CH3), 1.49 (s, 9H, C(CH3)3), 1.62-1.73 (4H,

CH2CH2CH2CH3 and CH2CH2(CH2)2CH3), 3.20-4.24 (m, 5H, CH2(CH2)2CH3 and

CH2(CH2)3CH3), 3.79 (t, J = 7.6 Hz, 2H, CH2(CH2)3CH3), 4.25 (q, J = 7.1 Hz, 2H, CO2CH2CH3),

4.91 (s, 2H, CH2CO2Et), 7.74 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C24H41N6O4 [M+H]

m/z = 477.31, fnd. 477.38.

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(isopentylamino)-9H-purin-9-yl)acetate

(3.5al). Purine 3.4a was treated with isoamylamine according to general procedure B, yielding

the final product 3.5al as a white solid (70 %): m.p. = 70-91 °C; IR (KBr, cm-1

) 3546, 3475,

3410, 2960, 2925, 2860, 1760, 1700, 1608, 1380, 1250, 1213; δH (400 MHz, CDCl3) 0.87 (t, J =

6.9 Hz, 3H, (CH2)4CH3), 0.95 (s, 3H, (CH2)2CH(CH3)2), 0.96 (s, 3H, (CH2)2CH(CH3)2), 1.25-

1.34 (m, 7H, CO2CH2CH3, and (CH2)2CH2CH2CH3), 1.49(s, 9H, C(CH3)3), 1.53-1.78 (m, 5H,

CH2CH2(CH2)2CH3 and CH2CH2CH(CH3)2), 3.62 (bs, 2H, CH2(CH2)2(CH3)2), 3.81 (t, J = 7.6

Hz, 2H, CH2(CH2)3CH3), 4.25 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.89 (s, 2H, CH2CO2Et) 5.76

190

(bs, 1H, NH), 7.77(s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C24H41N6O4 [M+H] m/z =

477.3, fnd 477.32.

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-morpholino-9H-purin-9-yl)acetate

(3.5am). Purine 3.4a was treated with morpholine according to general procedure B, yielding the

final product 3.5am as a clear viscous oil (83 %): IR (KBr, cm-1

) 2960, 2931, 2858, 1755, 1712,

1589, 1478, 1444, 1386, 1365, 1220, 1146, 1117; δH (400 MHz, CDCl3) 0.87 (t, J = 6.9 Hz, 3H,

(CH2)4CH3), 1.25-1.31 (m, 7H, CO2CH2CH3 and (CH2)2CH2CH2CH3), 1.47 (s, 9H, C(CH3)3),

1.65 (p, J = 7.4 Hz, 2H, CH2CH2(CH2)2CH3), 3.78-3.84 (m, 6H, CH2(CH2)3CH3 and 2 CH2

(morpholine)), 4.25 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.26 (bs, 4H, 2 CH2 (morpholine)), 4.89

(s, 2H, CH2CO2Et), 7.75 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C23H36N6O4Na [M+Na]

m/z = 499.27, fnd 499.43.

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(3-nitrophenoxy)-9H-purin-9-yl)acetate

(3.5an). Purine 3.4a was treated with 3-nitrophenol according to general procedure D, yielding

the final product 3.5an as a clear viscous oil (73 %): IR (KBr, cm-1

) 2959, 2931, 1752, 1713,

1578, 1533, 1448, 1407, 1354, 1276, 1222, 1149; δH (400 MHz, CDCl3) 0.82 (t, J = 7.3 Hz, 3H,

(CH2)4CH3), 1.04-1.21 (m, 4H, (CH2)2CH2CH2CH3), 1.32 (t, J = 7.2 Hz, 3H, CO2CH2CH3), 1.40

(s, 9H, C(CH3)3), 1.44-1.52 (m, 2H, CH2CH2(CH2)2CH3), 3.65-3.69 (m, 2H, CH2(CH2)3CH3),

4.28 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.98 (s, 2H, CH2CO2Et), 7.60 (t, J = 8.2 Hz, 1H, CH

191

(Ar)), 7.68 (d, J = 8.2 Hz, 1H, CH (Ar)), 8.02 (s, 1H, CH (H-8)), 8.14 (d, J = 8.2 Hz, 1H, 1 CH

(Ar)), 8.23(d, J = 2.2 Hz, 1H, 1 CH (Ar)); LRMS (MS- ES), calcd for C24H33N6O7 [M+H] m/z =

529.23, fnd 529.45.

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(4-nitrophenoxy)-9H-purin-9-yl)acetate

(3.5ao). Purine 3.4a was treated with 4-nitrophenol according to general procedure D, yielding

the final product 3.5ao as a white solid (68 %): m.p. > 99-110 °C; IR (KBr, cm-1

) 3100, 3080,

2940, 2870, 1760, 1725, 1608, 1570, 1530, 1345, 1250, 1230; δH (400 MHz, CDCl3) 0.82 (t, J =

7.1 Hz, 3H, (CH2)4CH3), 1.01-1.26 (m, 4H, (CH2)2CH2CH2CH3), 1.32 (t, J = 7.2 Hz, 3H,

CO2CH2CH3), 1.43 (s, 9H, C(CH3)3), 1.51 (p, J = 7.6 Hz, 2H, CH2CH2(CH2)2CH3), 3.68-3.72

(m, 2H, CH2(CH2)3CH3 ), 4.28 (q, J = 7.6 Hz, 2H, CO2CH2CH3), 4.98 (s, 2H, CH2CO2Et), 7.54

(d, J = 9.1 Hz, 2H, 2 CH (Ar)), 8.02 (s, 1H, CH (H-8)), 8.31 (d, J = 9.1 Hz, 2H, 2 CH (Ar));

LRMS (MS- ES), calcd for C25H32N6O7Na [M+Na] m/z = 528.23, fnd. 551.27.

ethyl 2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-((tetrahydro-2H-pyran-4-yl)amino)-9H-

purin-9-yl)acetate (3.5ay). Purine 3.4a was treated with tetrahydro-2H-pyran-4-amine

according to general procedure B, yielding the final product 3.5ay as a white solid (86 %): m.p.

> 183 °C (dec); IR (KBr, cm-1

) 2953, 2850, 1760, 1683, 1472, 1441, 1400, 1383, 1366, 1298,

1277, 1208, 1140; δH (400 MHz, CDCl3) 0.87 (t, J = 6.9 Hz, 3H, (CH2)4CH3), 1.25-1.34 (m, 7H,

CO2CH2CH3, and (CH2)2CH2CH2CH3), 1.48 (s, 9H, C(CH3)3), 1.58-1.73 (m, 4H, 2H, CH2,

192

(tetrahydropyran) and CH2CH2(CH2)2CH3)), 2.04-2.08 (m, 2H, CH2, (tetrahydropyran)), 3.48-

3.60 (m, 2H, CH2, (tetrahydropyran)), 3.79 (t, J = 7.6 Hz, 2H, CH2(CH2)3CH3), 3.95-4.07 (m,

2H, CH2, (tetrahydropyran)), 4.25 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.33 (bs, 1H, CH), 4.89 (s,

2H, CH2CO2Et) 6.01 (bs, 1H, NH), 7.77 (s, 1H, CH (H-8)); LRMS (MS- ES), calcd for

C24H38N6O5Na [M+Na] m/z = 513.29, fnd. 513.44.

ethyl 2-(6-(benzylamino)-2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-9H-purin-9-

yl)acetate (3.5ba). Purine 3.4b was treated with benzylamine according to general procedure B,

yielding the final product 3.5ba as a white solid (85 %): m.p. > 116 °C (dec); IR (KBr, cm-1

)

3325, 3140, 2990, 2925, 2850, 1750, 1697, 1625, 1600, 1390, 1370, 1225; δH (400 MHz, CDCl3)

1.21-1.40 (m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.46 (s, 9H, C(CH3)3), 1.71-1.85 (m, 5H

(cyclohexyl)), 2.41-2.46 (m, 1H, CH), 4.25 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.75 (bs, 2H,

HNCH2), 4.90 (bs, 2H, CH2Ar), 5.06 (s, 2H, CH2CO2Et), 7.08 (m, 2H, 2 CH (Ar)), 7.21-7.32 (m,

7H, 7 CH (Ar)), 7.43 (bs, 1H, NH), 7.87 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for

C34H43N6O4 [M+H] m/z = 599.33, fnd. 599.49.

ethyl 2-(6-(benzyl(methyl)amino)-2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-9H-

purin-9-yl)acetate (3.5bb). Purine 3.4b was treated with N-methylbenzylamine according to

general procedure B, yielding the final product 3.5bb as a white solid (72 %): m.p. = 115-121

°C; IR (KBr, cm-1

) 3419, 2979, 2925, 2851, 1755, 1698, 1594, 1558, 1488, 1454, 1418, 1377,

1204, 1152, 1107; δH (400 MHz, CDCl3) 1.29 (t, J = 7.2 Hz, 3H, CO2CH2CH3), 1.33 - 1.41 (m,

5H, (cyclohexyl)), 1.41 (s, 9H, C(CH3)3), 1.71-1.82 (m, 5H (cyclohexyl)), 2.40-2.47 (m, 1H,

193

CH), 3.06-3.71 (bm, 3H, NCH3), 4.24 (q, J = 7.2Hz, 2H, CO2CH2CH3), 4.89 (s, 2H, CH2Ar),

5.03 (bs, 2H, CH2CO2Et), 5.17-5.61 (bm, 2H, CH3NCH2), 7.03-7.05 (m, 2H, CH (Ar)), 7.23 -

7.31 (m, H, 7 CH (Ar)), 7.73 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C35H45N6O4 [M+H]

m/z = 613.34, fnd. 613.50.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)(methyl)

amino)-9H-purin-9-yl)acetate (3.5bd). Purine 3.4b was treated with N-methylfurfurylamine

according to general procedure B, yielding the final product 3.5bd as a white solid (67 %): m.p.

> 120 °C (dec); IR (KBr, cm-1

) 1158, 1213, 1377, 1447, 1591, 1699, 1755, 2850, 2900, 2945; δH

(400 MHz, CDCl3) 1.26-1.39 (m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.41 (s, 9H, C(CH3)3),

1.71-1.83 (m, 5H (cyclohexyl)), 2.40-2.46 (m, 1H, CH), 3.14-3.75 (vbs, 3H, NCH3), 4.23 (q, J =

7.2 Hz, 2H, CO2CH2CH3), 4.88 (s, 2H, CH2Ar), 5.05 (s, 2H, CH2CO2Et), 5.17 (vbs, 2H, CH2

(furfuryl)), 6.17-6.23 (m, 1H, CH (furfuryl)), 6.28-6.29 (m, 1H, CH (furfuryl)), 7.07 (d, J = 8.1

Hz, 2H, 2 CH (Ar)), 7.27 (d, J = 8.2 Hz, 2H, 2 CH (Ar)), 7.32-7.33 (m, 1H, CH (furfuryl)), 7.75

(s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C33H42N6O5Na [M+Na] m/z = 625.32, fnd. 625.49.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(cyclopentylamino)-9H-

purin-9-yl)acetate (3.5be). Purine 3.4b was treated with cyclopentanamine according to general

procedure B, yielding the final product 3.5be as a white solid (81 %): m.p. > 133 °C (dec); IR

194

(KBr, cm-1

) 3549, 2978, 2926, 2851, 1752, 1702, 1541, 1515, 1481, 1438, 1391, 1238, 1212,

1158, 1110, 1022; δH (400 MHz, CDCl3) 1.18-1.46 (m, 14H, 5H (cyclohexyl) and C(CH3)3),

1.28 (t, J = 7.2 Hz, 3H, CO2CH2CH3), 1.46-1.54 (m, 4H (cyclopentyl)), 1.71-1.82 (m, 7H, 5H

(cyclohexyl) and 2H (cyclopentyl)), 2.03 (bs, 2H (cyclopentyl)), 2.41-2.47 (m, 1H, CH), 4.23 (q,

J = 7.2 Hz, 2H, CO2CH2CH3), 4.44 (bs, 1H, NCH), 4.87 (s, 2H, CH2Ar), 5.05 (s, 2H,

CH2CO2Et), 5.76 (bs, 1 H, NH), 7.09 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.30 (d, J = 8.1 Hz, 2H, 2

CH (Ar)), 7.74 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C32H45N6O4 [M+H] m/z = 577.34,

fnd. 577.46.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(cyclohexylamino)-9H-

purin-9-yl)acetate (3.5bf). Purine 3.4b was treated with cyclohexanamine according to general

procedure B, yielding the final product 3.5bf as a white solid (88 %): m.p. = 75–84 °C; IR (KBr,

cm-1

) 3413, 2913, 2850, 1712, 1475, 1357, 1237, 1213, 1150; δH (400 MHz, CDCl3) 1.15-1.40

(m, 13H, 5H, (cyclohexyl)), 5H, (NH-cyclohexyl) and CO2CH2CH3)), 1.42 (s, 9H, C(CH3)3),

1.57-1.86 (m, 10H, 5H, (cyclohexyl) and 5H, (NH-cyclohexyl)), 2.38-2.48 (m, 1H, CH), 4.02

(bs, 1H, HNCH), 4.24 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.87 (s, 2H, CH2Ar), 5.03 (s, 2H,

CH2CO2Et), 5.58 (bs, 1H, NH), 7.09 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.30 (d, J = 8.1 Hz, 2H, 2


fnd. 591.54.

195

ethyl 2-(6-(allylamino)-2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-9H-purin-9-

yl)acetate (3.5bi). Purine 3.4b was treated with allylamine according to general procedure B,

yielding the final product 3.5bi as a white solid (82 %): m.p. = 125–134 °C; IR (KBr, cm-1

)

3559, 3475, 3410, 3245, 2930, 2858, 1755, 1700, 1630, 1615, 1480, 1408; δH (400 MHz, CDCl3)


(cyclohexyl)), 2.40-2.48 (m, 1H, CH), 4.25 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.26 (bs, 2 H,

CH2CHCH2), 4.88 (s, 2H, CH2Ar), 5.05 (s, 2H, CH2CO2Et), 5.15 (dd, J = 10.3 and 1.5 Hz, 1H,

CH2CHCH2), 5.25 (dd, J = 17.1 and 1.5 Hz, 1H, CH2CHCH2), 5.70 (bs, 1H, NH), 5.89-5.99 (m,

1H, CH2CHCH2), 7.09 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.29 (d, J = 8.3 Hz, 2H, 2 CH (Ar)), 7.75

(s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C30H41N6O4 [M+H] m/z = 549.31, fnd. 549.45.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(isobutylamino)-9H-purin-

9-yl)acetate (3.5bj). Purine 3.4b was treated with isobutylamine according to general procedure

B, yielding the final product 3.5bj as a white solid (77 %): m.p. = 70 - 85 °C; IR (KBr, cm-1

)

2926, 1755, 1532, 1479, 1448, 1385, 1352, 1240, 1210, 1152; δH (400 MHz, CDCl3) 0.93 (s, 3H,

CH2CH(CH3)2), 0.95 (s, 3H, CH2CH(CH3)2), 1.21-1.40 (m, 8H, 5H (cyclohexyl) and

CO2CH2CH3), 1.42 (s, 9H, C(CH3)3), 1.67-1.84 (m, 5H (cyclohexyl)), 1.86-1.96 (m, 1H,

CH2CH(CH3)2), 2.40-2.47 (m, 1H, CH(CH3)2), 3.37 (bs, 2H, CH2CH(CH3)2), 4.24 (q, J =

7.2 Hz, 2H, CO2CH2CH3), 4.88 (s, 2H, CH2Ar), 5.04 (s, 2H, CH2CO2Et), 5.75 (bs, 1H, NH),

7.08 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.30 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.74 (s, 1H, CH (H-8));

LRMS (MS-ES), calcd for C31H44N6O4Na [M+Na] m/z = 587.34, fnd. 587.51.

196

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(isopentylamino)-9H-purin-

9-yl)acetate (3.5bl). Purine 3.4b was treated with isoamylamine according to general procedure

B, yielding the final product 3.5bl as a clear viscous oil (88 %): IR (KBr, cm-1

) 2924, 2851,

1755, 1704, 1514, 1434, 1385, 1244, 1160, 1023; δH (400 MHz, CDCl3) 0.91 (s, 3H,

(CH2)2CH(CH3)2), 0.93 (s, 3H, (CH2)2CH(CH3)2), 1.25-1.39 (m, 8H, 5H (cyclohexyl) and

CO2CH2CH3), 1.41 (s, 9H, C(CH3)3), 1.49-1.55 (m, 1H, (CH2)2CH(CH3)2), 1.65-1.83 (m, 7H,

CH2CH2CH(CH3)2 and 5H (cyclohexyl)), 2.40-2.47 (m, 1H, CH), 3.58 (bs, 2H,

CH2CH2CH(CH3)2), 4.24 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.87 (s, 2H, CH2Ar), 5.06 (s, 2H,

CH2CO2Et), 5.58 (bs, 1H, NH), 7.08 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.30 (d, J = 8.1 Hz, 2H, 2


fnd. 579.48.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-morpholino-9H-purin-9-

yl)acetate (3.5bm). Purine 3.4b was treated with morpholine according to general procedure B,

yielding the final product 3.5bm as a white solid (81 %): m.p. = 166-167 °C; IR (KBr, cm-1

)

2925, 2852, 1755, 1698, 1590, 1479, 1440, 1384, 1305, 1240, 1209, 1154, 1116; δH (400 MHz,

CDCl3) 1.21-1.40 (m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.41 (s, 9H, C(CH3)3), 1.75-1.84

(m, 5H (cyclohexyl)), 2.40-2.45 (m, 1H, CH), 3.77 (t, J = 4.7 Hz, 4H, 2 CH2, (morpholine)), 4.19

197

(bs, 4H, 2 CH2, (morpholine)), 4.24 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.88 (s, 2H, CH2Ar), 5.03

(s, 2H, CH2CO2Et), 7.08 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.27 (d, J = 7.5 Hz, 2H, 2 CH (Ar)),

7.73 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C31H42N6O5Na [M+Na] m/z = 601.32, fnd.

601.49.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(3-nitrophenoxy)-9H-purin-

9-yl)acetate (3.5bn). Purine 3.4b was treated with 3-nitrophenol according to general procedure

D, yielding the final product 3.5bn as a white solid (82 %): m.p. = 57.8-79.3 °C; IR (KBr, cm-1

)

3546, 3480, 3425, 2930, 2846, 1750, 1708, 1625, 1580, 1545, 1455, 1360; δH (400 MHz, CDCl3)


(cyclohexyl)), 2.40-2.45 (m, 1H, CH), 4.27 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.92 (s, 2H,

CH2Ar), 4.97 (s, 2H, CH2CO2Et), 6.98-7.09 (m, 4H, 4 CH (Ar)), 7.52 (t, J = 8.2 Hz, 1H, CH

(Ar)), 7.61 (d, J = 8.1 Hz, 1H, CH (Ar)), 8.01 (s, 1H, CH, (H-8)), 8.09 (d, J = 8.1 Hz, 1H, CH

(Ar)), 8.2 (t, J = 2.2 Hz, 1H, CH (Ar)); LRMS (MS-ES), calcd for C33H38N6O7Na [M+Na] m/z =

653.28, fnd. 653.39.


9-yl)acetate (3.5bo). Purine 3.4b was treated with 4-nitrophenol according to general procedure

198

B, yielding the final product 3.5bo as a clear viscous oil (79 %): IR (KBr, cm-1

) 3530, 3480,

3425, 2925, 2850, 1770, 1725, 1640, 1625, 1575, 1540, 1350; δH (400 MHz, CDCl3) 1.20-1.33

(m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.36 (s, 9H, C(CH3)3), 1.7-1.83 (m, 5H


CH2Ar), 4.99 (s, 2H, CH2CO2Et), 7.06 (s, 4H, 4 CH (Ar)), 7.45 (d, J = 9.0 Hz, 2H, 2 CH (Ar)),

8.13 (s, 1H, CH (H-8)), 8.22 (d, J = 9.2 Hz, 2H, 2 CH (Ar)); LRMS (MS-ES), calcd for

C33H38N6O7Na [M+Na] m/z = 653.28, fnd. 653.30.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-((4-fluorophenyl)amino)-

9H-purin-9-yl)acetate (3.5bp). Purine 3.4b was treated with 4-fluoroaniline according to

general procedure C, yielding the final product 3.5bp as a white solid (56 %): m.p. > 125 °C

(dec); IR (KBr, cm-1

) 2926, 2852, 1707, 1593, 1389, 1229, 1157; δH (400 MHz, CDCl3) 1.20-

1.38 (m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.41 (s, 9H, C(CH3)3), 1.70-1.85 (m, 5H


CH2Ar), 5.10 (s, 2H, CH2CO2Et), 6.91-6.96 (m, 2H, 2 CH (Ar)), 7.11 (d, J = 8.0 Hz, 2H, 2 CH

(Ar)), 7.27 (d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.57 (bs, 1H, CH (Ar)), 7.67-7.72 (m, 2H, 2 CH

(Ar)), 7.83 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C33H39FN6O4Na [M+Na] m/z =

625.30, fnd. 625.43.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)amino)-

199

9H-purin-9-yl)acetate (3.5bq). Purine 3.4b was treated with furfurylamine according to general

procedure B, yielding the final product 3.5bq as a white solid (87 %): m.p. > 120 (dec) °C; IR

(KBr, cm-1

) 2925, 2851, 1755, 1703, 1481, 1438, 1390, 1237, 1156, 1109; δH (400 MHz, CDCl3)


(cyclohexyl)), 2.41-2.47 (m, 1H, CH), 4.23 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.76 (bs, 2H, CH2

(furfuryl)), 4.88 (s, 2H, CH2Ar), 5.07 (s, 2H, CH2CO2Et), 6.01 (bs, 1H, NH (furfuryl)), 6.19-6.20

(m, 1H, CH (furfuryl)), 6.29-6.30 (m, 1H, CH (furfuryl)), 7.09 (d, J = 8.1 Hz, 2H, 2 CH (Ar)),

7.29 (d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.34-7.35 (m, 1H, CH (furfuryl)), 7.75 (s, 1H, CH (H-8));

LRMS (MS-ES), calcd for C32H41N6O5 [M+H] m/z = 589.31, fnd. 589.43.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(propylamino)-9H-purin-9-

yl)acetate (3.5bs). Purine 3.4b was treated with n-propylamine according to general procedure

B, yielding the final product 3.5bs as a clear viscous oil (77 %): IR (KBr, cm-1

) 2926, 1703,

1384, 1213, 1156; δH (400 MHz, CDCl3) 0.95 (t, J = 7.4 Hz, 3H, NHCH2CH2CH3), 1.20-1.33

(m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.42 (s, 9H, C(CH3)3), 1.64 (m, 2H,

NHCH2CH2CH3) 1.7-1.83 (m, 5H (cyclohexyl)), 2.40-2.46 (m, 1H, CH), 3.52 (bs, 2H,

NHCH2CH2CH3), 4.24 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.87 (s, 2H, CH2Ar), 5.05 (s, 2H,

CH2CO2Et), 5.70 (bs, 1H, NH), 7.08 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.30 (d, J = 8.0Hz, 2H, 2


fnd. 551.54.

200

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(hexylamino)-9H-purin-9-

yl)acetate (3.5bt). Purine 3.4b was treated with n-hexylamine according to general procedure B,

yielding the final product 3.5bt as a white solid (81 %): m.p. = 115–121 °C; IR (KBr, cm-1

)

3546, 3490, 3425, 2925, 2860, 1770, 1700, 1625, 1530, 1440, 1360, 1246; δH (400 MHz, CDCl3)

0.88 (t, J = 7.2 Hz, 3H, NH(CH2)4CH3), 1.16-1.34 (m, 14H, 5H (cyclohexyl) and 6H

NH(CH2)2CH2CH2CH2CH3 and CO2CH2CH3), 1.42 (s, 9H, C(CH3)3), 1.51-1.76 (m, 7H, 5H

(cyclohexyl) and NHCH2CH2(CH2)3CH3)), 2.40-2.46 (m, 1H, CH), 3.54 (bs, 2H,

NHCH2(CH2)4CH3), 4.24 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.87 (s, 2H, CH2Ar), 5.05 (s, 2H,

CH2CO2Et), 5.93 (bs, 1H, NH), 7.08 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.30 (d, J = 8.0Hz, 2H, 2


fnd. 593.51.

ethyl 2-(6-(3-bromophenoxy)-2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-9H-

purin-9-yl)acetate (3.5bu). Purine 3.4b was treated with 3-bromophenol according to general

procedure D, yielding the final product 3.5bu as a clear viscous oil (76 %): IR (KBr, cm-1

) 3546,

3480, 3425, 3230, 2930, 2840, 1750, 1710, 1625, 1580, 1470, 1400; δH (400 MHz, CDCl3) 1.14-

1.34 (m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.35 (s, 9H, C(CH3)3), 1.67-1.86 (m, 5H,


CH2Ar), 4.95 (s, 2H, CH2CO2Et), 7.12-7.07 (m, 4H, 4 CH (Ar)), 7.17-7.21 (m, 1H, CH (Ar)),

201

7.23-7.28 (m, 1H, CH (Ar)), 7.35-7.41 (m, 1H, CH (Ar)), 7.49 (t, J = 2.0 Hz, CH, (Ar)), 7.98 (s,

1H, CH, (H-8)); LRMS (MS-ES), calcd for C33H39BrN5O5 [M+H] m/z = 664.21, fnd. 664.28.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(4-fluorophenoxy)-9H-

purin-9-yl)acetate (3.5bv). Purine 3.4b was treated with 4-fluorophenol according to general

procedure D, yielding the final product 3.5bv as a white solid (67 %): m.p. = 93–97 °C; IR (KBr,

cm-1

) 3546, 3470, 3408, 3230, 2925, 2846, 1760, 1700, 1625, 1500, 1440, 1400; δH (400 MHz,


(m, 5H (cyclohexyl)), 2.40-2.47 (m, 1H, CH), 4.26 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.90 (s,

2H, CH2Ar), 4.95 (s, 2H, CH2CO2Et), 7.02-7.07 (m, 6H, 6 CH (Ar)), 7.18-7.21 (m, 2H, 2 CH

(Ar)), 7.98 (s, 1H, CH, (H-8)); LRMS (MS-ES), calcd for C33H39FN5O5 [M+H] m/z = 604.29,

fnd. 604.37.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(perfluorophenoxy)-9H-

purin-9-yl)acetate (3.5bw). Purine 3.4b was treated with pentafluorophenol according to

202

general procedure D, yielding the final product 3.5bw as a white solid (75 %): m.p. = 91–110 °C;

IR (KBr, cm-1

) 3546, 3475, 3425, 2905, 2860, 1760, 1730, 1630, 1560, 1400, 1370, 1230; δH

(400 MHz, CDCl3) 1.21-1.34 (m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.37 (s, 9H, C(CH3)3),

1.71-1.84 (m, 5H (cyclohexyl)), 2.40-2.47 (m, 1H, CH), 4.28 (q, J = 7.1 Hz, 2H, CO2CH2CH3),

4.88 (s, 2H, CH2Ar), 4.98 (s, 2H, CH2CO2Et), 6.98 (d, J = 8.2 Hz, 2H, 2 CH (Ar)), 7.04 (d, J =

8.2Hz, 2H, 2 CH (Ar)), 8.04 (s, 1H, CH, (H-8)); LRMS (MS-ES), calcd for C33H34F5N5O5Na

[M+Na] m/z = 698.25, fnd. 698.34.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-phenoxy-9H-purin-9-

yl)acetate (3.5bx). Purine 3.4b was treated with phenol according to general procedure D,

yielding the final product 3.5bx as a white solid (79 %): m.p. = 104–110 °C; IR (KBr, cm-1

)

3546, 3470, 3425, 2940, 2850, 1750, 1700, 1630, 1570, 1490, 1395, 1230; δH (400 MHz, CDCl3)



CH2Ar), 4.95 (s, 2H, CH2CO2Et), 7.01-7.07 (m, 4H, 4 CH (Ar)), 7.22-7.26 (m, 3H, 3 CH (Ar)),

7.37-7.42 (m, 2H, 2 CH (Ar)), 7.97 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C33H40N5O5

[M+H] m/z = 586.30, fnd. 586.43.

203

2-(6-(benzylamino)-2-((tert-butoxycarbonyl)(pentyl)amino)-9H-purin-9-yl)acetic acid

(3.6aa). Purine 3.5aa was treated according to general procedure E, to yield lyophilized product

3.6aa as a white solid (72 %): m.p. > 198 (dec) °C; IR (KBr, cm-1

) 3549, 3476, 3414, 2959,

1707, 1624, 1390, 1367, 1355, 1300, 1271, 1217; δH (400 MHz, DMSO-d6) 0.77 (t, J = 7.0 Hz,

3H, (CH2)4CH3), 1.09-1.23 (m, 4H, (CH2)2CH2CH2CH3), 1.35 (s, 9H, C(CH3)3), 1.52-1.59 (m,

2H, CH2CH2(CH2)2H3), 3.59 (t, J = 6.9 Hz, 2H, CH2(CH2)3CH3), 4.65 (bs, 2H, CH2Ar), 4.89 (s,

2H, CH2CO2H), 7.20 (t, J = 7.2 Hz, 1H, CH (Ar)), 7.28 (t, J = 7.5 Hz, 2H, 2 CH (Ar)), 7.30-7.35

(m, 2H, 2 CH (Ar)), 8.07 (s, 1H, CH (H-8)), 8.43 (m, 1H, NH) 13.26 (vbs, 1H, CH2CO2H); δC

(100 MHz, DMSO-d6) 13.8, 21.7, 27.8, 27.9, 28.3, 43.0, 43.7, 47.3, 79.3, 115.7, 126.5, 127.0,

127.1, 128.0, 140.0, 141.3, 149.8, 153.9, 155.2, 169.2; HRMS (MS- ES), calcd for C24H33N6O4


purity 91.2 %and 93.4%.

2-(6-(benzyl(methyl)amino)-2-((tert-butoxycarbonyl)(pentyl)amino)-9H-purin-9-yl)acetic

acid (3.6ab). Purine 3.5ab was treated according to general procedure E, to yield lyophilized

product 3.6ab as a white solid (87 %): m.p. = 116-127 °C; IR (KBr, cm-1

) 3294, 2924, 2444,

2356, 1399, 1198; δH (400 MHz, DMSO-d6) 0.82 (m, 3H, (CH2)4CH3), 1.21-1.29 (m, 4H,

204

(CH2)2CH2CH2CH3), 1.38 (s, 9H, C(CH3)3), 1.43-1.58 (m, 2H, (CH2)3CH2CH3), 3.15-3.60 (bm,

3H, NCH3), 3.60-3.70 (m, 2H, CH2(CH2)3CH3), 4.78 (s, 2H, CH2CO2H) , 4.86-5.55 (bm, 2H,

CH2Ar), 7.24-7.31 (m, 5H, 2 CH (Ar)), 7.71 (s, 1H, CH (H-8)), 13.23 (vbs, 1H, CH2CO2H); δC

(100 MHz, DMSO-d6) 13.6, 21.5, 27.7, , 28.2, 43.1, 43.8, 47.5, 79.4, 115.6, 126.2, 127.1, 127.2,

128.2, 140.1, 141.4, 149.7, 153.7, 155.1, 169.5; HRMS (MS- ES), calcd for C25H35N6O4 [M+H]

m/z = 483.2701, fnd. 483.2714; rpHPLC tR: condition (I) 15.031 (II) 38.982 minutes, purity 90.0

%and 90.4%.

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(phenylamino)-9H-purin-9-yl)acetic acid

(3.6ac). Purine 3.5ac was treated according to general procedure E, to yield lyophilized product

3.6ac as an off-white solid (75 %): m.p. > 139 °C (dec); IR (KBr, cm-1

) 3424, 2958, 1704, 1442,

1364, 1164; δH (400 MHz, DMSO-d6) 0.81 (t, J = 7.0 Hz, 3H, (CH2)4CH3), 1.23-1.27 (m, 4H,

(CH2)2CH2CH2CH3), 1.39 (s, 9H, C(CH3)3), 1.52-1.59 (m, 2H, (CH2)3CH2CH3), 3.72 (t, J = 7.4

Hz, 2H, CH2(CH2)3CH3), 4.90 (s, 2H, CH2CO2H), 7.03 (t, J = 7.3 Hz, 1H, CH (Ar)), 7.29 (t, J =

7.9 Hz, 2H, 2 CH (Ar)), 7.96 (d, J = 7.5Hz, 2H, 2 CH (Ar)), 8.21 (s, 1H, CH (H-8)), 9.93 (s, 1H,

NH); δC (100 MHz, DMSO-d6) 13.8, 21.7, 27.7, 27.9, 28.3, 44.2, 47.5, 79.6, 116.6, 120.4, 122.4,

128.1, 139.5, 142.3, 150.6, 151.5, 153.7, 154.7, 169.1;. HRMS (MS- ES), calcd for C23H31N6O4


purity 93.1 %and 98.2%.

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-((furan-2-ylmethyl)(methyl)amino)-9H-purin-

205

9-yl)acetic acid (3.6ad). Purine 3.5ad was treated according to general procedure E, to yield

product 3.6ad as a clear viscous oil (92%): IR (KBr, cm-1

) 3549, 3471, 3415, 3120, 2958, 2925,

2855, 1703, 1637, 1618, 1591, 1460; δH (400 MHz, CDCl3) 0.83-0.88 (m, 3H, (CH2)4CH3), 1.25-

1.34 (m, 4H, (CH2)2CH2CH2CH3), 1.48 (s, 9H, C(CH3)3), 1.56-1.69 (m, 2H,

CH2CH2(CH2)2CH3), 3.50 (vbs, 3H, CH3(furfuryl)), 3.80 (t, J = 7.6 Hz, 2H, CH2(CH2)3CH3),

4.86 (s, 2H, CH2CO2H), 5.22 (vbs, 2H, CH3(furfuryl)), 6.29-6.33 (m, 2H, CH (furfuryl)), 7.35-

7.36 (m, 1H, CH (furfuryl)), 7.81 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C23H31N6O5 [M-

H] m/z = 471.24, fnd. 471.25.

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(cyclopentylamino)-9H-purin-9-yl)acetic acid

(3.6ae). Purine 3.5ae was treated according to general procedure E, to yield product 3.6ae as a

white solid (95 %): m.p. > 140-146 °C; IR (KBr, cm-1

) 3551, 3474, 3413, 2959, 2929, 2871,


1.32 (m, 4H, (CH2)2CH2CH2CH3), 1.49 (s, 9H, C(CH3)3), 1.56-1.80 (m, 8H, CH2CH2(CH2)2CH3

and 3 CH2 (cyclopentyl)), 2.00-2.11 (m, 2H, CH2 (cyclopentyl)), 3.80-3.86 (m, 2H,

CH2(CH2)3CH3), 4.45 (bs, 1H, CH (cyclopentyl)), 4.89 (s, 2H, CH2CO2H), 7.10 (s, 1H, NH),

7.90 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C22H33N6O4 [M-H] m/z = 445.26, fnd.

445.27.

206

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(cyclohexylamino)-9H-purin-9-yl)acetic acid

(3.6af). Purine 3.5af was treated according to general procedure E, to yield product 3.6af as a

white solid (70 %): m.p. = 140-158 °C; IR (KBr, cm-1

) 3550, 3413, 2930, 2855, 1741, 1707,


1.42 (m, 10H, (CH2)2CH2CH2CH3 and 3 CH2(cyclohexyl)), 1.49 (s, 9H, C(CH3)3), 1.60-1.72(m,

2H, CH2CH2(CH2)2CH3), 1.75-1.83 (m, 2H, CH2 (cyclohexyl)), 2.00-2.07 (m, 2H, CH2

(cyclohexyl)), 3.78-3.85 (m, 2H, CH2(CH2)3CH3), 4.03 (bs, 1H, CH (cyclohexyl)), 4.89 (s, 2H,

CH2CO2H), 6.90 (bs, 1H, NH), 7.89 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C23H35N6O4

[M-H] m/z = 459.28, fnd. 459.35.

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(ethyl(methyl)amino)-9H-purin-9-yl)acetic

acid (3.6ag). Purine 3.5ag was treated according to general procedure E, to yield product 3.6ag

as a clear oil (94 %): IR (KBr, cm-1

) 3414, 2961, 2931, 2859, 1723, 1596, 1492, 1456, 1433,

1418, 1380, 1296; δH (400 MHz, CDCl3) 0.89 (t, J = 6.9 Hz, 3H, (CH2)4CH3), 1.25-1.36 (m, 7H,

(CH2)2CH2CH2CH3 and NCH2CH3), 1.52 (s, 9H, C(CH3)3), 1.68 (p, 7.4 Hz, 2H,

CH2CH2(CH2)2CH3), 3.21-3.76 (bm, 3H, NCH3), 3.85-3.91 (m, 2H, CH2(CH2)3CH3), 4.28 (bs,

2H, NCH2CH3), 5.00 (s, 2H, CH2CO2H), 7.74 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for

C20H31N6O4 [M-H] m/z = 419.25, fnd. 419.36.

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(isopropylamino)-9H-purin-9-yl)acetic acid

207

(3.6ah). Purine 3.5ah was treated according to general procedure E, to yield product 3.6ah as a

white solid (98 %): m.p. > 146 °C (dec); IR (KBr, cm-1

) 3413, 3314, 2976, 2929, 1714, 1613,


1.41 (m, 10H, (CH2)2CH2CH2CH3 and CH(CH3)2), 1.52 (s, 9H, C(CH3)3), 1.58-1.72 (m, 2H,

CH2CH2(CH2)2CH3), 3.80-3.90 (m, 2H, CH2(CH2)3CH3), 4.33 (bs, 1H, CH(CH3)2), 4.92 (s, 2H,

CH2CO2H), 7.26 (bs, 1H, NH), 7.96 (bs, 1H, CH (H-8)); LRMS (MS-ES), calcd for C20H31N6O4

[M-H] m/z = 419.25, fnd. 419.36.

2-(6-(allylamino)-2-((tert-butoxycarbonyl)(pentyl)amino)-9H-purin-9-yl)acetic acid (3.6ai).

Purine 3.5ai was treated according to general procedure E, to yield product 3.6ai as a white solid

(96%): m.p. = 174-176 °C; IR (KBr, cm-1

) 3550, 3475, 3414, 2931, 1711, 1619, 1477, 1445,

1403, 1386, 1365, 1349; δH (400 MHz, CDCl3) 0.86 (t, J = 6.8 Hz, 3H, (CH2)4CH3), 1.26-1.34

(m, 4H, (CH2)2CH2CH2CH3), 1.49 (s, 9H, C(CH3)3), 1.64 (p, J = 7.3 Hz, 2H,

CH2CH2(CH2)2CH3), 3.82 (t, J = 7.6 Hz, 2H, CH2(CH2)3CH3), 4.24 (bs, 2H, CH2CHCH2), 4.89

(s, 2H, CH2CO2H), 5.16 (d, J = 10.1 Hz, 1H, CH2CHCH2), 5.30 (d, J = 17.4 Hz, 1H,

CH2CHCH2), 5.91-6.03 (m, 1H, CH2CHCH2), 7.86 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd

for C20H29N6O4 [M-H] m/z = 417.23, fnd. 417.37.

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(isobutylamino)-9H-purin-9-yl)acetic acid

(3.6aj). Purine 3.5aj was treated according to general procedure E, to yield product 3.6aj as a


) 3413, 3315, 2958, 2928, 2872, 1704,

208


1.02 (m, 6H, CH(CH3)2), 1.20-1.35 (m, 4H, (CH2)2CH2CH2CH3), 1.51 (s, 9H, C(CH3)3), 1.61-

1.73 (m, 2H, CH2CH2(CH2)2CH3), 1.94-2.08 (m, 1H, CH(CH3)2), 3.36-3.44 (m, 2H,

CH2CH(CH3)2), 3.78-3.92 (m, 2H, CH2(CH2)3CH3), 4.92 (s, 2H, CH2CO2H), 7.94 (s, 1H, CH (H-

8)); LRMS (MS-ES), calcd for C21H33N6O4 [M-H] m/z = 433.26, fnd. 433.37.

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(butyl(methyl)amino)-9H-purin-9-yl)acetic

acid (3.6ak). Purine 3.5ak was treated according to general procedure E, to yield product 3.6ak

as a clear viscous oil (89 %): IR (KBr, cm-1

) 3549, 3476, 3414, 2958, 2926, 1702, 1637, 1618,

1384; δH (400 MHz, CDCl3) 0.84-0.89 (m, 3H, (CH2)4CH3), 0.94 (t, J = 7.3 Hz, 3H, (CH2)3CH3),

1.25-1.43 (m, 6H, CH2CH2CH2CH3 and (CH2)2CH2CH2CH3), 1.47 (s, 9H, C(CH3)3), 1.59-1.70

(m, 4H, CH2CH2CH2CH3 and CH2CH2(CH2)2CH3), 3.14-3.86 (bm, 4H, CH2(CH2)2CH3 and

CH2(CH2)3CH3), 3.79 (t, J = 7.6 Hz, 2H, CH2(CH2)3CH3), 4.84 (s, 2H, CH2CO2H), 7.78 (s, 1H,

CH (H-8)); LRMS (MS-ES), calcd for C22H35N6O4 [M-H] m/z = 447.28, fnd. 447.38.

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(isopentylamino)-9H-purin-9-yl)acetic acid

(3.6al). Purine 3.5al was treated according to general procedure E, to yield product 3.6al as a


) 3550, 3414, 3322, 2957, 2930, 2871,

209

1741, 1708, 1621, 1468, 1383, 1365; δH (400 MHz, CDCl3) 0.82-0.90 (m, 3H, (CH2)4CH3), 0.92

(s, 3H, (CH2)2CH(CH3)2), 0.94 (s, 3H, (CH2)2CH(CH3)2), 1.19-1.35 (m, 4H,

(CH2)2CH2CH2CH3), 1.50 (s, 9H, C(CH3)3), 1.54-1.76 (m, 5H, CH2CH2(CH2)2CH3 and

CH2CH2CH(CH3)2), 3.57 (bs, 2H, CH2(CH2)2(CH3)2), 3.80-3.89 (m, 2H, CH2(CH2)3CH3), 4.05

(bs, 1H, NH), 4.91 (s, 2H, CH2CO2H), 7.92 (bs, 1H, CH (H-8)); LRMS (MS-ES), calcd for

C22H35N6O4 [M-H] m/z = 447.28, fnd. 447.38.

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-morpholino-9H-purin-9-yl)acetic acid (3.6am).

Purine 3.5am was treated according to general procedure E, to yield product 3.6am as a

lyophilized white powder (94 %): m.p. > 143 (dec); IR (KBr, cm-1

) 2959, 2929, 2857, 1588,

1478, 1446, 1388, 1304, 1266, 1241, 1137; δH (400 MHz, DMSO-d6) 0.87 (t, J = 6.9 Hz, 3H,

(CH2)4CH3), 1.17-1.26 (m, 4H, (CH2)2CH2CH2CH3), 1.38 (s, 9H, C(CH3)3), 1.52 (p, J = 7.3 Hz,

2H, CH2CH2(CH2)2CH3), 3.64-3.75 (m, 6H, CH2(CH2)3CH3 and 2 CH2 (morpholine)), 4.17 (bs,

4H, 2 CH2 (morpholine)), 4.76 (s, 2H, CH2CO2H), 8.07 (s, 1H, CH (H-8)); δC (100 MHz,

DMSO-d6) 13.8, 21.6, 27.8, 27.9, 28.3, 44.6, 45.0, 47.3, 66.1, 79.3, 115.9, 141.0, 151.8, 152.9,

153.8, 154.5, 169.2; HRMS (MS-ES), calcd for C21H33N6O5 [M+H] m/z = 449.2506, fnd.

449.2497; rpHPLC tR: condition (I) 13.883 (II) 32.404 minutes, purity 90.8 %and 90.9%.

210

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(3-nitrophenoxy)-9H-purin-9-yl)acetic acid

(3.6an). Purine 3.5an was treated according to general procedure E, to yield product 3.6an as a

lyophilized white solid (62 %): m.p. > 85 °C (dec); IR (KBr, cm-1

) 3595, 3385, 3115, 2945,


(CH2)2CH2CH2CH3), 1.29 (s, 9H, C(CH3)3), 1.31-1.38 (m, 2H, (CH2)3CH2CH3), 3.52 (t, J = 7.4

Hz, 2H, CH2(CH2)3CH3), 5.03 (s, 2H, CH2CO2H), 7.78 (t, J = 8.1 Hz, 1H, CH (Ar)), 7.85-7.88

(m, 1H, CH (Ar)), 8.18-8.21 (m, 1H, CH (Ar)), 8.28 (t, J = 2.2 Hz, 1H, CH (Ar), 8.43 (s, 1H, CH

(H-8)), 13.44 (vbs, 1H, CH2CO2H); δC (100 MHz, DMSO-d6) 13.7, 21.6, 27.7, 28.2, 28.5, 44.3,

47.7, 80.2, 116.8, 117.6, 120.5, 129.1, 130.8, 145.4 148.3, 152.3, 153.2, 154.0, 154.2, 158.2,

168.9; HRMS (MS- ES), calcd for C23H29N6O7 [M+H] m/z = 501.2095, fnd. 501.2092; rpHPLC

tR: condition (I) 14.230 (II) 36.038 minutes, purity 98.3% and 97.16%.

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-(4-nitrophenoxy)-9H-purin-9-yl)acetic acid

(3.6ao). Purine 3.5ao was treated according to general procedure E, to yield product 3.6ao as a

lyophilized white solid (70 %): m.p. > 194 °C (dec); IR (KBr, cm-1

)3119, 2959, 2931, 2861,

1723, 1579, 1525, 1489, 1407, 1347, 1252, 1209, 1137, 1045; δH (400 MHz, DMSO-d6) 0.74 (t, J

= 7.2 Hz, 3H, (CH2)4CH3), 0.99-1.17 (m, 4H, (CH2)2CH2CH2CH3), 1.31 (s, 9H, C(CH3)3), 1.34-

1.39 (m, 2H, CH2CH2(CH2)2CH3), 2.81-3.03 (m, 2H, CH2(CH2)3CH3 ), 5.04 (s, 2H, CH2CO2H),

7.66 (d, J = 9.0 Hz, 2H, 2 CH (Ar)), 8.43 (s, 1H, CH (H-8)), 8.35 (d, J = 9.1 Hz, 2H, 2 CH (Ar));

δC (100 MHz, DMSO-d6) 13.7, 21.7, 27.6, 27.8, 28.3, 41.0, 44.3, 47.8, 112.9, 116.8, 123.2,



purity 98.2 %and 98.3%. (Decomposed- remaking)

211

2-(2-((tert-butoxycarbonyl)(pentyl)amino)-6-((tetrahydro-2H-pyran-4-yl)amino)-9H-purin-

9-yl)acetic acid (3.6ay). Purine 3.5ay was treated according to general procedure E, to yield

product 3.6ay as a lyophilized a white powder (88 %): m.p. > 112 °C (dec); IR (KBr, cm-1

) 3666,

2958, 2927, 2856, 1707, 1475, 1384, 1367, 1275, 1241, 1151; δH (400 MHz, DMSO-d6) 0.83 (t,

J = 6.9 Hz, 3H, (CH2)4CH3), 1.08-1.26 (m, 4H, (CH2)2CH2CH2CH3), 1.38 (s, 9H, C(CH3)3),

1.47-1.88 (m, 6H, 2 CH2 (tetrahydropyran) and CH2CH2(CH2)2CH3), 3.34-3.51 (m, 2H, CH2

(tetrahyropyran)), 3.64 (t, J = 7.1 Hz, 2H, CH2(CH2)3CH3), 3.85-3.96 (m, 2H, CH2

(tetrahydropyran)), 4.22 (bs, 1H, CH), 4.77 (s, 2H, CH2CO2Et) 7.74 (bs, 1H, NH), 8.02 (s, 1H,

CH (H-8)); δC (100 MHz, DMSO-d6); 13.9, 21.7, 27.9, 28.0, 28.4, 32.3, 44.3, 46.2, 47.5, 66.3,

79.2, 115.8, 141.3, 150.0, 153.5, 153.9, 155.2, 169.2 HRMS (MS- ES), calcd for C22H35N6O5


purity 90.8 %and 91.6%.

2-(6-(benzylamino)-2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-9H-purin-9-

yl)acetic acid (3.6ba). Purine 3.5ba was treated according to general procedure E, to yield

product 3.6ba as a white solid (63 %): m.p. > 147 °C (dec); IR (KBr, cm-1

) 3552, 3476, 3414,

3261, 2919, 2849, 1741, 1631, 1478, 1446, 1421, 1398; δH (400 MHz, CDCl3) 1.20-1.42 (m,

14H, 5H (cyclohexyl) and C(CH3)3), 1.69-1.81 (m, 5H (cyclohexyl)), 2.39-2.45 (m, 1H, CH),

4.72 (bs, 2H, HNCH2), 4.87 (bs, 2H, CH2Ar), 5.04 (s, 2H, CH2CO2H), 6.94-7.27 (m, 10H, NH

and 9 CH (Ar)), 7.88 (bs, 1H, CH (H-8)); LRMS (MS-ES), calcd for C32H37N6O4 [M-H] m/z =

212

569.30, fnd. 569.40.

2-(6-(benzyl(methyl)amino)-2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-9H-purin-

9-yl)acetic acid (3.6bb). Purine 3.5bb was treated according to general procedure E, to yield

product 3.6bb as a white solid (90 %): m.p. > 126-131 °C; IR (KBr, cm-1

) 3414, 2922, 2850,

1743, 1702, 1655, 1596, 1480, 1445, 1398, 1367, 1282; δH (400 MHz, CDCl3) 1.28-1.43 (m,

14H, 5H (cyclohexyl) and C(CH3)3), 1.71-1.81 (m, 5H (cyclohexyl)), 2.38-2.42 (m, 1H, CH),

2.97-3.77 (bm, 3H, NCH3), 4.94 (s, 2H, CH2Ar), 5.03 (bs, 2H, CH2CO2H), 5.39-5.62 (bm, 2H,

CH3NCH2), 6.98-7.29 (m, 9H, 9 CH (Ar)), 7.73 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for

C33H39N6O4 [M-H] m/z = 583.31, fnd. 583.38.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)

(methyl)amino)-9H-purin-9-yl)acetic acid (3.6bd). Purine 3.5bd was treated according to

general procedure E, to yield product 3.6bd as a white solid (72 %): m.p. > 130 °C (dec); IR

(KBr, cm-1

) 2919, 2849, 1741, 1648, 1601, 1445, 1406, 1392, 1367, 1290, 1274, 1245; δH

(400 MHz, CDCl3) 1.20-1.40 (m, 5H, 5H (cyclohexyl)), 1.43 (s, 9H, C(CH3)3), 1.71-1.82 (m, 5H

(cyclohexyl)), 2.42-2.47 (m, 1H, CH), 3.05-3.81(m, 5H, CH2 and CH3 (furfuryl)), 5.01 (bs, 2H,

CH2Ar), 5.12 (s, 2H, CH2CO2H), 6.26-6.38 (m, 2H, 2 CH (furfuryl)), 7.10 (d, J = 7.7 Hz, 2H, 2

CH (Ar)), 7.24 (d, J = 8.3 Hz, 2H, 2 CH (Ar)), 7.34 (s, 1H, CH (furfuryl)), 7.77 (s, 1H, CH (H-

213

8)); LRMS (MS-ES), calcd for C31H37N6O5 [M-H] m/z = 573.29, fnd. 573.37.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(cyclopentylamino)-9H-purin-9-

yl)acetic acid (3.6be). Purine 3.5be was treated according to general procedure E, to yield

product 3.6be as a white solid (68 %): m.p. > 144 °C; IR (KBr, cm-1

) 3550, 3475, 3414, 2925,

2851, 1706, 1618, 1448, 1366, 1241; δH (400 MHz, CDCl3) 1.18-1.46 (m, 14H, 5H (cyclohexyl)

and C(CH3)3), 1.46-1.54 (m, 4H (cyclopentyl)), 1.71-1.82 (m, 7H, 5H (cyclohexyl) and 2H

(cyclopentyl)), 1.91-1.99 (bs, 2H (cyclopentyl), 2.42-2.47 (m, 1H, CH), 4.40 (bs, 1H, NCH),

4.86 (s, 2H, CH2Ar), 5.05(s, 2H, CH2CO2H), 7.00 (bs, 1 H, NH), 7.07 (d, J = 7.7 Hz, 2H, 2 CH

(Ar)), 7.28 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.79 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for

C30H39N6O4 [M-H] m/z = 547.31, fnd. 547.44.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(cyclohexylamino)-9H-purin-9-

yl)acetic acid (3.6bf). Purine 3.5bf was treated according to general procedure E, to yield

product 3.6bf as a white solid (89 %): m.p. = 118-123 °C; IR (KBr, cm-1

) 2926, 2852, 1617,

1477, 1449, 1389, 1367, 1245, 1158, 1108; δH (400 MHz, CDCl3) 1.16-1.38 (m, 10H, 5H

(cyclohexyl) and 5H (NH-cyclohexyl)), 1.35 (s, 9H, C(CH3)3), 1.59-1.94 (m, 10H, 5H

(cyclohexyl) and 5H (NH-cyclohexyl)), 2.38-2.48 (m, 1H, CH), 3.90 (bs, 1H, HNCH), 4.79 (s,

214

2H, CH2Ar), 5.00 (s, 2H, CH2CO2H), 6.29 (bs, 1H, NH), 7.08 (d, J = 8.1 Hz, 2H, 2 CH (Ar)),

7.24 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.71 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for

C31H41N6O4 [M-H] m/z = 561.33, fnd. 561.44.

2-(6-(allylamino)-2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-9H-purin-9-yl)acetic

acid (3.6bi). Purine 3.5bi was treated according to general procedure E, to yield product 3.6bai

as a white solid (88 %): m.p. > 123 °C (dec); IR (KBr, cm-1

) 3549, 3476, 3414, 3275, 2920,

2849, 1745, 1618, 1449, 1404, 1366, 1249; δH (400 MHz, CDCl3) 1.17-1.30 (m, 5H,

(cyclohexyl)), 1.36 (s, 9H, C(CH3)3), 1.68-1.87 (m, 5H (cyclohexyl)), 2.36-2.49 (m, 1H, CH),

4.15 (bs, 2 H, CH2CHCH2), 4.88 (s, 2H, CH2Ar), 5.06 (s, 2H, CH2CO2H), 5.12 (dd, J = 10.6 and

1.5 Hz, 1H, CH2CHCH2), 5.21 (dd, J = 17.2 and 1.5 Hz, 1H, CH2CHCH2), 5.79-5.97 (m, 1H,

CH2CHCH2), 6.39 (bs, 1H, NH), 7.09 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.25 (d, J = 7.2 Hz, 2H, 2

CH (Ar)), 7.74 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C28H35N6O4 [M-H] m/z = 519.28,

fnd. 519.30.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(isobutylamino)-9H-purin-9-

yl)acetic acid (3.6bj). Purine 3.5bj was treated according to general procedure E, to yield

product 3.6bj as a white solid (86 %): m.p. > 124-126 °C; IR (KBr, cm-1

) 3549, 3476, 3414,

3335, 2929, 1759, 1683, 1619, 1591, 1434, 1388, 1343; δH (400 MHz, CDCl3) 0.93 (s, 3H,

CH2CH(CH3)2), 0.95 (s, 3H, CH2CH(CH3)2), 1.19-1.38 (m, 5H (cyclohexyl), 1.39 (s, 9H,

C(CH3)3), 1.67-1.79 (m, 5H, (cyclohexyl)), 1.84-1.93 (m, 1H, CH2CH(CH3)2) 2.40-2.47 (m, 1H,

215

CH), 3.37 (bs, 2H, CH2CH(CH3)2), 4.88 (s, 2H, CH2Ar), 5.04 (s, 2H, CH2CO2H), 6.03 (bs, 1H,

NH), 7.1 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.23 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.74 (s, 1H, CH

(H-8)); LRMS (MS-ES), calcd for C29H39N6O4 [M-H] m/z = 535.31, fnd. 535.35.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(isopentylamino)-9H-purin-9-

yl)acetic acid (3.6bl). Purine 3.5bl was treated according to general procedure E, to yield

product 3.6bl as a white solid (93 %): m.p. > 128 °C (dec); IR (KBr, cm-1

) 2925, 2852, 1707,

1485, 1440, 1400, 1379, 1246; δH (400 MHz, CDCl3) 0.87 (s, 3H, (CH2)2CH(CH3)2), 0.88 (s,

3H, (CH2)2CH(CH3)2), 1.25-1.39 (m, 5H, (cyclohexyl)), 1.39 (s, 9H, C(CH3)3), 1.46-1.66 (m,

3H, CH2CH2CH(CH3)2), 1.67-1.84 (m, 5H, (cyclohexyl)), 2.39-2.47 (m, 1H, CH), 3.50 (bs, 2H,

CH2CH2CH(CH3)2), 4.88 (s, 2H, CH2Ar), 5.08 (s, 2H, CH2CO2H), 6.76 (bs, 1H, NH), 7.07 (d, J

= 7.9 Hz, 2H, 2 CH (Ar)), 7.27 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.76 (s, 1H, CH (H-8)); LRMS

(MS-ES), calcd for C30H41N6O4 [M-H] m/z = 549.33, fnd. 549.39.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-morpholino-9H-purin-9-yl)acetic

acid (3.6bm). Purine 3.5bm was treated according to general procedure E, to yield product

3.6bm as a lyophilized white powder (83 %): m.p. = 166-167 °C; IR (KBr, cm-1

) 3666,2958,

216

2927, 2856, 1707, 1475, 1385, 1367, 1275, 1242, 1151, 1011; δH (400 MHz, DMSO-d6) 1.17-

1.36 (m, 5H, (cyclohexyl)), 1.37 (s, 9H, C(CH3)3), 1.66-1.77 (m, 5H, (cyclohexyl)), 2.38-2.44

(m, 1H, CH), 3.68 (t, J = 4.5 Hz, 4H, 2 CH2, (morpholine)), 4.12 (bs, 4H, 2 CH2, (morpholine)),

4.85 (s, 2H, CH2Ar), 4.91 (s, 2H, CH2CO2H), 7.1 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.21 (d, J = 8.1

Hz, 2H, 2 CH (Ar)), 8.07 (s, 1H, CH (H-8)); δC (100 MHz, DMSO-d6) 25.5, 26.3, 27.8, 33.9,

43.4, 44.2, 50.3, 66.1, 79.9, 115.8, 126.3, 127.3, 136.5, 140.8, 145.9, 151.8, 152.7, 154.1, 154.5,

169.2; HRMS (MS-ES), calcd for C29H39N6O5 [M+H] m/z = 551.2962, fnd. 551.2976; rpHPLC

tR: condition (I) 15.722 (II) 41.975 minutes, purity 91.8% and 90.7%.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(3-nitrophenoxy)-9H-purin-9-

yl)acetic acid (3.6bn). Purine 3.5bn was treated according to general procedure E, to yield

product 3.6bn as a white solid (90 %): m.p. = 103–107 °C; IR (KBr, cm-1

) 2925, 2852, 1578,

1532, 1448, 1402, 1368, 1351, 1275, 1236, 1154; δH (400 MHz, CDCl3) 1.19 (s, 9H, C(CH3)3),

1.31-1.42 (m, 5H, (cyclohexyl)), 1.72-1.84 (m, 5H, (cyclohexyl)), 2.37-2.44 (m, 1H, CH), 4.79

(s, 2H, CH2Ar), 4.88 (s, 2H, CH2CO2H), 6.92 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 6.97 (d, J = 8.1

Hz, 2H, 2 CH (Ar)), 7.45-7.51 (m, 2H, 2 CH (Ar)), 7.99-8.08 (m, 2H, 2 CH (Ar)), 8.10 (s, 1H,

CH (H-8)); LRMS (MS-ES), calcd for C31H33N6O7 [M-H] m/z = 601.25, fnd. 601.42.

217

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(4-nitrophenoxy)-9H-purin-9-

yl)acetic acid (3.6bo). Purine 3.5bo was treated according to general procedure E, to yield

product 3.6bo as a white solid (83 %): m.p. > 126 °C (dec); IR (KBr, cm-1

) 3550, 3474, 3415,

2924, 2853, 1747, 1638, 1617, 1576, 1524, 1486, 1457; δH (400 MHz, CDCl3) 1.19-1.28 (m, 5H,

(cyclohexyl)), 1.35 (s, 9H, C(CH3)3), 1.7-1.83 (m, 5H, (cyclohexyl)), 2.40-2.49 (m, 1H, CH),

4.91 (s, 2H, CH2Ar), 5.02 (s, 2H, CH2CO2H), 6.95-7.12 (m, 4H, 4 CH (Ar)), 7.34-7.41 (m, 2H, 2

CH (Ar)), 8.02 (s, 1H, CH (H-8)), 8.17-8.22 (m, 2H, 2 CH (Ar)); LRMS (MS-ES), calcd for

C31H33N6O7 [M-H] m/z = 601.25, fnd. 601.31.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-((4-fluorophenyl)amino)-9H-

purin-9-yl)acetic acid (3.6bp). Purine 3.5bp was treated according to general procedure E, to

yield product 3.6bp as a white solid (92 %): m.p. > 124 °C (dec); IR (KBr, cm-1

) 3549, 3475,

3415, 3238, 2925, 1710, 1638, 1617, 1509, 1474, 1449, 1408; δH (400 MHz, CDCl3) 1.22-1.42

(m, 14H, 5H (cyclohexyl) and C(CH3)3), 1.67-1.85 (m, 5H (cyclohexyl)), 2.40-2.45 (m, 1H, CH),

4.99 (s, 2H, CH2Ar), 5.10 (s, 2H, CH2CO2H), 6.88-6.92 (m, 2H, 2 CH (Ar)), 7.10 (d, J = 8.1 Hz,

2H, 2 CH (Ar)), 7.25 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.68-7.72 (m, 2H, 2 CH (Ar)), 7.95 (s, 1H,

CH (H-8)); LRMS (MS-ES), calcd for C31H34FN6O4 [M-H] m/z = 573.27, fnd. 573.37.

218

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)amino)-9H-

purin-9-yl)acetic acid (3.6bq). Purine 3.5bq was treated according to general procedure E, to

yield product 3.6bq as a white solid (91 %): m.p. > 132 (dec) °C; IR (KBr, cm-1

) 2920, 2850,

1744, 1701, 1478, 1445, 1391, 1366, 1301, 1241, 1209, 1161, 1109; δH (400 MHz, CDCl3) 1.19-

1.38 (m, 5H, 5H (cyclohexyl)), 1.40 (s, 9H, C(CH3)3), 1.79-1.81 (m, 5H (cyclohexyl)), 2.39-2.45

(m, 1H, CH), 4.73 (bs, 2H, CH2 (furfuryl)), 4.85 (s, 2H, CH2Ar), 5.06 (s, 2H, CH2CO2H), 6.16-

6.17 (m, 1H, CH (furfuryl)), 6.26 (bs, 1H, NH), 6.26-6.27 (m, 1H, CH (furfuryl)), 7.07 (d, J =

7.5 Hz, 2H, 2 CH (Ar)), 7.29 (d, J = 8.2 Hz, 2H, 2 CH (Ar)), 7.30-7.31 (m, 1H, CH (furfuryl)),

7.76 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C30H35FN6O5 [M-H] m/z = 559.27, fnd.

559.36.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(propylamino)-9H-purin-9-

yl)acetic (3.6bs). Purine 3.5bs was treated according to general procedure E, to yield product

3.6bs as a white solid (89 %): m.p. > 68°C (dec); IR (KBr, cm-1

) 3412, 2926, 2852, 1515, 1482,

1448, 1381, 1244, 1156; δH (400 MHz, CDCl3) 0.91 (t, J = 7.3 Hz, 3H, NHCH2CH2CH3), 1.21

(s, 9H, C(CH3)3), 1.28-1.43 (m, 5H (cyclohexyl)), 1.59 (m, 2H, NHCH2CH2CH3), 1.7-1.83 (m,

5H (cyclohexyl)), 2.40-2.46 (m, 1H, CH), 3.42 (bs, 2H, NHCH2CH2CH3), 4.81 (s, 2H, CH2Ar),

5.00 (s, 2H, CH2CO2H), 6.12 (bs, 1H, NH), 7.08 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.23 (d, J = 8.1

Hz, 2H, 2 CH (Ar)), 7.67 (s, 1H, CH, (H-8)); LRMS (MS-ES), calcd for C28H37N6O4 [M-H] m/z

219

= 521.30, fnd. 521.42.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(hexylamino)-9H-purin-9-

yl)acetic acid (3.6bt). Purine 3.5bt was treated according to general procedure E, to yield

product 3.6bt as a white solid (85 %): m.p. > 122 °C (dec); IR (KBr, cm-1

) 3414, 2956, 2926,

2853, 1707, 1619, 1514, 1449, 1389, 1242; δH (400 MHz, CDCl3) 0.88 (t, J = 7.2 Hz, 3H,

NH(CH2)5CH3), 1.11-1.23 (m, 11H, 5H (cyclohexyl), 6H, NH(CH2)2CH2CH2CH2CH3), 1.25 (s,

9H, C(CH3)3), 1.53-1.76 (m, 7H, 5H, (cyclohexyl) and NH(CH2)4CH2CH3)), 2.36-2.47 (m, 1H,

CH), 3.40 (bs, 2H, NHCH2(CH2)4CH3), 4.53-4.75 (m, 2H, CH2Ar), 4.95 (s, 2H, CH2CO2H),

7.03-7.23 (m, 4H, 4 CH (Ar)), 7.58 (bs, 1H, NH),7.73 (s, 1H, CH, (H-8)); LRMS (MS-ES), calcd

for C31H43N6O4 [M-H] m/z = 563.34, fnd. 563.43.

2-(6-(3-bromophenoxy)-2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-9H-purin-9-

yl)acetic acid (3.6bu). Purine 3.5bu was treated according to general procedure E, to yield

product 3.6bu as a white solid (84 %): m.p. > 127 °C (dec); IR (KBr, cm-1

) 3550, 3478, 3415,

2924, 2851, 1721, 1709, 1626, 1602, 1577, 1515, 1473; δH (400 MHz, CDCl3) 1.10-1.33 (m, 5H,

(cyclohexyl)), 1.37 (s, 9H, C(CH3)3), 1.67-1.85 (m, 5H, (cyclohexyl)), 2.37-2.47 (m, 1H, CH),

4.90 (s, 2H, CH2, (Ar)), 4.99 (s, 2H, CH2CO2H), 6.98-7.07 (m, 4H, 4 CH (Ar)), 7.12-7.17 (m,

220

1H, CH (Ar)), 7.23 (t, J = 8.1 Hz, 1H, CH (Ar)), 7.36-7.40 (m, 1H, CH (Ar)), 7.45 (t, J = 2.0

Hz, 1H, CH (Ar)), 8.13 (s, 1H, CH, (H-8)); LRMS (MS-ES), calcd for C31H33BrN5O5 [M-H] m/z

= 634.17, fnd. 634.33.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(4-fluorophenoxy)-9H-purin-9-

yl)acetic acid (3.6bv). Purine 3.5bv was treated according to general procedure E, to yield

product 3.6bv as a white solid (86 %): m.p. = 119-133 °C; IR (KBr, cm-1

) 3550, 3475, 3415,

3236, 2924, 2852, 1707, 1619, 1587, 1503, 1449, 1393; δH (400 MHz, CDCl3) 1.11-1.34 (m, 5H,


4.87 (s, 2H, CH2Ar), 4.99 (s, 2H, CH2CO2H), 6.97-7.04 (m, 6H, 6 CH (Ar)), 7.12-7.15 (m, 2H,

2 CH (Ar)), 8.11 (s, 1H, CH, (H-8)); LRMS (MS-ES), calcd for C31H33FN5O5 [M-H] m/z =

574.25, fnd. 574.36.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(perfluorophenoxy)-9H-purin-9-

yl)acetic acid (3.6bw). Purine 3.5bw was treated according to general procedure E, to yield

221

product 3.6bw as a white solid (79 %): m.p. > 94.1–104 °C; IR (KBr, cm-1

) 3414, 2927, 2852,

1743, 1669, 1637, 1618, 1581, 1522, 1452, 1409, 1380; δH (400 MHz, CDCl3) 1.18-1.28 (m, 5H


4.85 (s, 2H, CH2Ar), 5.06 (s, 2H, CH2CO2H) 6.93 (d, J = 8.2 Hz, 2H, 2 CH (Ar)), 7.03 (d, J =

8.1Hz, 2H, 2 CH (Ar)), 8.16 (s, 1H, CH, (H-8)); LRMS (MS-ES), calcd for C31H29F5N5O5 [M-H]

m/z = 646.22, fnd.646.35.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-phenoxy-9H-purin-9-yl)acetic

acid (3.6bx). Purine 3.5bx was treated according to general procedure E, to yield product 3.6bx

as a white solid (83 %): m.p. > 129 °C (dec); IR (KBr, cm-1

) 3549, 3477, 3414, 2923, 2851,

1741, 1618, 1578, 1491, 1446, 1391, 1367; δH (400 MHz, CDCl3) 1.11-1.34 (m, 5H,


4.87 (s, 2H, CH2Ar), 4.99 (s, 2H, CH2CO2H), 6.96-7.02 (m, 4H, 4 CH (Ar)), 7.16-7.26 (m, 3H, 3

CH (Ar)), 7.35-7.40 (m, 2H, 2 CH (Ar)), 8.04 (s, 1H, CH, (H-8)); LRMS (MS-ES), calcd for

C31H34N5O5 [M-H] m/z = 556.26, fnd. 556.34.

222

2-(6-(benzylamino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7aa). Purine 3.6aa was

treated according to general procedure F, to yield final product 3.7aa as an off-white lyophilized

powder (85 %): m.p. > 81 °C (dec); IR (KBr, cm-1

) 3504, 3281, 2934, 2485, 1351, 1184; δH

(400 MHz, DMSO-d6) 0.84 (m, 3H, (CH2)4CH3), 1.19-1.34 (m, 4H, (CH2)2CH2CH2CH3), 1.42-

1.54 (m, 2H, CH2CH2(CH2)2CH3), 3.26 (t, J = 6.9 Hz, 2H, CH2(CH2)3CH3), 4.67 (bs, 2H,

CH2Ar), 4.89 (s, 2H, CH2CO2H), 7.22-7.37 (m, 5H, CH (Ar)), 7.31 (bs, 1H, NH), 7.93 (s, 1H, ,

CH (H-8)), 8.89 (bs, 1H, NH); δC (100 MHz, DMSO-d6) 13.7, 21.7, 28.4, 40.4, 41.1, 44.2, 47.3,

112.4, 126.4, 127.2, 127.3, 128.3, 137.1, 138.5, 154.2, 158.8, 169.4; HRMS (MS- ES), calcd for

C19H25N6O2 [M+H] m/z = 369.2035, fnd. 369.2033; rpHPLC tR: condition (I) 13.814 (II) 33.928

minutes, purity 97.58 %and 96.7%.

2-(6-(benzyl(methyl)amino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7ab). Purine 3.6ab

was treated according to general procedure F, to yield final product 3.7ab as a white lyophilized

powder (83 %): m.p. = 134-142 °C; IR (KBr, cm-1

) 3466, 3080, 1937, 1419, 1246, 1203, 1140;

δH (400 MHz, DMSO-d6) 0.82-0.87 (m, 3H, (CH2)4CH3), 1.12-1.30 (m, 4H,

CH2CH2CH2CH2CH3), 1.49-1.53 (m, 2H, CH2CH2CH2CH2CH3), 3.04-3.67 (m, 3H, NCH3),

3.23-3.31 (m, 2H, CH2(CH2)3CH3), 4.67-5.59 (bm, 2H, CH2Ar), 4.87 (s, 2H, CH2CO2H),

223

7.22(bs, 1H, NH), 7.24-7.35 (m, 5H, CH (Ar)), 7.83 (s, 1H, CH (H-8)); δC (100 MHz, DMSO-d6)

13.8, 21.8, 27.8, 28.6, 40.3, 41.0, 44.3, 47.4, 112.5, 126.8, 127.1, 127.2, 128.3, 137.0, 138.5,

154.1, 158.5, 169.1; HRMS (MS- ES), calcd for C20H27N6O2 [M+H] m/z = 383.2177, fnd.


2-(2-(pentylamino)-6-(phenylamino)-9H-purin-9-yl)acetic acid (3.7ac). Purine 3.6ac was

treated according to general procedure F, to yield final product 3.7ac as a white lyophilized


) 3071, 2962, 2934, 1736, 1554, 1439, 1359,

1245, 1186, 1142; δH (400 MHz, DMSO-d6) 0.87 (t, J = 7.0 Hz, 3H, (CH2)4CH3), 1.22-1.32 (m,

4H, (CH2)2CH2CH2CH3), 1.52-1.59 (m, 2H, (CH2)3CH2CH3), 3.27 (t, J = 7.2 Hz, 2H,

CH2(CH2)3CH3), 4.85 (s, 2H, CH2CO2H), 6.95 (bs, 1H, NHCH2), 7.01 (t, J = 7.3 Hz, 1H, CH

(Ar)), 7.29 (t, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.93 (s, 1H, CH (H-8)), 7.97(d, J = 7.7Hz, 2H, 2 CH

(Ar)), 9.64 (bs, 1H, ArNH); δC (100 MHz, DMSO-d6) 13.9, 21.8, 28.7, 28.3, 41.7, 43.8, 116.6,

120.4, 122.4, 128.1, 139.5, 142.3, 150.6, 151.5, 153.7, 154.7, 169.1; HRMS (MS- ES), calcd for



2-(6-((furan-2-ylmethyl)(methyl)amino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7ad).

Purine 3.6ad was treated according to general procedure F, to yield final product 3.7ad as a

white lyophilized powder (78 %): m.p. > 164 °C (dec); IR (KBr, cm-1

) 3631, 2925, 1561, 1456,

1384, 1313, 1147; δH (400 MHz, DMSO-d6) (0.85, t, J = 6.9 Hz, 3H, (CH2)4CH3), 1.22-1.30 (m,

224

4H, (CH2)2CH2CH2CH3), 1.50 (p, J = 7.1 Hz, 2H, CH2CH2(CH2)2CH3), 3.21 (q, J = 6.7 Hz, 2H,

CH2(CH2)3CH3), 3.32 (vbs, 3H, NCH3), 4.55 (s, 2H, CH2CO2H), 5.26 (vbs, 2H, CH2(furfuryl)),

6.27-6.29 (m, 1H, CH (furfuryl)), 6.33 (bs, 1H, NH), 6.37-6.39 (m, 1H, CH (furfuryl)), 7.55-7.57

(m, 1H, CH (furfuryl)), 7.66 (s, 1H, CH (H-8)); δC (100 MHz, DMSO-d6) 13.9, 21.9, 22.5, 25.3,

28.8, 29.1, 37.7, 38.4, 41.0, 43.6, 112.5, 137.4, 151.0, 154.6, 159.4, 169.7; HRMS (MS-ES),

calcd for C18H25N6O3 [M+H] m/z = 373.1994, fnd. 373.1982; rpHPLC tR: condition (I) 14.074

(II) 33.425 minutes, purity 99.3 %and 94.0%.

2-(6-(cyclopentylamino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7ae). Purine 3.6ae was

treated according to general procedure F, to yield final product 3.7ae as a white lyophilized


) 3233, 3071, 2962, 2934, 1736, 1648, 1554,

1439, 1359, 1245, 1186, 1142; δH (400 MHz, DMSO-d6) 0.87 (t, J = 6.8 Hz, 3H, (CH2)4CH3),

m, 4H, (CH2)2CH2CH2CH3), 1.50-1.77 (m, 8H, CH2CH2(CH2)2CH3 and 3 CH2

(cyclopentyl)), 1.92-2.04 (m, 2H, CH2 (cyclopentyl)), 3.27-3.33 (m, 2H, CH2(CH2)3CH3), 4.35

(vbs, 1H, CH (cyclopentyl)), 4.88 (s, 2H, CH2CO2H), 7.30 (vbs, 1H, NH), 7.96 (bs, 1H, NH),

8.32 (s, 1H, CH (H-8)), 13.34 (vbs, 1H, CH2CO2H); δC (100 MHz, DMSO-d6) 14.2, 22.1, 22.5,

23.3, 25.4, 27.5, 28.9, 29.3, 38.5, 41.1, 43.8, 112.6, 137.8, 153.3, 154.9, 159.2, 169.3; HRMS

(MS-ES), calcd for C17H27N6O2 [M+H] m/z = 347.2192, fnd. 347.2190; rpHPLC tR: condition (I)

14.582 (II) 34.685 minutes, purity 90.1 %and 97.6%.

225

2-(6-(cyclohexylamino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7af). Purine 3.6af was

treated according to general procedure F, to yield final product 3.7af as a white lyophilized


) 2929, 2857, 1736, 1439, 1391, 1246, 1194,


(CH2)2CH2CH2CH3 and 3 CH2(cyclohexyl)), 1.53 (p, J = 6.8 Hz, 2H, CH2CH2(CH2)2CH3), 1.71-

1.79 (m, 2H, CH2 (cyclohexyl)), 1.84-1.99 (m, 2H, CH2 (cyclohexyl)), 3.26 (t, J = 6.6, 2H,

CH2(CH2)3CH3), 3.95 (bs, 1H, CH (cyclohexyl)), 4.84 (s, 2H, CH2CO2H), 7.07 (vbs, 1H, NH),

7.86 (bs, 1H, NH), 8.32 (1H, s, CH (H-8)); HRMS (MS-ES), calcd for C18H29N6O2 [M+H] m/z =

361.2356, fnd. 361.2346; rpHPLC tR: condition (I) 14.966 (II) 37.235 minutes, purity 94.7% and

91.5%.

2-(6-(ethyl(methyl)amino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7ag). Purine 3.6ag

was treated according to general procedure F, to yield final product 3.7ag as a white lyophilized


)3626, 2958, 2931, 1385, 1326, 1183, 1057;

δH (400 MHz, DMSO-d6) 0.85 (t, J = 6.9 Hz, 3H, (CH2)4CH3), 1.13 (t, 7.0 Hz, 3H, NCH2CH3),

1.22-1.33 (m, 4H, (CH2)2CH2CH2CH3), 1.49 (p, J = 7.0 Hz, 2H, CH2CH2(CH2)2CH3), 3.20 (q, J

= 6.7 Hz, 2H, CH2(CH2)3CH3), .30 (vbs, 3H, NCH3vbs, 2H, NCH2CH3), 4.59 (s, 2H,

CH2CO2H), 6.26 (bs, 1H, NH), 7.63 (s, 1H, CH (H-8)); HRMS (MS-ES), calcd for C15H25N6O2


purity 99.7 %and 99.5%.

226

2-(6-(isopropylamino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7ah). Purine 3.6ah was

treated according to general procedure F, to yield final product 3.7ah as a white lyophilized

powder (73 %): m.p. = 173–176 °C; (KBr, cm-1

)3685, 3653, 2926, 2857, 1581, 1420, 1383,

1304, 1202; δH (400 MHz, DMSO-d6) 0.86 (t, J = 6.7 Hz, 3H, (CH2)4CH3), 1.20 (s, 3H,

CH(CH3)2), 1.22 (s, 3H, CH(CH3)2), 1.25-1.34 (m, 4H, (CH2)2CH2CH2CH3), 1.51 (p, J = 6.8 Hz,

2H, CH2CH2(CH2)2CH3), 3.22-3.28 (m, 2H, CH2(CH2)3CH3), 4.35 (bs, 1H, CH(CH3)2), 4.79 (s,

2H, CH2CO2H), 6.65 (bs, 1H, NH), 7.40 (bs, 1H, NH), 7.75 (s, 1H, CH (H-8)) 13.15 (vbs, 1H

CH2CO2H); HRMS (MS-ES), calcd for C15H25N6O2 [M+H] m/z = 321.2039, fnd. 321.2033;

rpHPLC tR: condition (I) 13.698 (II) 30.922 minutes, purity 94.6 %and 91.0%.

2-(6-(allylamino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7ai). Purine 3.6ai was treated

according to general procedure F, to yield final product 3.7ai as a white lyophilized powder (76

%): m.p. > 153 °C (dec); IR (KBr, cm-1

)3855, 3630, 1523, 1384, 1142; δH (400 MHz, DMSO-d6)

0.85 (t, J = 6.9, 3H, (CH2)4CH3), 1.22-1.33 (m, 4H, (CH2)2CH2CH2CH3), 1.49 (p, J = 7.0 Hz, 2H,

CH2CH2(CH2)2CH3), 3.20 (q, J = 6.6 Hz, 2H, CH2(CH2)3CH3), 4.07 (bs, 2H, CH2CHCH2), 4.47

(s, 2H, CH2CO2H), 5.02 (dd, 1H, J = 10.3 Hz and 1.7 Hz, CH2CHCH2 ), 5.14 (dd, 1H, J = 17.2

Hz and 1.8 Hz, CH2CHCH2), 5.88-5.99 (m, 1H, CH2CHCH2), 6.20 (bs, 1H, NH), 7.24 (bs, 1H,

NH), 7.59 (s, 1H, CH (H-8)); δC (100 MHz, DMSO-d6) 14.0, 21.9, 28.8, 29.0, 41.0, 45.0, 45.1,

112.5, 114.6, 136.4, 138.1, 144.5, 154.3, 159.2, 170.6; HRMS (MS-ES), calcd for C15H23N6O2


purity 95.07 %and 90.4%.

227

2-(6-(isobutylamino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7aj). Purine 3.6aj was

treated according to general procedure F, to yield final product 3.7aj as a white lyophilized

powder (75 %): m.p. = 139.1-147.8 °C; IR (KBr, cm-1

) 2956, 2926, 2854, 1467, 1385, 1246,

1186, 1142; δH (400 MHz, DMSO-d6) 0.81-0.86 (m, 3H, (CH2)4CH3), 0.87-0.92 (m, 6H,

CH(CH3)2), 1.13-1.31 (m, 4H, (CH2)2CH2CH2CH3), 1.52 (p, J = 7.1 Hz, 2H,

CH2CH2(CH2)2CH3), 1.89-1.98 (m, 1H, CH(CH3)2), 3.23-3.31 (m, 4H, CH2(CH2)3CH3 and

CH2CH(CH3)2), 4.76 (s, 2H, CH2CO2H), 7.63 (bs, 1H, NH), 7.90 (s, 2H, CH (H-8) and NH);

HRMS (MS-ES), calcd for C16H27N6O2 [M+H] m/z = 335.2201, fnd. 335.2190; rpHPLC tR:

condition (I) 14.357 (II) 22.765 minutes, purity 93.9 %and 93.5%.

2-(6-(butyl(methyl)amino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7ak). Purine 3.6ak

was treated according to general procedure F, to yield final product 3.7ak as a white lyophilized


) 2959, 2931, 2859, 1561, 1459, 1396, 1324,

1203, 1137; δH (400 MHz, DMSO-d6) 0.87 (t, J = 6.7 Hz, 3H, (CH2)4CH3), 0.91 (t, 3H, J = 7.3

Hz, (CH2)3CH3), 1.22-1.36 (m, 6H, CH2CH2CH2CH3 and (CH2)2CH2CH2CH3), 1.53 (p, J = 6.9

Hz, 2H, CH2CH2(CH2)2CH3), 1.61 (p, 2H, CH2CH2CH2CH3), 3.23-4.17 (bm, 5H, CH2(CH2)2CH3

and NCH3), 3.27 (t, J =7.3 Hz, 2H, CH2CH2(CH2)2CH3), 4.84 (s, 2H, CH2CO2H), 6.90 (vbs, 1H,

NH), 7.80 (s, 1H, CH (H-8)); HRMS (MS-ES), calcd for C17H29N6O2 [M+H] m/z = 349.2342,

fnd. 349.2346; rpHPLC tR: condition (I) 14.902 (II) 36.830 minutes, purity 97.8 %and 95.8%.

228

2-(6-(isopentylamino)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7al). Purine 3.6al was

treated according to general procedure F, to yield final product 3.7al as a white lyophilized


) 2956, 2928, 2858, 1578, 1470, 1431, 1409,

1367, 1306, 1224; δH (400 MHz, DMSO-d6) 0.79-0.86 (m, 3H, (CH2)4CH3), 0.87 (s, 3H,

(CH2)2CH(CH3)2), 0.89 (s, 3H, (CH2)2CH(CH3)2), 1.10-1.30 (m, 4H, (CH2)2CH2CH2CH3), 1.45-

1.55 (m, 4H, CH2CH2(CH2)2CH3 and CH2CH2CH(CH3)2), 1.59-1.67 (m, 1H,

CH2CH2CH(CH3)2), 3.25-3.33 (m, 2H, CH2(CH2)3CH3), 3.41-3.53 (m, 2H, CH2(CH2)3CH3), 4.77

(s, 2H, CH2CO2H), 7.63 (bs, 1H, NH), 7.86 (s, 1H, CH (H-8)), 7.87 (bs, 1H, NH); δC (100 MHz,

DMSO-d6) 13.9, 21.9, 22.5, 25.3, 28.8, 29.1, 41.0, 43.6, 112.5, 131.0, 137.4, 154.6, 159.4, 169.7;

HRMS (MS-ES), calcd for C17H29N6O2 [M+H] m/z = 349.2339, fnd. 349.2346; rpHPLC tR:

condition (I) 14.864 (II) 36.430 minutes, purity 90.3% and 96.1%.

2-(6-morpholino-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7am). Purine 3.6am was

treated according to general procedure F, to yield final product 3.7am as a white lyophilized


) 2956, 2926, 2855, 1444, 1384, 1120; δH

(400 MHz, DMSO-d6) 0.85 (t, J = 6.9 Hz, 3H, (CH2)4CH3), 1.22-1.31 (m, 4H,

(CH2)2CH2CH2CH3), 1.49 (p, J = 6.9 Hz, 2H, CH2CH2(CH2)2CH3), 3.2 (m, 2H,

CH2(CH2)3CH3), 3.63-3.76 (m, 4H, 2 CH2 (morpholine)), 4.11 (bs, 4H, 2 CH2 (morpholine)),

4.69 (s, 2H, CH2CO2H), 6.40 (bs, 1H, NH), 7.69 (s, 1H, CH (H-8)); δC (100 MHz, DMSO-d6)

229

13.9, 21.9, 28.7, 28.8, 40.9, 43.9, 44.9, 66.2, 112.7, 137.4, 153.3, 153.4, 158.7, 169.7; HRMS

(MS-ES), calcd for C16H26N6O3[M+H] m/z = 349.1982, fnd. 349.1974; rpHPLC tR: condition (I)


2-(6-(3-nitrophenoxy)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7an). Purine 3.6an was

treated according to general procedure F, to yield final product 3.7an as a white lyophilized


) 3550, 3407, 3336, 2958, 1352, 1200; δH

(400 MHz, DMSO-d6) 0.73-0.79 (m, 3H, (CH2)4CH3), 0.96-1.42 (m, 6H, CH2CH2CH2CH2CH3),

2.84-3.10 (m, 2H, CH2(CH2)3CH3), 4.87 (s, 2H, CH2CO2H), 7.14 (bm, 1H, NH), 7.75 (t, J = 8.1

Hz, 1H, CH (Ar)), 7.78-7.81 (m, 1H, CH (Ar)), 8.00 (s, 1H, CH (H-8)), 8.14-8.20 (m, 2H, 2 CH

(Ar)); δC (100 MHz, DMSO-d6) 13.8, 21.7, 28.2, 28.5, 41.0, 43.8, 112.7, 117.3, 120.1, 128.9,



purity 92.67 %and 92.5%.

2-(6-(4-nitrophenoxy)-2-(pentylamino)-9H-purin-9-yl)acetic acid (3.7ao). Purine 3.6ao was

treated according to general procedure F, to yield final product 3.7ao as a white lyophilized


) 3571, 3100, 2921, 1582, 1342, 1254; δH

(400 MHz, DMSO-d6) 0.78-0.86 (m, 3H, (CH2)4CH3), 1.00-1.44 (m, 6H, CH2CH2CH2CH2CH3),

230

2.87-2.92 (m, 2H, CH2(CH2)3CH3), 4.88 (s, 2H, CH2CO2H), 7.15 (bs, 1H, NH), 7.57 (d, J = 9.2

Hz, 2H, 2 CH (Ar)), 8.01 (s, 1H, CH (H-8)), 8.31 (d, J = 9.2 Hz, 2H, 2 CH (Ar)); δC (100 MHz,

DMSO-d6) 13.8, 21.7, 28.6, 41.0, 43.7, 43.8, 52.4, 112.9, 122.8, 125.1, 141.7, 144.3, 155.9,

157.8, 158.4, 158.6, 169.2; HRMS (MS- ES), calcd for C18H21N6O5 [M+H] m/z = 401.1577, fnd.

401.1567; rpHPLC tR: condition (I) 13.586 (II) 30.762 minutes, purity 97.1 % and 95.7%.

2-(6-(benzylamino)-2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-9H-purin-9-

yl)acetic acid (3.7ba). Purine 3.6ba was treated according to general procedure F, to yield final

product 3.7ba as a white lyophilized powder (79 %): m.p. > 182 °C (dec); IR (KBr, cm-1

) 3548,

3475, 3414, 2925, 2852, 1733, 1642, 1618, 1425, 1394, 1345, 1244; δH (400 MHz, DMSO-d6)

1.28-1.38 (m, 5H (cyclohexyl)), 1.67-1.78 (m, 5H (cyclohexyl)), 2.42-2.45 (m, 1H, CH), 4.44 (s,

2H, HNCH2), 4.63 (bs, 2H, CH2Ar), 4.88 (s, 2H, CH2CO2H), 7.10-7.29 (m, 9H, 9 CH (Ar)), 7.63

(bs, 1H, NHAr), 7.94 (s, 1H, CH (H-8)), 8.70 (bs, 1H, NHAr); HRMS (MS-ES), calcd for


minutes, purity 98.0 % and 90.1%.

2-(6-(benzyl(methyl)amino)-2-((4-cyclohexylbenzyl)amino)-9H-purin-9-yl)acetic acid

(3.7bb). Purine 3.6bb was treated according to general procedure F, to yield final product 3.7bb

as a white lyophilized powder (82 %): m.p. > 133 °C (dec); IR (KBr, cm-1

) 3318, 2925, 2852,

1735, 1655, 1625, 1558, 1421, 1244, 1199; δH (400 MHz, DMSO-d6) 1.29-1.42 (m, 5H,

(cyclohexyl)), 1.67-1.77 (m, 5H (cyclohexyl)), 2.40-2.45 (m, 1H, CH), 2.97-3.71 (bm, 3H,

NCH3), 4.43 (s, 2H, CH2Ar), 4.77-5.63 (bm, 2H, CH3NCH2), 4.87 (bs, 2H, CH2CO2H), 7.09-

231

7.30 (m, 9H, 9 CH (Ar)), 7.47 (bs, 1H, NH), 7.82 (s, 1H, CH (H-8)); δC (100 MHz, DMSO-d6)

13.4, 21.8, 28.2, 40.7, 44.4, 53.1, 108.1, 110.7, 112.9, 127.7, 137.8, 145.7, 151.3, 153.4, 153.6,


tR: condition (I) 18.496 (II) 44.040 minutes, purity 92.6 %and 90.89%.

2-(2-((4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)(methyl)amino)-9H-purin-9-

yl)acetic acid (3.7bd). Purine 3.6bc was treated according to general procedure F, to yield final

product 3.7bc as a white lyophilized powder (84 %): m.p. > 74 °C (dec); IR (KBr, cm-1

) 2925,

2851, 1661, 1555, 1402, 1320, 1201, 1138; δH (400 MHz, DMSO-d6) 1.29-1.40 (m, 5H, 5H

(cyclohexyl)), 1.67-1.77 (m, 5H (cyclohexyl)), 2.40-2.45 (m, 1H, CH), 2.98-3.57(bm, 3H, CH3

(furfuryl)), 4.24 (bm, 2H, CH2 (furfuryl)), 4.43 (s, 2H, CH2Ar), 4.84 (s, 2H, CH2CO2H), 6.21-

6.40 (m, 2H, 2 CH (furfuryl)), 7.11 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.24 (d, J = 7.9 Hz, 2H, 2

CH (Ar)), 7.20 (bs, 1H, NH), 7.54-7.60 (m, 1H, CH (furfuryl)), 7.80 (s, 1H, CH (H-8)); δc

(100 MHz, DMSO-d6) 25.5, 26.3, 33.9, 41.7, 43.4, 43.9, 44.2, 53.5, 108.0, 110.3, 112.8, 126.2,

127.4, 137.6, 138.1, 142.5, 145.7, 151.3, 153.6, 153.6, 169.3; HRMS (MS-ES), calcd for



232

2-(2-((4-cyclohexylbenzyl)amino)-6-(cyclopentylamino)-9H-purin-9-yl)acetic acid (3.7be).

Purine 3.6be was treated according to general procedure F, to yield final product 3.7be as a


) 3855, 3508, 3294, 2928,

1388, 1202; δH (400 MHz, DMSO-d6) 1.28-1.41 (m, 5H, (cyclohexyl)), 1.47-1.59 (m, 4H

(cyclopentyl)), 1.65-1.93 (m, 9H, 5H (cyclohexyl) and 4H (cyclopentyl)), 2.40-2.45 (m, 1H,

CH), 4.37 (bs, 1H, NCH), 4.41 (bs, 2H, CH2Ar), 4.81(s, 2H, CH2CO2H), 7.11 (d, J = 7.9 Hz, 2H,

2 CH (Ar)), 7.22 (bs, 1H, NH), 7.24 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.56 (bs, 1H, NH), 7.78 (bs,

1H, CH (H-8)); HRMS (MS-ES), calcd for C25H33N6O2 [M+H] m/z = 449.2680, fnd. 449.2659;


2-(6-(cyclohexylamino)-2-((4-cyclohexylbenzyl)amino)-9H-purin-9-yl)acetic acid (3.78bf).

Purine 3.6bf was treated according to general procedure F, to yield final product 3.7bf as a white

lyophilized powder (88 %): m.p. = 172-179°C; IR (KBr, cm-1

) 2927, 2854, 1448, 1388, 1201,

1142; δH (400 MHz, DMSO-d6) 1.13-1.38 (m, 10H, 5H (cyclohexyl) and 5H (NH-cyclohexyl)),

1.56-1.81 (m, 10H, 5H (cyclohexyl) and 5H (NH-cyclohexyl)), 2.38-2.48 (m, 1H, CH), 3.89 (bs,

1H, HNCH), 4.44 (s, 2H, CH2Ar), 4.89 (s, 2H, CH2CO2H), 7.14 (d, J = 7.7 Hz, 2H, 2 CH (Ar)),

7.26 (d, J = 7.7 Hz, 2H, 2 CH (Ar)), 7.75 (bs, 1H, NH), 7.99 (s, 1H, CH (H-8)); HRMS (MS-

ES), calcd for C26H35N6O2 [M+H] m/z = 463.2819, fnd. 463.2816; rpHPLC tR: condition (I)


233

2-(6-(allylamino)-2-((4-cyclohexylbenzyl)amino)-9H-purin-9-yl)acetic acid (3.7bi). Purine

3.6bi was treated according to general procedure F, to yield final product 3.7bi as a white

lyophilized powder (81 %): m.p. > 170 °C (dec); IR (KBr, cm-1

)3550, 3477, 3414, 2924, 2852,

1638, 1618, 1385, 1201; δH (400 MHz, DMSO-d6) 1.27-1.44 (m, 5H (cyclohexyl)), 1.62-1.81

(m, 5H (cyclohexyl)), 2.38-2.48 (m, 1H, CH), 4.04 (bs, 2 H, CH2CHCH2), 4.43 (s, 2H, CH2Ar),

4.84 (s, 2H, CH2CO2H), 5.05 (dd, J = 10.1 and 1.5 Hz, 1H, CH2CHCH2), 5.14 (dd, J = 17.1 and

1.5 Hz, 1H, CH2CHCH2), 5.81-5.97 (m, 1H, CH2CHCH2), 7.12 (d, J = 8.1 Hz, 2H, 2 CH (Ar)),

7.25 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.36 (bs, 1H, NH), 7.85 (s, 1H, CH (H-8)), 8.04 (bs, 1H,

NH); HRMS (MS-ES), calcd for C23H29N6O2 [M+H] m/z = 421.2349, fnd. 421.2346; rpHPLC


2-(2-((4-cyclohexylbenzyl)amino)-6-(isobutylamino)-9H-purin-9-yl)acetic acid (3.7bj).

Purine 3.6bj was treated according to general procedure F, to yield final product 3.7bj as a white


) 3549, 3477, 3414, 2920, 1744,

1620, 1449, 1404, 1387, 1367, 1248, 1206; δH (400 MHz, DMSO-d6) 0.81 (s, 3H,

CH2CH(CH3)2), 0.83 (s, 3H, CH2CH(CH3)2), 1.26-1.42 (m, 5H, (cyclohexyl)), 1.62-1.80 (m, 5H,

(cyclohexyl)), 1.79-1.92 (m, 1H, CH2CH(CH3)2) 2.33-2.46 (m, 1H, CH), 3.16 (bs, 2H,

CH2CH(CH3)2), 4.30-4.43 (m, 2H, CH2Ar), 4.69 (s, 2H, CH2CO2H), 6.90 (bs, 1H, NH), 7.1 (d, J

= 7.9 Hz, 2H, 2 CH (Ar)), 7.23 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.27 (bs, 1H, NH), 7.64 (s, 1H,

CH (H-8)); δC (100 MHz, DMSO-d6) 20.1, 25.5, 26.3, 34.0, 43.4, 43.8, 44.3, 46.9, 112.6, 126.1,

127.3, 137.5, 138.9, 145.4, 151.4, 154.7, 159.1, 169.7; HRMS (MS-ES), calcd for C24H33N6O2

234


purity 96.6 %and 97.8%.


yl)acetic acid (3.7bl). Purine 3.6bl was treated according to general procedure F, to yield final

product 3.7bl as a white lyophilized powder (69 %): m.p. > 153 °C (dec); IR (KBr, cm-1

) 2937,

2851, 1736, 1646, 1528, 1432, 1244, 1201; δH (400 MHz, DMSO-d6) 0.85 (s, 3H,

(CH2)2CH(CH3)2), 0.86 (s, 3H, (CH2)2CH(CH3)2), 1.18-1.60 (m, 8H, 5H (cyclohexyl) and

(CH2)2CH(CH3)2 and CH2CH2CH(CH3)2), 1.67-1.77 (m, 5H, (cyclohexyl)), 2.41-2.47 (m, 1H,

CH), 3.41 (bs, 2H, CH2CH2CH(CH3)2), 4.47 (s, 2H, CH2Ar), 4.88 (s, 2H, CH2CO2H), 7.14 (d, J

= 7.9 Hz, 2H, 2 CH (Ar)), 7.25 (d, J = 7.7 Hz, 2H, 2 CH (Ar)), 7.58 (bs, 1H, NH), 7.91 (s, 1H,

CH (H-8)), 8.32 (bs, 1H, NH); HRMS (MS-ES), calcd for C25H35N6O2 [M+H] m/z = 451.2835,

fnd. 451.2816; rpHPLC tR: condition (I) 17.061 (II) 44.519 minutes, purity 91.9 %and 94.2%.

2-(2-((4-cyclohexylbenzyl)amino)-6-morpholino-9H-purin-9-yl)acetic acid (3.7bm). Purine

3.6bm was treated according to general procedure F, to yield final product 3.7bm as a white


) 3422, 2923, 2851, 1603, 1542,

1516, 1446, 1416, 1384, 1314, 1272, 1242, 1207, 1121, 1003; δH (400 MHz, DMSO-d6) 1.17-

235

1.36 (m, 5H, (cyclohexyl)), 1.66-1.77 (m, 5H, (cyclohexyl)), 2.38-2.45 (m, 1H, CH), 3.63 (t, J =

4.4 Hz, 4H, 2 CH2, (morpholine)), 4.08 (bs, 4H, 2 CH2, (morpholine)), 4.37 (d, J = 5.1 Hz, 2H,

CH2Ar), 4.78 (s, 2H, CH2CO2H), 7.03 (bs, 1H, NH), 7.1 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.23 (d,

J = 7.9 Hz, 2H, 2 CH (Ar)), 7.73 (s, 1H, CH, (H-8)); HRMS (MS-ES), calcd for C24H31N6O3


purity 99.9% and 96.6%.

2-(2-((4-cyclohexylbenzyl)amino)-6-(3-nitrophenoxy)-9H-purin-9-yl)acetic acid (3.7bn).

Purine 3.6bn was treated according to general procedure F, to yield final product 3.7bn as a


) 3434, 2926, 2853, 1587,

1526, 1417, 1352, 1252; δH (400 MHz, DMSO-d6) 1.29-1.37 (m, 5H, (cyclohexyl)), 1.66-1.77

(m, 5H, (cyclohexyl)), 2.35-2.41 (m, 1H, CH), 4.17 (m, 2H, CH2Ar), 4.89 (s, 2H, CH2CO2H),

6.81-7.20 (m, 4H, 3 CH (Ar) and NH), 7.72-7.75 (m, 3H, 3 CH (Ar)), 8.00 (s, 1H, CH, (H-8)),

8.10-8.17 (m, 2H, 2 CH (Ar)); δC (100 MHz, DMSO-d6) 25.5, 26.3, 33.9, 43.4, 43.9, 44.2, 113.0,

117.3, 120.2, 126.0, 127.6, 129.1, 130.7, 137.5, 141.7, 145.7, 148.3, 152.7, 155.8, 158.3, 158.8,


tR: condition (I) 15.558 (II) 40.643, purity 99.7 %and 99.0%.

236

2-(2-((4-cyclohexylbenzyl)amino)-6-(4-nitrophenoxy)-9H-purin-9-yl)acetic acid (3.7bo).

Purine 3.6bo was treated according to general procedure F, to yield final product 3.7bo as a


) 3550, 3413, 2924, 2852,

1724, 1636, 1616, 1581, 1552, 1522, 1488, 1449; δH (400 MHz, DMSO-d6) 1.31-1.39 (m, 5H,

(cyclohexyl)), 1.67-1.78 (m, 5H, (cyclohexyl)), 2.37-2.44 (m, 1H, CH), 4.07-4.36 (m, 2H,

CH2Ar), 4.89 (s, 2H, CH2CO2H), 6.92-7.26 (m, 4H, 4 CH (Ar)), 7.44-7.53 (m, 2H, 2 CH (Ar)),

7.70 (bs, 1H, NH), 8.01 (s, 1H, CH, (H-8)), 8.23-8.28 (m, 2H, 2 CH (Ar)); δC (100 MHz, DMSO-

d6) 25.5, 26.3, 33.9, 43.4, 43.8, 44.2, 113.2, 115.8, 122.6, 125.1, 126.1, 127.4, 127.9, 137.4,

141.9, 144.2, 145.7, 157.6, 158.4, 169.2; HRMS (MS-ES), calcd for C26H27N6O5 [M+H] m/z =

503.2026, fnd. 503.2037; rpHPLC tR: condition (I) 13.824 (II) 41.102 minutes, purity 90.4 %and

90.2%.

2-(2-((4-cyclohexylbenzyl)amino)-6-((4-fluorophenyl)amino)-9H-purin-9-yl)acetic acid

(3.7bp). Purine 3.6bp was treated according to general procedure F, to yield final product 3.7bp

as a white lyophilized powder (91 %): m.p. > 125 °C (dec); IR (KBr, cm-1

) 3429, 3226, 2924,

2851, 1682, 1646, 1509, 1206, 1134; δH (400 MHz, DMSO-d6) 1.31-1.40 (m, 5H, (cyclohexyl)),

1.66-1.76 (m, 5H (cyclohexyl)), 2.40-2.46 (m, 1H, CH), 4.42 (d, J = 6.2 Hz, 2H, CH2Ar), 4.83 (s,

237

2H, CH2CO2H), 6.99-7.04 (m, 2H, 2 CH (Ar)), 7.12 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.24 (d, J =

8.1 Hz, 2H, 2 CH (Ar)), 7.29 (bs, 1H, NHAr), 7.75-7.90 (m, 2H, 2 CH (Ar)), 7.83 (s, 1H, CH

(H-8)), 9.50 (s, 1H, NHAr), 13.21 (bs, 1H, CO2H); δC (100 MHz, DMSO-d6) 25.5, 26.3, 34.0,

41.7, 43.4, 44.3, 113.1, 114.4, 114.6, 121.5, 121.6, 126.2, 136.5, 138.3, 138.6 145.5, 151.8,

156.0, 158.9, 169.5; HRMS (MS-ES), calcd for C26H28N6O2F [M+H] m/z = 475.2266, fnd.


2-(2-((4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)amino)-9H-purin-9-yl)acetic acid

(3.7bq). Purine 3.6bq was treated according to general procedure F, to yield final product 3.7bq

as a white lyophilized powder (88 %): m.p. > 162 (dec) °C; IR (KBr, cm-1

) 3320, 2920, 2855,

1731, 1574, 1530, 1426, 1246, 1201, 1141; δH (400 MHz, DMSO-d6) 1.29-1.42 (m, 5H, 5H

(cyclohexyl)), 1.67-1.77 (m, 5H (cyclohexyl)), 2.41-2.47 (m, 1H, CH), 4.46 (s, 2H, CH2

(furfuryl)), 4.62 (bs, 2H, CH2Ar), 4.88 (s, 2H, CH2CO2H), 6.15-6.26 (m, 1H, CH (furfuryl)),

6.35 (bs, 1H, CH (furfuryl)), 7.12 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.25 (d, J = 7.9 Hz, 2H, 2 CH

(Ar)), 7.55 (s, 1H, CH (furfuryl)), 7.61 (bs, 1H, NH), 7.96 (bs, 1H, CH (H-8)), 8.33-8.55 (bm,

1H, NH); δC (100 MHz, DMSO-d6) 25.5, 26.3, 34.0, 36.7, 41.7, 43.4, 44.3, 113.1, 114.4, 114.6,

121.5, 121.6, 126.2, 136.5, 138.3, 145.5, 151.8, 158.9, 169.5; HRMS (MS-ES), calcd for



238

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(propylamino)-9H-purin-9-yl)

acetic acid (3.7bs). Purine 3.6bs was treated according to general procedure H, to yield final

product 3.7bs as a white lyophilized powder (78 %): m.p. > 202 °C (dec); IR (KBr, cm-1

) 3677,

3519, 3396, 2922, 1452, 1123; δH (400 MHz, DMSO-d6) 0.85 (m, 3H, NHCH2CH2CH3), 1.26-

1.41 (m, 5H (cyclohexyl)), 1.53 (m, 2H, NHCH2CH2CH3), 1.65-1.78 (m, 5H (cyclohexyl)), 2.40-

2.46 (m, 1H, CH), 3.38 (bs, 2H, NHCH2CH2CH3), 4.41-4.44 (m, 2H, CH2Ar), 4.85 (s, 2H,

CH2CO2H), 7.11 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.23 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.88 (s,

1H, CH, (H-8)); δC (100 MHz, DMSO-d6) 11.2, 25.5, 26.3, 33.9, 43.5, 43.9, 44.1, 44.2, 112.7,

115.7, 118.6, 121.6, 126.3, 127.6, 157.9, 158.2, 158.5, 158.8, 169.1; HRMS (MS-ES), calcd for



2-(2-((4-cyclohexylbenzyl)amino)-6-(hexylamino)-9H-purin-9-yl)acetic acid (3.7bt). Purine

3.6bt was treated according to general procedure F, to yield final product 3.7bt as a white


)3549, 3413, 2925, 2853, 1686,

1638, 1618, 1448, 1384, 1303, 1208, 1183; δH (400 MHz, CDCl3) 0.84 (t, J = 7.1 Hz, 3H,

(CH2)5CH3), 1.10-1.39 (m, 11H, 5H (cyclohexyl) and (CH2)2CH2CH2CH2CH3), 1.43-1.57 (m,

2H, CH2CH2(CH2)3CH3)), 1.60-1.87 (m, 5H, (cyclohexyl)), 2.37-2.47 (m, 1H, CH), 3.42 (bs,

2H, CH2(CH2)4CH3), 4.42 (s, 2H, CH2Ar), 4.81 (s, 2H, CH2CO2H), 7.11 (d, J = 7.9 Hz, 2H, 2

CH (Ar)), 7.24 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.25 (bs, 1H, NH), 7.76 (bs, 1H, NH), 7.77 (s,

1H, CH, (H-8)); δC (100 MHz, DMSO-d6) 13.8, 18.8, 22.1, 25.5, 26.1, 26.3, 28.9, 31.0, 33.9,

43.4, 43.7, 43.8, 44.2, 112.1, 121.9, 126.2, 127.4, 128.6, 131.5, 145.6, 158.1, 169.3; HRMS (MS-

ES), calcd for C26H37N6O2 [M+H] m/z = 465.2991, fnd. 465.2983; rpHPLC tR: condition (I)


239

2-(6-(3-bromophenoxy)-2-((4-cyclohexylbenzyl)amino)-9H-purin-9-yl)acetic acid (3.7bu).

Purine 3.6bu was treated according to general procedure F, to yield final product 3.7bu as a


) 3462, 2921, 2850, 1729,


(m, 5H, (cyclohexyl)), 2.35-2.47 (m, 1H, CH), 4.04-4.25 (m, 2H, CH2, (Ar)), 4.88 (s, 2H,

CH2CO2H), 6.71-7.18 (m, 4H, 4 CH (Ar)), 7.22-7.34 (m, 1H, CH (Ar)), 7.42 (t, J = 8.1 Hz, 1H,

CH (Ar)), 7.47-7.52 (m, 1H, CH (Ar)), 7.54 (t, J = 2.02 Hz, 1H, CH (Ar)), 7.69 (bs, 1H, NH),

8.00 (s, 1H, CH, (H-8)); δC (100 MHz, DMSO-d6) 25.5, 26.3, 33.9, 43.4, 43.8, 44.2, 112.8,

121.4, 121.5, 125.1, 125.2, 126.2, 127.8, 128.3, 131.1, 137.5, 141.4, 145.7, 153.1, 158.4, 159.1,

169.2; HRMS (MS-ES), calcd for C26H27N5O3Br [M+H] m/z = 536.1271, fnd. 536.1291;

rpHPLC tR: condition (I) 16.049 (II) 43.812 minutes, purity 99.8 % and 97.32%.

2-(2-((4-cyclohexylbenzyl)amino)-6-(4-fluorophenoxy)-9H-purin-9-yl)acetic acid (3.7bv).

Purine 3.6bv was treated according to general procedure F, to yield final product 3.7bv as a

white lyophilized powder (77 %): m.p. > 100°C (dec); IR (KBr, cm-1

)3550, 3414, 3235, 2925,

240

2852, 1619, 1587, 1504, 1450, 1408, 1349, 1256; δH (400 MHz, DMSO-d6) 1.31-1.40 (m, 5H,

(cyclohexyl)), 1.67-1.79 (m, 5H, (cyclohexyl)), 2.38-2.44 (m, 1H, CH), 4.01-4.32 (m, 2H,

CH2Ar), 4.88 (s, 2H, CH2CO2H), 6.57-7.14 (m, 4H, 4 CH (Ar)), 7.26 (d, J = 6.8Hz, 4H, 4 CH

(Ar)), 7.61 (bs, 1H, NH), 8.00 (s, 1H, CH, (H-8)); δC (100 MHz, DMSO-d6) 25.5, 26.3, 33.9,

43.4, 43.8, 44.2, 112.8, 115.8, 116.0, 123.6, 123.7, 126.1, 127.8, 137.5, 145.7, 148.2, 148.3,

158.1, 158.4, 159.4, 160.5, 169.2; HRMS (MS-ES), calcd for C26H27FN5O3 [M+H] m/z =


92.1%.

2-(2-((4-cyclohexylbenzyl)amino)-6-(perfluorophenoxy)-9H-purin-9-yl)acetic acid (3.7bw).

Purine 3.6bw was treated according to general procedure F, to yield final product 3.7bw as a


)3550, 3408, 2925, 1637,


1.67-1.80 (m, 5H, (cyclohexyl)), 2.38-2.45 (m, 1H, CH), 4.02-4.41 (m, 2H, CH2Ar), 4.91 (s, 2H,

CH2CO2H), 6.74-7.31 (m, 4H, 4 CH (Ar)), 8.01 (bs, 1H, NH), 8.07 (s, 1H, CH (H-8)), 13.3 (vbs,

1H, CO2H); δC (100 MHz, DMSO-d6) 25.5, 26.3, 33.9, 43.4, 43.9, 44.4, 112.0, 126.1, 127.1,

132.9, 138.5, 142.5, 142.9, 145.6, 152.3, 156.1, 158.1, 159.2, 169.1; HRMS (MS-ES), calcd for

C26H23F5N5O3 [M+H] m/z = 548.1704, fnd. 548.1715; rpHPLC tR: condition (I) 16.078 (II)

44.286 minutes, purity 97.2 %and 97.3%.

241

2-(2-((4-cyclohexylbenzyl)amino)-6-(perfluorophenoxy)-9H-purin-9-yl)acetic acid (3.7bx).

Purine 3.6bx was treated according to general procedure F, to yield final product 3.7bx as a

white lyophilized powder (82 %): m.p. > 129°C (dec); IR (KBr, cm-1

) 3707, 2925, 2851, 1580,


(m, 5H, (cyclohexyl)), 2.37-2.43 (m, 1H, CH), 4.01-4.25 (m, 2H, CH2Ar), 4.60 (s, 2H,

CH2CO2H), 7.02-7.05 (m, 3H, 3 CH (Ar)), 7.17-7.28 (m, 4H, 4 CH (Ar)), 7.39-7.46 (m, 3H, 2

CH (Ar) and 1 NH), 7.89 (s, 1H, CH (H-8)); δC (100 MHz, DMSO-d6) 25.5, 26.3, 33.9, 43.4,

44.1, 45.4, 113.2, 121.8, 125.0, 126.2, 127.7, 129.4, 137.8, 141.9, 145.6, 152.4, 155.4, 158.3,

159.3, 170.0; HRMS (MS-ES), calcd for C26H28N5O3 [M+H] m/z = 458.2180, fnd. 458. 2186;


methyl 2-(2-amino-6-chloro-9H-purin-9-yl)acetate (3.8). Purine 4 was treated according to

general procedure F, to yield lyophilized product 9 as an off-white solid (90 %): m.p. = 148–150

°C; IR (KBr, cm-1

) 2982, 1761, 1738, 1522, 1473, 1423, 1441, 1380, 1343, 1310, 1286, 1225,

1173, 1143, 1023, 1002; δH (400 MHz, CDCl3) 1.30 (t, J = 7.2 Hz, 3H, CO2CH2CH3), 4.26 (q, J

= 7.2 Hz, 2H, CO2CH2CH3), 4.84 (s, 2H, CH2CO2Et), 5.15 (bs, 2H, NH2), 7.83 (s, 1H, CH (H-

8)); LRMS (MS-ES), calcd for C9H11ClN5O2 [M+H] m/z = 256.05, fnd. 256.18.

242

ethyl 2-(6-chloro-2-(4-cyclohexylbenzamido)-9H-purin-9-yl)acetate (3.9a). Purine 3.8 was

treated with 4-cyclohexylbenzoyl chloride according to general procedure G, to yield lyophilized

product 3.9a as a yellow solid (63 %): m.p. = 90-107 °C; IR (KBr, cm-1

) 2924, 2850, 1750, 1576,

1493, 1437, 1402, 1285, 1215, 1172; δH (400 MHz, CDCl3) 1.32 (t, J = 7.2 Hz, 3H,

CO2CH2CH3), 1.38-1.49 (m, 5H, (cyclohexyl), 1.76-1.92 (m, 5H, (cyclohexyl)), 2.56-2.62 (m,

1H, CH), 4.29 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 5.06 (s, 2H, CH2CO2Et), 7.35 (d, J = 8.3 Hz,

2H, 2 CH (Ar)), 7.87 (d, J = 8.3 Hz, 2H, 2 CH (Ar)), 8.12 (s, 1H, CH (H-8)), 8.71 (bs, 1H, NH);

LRMS (MS-ES), calcd for C22H24ClN5O3Na [M+Na] m/z = 464.16, fnd. 464.32.

ethyl 2-(6-chloro-2-(cyclohexanecarboxamido)-9H-purin-9-yl)acetate (3.9b). Purine 3.8 was

treated with 4-cyclohexylbenzoyl chloride according to general procedure G, to yield lyophilized

product 3.9b as a yellow solid (67 %): m.p. > 145 °C (dec); δH (400 MHz, CDCl3) 1.29 (t, J =

7.2 Hz, 3H, CO2CH2CH3), 1.27-1.31 (m, 2H, CH2 (cyclohexyl)), 1.48 (m, 3H, (cyclohexyl)),

1.69-1.71 (m, 1H, (cyclohexyl)), 1.81 (m, 2H, (cyclohexyl)), 1.95-1.96 (m, 2H, (cyclohexyl)),

2.87 (m, 1H, CH), 4.24 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.85 (s, 2H, CH2CO2Et), 7.54 (bs, 1H,

NH), 7.57 (s, 1H, CH (H-8)); LRMS (MS-ES), calcd for C16H29ClN5O3 [M+H] m/z = 366.81,

fnd 366.95.

243

ethyl 2-(6-chloro-2-pentanamido-9H-purin-9-yl)acetate (3.9c). Purine 3.8 was treated with 4-

cyclohexylbenzoyl chloride according to general procedure G, to yield lyophilized product 3.9c

as a yellow solid (65 %): m.p. > 141°C (dec); δH (400 MHz, CDCl3) 0.93 (t, J = 7.3 Hz, 3H,

(CH2)3CH3), 1.29 (t, J = 7.2 Hz, 3H, CO2CH2CH3), 1.40 (sextet, J = 7.4 Hz, 2H,

(CH2)2CH2CH3), 1.70 (p, J = 7.5 Hz, 2H, CH2CH2CH2CH3), 2.76 (m, 2H, CH2(CH2)2CH3), 4.25

(q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.84 (s, 2H, CH2CO2Et), 7.62(bs, 1H, NH), 7.68 (s, 1H, CH

(H-8)); LRMS (MS-ES), calcd for C14H19ClN5O3 [M+H] m/z = 340.78, fnd 340.87.

ethyl 2-(2-(4-cyclohexylbenzamido)-6-morpholino-9H-purin-9-yl)acetateacetate (3.10aa).

Purine 3.9a was treated with morpholine according to general procedure B, yielding the final

product 3.10aa as a off-white solid (67 %); m.p, > 70 oC (dec); IR (KBr, cm

-1) 2958, 2926, 2856,

1752, 1730, 1590, 1458, 1389, 1305, 1267, 1244, 1146, 1113; δH (400 MHz, CDCl3) 1.30 (t, J =

7.2 Hz, 3H, CO2CH2CH3), 1.36-1.50 (m, 5H, (cyclohexyl)), 1.75-1.90 (m, 5H, (cyclohexyl)),

2.54-2.60 (m, 1H, CH), 3.82 (t, J = 4.7 Hz, 4H, 2 CH2 (morpholine)), 4.26 (q, J = 7.2 Hz, 2H,

CO2CH2CH3), 4.29 (bs, 4H, 2CH2 (morpholine)), 4.92 (s, 2H, CH2CO2Et), 7.31 (d, J = 8.1 Hz,

2H, 2 CH (Ar)), 7.73 (s, 1H, CH (H-8)), 7.82 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 8.28 (bs, 1H, NH);

LRMS (MS-ES), calcd for C26H33N6O4 [M+H] m/z = 493.25, fnd. 493.41.

244

ethyl 2-(6-(benzylamino)-2-(4-cyclohexylbenzamido)-9H-purin-9-yl)acetate (3.10ab). Purine

3.9a was treated with benzylamine according to general procedure B, yielding the final product

3.10ab as a off-white solid (83 %): m.p. > 100–118 °C; IR (KBr, cm-1

) 2924, 1449, 1385, 1245;

δH (400 MHz, CDCl3) 1.31 (t, J = 7.2 Hz, 3H, CO2CH2CH3), 1.35-1.50 (m, 5H, (cyclohexyl)),

1.75-1.89 (m, 5H, (cyclohexyl)), 2.53-2.60 (m, 1H, CH), 4.27 (q, J = 7.2 Hz, 2H, CO2CH2CH3),

4.83 (bs, 2H, CH2Ar), 4.97 (s, 2H, CH2CO2Et), 6.32 (bs, 1H, HNCH2Ar), 7.28-7.41 (m, 7H, 2

CH (Ar)), 7.79 (s, 1H, CH (H-8)), 7.86 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 8.54 (bs, 1H, NH); LRMS

(MS-ES), calcd for C29H33N6O3 [M+H] m/z = 513.25, fnd. 513.50.

ethyl 2-(6-(butyl(methyl)amino)-2-(4-cyclohexylbenzamido)-9H-purin-9-yl)acetate (3.10ac).

Purine 3.9a was treated with N-butylmethylamine according to general procedure B, yielding the

final product 3.10ac as a clear viscous oil (69 %): IR (KBr, cm-1

) 3630, 2931, 1752, 1578, 1533,

1449, 1406, 1353, 1275, 1221, 1149; δH (400 MHz, CDCl3) 0.95 (t, J = 7.4 Hz, 3H,

N(CH2)3CH3), 1.27-1.49 (m, 7H, N(CH2)2CH2CH3 and 5H (cyclohexyl)), 1.30 (t, J = 7.2 Hz, 3H,

CO2CH2CH3), 1.63-1.91 (m, 7H, NCH2CH2CH2CH3 and 5H (cyclohexyl)), 2.54-2.61 (m, 1H,

CH), 3.16-4.34 (bm, 5H, CH3NCH2(CH2)2CH3), 4.26 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.92 (s,

2H, CH2CO2Et), 7.31 (d, J = 8.3 Hz, 2H, 2 CH (Ar)), 7.72 (s, 1H, CH (H-8)), 7.82 (d, J = 7.9 Hz,

2H, 2 CH (Ar)), 8.24 (bs, 1H, NH); LRMS (MS-ES), calcd for C27H37N6O3 [M+H] m/z =

493.28, fnd. 493.47.

ethyl 2-(2-(cyclohexanecarboxamido)-6-morpholino-9H-purin-9-yl)acetate (3.10ba). Purine

245

3.9b was treated with valeryl chloride according to general procedure G, to yield product 3.10ba

as an off-white solid (74 %): m.p. = 142-147 °C; IR (KBr, cm-1

) 3551, 3415, 3238, 2928, 2852,

1755, 1669, 1604, 1585, 1514, 1448, 1407; δH (400 MHz, CDCl3) 1.29 (t, J = 7.2 Hz, 3H, CO-

2CH2CH3), 1.28-1.32 (m, 2H, CH2 (cyclohexyl)), 1.49 (m, 3H, (cyclohexyl)), 1.70-1.71 (m, 1H,

(cyclohexyl)), 1.82 (m, 2H, (cyclohexyl)), 1.96-1.99 (m, 2H, (cyclohexyl)), 2.88 (m, 1H, CH),

3.82 (t, J = 4.9 Hz, 4H, 2 CH2 (morpholine)), 4.25 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.27 (bs,

4H, 2CH2 (morpholine)), 4.87 (s, 2H, CH2CO2Et), 7.69 (bs, 1H, NH), 7.70 (s, 1H, CH (H-8));

LRMS (MS-ES), calcd for C20H29N6O4 [M+H] m/z = 417.22, fnd 417.40.

ethyl 2-(6-morpholino-2-pentanamido-9H-purin-9-yl)acetate (3.10ca). Purine 3.9c was

treated with valeryl chloride according to general procedure G, to yield lyophilized product

3.10ca as a white solid (72%): m.p. > 141°C (dec); IR (KBr, cm-1

)3551, 3477, 3414, 3228, 3110,

2956, 2930, 2849, 1751, 1670, 1638, 1608; δH (400 MHz, CDCl3) 0.94 (t, J = 7.3 Hz, 3H,

(CH2)3CH3), 1.30 (t, J = 7.2 Hz, 3H, CO2CH2CH3), 1.41 (sextet, J = 7.4 Hz, 2H,

(CH2)2CH2CH3), 1.71 (p, J = 7.5 Hz, 2H, CH2CH2CH2CH3), 2.78 (m, 2H, CH2(CH2)2CH3), 3.83

(t, J = 4.9 Hz, 4H, 2 CH2 (morpholine)), 4.26 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.28 (bs, 4H,

2CH2 (morpholine)), 4.86 (s, 2H, CH2CO2Et), 7.69 (bs, 1H, NH), 7.70 (s, 1H, CH (H-8));

LRMS (MS-ES), calcd for C18H26N6O4Na [M+Na] m/z = 413.20, fnd 413.37.

246

2-(2-(4-cyclohexylbenzamido)-6-morpholino-9H-purin-9-yl)acetic acid (3.11aa). Purine

3.10aa was treated according to general procedure E, to yield final product 3.11aa as a white


3672, 2925, 2854, 1720, 1523,

1459, 1384, 1266, 1241, 1194; δH (400 MHz, DMSO-d6) 1.32-1.52 (m, 5H, (cyclohexyl)), 1.69-

1.81 (m, 5H, (cyclohexyl)), 2.53-2.59 (m, 1H, CH), 3.67-3.69 (m, 4H, 2 CH2 (morpholine)), 4.14

(bs, 4H, CH2 (morpholine)), 4.77 (s, 2H, CH2CO2H), 7.30 (d, J = 8.3 Hz, 2H, 2 CH (Ar)), 7.81

(d, J = 8.1 Hz, 2H, 2 CH (Ar)), 8.04 (s, 1H, CH (H-8)), 10.37 (s, 1H, NH); δC (100 MHz,

DMSO-d6) 25.5, 26.2, 33.6, 43.6, 44.9, 45.0, 66.2, 115.8, 126.4, 128.0, 132.6, 140.6, 151.2,

152.0, 152.3, 152.9, 165.5, 169.3; HRMS (MS-ES), calcd for C24H29N6O4 [M+H] m/z =


99.26%.

2-(6-(benzylamino)-2-(4-cyclohexylbenzamido)-9H-purin-9-yl)acetic acid (3.11ab). Purine

3.10ab was treated according to general procedure E, to yield final product 3.11ab as a white

lyophilized powder (78 %): m.p. > 167 °C; IR (KBr, cm-1) 2926, 2851, 1454, 1386, 1352, 1252,

1126; δH (400 MHz, DMSO-d6) 1.32-1.48 (m, 5H, (cyclohexyl)), 1.69-1.84 (m, 5H,

(cyclohexyl)), 2.52-2.60 (m, 1H, CH), 4.64 (bs, 4H, HNCH2 and CH2CO2H), 7.18-7.21 (m, 1H, 1

CH (Ar)), 7.26-7.32 (m, 4H, CH (Ar)), 7.40 (d, J = 7.3 Hz, 2H, 2 CH (Ar)), 7.84 (d, J = 8.3 Hz,

2H, 2 CH (Ar)), 7.98 (s, 1H, CH (H-8)), 8.21 (bs, 1H, NH), 10.30 (s, 1H, CONH); δC (100 MHz,

DMSO-d6) 25.5, 26.2, 33.6, 42.7, 43.6, 45.4, 116.0, 126.4, 126.6, 127.6, 128.0, 132.5, 140.3,

141.4, 151.3, 152.8, 154.3, 165.5, 169.8; HRMS (MS-ES), calcd for C27H29N6O3 [M+H] m/z =


98.7%.

247

2-(6-(butyl(methyl)amino)-2-(4-cyclohexylbenzamido)-9H-purin-9-yl)acetic acid (3.11ac).

Purine 3.10a was treated according to general procedure E, to yield final product 3.11a as a

white lyophilized powder (85 %): m.p. > 124 °C (dec); IR (KBr, cm-1)2925, 2852, 1504,1463,

1402, 1314, 1256, 1059; δH (400 MHz, DMSO-d6) 0.89 (t, J = 7.3 Hz, 3H, N(CH2)3CH3), 1.27-

1.49 (m, 7H, N(CH2)2CH2CH3 and 5H (cyclohexyl)), 1.52-1.64 (m, 2H, NCH2CH2CH2CH3),

1.69-1.80 (m, 5H, (cyclohexyl)), 2.54-2.61 (m, 1H, CH), 2.99-4.34 (bm, 5H,

CH3NCH2(CH2)2CH3), 4.60 (s, 2H, CH2CO2H), 7.29 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.80 (d, J =

7.9 Hz, 2H, 2 CH (Ar)), 7.95 (s, 1H, CH (H-8)), 10.24 (s, 1H, NH); δC (100 MHz, DMSO-d6)

13.8, 19.3, 25.5, 26.2, 29.2, 33.6, 33.6, 43.6, 46.1, 49.4, 116.0, 126.4, 128.0, 132.6, 140.6, 151.1,

151.5, 153.7, 165.5, 170.3; HRMS (MS-ES), calcd for C25H33N6O3 [M+H] m/z = 465.2601, fnd.


2-(6-morpholino-2-pentanamido-9H-purin-9-yl)acetic acid (3.11ba). Purine 3.10ba was

treated according to general procedure E, to yield final product 3.11ba as a white lyophilized


) 3233, 1753, 1516, 1466, 1385, 1311, 1267,

1220, 1114, 1009; δH (400 MHz, DMSO-d6) 0.87 (t, J = 7.3 Hz, 3H, (CH2)3CH3), 1.29 (sextet, J

= 7.5 Hz, 2H, (CH2)2CH2CH3), 1.52 (p, J = 7.5 Hz, 2H, CH2CH2CH2CH3), 2.47 (t, J = 7.2 Hz,

2H, CH2(CH2)2CH3), 3.83 (t, J = 4.3 Hz, 4H, 2 CH2 (morpholine)), 4.19 (bs, 4H, 2 CH2

(morpholine)), 4.74 (s, 2H, CH2CO2H), 7.99 (s, 1H, CH (H-8)), 9.92 (s, 1H, NH); δC (100 MHz,

DMSO-d6) 13.7, 21.8, 26.8, 35.9, 44.7, 45.0, 66.1, 115.3, 140.2, 151.9, 152.1, 152.9, 169.2,

248



2-(2-(cyclohexanecarboxamido)-6-morpholino-9H-purin-9-yl)acetic acid (3.11ca). Purine

3.10ca was treated according to general procedure E, to yield final product 3.11ca as a white


) 3631, 2927, 2856, 1743, 1514,

1466, 1385, 1306, 1265, 1240, 1192, 1116, 1069; δH (400 MHz, DMSO-d6) 1.09-1.38 (m, 5H,

(cyclohexyl)), 1.61-1.78 (m, 5H, (cyclohexyl)), 2.61-2.75 (m, 1H, (cyclohexyl)), 3.82 (t, J = 4.6

Hz, 4H, 2 CH2 (morpholine)), 4.19 (bs, 4H, 2 CH2 (morpholine)), 4.74 (s, 2H, CH2CO2H), 7.99

(s, 1H, CH (H-8)), 9.85 (s, 1H, NH); δC (100 MHz, DMSO-d6) 25.2, 25.4, 29.0, 43.8, 44.7, 45.0,

66.2, 140.2, 151.9, 152.2, 153.0, 169.3, 174.3; HRMS (MS-ES), calcd for C18H25N6O4 [M+H]

m/z = 389.1919, fnd. 389.1931; rpHPLC tR: condition (I) 10.978 (II) 17.891 minutes, purity 97.9

%and 98.0%.

249

10 Appendix 4: Experimental Methods For 2nd Generation Purines

10.1 Biophysical Evaluations of 2,6,9-Heterotrisubstituted STAT3 Inhibitors

10.1.1 Competitive FP Experiments

FP experiments were performed as described in section 8.2.1. Changes to the procedure is

outlined below:

STAT3 was generously provided by the Minden laboratory at 10 μL concentration in buffer

consisting of: pH 7.5, 25mM NA2HPO4, 150mM NaCl, 2mM dithiothrietol, 2mM tris(2-

carboxyethyl)phosphine), 2mM benzamidine, 1mM ethylenediaminetetraacetic acid, 0.5mM

phenylmethanesulfonylfluoride. A calibration curve was performed using 10nM Fam-pYLPQTV

and dilutions of STAT3 protein (5.0 μL to 2.4 nM) at a final DMSO concentration of 10%

(Figure 4.8).

Figure 4.8: STAT3 calibration curve.

The concentration that corresponded to the midpoint of the saturation curve was utilized as the

STAT3 concentration used in the competitive fluorescent polarization assay. 7.5μL of FAM-

250

pYLPQTV peptides was added to pre-plated 15μL of 500 nM STAT3 protein solution in a black

384-flat well microplate (Corning). 7.5μL of inhibitory molecules (and positive control) solution

were individually added to the plate forming the following final inhibitory concentrations: 400

μL, 200 μL, 100 μL, 50 μL, 25μL, 12.5 μL, 6.3 μL, 3.1 μL, 1.6 μL, 0.78 μL, 0.39 μL, 0.19 μL.

The final 10% DMSO buffer solution was incubated for 15-30 minutes before the Infinite M1000

measured the FP signal.

10.1.2 Phospho-Flow Cytometry

For a 4.5 h treatment XG6 and OPM2 cells were starved overnight and treated with different

doses of 4.12e. For OPM2 cells, 100 ng/mL of hIL6 was added causing the cells to be

stimulated for 10 min at the end of the 4.5 h treatment. Baseline cells possessed no drug and

were not subjected to hIL6 stimulation. Cells were fixed by adding 10% formaldehyde (to a final

concentration of 2.5%) at room temperature for 10 min. Ice cold methanol was added dropwise

to a final concentration of 85%. Samples were left on ice for 30 min before being centrifuged in

order for methanol to be decanted. Samples were washed once in PBS with 3-4% FCS then

stained with mouse anti pSTAT3-PE(BD) and incubated in the dark for 30 min. A second wash

of PBS with 3-4% FCS was conducted. Samples were then run using FACSCalibur (BD) and

analysed using FlowJo software (Tree Star, Ashland, OR).

10.1.3 Kinase Screen Initial

Select kinases (ABL1, AKT1, c-Src, CDK1/cyclin B, CDK2/cyclin A, ERK2/MAPK1, FLT3,

JAK2, JAK3, and LCK ) screening and JAK family kinase IC50 determination (TYK1, JAK1,

JAK2, and JAK3) was performed at Reaction Biology Corporation (www.reactionbiology.com,

Malvern, PA) using the “HotSpot” assay platform. For both experiments, specific

kinase/substrate pairs along with their required cofactors were prepared in reaction buffer; 20

mM Hepes pH 7.5, 10 mM MgCl2, 1 mM EGTA, 0.02% Brij35, 0.02 mg/ml BSA, 0.1 mM

Na3VO4, 2 mM DTT, 1% DMSO. The first screen was completed in duplicate whereby 4.12e

was placed into the reaction well at a single concentration of 50 μM , followed ~ 20 min later by

addition of a mixture of ATP (Sigma, St. Louis MO) and 33

P ATP (Perkin Elmer, Waltham MA)

to a final concentration of 10μM. IC50 determination experiment was completed in triplicate and

utilized variable concentrations of inhibitor while all other conditions remained the same as the

single concentration experiment. Reaction wells were kept at room temperature for 120 min,

251

followed by spotting each of the reactions onto P81 ion exchange filter paper (Whatman Inc.,

Piscataway, NJ). Any unbound phosphate was removed though extensive washing of filters using

0.75% phosphoric acid. Background was subtracted using control reactions and the kinase

activity data was expressed as the percent remaining kinase activity in test samples compared to

vehicle (dimethyl sulfoxide) reactions. All IC50 values and curve fitting were produced using

Prism (GraphPad Software).

10.1.4 Kinome Screen

Kinase-tagged T7 phage strains were grown in parallel in 24-well blocks in an E. coli host

derived from the BL21 strain. E. coli were grown to the log-phase and were then infected with

T7 phage from a frozen stock (multiplicity of infection = 0.4) and incubated at 32 oC with

shaking until lysis (90-150 min). Lysates were centrifuged (6,000 x g) and filtered (0.2 μm) to

remove any cell debris. The remaining kinases were produced in HEK-293 cells and were then

tagged with DNA for easy quantitative PCR (qPCR) detection. Magnetic beads coated with

Streptavidin were treated with biotinylated small molecule ligands for 30 min at room

temperature to generate the affinity resins needed for capturing kinases. The liganged beads were

blocked with excess biotin and washed with blocking buffer (SeaBlock (Pierce), 1% BSA, 0.05%

Tween 20, 1 mM DTT) in order to remove unbound ligand and to also reduce non-specific phage

binding. Binding reactions were assembled by combining kinases, liganded affinity beads, and

4.12e in 1x binding buffer (20% SeaBlock, 0.17x PBS, 0.05% Tween 20, 6 mM DTT). 4.12e

were prepared as 40x stocks in 100% DMSO and were directly diluted into the assay. All

reactions were performed in polypropylene 384-well plates in a final volume of 40μL. The assay

plates were shaked at room temperature for 1 hour and the affinity beads were washed with wash

buffer (1x PBS, 0.05 % Tween 20). Following the wash, beads were re-suspended in elution

buffer (1x PBS, 0.05% Tween 20, 0.5 μM non-biotinylated affinity ligand) and incubated at

room temperature with shaking for 30 min. Kinase concentration in eluates was measured by

qPCR.

10.2 Biological Evaluation of 2,6,9-Heterotrisubstituted STAT3 Inhibitors

10.2.1 Liver Mouse Microsomes

Experiment was performed as outlined in section 9.3.6.

252

10.2.2 Caco-2 Cell Permeability Determination

The experimental procedure is outlined in section 8.3.1.

10.2.3 MTT and MTS Assay

MTS: This experiment was conducted at described in section 8.3.5.

MTT: The viability of cells following treatment with 4.12e was assessed by MTT dye

absorbance in accordance with the manufacturer’s instructions (Boehinger Mannheim,

Mannheim, Germany). MM cells were seeded in 96-well plates at a density of 20,000 cells per

well. Cells were incubated in the presence of IGF-1 (50 ng/mL) or IL-6 (10 ng/mL) as needed.

4.12e was dissolved in DMSO and variable concentrations were accomplished though dilution

with cell medium. Drug was added to cell plates and were then incubated at 37 °C, 5% CO2 for

48 h. All cell lines were tested in triplicate.


10.3.1 Chemical Methods for Purines

General chemical methods can be found at the beginning of A2.4.1, changes to these methods are

listed here: Analysis by rpHPLC was performed using a Microsorb-MV 300 Å C18 250 mm x

4.6 mm column with eluent flow set at 1 mL/min, and using gradient mixtures of (A) water with

0.1% TFA and (B) an acetonitrile solution containing 10% H2O and 0.1% TFA. Ligand purity

was confirmed using linear gradients from 50% A and 50% B to 100% B after an initial 2 minute

period of 100% A (I), and a second linear gradient of 100% A to 100% B (II). The linear

gradient consisted of a changing solvent composition of either (I) 1.8% per minute and UV

detection at 254 nm ending with 30 min of 100% or (II) 2.3% per minute and detection at 254nm

ending with 15 min of 100% B. When reporting the HPLC results, retention times for each

condition are written followed by their purities in their respective order. Biologically evaluated

compounds are > 90% chemical purity as measured by HPLC.

10.3.2 General Procedures for 2nd Generation Purines

General Procedure A. Nucleophilic aromatic substitution at C6 with amine:

To a Biotage Initiator vial, containing a solution of chloropurine (0.28 mmol, 1.0 eq) in DMSO

253

(0.15 M), was added the amine or phenol (0.57 mmol, 2.0 eq) and DIPEA (0.85 mmol, 3.0 eq).

The resulting mixture was sealed and irradiated in a Biotage Initiator microwave reactor (30 min,

135 °C). Following cooling, the product was extracted from the DMSO solution diluted with

H2O and extracted into EtOAc. The combined organics were then washed with water and brine.

The solution was dried over anhydrous Na2SO4, filtered and concentrated under reduced

pressure. The resulting residue was dissolved in an EtOAc and Hexanes solution and wet loaded

onto a Biotage Isolera and purified with the same solvent gradient.

General Procedure B. Nucleophilic aromatic substitution at C6 with anilines:

To a solution of chloro-purine (0.28 mmol, 1.0 eq) in DMSO (0.2 M), the appropriate aniline

(0.85 mmol, 3.0 eq) and DIPEA (1.4 mmol, 5.0 eq) were added. The resulting mixture was

heated on an oil bath for 72 h at a temperature of 75 °C. The reaction was diluted with water and

repeatedly extracted into EtOAc. Combined organics were washed with water and brine, dried

over anhydrous Na2SO4, filtered and concentrated using a rotary evaporated. The resulting

residue was wet loaded onto a Biotage Isolera column from a solution of EtOAc and hexanes,

and purified using the same solvents used as the eluent.

General Procedure C. BOC de-protection step using TFA:

The appropriate purine (0.19 – 0.26 mmol, 1.0 eq) was dissolved in TFA and immediately

diluted using CH2Cl2 to form a 1:1 TFA: CH2Cl2 (0.1 M) solution. Reaction stirred for one hour

at room temperature and was then co-evaporated with MeOH to near dryness. The residue was

re-dissolved up in EtOAc and hexanes, wet loaded onto a Biotage Isolera column, and purified

using a gradient of EtOAc and hexanes.

General Procedure D. Ester hydrolysis with LiOH:

LiOH (1.1 eq) was added to a room temperature and stirring solution (0.1 M) of the appropriate

purine (0.14 - 0.20 mmol, 1.0 eq) in THF:H2O (3:1). After 30 min the reaction was deemed

complete and was then diluted with water acidified (pH~5.5) by KH2PO4, and continuously

extracted into EtOAc. Organic layers were washed with brine, dried over anhydrous Na2SO4 and

concentrated under reduced pressure. Reaction was purified by flash column chomatography

using an isocratic solvent system (35:7:1 CH2Cl2:MeOH:H2O).

254

General Procedure E. Pivaloyloxymethyl ester formation:

The appropriate free acid (0.070 – 0.10 mmol, 1.0 eq) was dissolved up in anhydrous DMF. To

the resulting solution re-distilled DIPEA (2.1 eq) was added in a single portion, followed by the

addition of iodopivalate (2.0 eq). Reaction was wrapped in tin foil and allowed to react at room

temperature for 16 h. At this point, the reaction was diluted with water and repeatedly extracted

into EtOAc. The combined organics were washed with water and brine, dried over anhydrous

Na2SO4, filtered and concentrated under reduced pressure. The concentrated product was re-

dissolved in the HPLC solution condition B. This solution was purified using preparative HPLC

and immediately lyophilized from the eluent solution.

General Procedure F. Acetoxymethyl ester formation:

The appropriate free acid (0.070 – 0.10 mmol, 1.0 eq) was dissolved up in anhydrous DMF. To

the resulting solution re-distilled DIPEA (1.2 eq) was added in a single portion, followed by the

addition of bromomethylacetate (1.1 eq). Reaction was wrapped in tin foil and allowed to react at

room temperature for 16 h. At this point, the reaction was diluted with water and repeatedly

extracted into EtOAc. The combined organics were washed with water and brine, dried over

anhydrous Na2SO4, filtered and concentrated under reduced pressure. The concentrated product

was re-dissolved in the HPLC solution condition B. This solution was purified using preparative

HPLC and immediately lyophilized from the eluent solution.

General Procedure G. Alkylation of N9: To a solution of purine 3 (7.4 mmol, 1.0 eq) in THF

(0.1 M) at room temperature, was added the appropriate alcohol (8.2 mmol, 1.1 eq) followed by

triphenylphosphine (PPh3, 8.2 mmol, 1.1 eq) under an N2 atmosphere. To the stirring solution,

diisopropylazodicarboxylate (DIAD, 8.2 mmol, 1.1 eq) was added dropwise (over 30 s).

According to TLC visualization the reaction was complete after 15 min and the solvent was

removed in vacuo. The resulting residue was adsorbed onto silica gel from CH2Cl2, and purified

by flash column chomatography (2:1 EtOAc:Hex).

General Procedure H. Alkylation of N2: To stirring solution of purine 4 (6.8 mmol, 1.0 eq) in

THF at room temperature, (0.1 M) the desired alcohol (10.2 mmol, 1.5 eq) was added, followed

by an addition of PPh3 (10.2 mmol, 1.5 eq). After ~10 min, DIAD (10.9 eq was added dropwise

(over ~30 s – 1 min). Reaction mixture was then heated to 40 °C and stirred for 0.5-2 h before

255

THF was removed under reduced pressure. The crude product was wet-loaded onto a Biotage

Isolera and was eluted from the column using a gradient of EtOAc and hexanes.

General Procedure I. Deprotection of the silyl ether protecting group:

To a stirring solution of silylated purine (0.27mmol, 0.1 eq, 0.1 M) cooled to 0 °C in THF is

added tetrabutylammonium fluoride (TBAF, 1 M solution, 1.5 eq). The reaction status is

monitored though TLC, visualized under a fluorescent lamp (254 nm).

General Procedure J. Nucleophilic attack of alkoxide on sulfamoyl chloride:

To a stirring solution of silylated purine (0.24 mmol, 0.1 eq, 0.1 M) cooled to 0 °C within an ice

bath is added solid NaH (60% dispersion in mineral oil, 1.2 mmol, 5.0 eq) to afford an opaque,

off-white, homogeneous solution after light effervescence. To this solution is added solid

sulfamoyl chloride (0.6mmol, 2.5 eq, air sensitive) under a nitrogen atmosphere. The solution pH

is monitored over a 3-5 h time course to ensure solution alkalinity along with the reaction status

via TLC and fluorescent illumination for visualization purposes. The solution contents were

concentrated under reduced pressure and diluted with a 1.0 M K2HPO4 solution followed by

repeated extractions into EtOAc. The combined organics were washed with water and brine,

dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The resulting

residue was wet-loaded onto silica gel from CH2Cl2 and columned using a Biotage Isolera in a

gradient of CH2Cl2 and MeOH.

General Procedure K. Tetrazole derivatives nucleophilic aromatic substitution at C6 with

amine:

To a solution of the appropriate chloro-purine (0.28 mmol, 1.0 eq) in DMSO (0.15 M), the

desired amine (0.56 mmol, 2.0 eq) and DIPEA (0.84 mmol, 3.0 eq) were added. The solution

was stirred at 55 oC for 16 h after which the reaction was deemed complete by TLC. Reaction

was diluted with water and repeatedly extracted with EtOAc. The combined organics were

washed with water and brine, dried over anhydrous Na2SO4, filtered and concentrated under

reduced pressure. Resulting residue was adsorbed onto silica gel from CH2Cl2 and columned

using a Biotage Isolera in a gradient of EtOAc and hexanes.

General Procedure L. Tetrazole derivatives nucleophilic aromatic substitution at C6 with

256

anilines:

To a solution of di-substituted chloro-purine (0.28 mmol, 1.0 eq) in DMSO (0.2 M), the

appropriate aniline (0.84 mmol, 3.0 eq) and DIPEA (1.4 mmol, 5.0 eq) were added. The solution

was stirred at 75 °C for 72 h after which the reaction fully consumed starting chloro-purine by

TLC. After cooling, reaction was diluted with water and repeatedly extracted into EtOAc. The

combined organics were washed with water and brine, dried over anhydrous Na2SO4, filtered and

concentrated under reduced pressure. The resulting residue was dry-loaded onto silica gel from

CH2Cl2 and columned using a Biotage Isolera in a gradient of EtOAc and hexanes.

General Procedure M. BOC and trityl deprotection:

The appropriate purine (0.20 – 0.24 mmol, 1.0 eq) was dissolved in TFA:CH2Cl2 (1:1) to form a

0.1 M solution. Upon first addition of TFA, reaction turns bright yellow. Reaction stirred for two

h at room temperature, co-evaporated with MeOH to near dryness, and re-dissolved in the HPLC

solution condition B. This solution was purified using preparative HPLC and immediately

lyophilized from the eluent solution.

General Procedure N. Acylation of N2:

The appropriate acid chloride was added (1.1 eq) to a stirring solution of pyridine (0.1 M) and

the required purine (0.36 - 1.5 mmol, 1.0 eq). Reaction was deemed complete within 15 min as

per TLC visualization, diluted with water, and repeatedly extracted into EtOAc. The combined

organics were washed several times with water and brine, dried over anhydrous Na2SO4 and

concentrated under reduced pressure. Using the Biotage Isolera automated column

chomotographer the resulting residue was purified in a gradient of EtOAc and CH2Cl2 and then

dried under reduced pressure.

10.3.3 Detailed Synthetic Procedures for 2nd Generation Purines

257

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(cyclopentylamino)-9H-

purin-9-yl)acetate (4.1a). Purine 3.7be was treated with cyclopentanamine according to general

procedure A, yielding the final product 4.1a as a white solid (81%): m.p. > 133 °C (dec); IR

(KBr, cm-1

) 3549, 2978, 2926, 2851, 1752, 1702, 1541, 1515, 1481, 1438, 1391, 1238, 1212,

1158, 1110, 1022; δH (400 MHz, CDCl3) 1.18-1.46 (m, 14H, 5H (cyclohexyl) and C(CH3)3),

1.28 (t, J = 7.2 Hz, 3H, CO2CH2CH3), 1.46-1.54 (m, 4H, (cyclopentyl)), 1.71-1.82 (m, 7H, 5H

(cyclohexyl) and 2H (cyclopentyl)), 2.03 (bs, 2H, (cyclopentyl)), 2.41-2.47 (m, 1H, CH), 4.23 (q,

J = 7.2 Hz, 2H, CO2CH2CH3), 4.44 (bs, 1H, NCH), 4.87 (s, 2H, CH2Ar), 5.05 (s, 2H,

CH2CO2Et), 5.76 (bs, 1 H, NH), 7.09 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.30 (d, J = 8.1 Hz, 2H, 2


fnd. 577.46.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(isobutylamino)-9H-purin-

9-yl)acetate (4.1b)

Purine 3.7bj was treated with isobutylamine according to general procedure A, yielding the final

product 4.1b as a white solid (77%): m.p. = 70 - 85 °C; IR (KBr, cm-1

) 3280, 3215, 2926, 2851,

1755, 1732, 1632, 1487, 1448, 1388, 1352, 1231, 1148; δH (400 MHz, CDCl3) 0.93 (s, 3H,

CH2CH(CH3)2), 0.95 (s, 3H, CH2CH(CH3)2), 1.21-1.40 (m, 8H, 5H (cyclohexyl) and

CO2CH2CH3), 1.42 (s, 9H, C(CH3)3), 1.67-1.84 (m, 5H (cyclohexyl)), 1.86-1.96 (m, 1H,

CH2CH(CH3)2), 2.40-2.47 (m, 1H, CH(CH3)2), 3.37 (bs, 2H, CH2CH(CH3)2), 4.24 (q, J =

7.2 Hz, 2H, CO2CH2CH3), 4.88 (s, 2H, CH2Ar), 5.04 (s, 2H, CH2CO2Et), 5.75 (bs, 1H, NH),

7.08 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.30 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.74 (s, 1H, CH (H-8));

LRMS (MS-ES), calcd for C31H44N6O4Na [M+Na] m/z = 587.34, fnd. 587.51.

258

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(isopentylamino)-9H-purin-

9-yl)acetate (4.1c). Purine 3.7bl was treated with isoamylamine according to general procedure

A, yielding the final product 4.1c as a clear viscous oil (88%): IR (KBr, cm-1

) 2924, 2851, 1755,

1704, 1514, 1434, 1385, 1244, 1160, 1023; δH (400 MHz, CDCl3) 0.91 (s, 3H, (CH2)2CH(CH3)2),

0.93 (s, 3H, (CH2)2CH(CH3)2), 1.25-1.39 (m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.41 (s,

9H, C(CH3)3), 1.49-1.55 (m, 1H, (CH2)2CH(CH3)2), 1.65-1.83 (m, 7H, CH2CH2CH(CH3)2 and

5H (cyclohexyl)), 2.40-2.47 (m, 1H, CH), 3.58 (bs, 2H, CH2CH2CH(CH3)2), 4.24 (q, J = 7.2 Hz,

2H, CO2CH2CH3), 4.87 (s, 2H, CH2Ar), 5.06 (s, 2H, CH2CO2Et), 5.58 (bs, 1H, NH), 7.08 (d, J

= 8.1 Hz, 2H, 2 CH (Ar)), 7.30 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.73 (s, 1H, CH (H-8)); LRMS

(MS-ES), calcd for C32H47N6O4 [M+H] m/z = 579.36, fnd. 579.48.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-morpholino-9H-purin-9-

yl)acetate (4.1d). Purine 3.7bm was treated with morpholine according to general procedure A,

yielding the final product 4.1d as a white solid (92%): m.p. = 166-167 °C; IR (KBr, cm-1

) 2925,

2852, 1755, 1698, 1590, 1479, 1440, 1384, 1305, 1240, 1209, 1154, 1116; δH (400 MHz, CDCl3)


(cyclohexyl)), 2.40-2.45 (m, 1H, CH), 3.77 (t, J = 4.7 Hz, 4H, 2 CH2, (morpholine)), 4.19 (bs,

4H, 2 CH2, (morpholine)), 4.24 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.88 (s, 2H, CH2Ar), 5.03 (s,

259

2H, CH2CO2Et), 7.08 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.27 (d, J = 7.5 Hz, 2H, 2 CH (Ar)), 7.73

(s, 1H, CH (H-8)); HMS (MS-ES), calcd for C24H31N6O3 [M+H] m/z = 503.2571, fnd. 503.2583.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-((4-fluorophenyl)amino)-

9H-purin-9-yl)acetate (4.1e). Purine 3.7bp was treated with 4-fluoroaniline according to

general procedure B, yielding the final product 4.1e as a white solid (65%): IR (KBr, cm-1

) 2926,

2852, 1752, 1707, 1625, 1593, 1508, 1384, 1212, 1155; δH (400 MHz, CDCl3) 1.20-1.38 (m, 8H,

5H (cyclohexyl) and CO2CH2CH3), 1.41 (s, 9H, C(CH3)3), 1.70-1.85 (m, 5H (cyclohexyl)), 2.43-

2.48 (m, 1H, CH), 4.25 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.91 (s, 2H, CH2Ar), 5.10 (s, 2H,

CH2CO2Et), 6.91-6.96 (m, 2H, 2 CH (Ar)), 7.11 (d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.27 (d, J = 8.0

Hz, 2H, 2 CH (Ar)), 7.57 (bs, 1H, CH (Ar)), 7.67-7.72 (m, 2H, 2 CH (Ar)), 7.83 (s, 1H, CH (H-

8)); LRMS (MS-ES), calcd for C33H39FN6O4Na [M+Na] m/z = 625.30, fnd. 625.43.

ethyl 2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)amino)-

9H-purin-9-yl)acetate (4.1f). Purine 3.7bq was treated with furfurylamine according to general

procedure A, yielding the final product 4.1f as a white solid (87%): m.p. > 120 °C (dec); IR

260

(KBr, cm-1

) 2925, 2851, 1752, 1703, 1620, 1480, 1438, 1384, 1236, 1156, 1108; δH (400 MHz,


(m, 5H (cyclohexyl)), 2.41-2.47 (m, 1H, CH), 4.23 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.76 (bs,

2H, CH2 (furfuryl)), 4.88 (s, 2H, CH2Ar), 5.07 (s, 2H, CH2CO2Et), 6.01 (bs, 1H, NH (furfuryl)),

6.19-6.20 (m, 1H, CH (furfuryl)), 6.29-6.30 (m, 1H, CH (furfuryl)), 7.09 (d, J = 8.1 Hz, 2H, 2

CH (Ar)), 7.29 (d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.34-7.35 (m, 1H, CH (furfuryl)), 7.75 (s, 1H, CH

(H-8)); LRMS (MS-ES), calcd for C32H41N6O5 [M+H] m/z = 589.31, fnd. 589.43.


9-yl)acetate (4.1g). Purine 3.7bo was treated with 4-nitrophenol according to general procedure

A, yielding the final product 4.1g as a clear viscous oil (69%): IR (KBr, cm-1

) 3530, 3480, 3425,

2925, 2850, 1770, 1725, 1640, 1625, 1575, 1540, 1350; δH (400 MHz, CDCl3) 1.20-1.33 (m, 8H,

5H (cyclohexyl) and CO2CH2CH3), 1.36 (s, 9H, C(CH3)3), 1.7-1.83 (m, 5H (cyclohexyl)), 2.43-

2.46 (m, 1H, CH), 4.25 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.94 (s, 2H, CH2Ar), 4.99 (s, 2H,

CH2CO2Et), 7.06 (s, 4H, 4 CH (Ar)), 7.45 (d, J = 9.0 Hz, 2H, 2 CH (Ar)), 8.13 (s, 1H, CH (H-

8)), 8.22 (d, J = 9.2 Hz, 2H, 2 CH (Ar)); LRMS (MS-ES), calcd for C33H38N6O7Na [M+Na] m/z

= 653.28, fnd. 653.30.

261

ethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-(cyclopentylamino)-9H-purin-9-yl)acetate (4.2a).

Purine 4.1a was treated with TFA as per general procedure E, yielding the final product 4.2a as a

white lyophilized solid (89%): IR (KBr, cm-1

) 3373, 2924, 2851, 1753, 1607, 1488, 1384 1261,

1201; δH (400 MHz, CDCl3) 1.18-1.46 (m, 5H, (cyclohexyl)), 1.28 (t, J = 7.2 Hz, 3H,

CO2CH2CH3), 1.46-1.70 (m, 8H, 5H(cyclohexyl) & 3H(cyclopentyl)), 1.71-1.85 (m, 5H,

(cyclopentyl)), 2.03 (bs, 2H (cyclopentyl)), 2.43-2.50 (m, 1H, CH), 4.24 (q, J = 7.2 Hz, 2H,

CO2CH2CH3), 4.58 (d, J = 5.8Hz, 2H, CH2Ar), 4.78 (s, 2H, CH2CO2Et), 5.12 (bs, 1 H, NH), 5.47

(bs, 1 H, NH), 7.15 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.28 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.52 (s,

1H, CH (H-8)); ); δC (100 MHz, CDCl3) 14.1, 23.8, 26.2, 26.9, 33.4, 34.5, 43.8, 44.3, 45.7, 62.0,

113.4, 126.7, 127.5, 136.8, 137.4, 146.6, 151.1, 155.0, 159.5, 167.6; HMS (MS-ES), calcd for


min, purity 97.4% and 91.7%.

ethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-(isobutylamino)-9H-purin-9-yl)acetate (4.2b).

Purine 4.1b was treated with TFA as per general procedure C, yielding the final product 4.2b as

a white lyophilized solid (88%): IR (KBr, cm-1

) 3263, 2957, 2923, 2851, 1750, 1627, 1602,

1550, 1384, 1261, 1222, 1126; δH (400 MHz, CDCl3) 0.96 (d, J = 6.6 Hz, 6H, CH2CH(CH3)2),

1.24-1.47 (m, 8H, 5H (cyclohexyl) and CO2CH2CH3), 1.53-1.95 (m, 6H, CH2CH(CH3)2 and 5

262

(cyclohexyl)), 2.40-2.47 (m, 1H, CH(CH3)2), 3.38 (bs, 2H, CH2CH(CH3)2), 4.24 (q, J = 7.1 Hz,

2H, CO2CH2CH3), 4.58 (d, J = 5.8 Hz, 2H, CH2Ar), 4.78 (s, 2H, CH2CO2Et), 5.07 (bs, 1H, NH),

5.56 (bs, 1H, NH), 7.15 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.29 (d, J = 7.8 Hz, 2H, 2 CH (Ar)),

7.50 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 14.0, 20.1, 26.0, 26.8, 28.5, 29.6, 34.4, 43.6, 44.1,

45.5, 61.8, 113.4, 126.7, 127.5, 136.8, 137.4, 146.6, 151.1, 155.0, 159.5, 167.6; HMS (MS-ES),


(II) 38.507 min, purity 96.8% and 92.7%.

ethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-(isopentylamino)-9H-purin-9-yl)acetate (4.2c).

Purine 4.1c was treated with TFA as per general procedure C, yielding the final product 4.2c as a


) 3265, 2959, 2926, 2852, 1737, 1681, 1650, 1610,

1522, 1429, 1384, 1261, 1231, 1202, 1127, 1098, 1021; δH (400 MHz, CDCl3) 0.92 (d, J = 6.5

Hz, 6H, (CH2)2CH(CH3)2), 1.25-1.39 (m, 9H, 5H (cyclohexyl), CO2CH2CH3, and CH2CH2CH),

1.49-1.65 (m, 2H, CH2CH2CH(CH3)2), 1.65-1.89 (m, 7H, CH2CH2CH(CH3)2 and 5H

(cyclohexyl)), 2.40-2.47 (m, 1H, CH), 3.58 (bs, 1H, NH), 4.02 (s, 1H, NH), 4.24 (q, J = 7.1 Hz,

2H, CO2CH2CH3), 4.58 (s, 2H, CH2Ar), 4.59 (s, 2H, CH2CO2Et),7.15 (d, J = 8.1 Hz, 2H, 2 CH

(Ar)), 7.26 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.61 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 14.0,

22.4, 25.6, 26.0, 26.8, 29.6, 34.4, 38.6, 43.6, 44.1, 45.5, 61.8, 113.4, 126.6, 127.5, 136.7, 137.6,

146.6, 151.2, 155.0, 159.8, 167.6; HMS (MS-ES), calcd for C27H39N6O2 [M+H] m/z = 479.3134,

fnd. 479.3140; rpHPLC tR: condition (I) 20.092 (II) 39.919 min, purity 94.4% and 93.1%.

263

ethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-morpholino-9H-purin-9-yl)acetate (4.2d). Purine

4.1d was treated with TFA as per general procedure C, yielding the final product 4.2d as a white

lyophilized solid (89%): IR (KBr, cm-1

) 3255, 3096, 2925, 2855, 2589, 1787, 1759, 1677, 1608,

1555, 1436, 1215, 1167; δH (400 MHz, CDCl3) 1.27-1.40 (m, 8H, 5H (cyclohexyl) and

CO2CH2CH3), 1.67-1.88 (m, 5H (cyclohexyl)), 2.42-2.48 (m, 1H, CH), 3.73-3.80(m, 4H, 2 CH2,

(morpholine)), 3.94 (bs, 2H, 2 CH2, (morpholine)), 4.27 (q, J = 7.2 Hz, 2H, CO2CH2CH3), 4.56

(s, 2H, CH2Ar), 4.64 (bs, 2H, 2 CH2, (morpholine)), 4.97 (s, 2H, CH2CO2Et), 7.13 (d, J = 8.1

Hz, 2H, 2 CH (Ar)), 7.23 (d, J = 8.2 Hz, 2H, 2 CH (Ar)), 7.40 (s, 1H, CH (H-8)); δC (100 MHz,

CDCl3) 14.1, 26.1, 26.9, 34.5, 43.8, 44.3, 45.7, 62.0, 67.1, 113.4, 126.9, 127.6, 136.1, 137.4,



ethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-((4-fluorophenyl)amino)-9H-purin-9-yl)acetate

(4.2e). Purine 4.1e was treated with TFA as per general procedure C, yielding the final product

4.2e as a white lyophilized solid (95%): IR (KBr, cm-1

) 3357, 2924, 2851, 1747, 1681, 1629,

1594, 1508, 1384, 1208, 1140; δH (400 MHz, CDCl3) 1.26-1.48 (m, 8H, 5H (cyclohexyl) and

CO2CH2CH3), 1.67-1.91 (m, 5H (cyclohexyl)), 2.43-2.49 (m, 1H, CH), 4.26 (q, J = 7.2 Hz, 2H,

CO2CH2CH3), 4.60 (s, 2H, CH2Ar), 4.85 (s, 2H, CH2CO2Et), 6.97-7.01 (m, 2H, 2 CH (Ar)),

264

7.17 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.27 (d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.45-7.78 (m, 4H, 3CH

(Ar) and CH(H-8)); δC (100 MHz, CDCl3) 14.1, 26.1, 26.9, 34.5, 43.8, 44.3, 45.8, 62.1, 113.7,

115.2, 115.4, 121.6, 121.7, 126.9, 127.5, 135.1, 137.1, 137.8, 147.0, 151.7, 152.2, 157.4, 159.5,

159.8, 167.5; HMS (MS-ES), calcd for C28H32N6O2 [M+H] m/z = 503.2571, fnd. 503.2583;

rpHPLC tR: condition (I) 20.913 (II) 40.496 min, purity 92.7% and 85.0%.

ethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)amino)-9H-purin-9-yl)acetate

(4.2f). Purine 4.1f was treated with TFA as per general procedure C, yielding the final product

4.2f as a white lyophilized solid (68%): IR (KBr, cm-1

) 3263, 2923, 2850, 1739, 1678, 1611,

1384, 1200, 1141; δH (400 MHz, CDCl3) 1.25-1.39 (m, 5H, cyclohexyl), 1.63-1.82 (m, 5H

(cyclohexyl)), 2.41-2.49 (m, 1H, CH), 4.16 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.53 (d, J = 5.7

Hz, 2H, CH2NH), 4.65-4.75 (m, 4H, CH2 (furfuryl) and CH2Ar), 5.19 (bs, 1H, NH), 6.02 (bs,

1H, NH (furfuryl)), 6.14-6.16 (m, 1H, CH (furfuryl)), 6.21-6.22 (m, 1H, CH (furfuryl)), 7.10 (d,

J = 8.0 Hz, 2H, 2 CH (Ar)), 7.21 (d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.25-7.26 (m, 1H, CH

(furfuryl)), 7.43 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 14.1, 26.2, 26.9, 34.5, 43.8, 44.3, 45.7,

62.0, 107.3, 110.4, 126.9, 127.6, 137.3, 137.4, 142.0, 146.9, 152.1, 154.4, 167.6; HMS (MS-ES),


(II) 37.814 min, purity 92.8% and 93.24%.

265

ethyl2-(2-((4-cyclohexylbenzyl)amino)-6-(4-nitrophenoxy)-9H-purin-9-yl)acetate (4.2g).

Purine 4.1g was treated with TFA as per general procedure C, yielding the final product 4.2g as a


) 3422, 3231, 3074, 2926, 2853, 1748, 1630, 1526,

1581, 1406, 1384, 1251, 1225; δH (400 MHz, CDCl3) 1.29-1.45 (m, 8H, 5H (cyclohexyl) and

CO2CH2CH3), 1.73-1.85 (m, 5H (cyclohexyl)), 2.43-2.49 (m, 1H, CH), 4.27 (q, J = 7.1 Hz, 2H,

CO2CH2CH3), 4.44 (s, 2H, CH2Ar), 4.86 (s, 2H, CH2CO2Et), 5.28 (bs, 1H, NH), 7.14 (s, 4H, 4

CH (Ar)), 7.36 (d, J = 9.9 Hz, 2H, 2 CH (Ar)), 7.74 (s, 1H, CH (H-8)), 8.23 (d, J = 8.7 Hz, 2H, 2

CH (Ar)); HMS (MS-ES), calcd for C28H31N6O5 [M+H] m/z = 531.2356, fnd. 531.2357;


2-(2-((4-cyclohexylbenzyl)amino)-6-(cyclopentylamino)-9H-purin-9-yl)acetic acid (4.3a).

Purine 4.2a was treated according to general procedure D, to yield final product 4.3a as a white

powder (91%): m.p. > 140 °C (dec); IR (KBr, cm-1

) 3855, 3508, 3294, 2928, 1388, 1202; δH

(400 MHz, DMSO-d6) 1.28-1.41 (m, 5H, (cyclohexyl)), 1.47-1.59 (m, 4H (cyclopentyl)), 1.65-

1.93 (m, 9H, 5H (cyclohexyl) and 4H (cyclopentyl)), 2.40-2.45 (m, 1H, CH), 4.37 (bs, 1H,

NCH), 4.41 (bs, 2H, CH2Ar), 4.81(s, 2H, CH2CO2H), 7.11 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.22

266

(bs, 1H, NH), 7.24 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.56 (bs, 1H, NH), 7.78 (bs, 1H, CH (H-8));

HMS (MS-ES), calcd for C25H33N6O2 [M+H] m/z = 449.2680, fnd. 449.2659; rpHPLC tR:

condition (I) 17.193 (II) 43.772 min, purity 95.1% and 91.9%.

2-(2-((4-cyclohexylbenzyl)amino)-6-(isobutylamino)-9H-purin-9-yl)acetic acid (4.3b). Purine

4.2b was treated according to general procedure D, to yield final product 4.3b as a white powder

(73%): m.p. > 116 °C (dec); IR (KBr, cm-1

) 3549, 3477, 3414, 2920, 1744, 1620, 1449, 1404,

1387, 1367, 1248, 1206; δH (400 MHz, DMSO-d6) 0.81 (s, 3H, CH2CH(CH3)2), 0.83 (s, 3H,

CH2CH(CH3)2), 1.26-1.42 (m, 5H, (cyclohexyl)), 1.62-1.80 (m, 5H, (cyclohexyl)), 1.79-1.92 (m,

1H, CH2CH(CH3)2) 2.33-2.46 (m, 1H, CH), 3.16 (bs, 2H, CH2CH(CH3)2), 4.30-4.43 (m, 2H,

CH2Ar), 4.69 (s, 2H, CH2CO2H), 6.90 (bs, 1H, NH), 7.1 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.23 (d,

J = 7.9 Hz, 2H, 2 CH (Ar)), 7.27 (bs, 1H, NH), 7.64 (s, 1H, CH (H-8)); δC (100 MHz, DMSO-d6)

20.1, 25.5, 26.3, 34.0, 43.4, 43.8, 44.3, 46.9, 112.6, 126.1, 127.3, 137.5, 138.9, 145.4, 151.4,

154.7, 159.1, 169.7; HMS (MS-ES), calcd for C24H33N6O2 [M+H] m/z = 437.2663, fnd.

437.2659; rpHPLC tR: condition (I) 16.906 (II) 45.089 min, purity 96.6% and 97.8%.

2-(2-((4-cyclohexylbenzyl)amino)-6-(isopentylamino)-9H-purin-9-yl)acetic acid (4.3c).

Purine 4.2c was treated according to general procedure D, to yield final product 4.3c as a white

267


) 2937, 2851, 1736, 1646, 1528, 1432, 1244,

1201; δH (400 MHz, DMSO-d6) 0.85 (s, 3H, (CH2)2CH(CH3)2), 0.86 (s, 3H, (CH2)2CH(CH3)2),

1.18-1.60 (m, 8H, 5H (cyclohexyl) and (CH2)2CH(CH3)2 and CH2CH2CH(CH3)2), 1.67-1.77 (m,

5H, (cyclohexyl)), 2.41-2.47 (m, 1H, CH), 3.41 (bs, 2H, CH2CH2CH(CH3)2), 4.47 (s, 2H,

CH2Ar), 4.88 (s, 2H, CH2CO2H), 7.14 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.25 (d, J = 7.7 Hz, 2H, 2

CH (Ar)), 7.58 (bs, 1H, NH), 7.91 (s, 1H, CH (H-8)), 8.32 (bs, 1H, NH); HMS (MS-ES), calcd

for C25H35N6O2 [M+H] m/z = 451.2835, fnd. 451.2816; rpHPLC tR: condition (I) 17.061 (II)

44.519 min, purity 91.9% and 94.2%.

2-(2-((4-cyclohexylbenzyl)amino)-6-morpholino-9H-purin-9-yl)acetic acid (4.3d). Purine

4.2d was treated according to general procedure D, to yield final product 4.3d as a white powder

(73%): m.p. > 147 °C (dec); IR (KBr, cm-1

) 3422, 2923, 2851, 1603, 1542, 1516, 1446, 1416,

1384, 1314, 1272, 1242, 1207, 1121, 1003; δH (400 MHz, DMSO-d6) 1.17-1.36 (m, 5H,

(cyclohexyl)), 1.66-1.77 (m, 5H, (cyclohexyl)), 2.38-2.45 (m, 1H, CH), 3.63 (t, J = 4.4 Hz, 4H, 2

CH2, (morpholine)), 4.08 (bs, 4H, 2 CH2, (morpholine)), 4.37 (d, J = 5.1 Hz, 2H, CH2Ar), 4.78

(s, 2H, CH2CO2H), 7.03 (bs, 1H, NH), 7.1 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.23 (d, J = 7.9 Hz,

2H, 2 CH (Ar)), 7.73 (s, 1H, CH, (H-8)); HMS (MS-ES), calcd for C24H31N6O3 [M+H] m/z =

451.2463, fnd. 451.2452; rpHPLC tR: condition (I) 14.895 (II) 38.319 min, purity 99.9% and

96.6%.

268

2-(2-((4-cyclohexylbenzyl)amino)-6-((4-fluorophenyl)amino)-9H-purin-9-yl)aceticacid

(4.3e). Purine 4.2e was treated according to general procedure D, to yield final product 4.3e as a

white powder (91%): m.p. > 125 °C (dec); IR (KBr, cm-1

) 3429, 3226, 2924, 2851, 1682, 1646,

1509, 1206, 1134; δH (400 MHz, DMSO-d6) 1.31-1.40 (m, 5H, (cyclohexyl)), 1.66-1.76 (m, 5H

(cyclohexyl)), 2.40-2.46 (m, 1H, CH), 4.42 (d, J = 6.2 Hz, 2H, CH2Ar), 4.83 (s, 2H, CH2CO2H),

6.99-7.04 (m, 2H, 2 CH (Ar)), 7.12 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.24 (d, J = 8.1 Hz, 2H, 2

CH (Ar)), 7.29 (bs, 1H, NHAr), 7.75-7.90 (m, 2H, 2 CH (Ar)), 7.83 (s, 1H, CH (H-8)), 9.50 (s,

1H, NHAr), 13.21 (bs, 1H, CO2H); δC (100 MHz, DMSO-d6) 25.5, 26.3, 34.0, 41.7, 43.4, 44.3,

113.1, 114.4, 114.6, 121.5, 121.6, 126.2, 136.5, 138.3, 138.6 145.5, 151.8, 156.0, 158.9, 169.5;

HMS (MS-ES), calcd for C26H28N6O2F [M+H] m/z = 475.2266, fnd. 475.2252; rpHPLC tR:


2-(2-((4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)amino)-9H-purin-9-yl)acetic acid

(4.3f). Purine 4.2f was treated according to general procedure D, to yield final product 4.3f as a

white powder (88%): m.p. > 162 °C (dec); IR (KBr, cm-1

) 3320, 2920, 2855, 1731, 1574, 1530,

1426, 1246, 1201, 1141; δH (400 MHz, DMSO-d6) 1.29-1.42 (m, 5H, 5H (cyclohexyl)), 1.67-

1.77 (m, 5H (cyclohexyl)), 2.41-2.47 (m, 1H, CH), 4.46 (s, 2H, CH2 (furfuryl)), 4.62 (bs, 2H,

269

CH2Ar), 4.88 (s, 2H, CH2CO2H), 6.15-6.26 (m, 1H, CH (furfuryl)), 6.35 (bs, 1H, CH (furfuryl)),

7.12 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.25 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.55 (s, 1H, CH

(furfuryl)), 7.61 (bs, 1H, NH), 7.96 (bs, 1H, CH (H-8)), 8.33-8.55 (bm, 1H, NH); HMS (MS-ES),


(II) 40.686 min, purity 96.4% and 92.2%.

2-(2-((4-cyclohexylbenzyl)amino)-6-(4-nitrophenoxy)-9H-purin-9-yl)acetic acid (4.3g).

Purine 4.2g was treated according to general procedure D, to yield final product 4.3g as a white


) 3550, 3413, 2924, 2852, 1724, 1636, 1616,

1581, 1552, 1522, 1488, 1449; δH (400 MHz, DMSO-d6) 1.31-1.39 (m, 5H, (cyclohexyl)), 1.67-

1.78 (m, 5H, (cyclohexyl)), 2.37-2.44 (m, 1H, CH), 4.07-4.36 (m, 2H, CH2Ar), 4.89 (s, 2H,

CH2CO2H), 6.92-7.26 (m, 4H, 4 CH (Ar)), 7.44-7.53 (m, 2H, 2 CH (Ar)), 7.70 (bs, 1H, NH),

8.01 (s, 1H, CH, (H-8)), 8.23-8.28 (m, 2H, 2 CH (Ar)); δC (100 MHz, DMSO-d6) 25.5, 26.3,

33.9, 43.4, 43.8, 44.2, 113.2, 115.8, 122.6, 125.1, 126.1, 127.4, 127.9, 137.4, 141.9, 144.2, 145.7,

157.6, 158.4, 169.2; HMS (MS-ES), calcd for C26H27N6O5 [M+H] m/z = 503.2026, fnd.

503.2037; rpHPLC tR: condition (I) 13.824 (II) 41.102 min, purity 90.4% and 90.2%.

270

(2-(2-((4-cyclohexylbenzyl)amino)-6-(cyclopentylamino)-9H-purin-9-yl)acetoxy)methyl

pivalate (4.4a). Purine 4.3a was treated with iodomethyl pivalate according to general procedure

E, yielding the final product 4.4a as a lyophilized white solid (78%): IR (KBr, cm-1

) 3404, 2927,

2853, 1762, 1686, 1637, 1437, 1384, 1201.7, 1138, 1110; δH (400 MHz, CDCl3) 1.20 (s, 9H,

C(CH3)3), 1.22-1.43 (m, 9H, 5H (cyclohexyl) and 4H (cyclopentyl)), 1.67-1.75 (m, 5H,

cyclohexyl), 2.00-2.15 (m, 3H, cyclopentyl), 2.43-2.48 (m, 1H, CH), 4.56 (s, 2H, CH2Ar), 4.83

(s, 2H, CH2CO2H), 5.80(s, 2H, OCH2), 6.99 (bs, 1H, NH), 7.15 (d, J = 8.1 Hz, 2H, 2 CH (Ar)),

7.22 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.65 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 23.9, 26.3,

27.0, 27.1, 33.7, 34.7, 39.0, 44.0, 44.5, 44.8, 56.2, 80.7, 111.2, 127.3, 127.7, 135.2, 139.5, 147.7,



(2-(2-((4-cyclohexylbenzyl)amino)-6-(isobutylamino)-9H-purin-9-yl)acetoxy)methyl

pivalate (4.4b). Purine 4.3b was treated with iodomethyl pivalate according to general procedure

E, yielding the final product 4.4b as a lyophilized white solid (61%): IR (KBr, cm-1

) 3282, 2961,

2927, 2852, 1761, 1686, 1641, 1433, 1384, 1202, 1109; δH (400 MHz, CDCl3) 1.01 (d, J =

6.0 Hz, 6H, CH2CH(CH3)2), 1.21 (s, 9H, C(CH3)3), 1.24-1.47 (m, 5H, cyclohexyl), 1.53-1.95 (m,

271

5H, cyclohexyl), 2.02 (heptet, J = 6.6 Hz, CH(CH3)2), 2.43-2.50 (m, 1H, CH(CH3)2), 3.84-3.87

(m, 2H, CH2CH(CH3)2), 4.58 (s, 2H, CH2Ar), 4.82 (s, 2H, CH2CO2H), 5.81 (s, 2H, OCH2), 7.05

(bs, 1H, NH), 7.16 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.26 (d, J = 7.8 Hz, 2H, 2 CH (Ar)), 7.45 (bs,

1H, NH), 7.61 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 19.6, 26.0, 26.6, 26.7, 28.9, 34.3, 38.6,

43.6, 44.1, 44.5, 51.2, 80.3, 110.9, 126.9, 127.3, 134.8, 138.9, 147.4, 152.1, 165.5, 176.8; HMS


22.228 (II) 41.547 min, purity 99.3% and 98.5%.

(2-(2-((4-cyclohexylbenzyl)amino)-6-(isopentylamino)-9H-purin-9-yl)acetoxy)methyl

pivalate (4.4c). Purine 4.3c was treated with iodomethyl pivalate according to general procedure

E, yielding the final product 4.4c as a lyophilized white solid (62%): IR (KBr, cm-1

) 3417, 2955,

2917, 2849, 1765, 1691, 1430, 1384, 1261, 1205, 1108, 1029 δH (400 MHz, CDCl3) 0.95 (d, J =

7.2 Hz, 6H, (CH2)2CH(CH3)2), 1.21 (s, 9H, C(CH3)3), 1.24-1.44 (m, 5H, cyclohexyl), 1.55-1.85

(m, 8H, CH2CH2CH(CH3)2 and 5H (cyclohexyl)), 2.43-2.50 (m, 1H, CH), 4.01 (bs, 2H,

CH2CH2CH(CH3)2), 4.57 (s, 2H, CH2Ar), 4.82 (s, 2H, CH2CO2H), 5.80 (s, 2H, OCH3), 7.03 (bs,

1H, NH), 7.16(d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.24 (d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.61 (s, 1H,

CH (H-8)); δC (100 MHz, CDCl3) 19.6, 22.3, 26.0, 26.6, 26.7, 28.9, 34.3, 38.6, 43.6, 44.1, 44.5,

51.2, 80.4, 99.8, 110.4, 126.9, 127.3, 134.8, 139.1, 149.4, 152.1, 169.2, 182.6; HMS (MS-ES),


(II) 43.125 min, purity 100% and 99.0%.

272

(2-(2-((4-cyclohexylbenzyl)amino)-6-morpholino-9H-purin-9-yl)acetoxy)methyl pivalate

(4.4d). Purine 4.3d was treated with iodomethyl pivalate according to general procedure E,

yielding the final product 4.4d as a lyophilized white solid (54%): IR (KBr, cm-1

) 3421, 2924,

2851, 1636, 1448, 1384, 1200; δH (400 MHz, CDCl3) 1.20 (s, 9H, (CH3)3), 1.32-1.45 (m, 5H,

cyclohexane), 1.72-1.83 (m, 5H, cyclohexane), 2.44-2.47 (m, 1H, CH(cyclohexane)), 3.76-3.78

(m, 2H, O(CH2)2), 4.20 (m, 2H, N(CH2)2), 4.54 (d, J = 5.0 Hz, 2H, CH2NH), 4.85 (s, 2H,

NCH2CO), 5.80 (s, 1H, OCH2O), 7.14 (d, J = 8.0 Hz, 1H, CH (Ar)), 7.26 (d, J = 8.0 Hz 1H, CH

(Ar)), 7.48 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 26.0, 26.6, 26.7, 34.3, 38.6, 44.1, 45.1, 66.6,

80.8, 126.7, 127.1, 135.4, 136.0, 147.0, 152.1, 163.0, 163.3, 165.4, 176.8; HMS (MS-ES), calcd

for C30H41N6O4 [M+H] m/z = 565.3138, fnd. 565.3124; rpHPLC tR: condition (I) 20.347 (II)

40.128 min, purity 95.8% and 94.1%.

(2-(2-((4-cyclohexylbenzyl)amino)-6-((4-fluorophenyl)amino)-9H-purin-9-yl)acetoxy)methyl

pivalate (4.4e). Purine 4.3e was treated with iodomethyl pivalate according to general procedure

E, yielding the final product 4.4e as a lyophilized white solid (42%): IR (KBr, cm-1

) 3415, 2924,

2851, 1757, 1681, 1594, 1508, 1384, 1203, 1131; δH (400 MHz, CDCl3) 1.22 (s, 9H, C(CH3)3),

273

1.31-1.45 (m, 5H, cyclohexyl), 1.72-1.88 (m, 5H, cyclohexyl), 2.44-2.53 (m, 1H, CH), 4.60 (s,

2H, CH2Ar), 4.95 (bs, 2H, CH2), 5.83 (s, 2H, CH2), 7.02-7.08 (m, 2H, C6H4F), 7.17 (d, J = 8.0

Hz, 2H, C6H4), 7.23 (d, J = 7.8 Hz, 2H, C6H4), 7.45-7.51 (m, 2H, C6H4F), 7.61 (bs, 1H, CH (H-

8)); δC (100 MHz, CDCl3) 26.0, 26.6, 26.7, 34.3, 38.6, 44.1, 115.5, 115.7, 126.9, 165.2; HMS

(MS-ES), calcd for C32H37FN6O4 [M+H] m/z = 589.2933, fnd. 589.2960; rpHPLC tR: condition

(I) 25.875 (II) 38.964 min, purity 95.2% and 98.6%.

(2-(2-((4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)amino)-9H-purin-9-

yl)acetoxy)methyl pivalate (4.4f). Purine 4.3f was treated with iodomethyl pivalate according to

general procedure E, yielding the final product 4.4f as a lyophilized white solid (43%): IR (KBr,

cm-1

) 3424, 2961, 2924, 1762, 1685, 1648, 1612, 1429, 1384, 1261; δH (400 MHz, CDCl3) 1.20

(s, 9H, (CH3)3), 1.37-1.45 (m, 5H, cyclohexane), 1.72-1.83 (m, 5H, cyclohexane), 2.45-2.48 (m,

1H, CH(cyclohexane)), 4.77 (m, 2H, CH2 (furan), 4.83 (s, 2H, CH2CO), 5.80 (s, 2H, OCH2O),),

6.22 (m, 1H, CH(furan)), 6.28-6.29 (m, 1H, CH(furan)), 7.15 (d, J = 8.0 Hz, 1H, CH (Ar)), 7.26

(d, J = 8.1 Hz 1H, CH (Ar)), 7.33 (m, 1H, CH (furan)), 7.50 (s, 1H, CH (H-8)); δC (100 MHz,

CDCl3) 26.0, 26.6, 26.7, 34.3, 38.6, 40.4, 44.1, 45.0, 80.3, 99.5, 108.4, 110.3, 123.6, 126.9,



274

(2-(2-((4-cyclohexylbenzyl)amino)-6-(4-nitrophenoxy)-9H-purin-9-yl)acetoxy)methyl

pivalate (4.4g). Purine 4.3g was treated with iodomethyl pivalate according to general procedure

E, yielding the final product 4.4g as a lyophilized white solid (54%): IR (KBr, cm-1

) 3441, 2925,

2851, 1770, 1751, 1627, 1581, 1407, 1384, 1348, 1258, 1235, 1114; δH (400 MHz, CDCl3) 1.22

(s,9H, C(CH3)3), 1.33-1.45 (m, 5H, cyclohexyl), 1.73-1.85 (m, 5H, cyclohexyl), 2.46-2.50 (m,

1H, CH), 4.42 (s, 2H, CH2), 4.94 (s, 2H, CH2Ar), 5.84 (s, 2H, CH2), 7.09-7.16 (m, 4H, CH (Ar)),

7.36 (d, J = 8.9 Hz, 2H, CH (Ar)), 7.77 (s, 1H, CH (H-8)), 8.22-8.25 (d, J = 8.8 Hz, 2H, CH2

(Ar)); δC (100 MHz, CDCl3) 26.3, 27.0, 27.1, 34.7, 39.0, 44.2, 44.4, 45.9, 80.6, 114.34, 122.7,

125.3, 127.2, 127.6, 127.6, 136.2, 140.5. 145.1, 147.6, 157.6, 158.8, 159.5, 166.2, 177.2 ; HMS


29.638 (II) 47.065 min, purity 87.4% and 91.0%.

acetoxymethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-(cyclopentylamino)-9H-purin-9-

yl)acetate (4.5a). Purine 4.3a was treated with bromomethyl acetate according to general

procedure F, yielding the final product 4.5a as a lyophilized white solid (57%): δH (400 MHz,

CDCl3) 1.22-1.43 (m, 9H, 5H (cyclohexyl) and 4H (cyclopentyl)), 1.55 (s, 3H, COCH3), 1.67-

1.75 (m, 5H, cyclohexyl), 2.00-2.15 (m, 3H, cyclopentyl), 2.43-2.48 (m, 1H, CH), 4.56 (s, 2H,

275

CH2Ar), 4.83 (s, 2H, CH2CO2H), 5.80(s, 2H, OCH2), 6.99 (bs, 1H, NH), 7.15 (d, J = 8.1 Hz, 2H,

2 CH (Ar)), 7.22 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.65 (s, 1H, CH (H-8));δC (100 MHz, CDCl3)

13.8, 21.7, 27.8, 27.9, 28.3, 43.0, 43.7, 47.3, 79.3, 115.7, 126.5, 127.0, 127.1, 128.0, 140.0,



acetoxymethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-(isobutylamino)-9H-purin-9-yl)acetate

(4.5b). Purine 4.3b was treated with bromomethyl acetate according to general procedure F,

yielding the final product 4.5b as a lyophilized white solid (56%): IR (KBr, cm-1

) 3386, 2927,

2853, 1774, 1685, 1642, 1515, 1433.53, 1367, 1202, 1139; δH (400 MHz, CDCl3) 1.19-1.28 (m,

2H, CH2CH), 1.29-1.33 (d, J = 6.7 Hz, 6H, CH(CH3)2), 1.32-1.43 (m, 5H, cyclohexyl), 1.70-1.90

(m, 5H, cyclohexyl), 1.96-2.08 (m, 1H, CH(CH3)2), 2.11 (s, 3H, COCH3), 2.43-2.49 (m, 1H,

CH), 3.84 (t, J = 6.6 Hz, 2H, NHBn), 4.56 (s, 1H, NHCH2CH), 4.57 (s, 2H, CH2), 4.83 (s, 2H,

COCH2NH), 5.80 (s, 2H, OCH2O), 7.16 (d, J = 7.7 Hz , 2H, C6H4), 7.24 (d, J = 7.9 Hz , 2H,

C6H4), 7.49-7.53 7.63 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 19.7, 20.4, 26.0, 26.7, 28.9, 34.3,

43.5, 44.1, 44.5, 51.2, 79.9, 110.9, 126.9, 127.4, 134.9, 138.9, 147.4, 149.6, 152.1, 165.6, 169.2;

HMS (MS-ES), calcd for C27H37N6O4 [M+H] m/z = 509.2876, fnd. 509.2887; rpHPLC tR:


276

acetoxymethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-(isopentylamino)-9H-purin-9-yl)acetate

(4.5c). Purine 4.3c was treated with bromomethyl acetate according to general procedure F,

yielding the final product 4.5c as a lyophilized white solid (41%): δH (400 MHz, CDCl3) 0.91 (d,

J = 7.1 Hz, 6H, (CH2)2CH(CH3)2), 1.23-1.27 (m, 9H, 5H (cyclohexyl), 1.47-1.53 (m, 2H,

CH2CH2CH(CH3)2), 1.64-1.83 (m, 7H, CH2CH2CH(CH3)2 and 5H (cyclohexyl)), 2.10 (s, 3H,

COCH3), 2.40-2.52 (m, 1H, CH), 3.56 (bs, 1H, NH), 4.02 (s, 1H, NH), 4.58 (s, 2H, CH2Ar), 4.83

(s, 2H, CH2CO2), 5.79 (s, 2H, OCH2), 7.14 (d, J = 8.2 Hz, 2H, 2 CH (Ar)), 7.26 (d, J = 8.1 Hz,

2H, 2 CH (Ar)), 7.48 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 14.1, 20.5, 20.9, 22.4, 22.6, 26.0,

26.8, 34.3 38.5, 43.3, 44.1, 45.4, 60.6, 76.6, 76.9, 77.3, 79.7, 126.7, 127.5; HMS (MS-ES), calcd

for C31H45N6O4 [M+H] m/z = 565.3502, fnd. 565.3496.

acetoxymethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-morpholino-9H-purin-9-yl)acetate

(4.5d). Purine 4.3d was treated with bromomethyl acetate according to general procedure F,

yielding the final product 4.5d as a lyophilized white solid (37%): IR (KBr, cm-1

) 3424, 2924,

2852, 1766, 1606, 1583, 1546, 1450, 1384, 1220, 1164; δH (400 MHz, CDCl3) 1.21-1.44 (m, 5H,

cyclohexyl), 1.72-1.83 (m, 5H, cyclohexyl), 2.91 (s, 3H, COCH3), 2.45-2.50 (m, 1H, CH), 3.77

(t, J = 4.8 Hz, 4H, 2 CH2 (morpholine)), 4.19 (bs, 4H, 2 CH2, (morpholine)), 4.55 (d, J = 5.8 Hz,

2H, CH2Ar), 4.85 (s, 2H, CH2CO2), 5.03 (bs, 1H, NH), 5.79 (s, 2H, OCH2), 7.15 (d, J = 8.0 Hz,

2H, 2 CH (Ar)), 7.27 (d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.50 (s, 1H, CH, (H-8)); HMS (MS-ES),


(II) 35.975 min, purity 91.4% and 92.1%.

277

acetoxymethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-((4-fluorophenyl)amino)-9H-purin-9-

yl)acetate (4.5e). Purine 4.3e was treated with bromomethyl acetate according to general

procedure F, yielding the final product 4.5e as a lyophilized white solid (52%): IR (KBr, cm-1

)

3416, 2925, 2852, 1770, 1682, 1626, 1508, 1203; δH (400 MHz, CDCl3) 1.26-1.45 (m, 5H,

cyclohexyl), 1.72-1.88 (m, 5H, cyclohexyl), 2.12 (s, 3H, COCH3), 2.42-2.48 (m, 1H, CH), 3.45-

3.50 (m, 2H, cyclohexyl), 4.60 (s, 2H, CH2Ar), 4.97 (s, 2H, CH2CO2), 5.82 (s, 2H, OCH2), 7.03

(t, J = 8.3 Hz, 2H, C6H4F), 7.17 (d, J = 8.0 Hz , 2H, C6H4), 7.25 (d, J = 8.0 Hz , 2H, C6H4), 7.49-

7.53 (m, 2H, C6H4F), 7.58 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 20.8, 26.3, 27.1, 34.7, 44.5,

45.5, 80.35, 115.8, 116.0, 117.9, 124.5, 127.3, 127.6, 135.5, 147.6, 147.7, 163.9, 164.25, 165.8,

169.6; HMS (MS-ES), calcd for C29H31FN6O4 [M+H] m/z = 547.2469, fnd. 547.2478; rpHPLC

tR: condition (I) 20.286 (II) 40.006 min, purity 97.4% and 93.8%.

acetoxymethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)amino)-9H-purin-9-

yl)acetate (4.5f). Purine 4.3f was treated with bromomethyl acetate according to general

procedure F, yielding the final product 4.5f as a lyophilized white solid (46%): IR (KBr, cm-1

)

3416, 2924, 2851, 1764, 1685, 1612, 1384, 1261, 1201, 1127; δH (400 MHz, CDCl3) 1.27-1.41

(m, 5H, 5H (cyclohexyl)), 1.69-1.89 (m, 5H (cyclohexyl)), 2.12 (s, 3H, CH3), 2.45-2.50 (m, 1H,

278

CH), 4.60 (bs, 2H, CH2), 4.76 (s, 1H, NH), 4.88 (bs, 2H, CH2Ar), 5.24 (bs, 2H, CH2), 5.80 (s,

2H, OCH2), 6.29-6.33 (m, 1H, CH (furfuryl)), 6.35 (bs, 1H, CH (furfuryl)), 7.16 (d, J = 8.1 Hz,

2H, C6H4), 7.25 (d, J = 7.9 Hz, 2H, C6H4), 7.26 (bs, 1H, CH), 7.96 (s, 1H, CH (H-8)); δC (100

MHz, CDCl3) 13.9, 20.5, 22.5, 26.0, 26.8, 29.6, 34.4, 36.6, 43.4, 44.1, 45.5, 63.5, 79.7. 107.1,

110.2, 126.8, 127.5, 136.7, 141.8, 146.8, 152.0, 166.4, 169.2; HMS (MS-ES), calcd for



acetoxymethyl 2-(2-((4-cyclohexylbenzyl)amino)-6-(4-nitrophenoxy)-9H-purin-9-yl)acetate

(4.5g). Purine 4.3g was treated with bromomethyl acetate according to general procedure F,

yielding the final product 4.5g as a lyophilized white solid (45%): IR (KBr, cm-1

) 3423, 2926,

2851, 1769, 1627, 1577, 1524, 1384, 1346, 1237; δH (400 MHz, CDCl3) 1.33-1.43 (m, 5H,

cyclohexyl), 1.73-1.84 (m, 5H, cyclohexyl), 2.13 (s, 3H, CH3) 2.46-2.50 (m, 2H, CH), 4.42 (s,

2H, CH2), 4.96 (s, 2H, CH2) 5.70 (s, 1H, NH), 5.83 (s, 2H, CH2), 7.02-7.12 (m, 4H, CH (Ar)),

7.35 (d, J = 8.6 Hz, 2H, CH (Ar)), 7.86 (s, 1H, CH (H-8)), 8.23 (d, J = 8.6 Hz, 2H, CH (Ar)); δC

(100 MHz, CDCl3) 20.8, 26.3, 27.1, 34.7, 44.4, 45.8, 80.2, 122.7, 125.3, 127.0, 127.2, 127.6,




279

2-((tert-butyldimethylsilyl)oxy)ethanol (4.6). To a stirring solution of ethylene glycol (0.1 M),

cooled to 0 oC in THF was added 60% NaH (dispersion in mineral oil, 1.0 eq). Upon observation

of dissolution to a milky white suspension solid tert butyl dimethyl silyl chloride (TBDMSiCl,

1.0 eq) was added. The reaction flask was then removed from the 0 oC ice bath and allowed to

stir under a nitrogen atmosphere at room temperature for approximately 8.0 h. Reaction status is

monitored though thin layer chomatography (TLC) staining by KMnO4. The reaction was diluted

with water and repeatedly extracted with EtOAc. The combined organics were washed with

water and brine, dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure.

Resulting residue was columned on silica gel isocratically in a 2:1 ethyl acetate/ hexanes to yield

product 4.6 as a off-yellow clear liquid (80%): IR (KBr, cm-1

) 3420.51, 2955.65, 2930.30,

2858.48, 1472.74, 1384.48, 1256.91, 1118.32, 1060.01, 938.90, 836.56, 77793, 665.44; δH

(400 MHz, CDCl3) 0.08 (s, 6H, Si(CH3)2C(CH3)3), 0.91 (s, 9H, Si(CH3)2C(CH3)3), 3.62-3.66 (m,

3H, CH2 and OH), 3.70-3.72 (m, 2H, CH2); LRMS (MS- ES) calcd for C14H34O2Si2 [M+H] m/z =

177.12, fnd. 177.04.

tert-butyl (9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-chloro-9H-purin-2-yl)carbamate (4.7)

Chloro-purine 3.2 was treated with PPh3, DIAD and the monosilylated alcohol (4.7) using

Mitsunobu conditions as per general procedure G to afford a viscous oil (95%): IR (KBr, cm-1

)

3260.43, 2955.13, 2857,75, 1752.37, 1609.94, 1573.17, 1521.60, 1472.38, 1444.27, 1405.01,

1367.57, 1306.40, 1257.51, 1223.24, 1206.08, 1156.59, 1138.06, 1062.43, 1006.54, 921.50,

875.34, 837.04, 810.96, 777.97, 724.68, 663.44; δH (400 MHz, CDCl3) -0.05 (s, 6H, Si(CH3)2),

0.85 (s, 9H, Si(CH3)3), 1.55 (s, 9H, (CH3)3), 3.93 (t, J = 4.9 Hz, 2H, CH2CH2OSi(CH3)2(CH3)3),

4.21 (t, J = 4.9 Hz, 2H, CH2CH2OSi(CH3)2(CH3)3), 8.09 (s, 1H, (H-8)).; LRMS (MS- ES) calcd

for C18H30ClN5O3Si [M-H] m/z = 426.181, fnd. 426.18.

280

tert-butyl(9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-chloro-9H-purin-2-yl)(4-

cyclohexylbenzyl)carbamate (4.8)

BOC protected, silylated chloro-purine (4.7) was reacted with cyclohexyl benzyl alcohol under

Mitsunobu conditions as per general procedure H to afford (4.8) as a slightly red, clear viscous

oil (82%); IR (KBr, cm-1

) 3259.77, 2955.01, 2930.71, 2857.69, 1751.63, 1609.72, 1573.17,

1521.50, 1472.23, 1444.23, 1404.89, 1367.55, 1306.46, 1278.12, 1257.50, 1223.21, 1206.01,

1156.67, 1138.38, 1063.08, 922.19, 837.24, 811.12, 778.57, 724.77, 646.11; δH (400 MHz,

CDCl3) -0.10 (s, 6H, Si(CH3)2C(CH3)3), 0.83 (s, 9H, Si(CH3)2C(CH3)3), 1.16 – 1.42 (m, 6H,

(cyclohexy)), 1.46 (s, 9H, C(O)C(CH3)3), 2.43 (m, 1H, CH), 3.87 (t, J = 4.8 Hz,

CH2CH2OSi(CH3)2C(CH3)3), 4.27 (t, J = 4.9 Hz, CH2CH2OSi(CH3)2C(CH3)3), 5.15 (s, 2H, Ar-

CH2), 7.09 (d, J = 8.1 Hz, 2H 2CH (Ar)), 7.27 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 8.07 (s, 1H, CH

(H-8)); LRMS (MS- ES) calcd for C31H46ClN5O5Si [M+H] m/z = 600.31, fnd. 600.36.

tert-butyl (9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-(cyclopentylamino)-9H-purin-2-yl)(4-

cyclohexylbenzyl)carbamate (4.9a). Protected chloro-purine 4.8 reacts with cyclopentyl amine

according to general procedure A to afford 4.8 a as a viscous oil (81%); IR (KBr, cm-1

) 3420.90,

2926.75, 2853.92, 1701.84, 1617.54, 1593.63, 1473.26, 1436.09, 1384.62, 1252.08, 1157.91,

1112.08, 1028.73, 954.64, 934.64, 835.51, 777.81, 706.63, 642.03; δH (400 MHz, CDCl3) -0.09

(s, 6H, Si(CH3)2C(CH3)3), 0.84 (s, 9H, Si(CH3)2C(CH3)3), 1.16 – 1.39 (m, 6H, (cyclohexy)),

1.41 (s, 9H, C(O)C(CH3)3), 1.66 – 1.87 (m, 8H, (cyclopentyl)), 2.43 (bs, 1H, C-H cyclohexyl),

281

3.56 (t, J = 5.0, 2H, CH2CH2OSiC(CH3)2C(CH3)3), 4.20 (t, J = 5.0, 2H,

CH2CH2OSi(CH3)2(CH3)3), 5.03 (s, 2H, Ar-CH2), 7.07 (d, J = 8.1 Hz, 2H, 2CH (Ar)), 7.30 (d, J

= 8.70, Hz, 2H, 2CH (Ar)), 7.74 (s, 1H, CH (H-8)); LRMS (ES–MS) calcd for C36H56N6O3Si

[M+H] m/z = 649.42, fnd. 649.35

tert-butyl (9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-(isobutylamino)-9H-purin-2-yl)(4-

cyclohexylbenzyl)carbamate (4.9b). Protected chloro-purine 4.8 reacts with isobutyl amine

according to general procedure A to afford 4.9b as an oil (82%); δH NMR (400 MHz, CDCl3) -

0.09 (s, 6H, dimethyl of silyl ether), 0.84 (s, 9H, tert butyl of silyl ether H’s), 0.94 (d, J = 6.6 Hz,

6H, alkyl and cyclohexyl H’s), 1.37 (dd, J = 12.2 and 8.8 Hz, 4H, cyclohexyl), 1.42 (s, 9H, tert

butyl of BOC group), 1.66-1.97 (m, 6H alkyl), 2.44 (s, 1H, CH cyclohexyl), 3.40 (s, 1H,

CH(CH3)2), 3.87 (t, J = 5.0 Hz, 2H, SiO-CH2CH2), 4.21 (t, J = 5.0 Hz, 2H, SiO-CH2CH2), 5.05

(s, 2H, ArCH2), 5.62 (s, 1H, NH), 7.08 (d, J = 7.8 Hz, 2H, 2 CH (Ar)), 7.30 (d, J = 7.9 Hz, 2H, 2

CH (Ar)), 7.76 (s, 1H, CH (H-8)); LRMS (ES-MS) calcd for C35H56N6O3Si [M+H] m/z = 637.42,

fnd. 637.61.

tert-butyl (9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-(isopentylamino)-9H-purin-2-yl)(4-

cyclohexylbenzyl)carbamate (4.9c). Protected chloro-purine 4.8 reacts with isoamylamine

282

according to general procedure A to afford 4.9c as a loose oil (94%); δH NMR (400 MHz,

CDCl3) 0.09 (s, 6H, dimethyl of the silyl ether), 0.84 (s, 9H, tert butyl of the silyl ether), 0.92 (d,

J = 6.6 Hz, 6H, dimethyl groups of the isopentyl group), 1.13-1.41 (m, 7H, alkyl and

cyclohexyl), 1.42 (s, 9H, tert butyl group), 1.45-1.90 (m, 8H, cyclohexyl and alkyl), 2.43 (m, 1H,

cyclohexyl), 3.87 (t, J = 4.9 Hz, 2H, SiOCH2CH2), 4.21 (t, J = 4.9 Hz, 2H, SiOCH2CH2), 5.06 (s,

2H, ArNR-CH2), 5.50 (s, 1H, Ar-NH), 7.08 (d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.31 (d, J = 7.8 Hz,

2H, 2 CH (Ar)), 7.75 (s, 1H, CH (H-8)),; LRMS (MS- ES) calcd for C36H58N6O3Si [M+H] m/z =

651.43, fnd. 651.49.

tert-butyl (9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-morpholino-9H-purin-2-yl)(4-

cyclohexylbenzyl)carbamate (4.9d). Protected chloro-purine 4.8 reacts with morpholine

according to general procedure A to afford 4.9d as a loose oil (78%); IR (KBr, cm-1

) 3425, 3275,

2980, 2940, 2868, 1761, 1705, 1625, 1495, 1390, 1270, 1208; δH (400 MHz, CDCl3) 0.85 (t, J =

7.0 Hz, 3H, (CH2)4CH3), 1.29-1.33 (m, 7H, CO2CH2CH3 and (CH2)2CH2CH2CH3), 1.48 (s, 9H,

C(CH3)3), 1.58-1.65 (m, 2H, (CH2)3CH2CH3), 3.77-3.81 (m, 2H, CH2(CH2)3CH3), 4.25 (q, J =

7.1 Hz, 2H, CO2CH2CH3), 4.83 (bs, 2H, CH2Ar), 4.90 (s, 2H, CH2CO2Et), 6.05 (bs, 1H, NH),

7.09 (t, J = 7.5 Hz, 1H, CH (Ar)), 7.27-7.38 (m, 4H, CH (Ar)), 7.75 (s, 1H, CH (H-8)); LRMS

(MS- ES) calcd for C35H54N6O4Si [M+H] m/z = 650.40, fnd. 651.52.

283

tert-butyl (9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-((4-fluorophenyl)amino)-9H-purin-2-

yl)(4-cyclohexylbenzyl)carbamate (4.9e). Protected chloro-purine 4.8 reacts with 4-fluroaniline

according to general procedure B to afford 4.9e as a loose oil (60%); δH NMR (400 MHz,

CDCl3) δ -0.09 (s, 6H, silyl ether dimethyl), 0.84 (d, J = 1.1 Hz, 9H, silyl ether tert-butyl), 1.04 –

1.37 (m, 6H, cyclohexyl), 1.41 (s, 9H, BOC tert-butyl), 1.82 (m, 5H, cyclohexyl), 2.43-2.45 (m,

1H, cyclohexyl), 2.61 (d, J = 0.9 Hz, 1H, CH2), 3.89 (t, J = 4.8 Hz, 2H, SiOCH2CH2), 4.25 (t, J =

4.9 Hz, 2H, SiOCH2CH2), 5.11 (s, 2H, Ar-NR- CH2), 6.94 (t, J = 8.5 Hz, 2H, 2 CH (Ar) coupled

to F), 7.10 (d, J = 7.8 Hz, 2H, 2ArCH), 7.28 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.72 (dd, J = 8.9 and

4.8 Hz, 2H, 2CH (Ar), coupled to F), 7.84 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd for

C37H51FN6O3Si [M+H] m/z = 675.38, fnd. 675.51.

tert-butyl (9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-((furan-2-ylmethyl)amino)-9H-purin-

2-yl)(4-cyclohexylbenzyl)carbamate (4.9f). Protected chloro-purine 4.8 reacts with

furfurylamine according to general procedure A to afford 4.9f as an off-white oil (81%): δH

(400 MHz, CDCl3); -0.09 (s, 6H, Si(CH3)2), 0.85 (s, 9H, Si-C(CH3)3), 1.30-1.39 (m, 5H,

cyclohexyl), 1.42 (s, 9H, CO2C(CH3)3), 1.69-1.89 (m, 5H, cyclohexyl), 2.41-2.46 (m, 1H,

cyclohexyl), 3.87 (t, J = 4.86 Hz, 2H, OCH2CH2N), 4.21 (t, J = 4.99 Hz, 2H, OCH2CH2N), 4.78

284

(bs, 2H, furyl-CH2), 5.07 (s, 2H, benzyl-CH2), 5.95 (bs, 1H, furyl-CH2NH), 6.20 (m, 1H, CH

(furyl)), 6.29 (m, 1H, CH (furyl)), 7.08 (d, 7.9 J = Hz, 2H, 2 CH (Ar)), 7.29 (d, J = 7.9 Hz, 2H, 2

CH (Ar)), 7.34 (s, 1H, CH (furyl)), 7.77 (s, 1H, CH (Ar))LRMS (MS- ES) calcd for

C36H52N6O4Si [M+H] m/z = 661.38, fnd. 661.50.

tert-butyl 4-cyclohexylbenzyl(6-(cyclopentylamino)-9-(2-hydroxyethyl)-9H-purin-2-

yl)carbamate (4.10a). Deprotection of the siyl ether 4.9a was achieved using general procedure

I affording 4.10a as a white powder (91%); IR (KBr, cm-1

) 3324.47, 3125.67, 2924.89, 2849.15,

1738.58, 1702.06, 1624.67, 1603.41, 1514.85, 1481.02, 1429.39, 1382.02, 1360.25, 1228.65,

1154.26, 1102.14, 1077.38, 1058.72, 997.78, 971.03, 934.69, 861.30, 831.68, 807.39, 790.25,

767.54, 727.11, 638.65, 528.32; δH (400 MHz, CDCl3) 1.17–1.41 (m, 6H, (cyclohexy)), 1.43 (s,

9H, C(O)C(CH3)3), 1.46–1.65 (m, 4H, (cyclopentyl)), 1.66-1.89 (m, 8H, CH2 (cyclohexyl) and

(cyclopentyl)), 1.99 (bs, 2H (cyclopentyl)), 2.43-2.45 (m, 1H, CH cyclohexyl), 4.03 (bs, 2H,

CH2CH2OSi(CH3(2C(CH3)3), 4.25 (t, J = 4.0, 2H, CH2CH2OSi(CH3)2(CH3)3CH2CH2N), 5.13 (s,

2H, (benzyl)), 5.60 (bs, 1H, cyclopentyl), 7.10 (d, J = 8.1 Hz, 2H, 2 CH (Ar)), 7.27 (s, 2H, CH

(Ar)), 7.58 (s, 1H, CH (H-8)); LRMS (ES – MS) calcd for C30H42N6O3 [M+H] m/z = 535.33, fnd.

535.40.

285

tert-butyl-4-cyclohexylbenzyl(9-(2-hydroxyethyl)-6-(isobutylamino)-9H-purin-2-

yl)carbamate (4.10b). Deprotection of the siyl ether 4.9b was achieved using general procedure

I affording 4.10b as a white powder (93%); δH (400 MHz, CDCl3) 0.90 (d, J = 6.6 Hz, 6H,

alkyl), 1.16–1.41 (m, 5H, cyclohexyl), 1.43 (s, 9H, tert butyl group), 1.65–1.93 (m, 6H,

cyclohexyl and alkyl), 2.45-2.47 (m, 1H, cyclohexyl), 3.32 (m, 1H, alkyl), 4.02 (s, 2H,

SiOCH2CH2), 4.21–4.30 (m, 2H, SiOCH2CH2), 5.12 (s, 2H, CH2Ar), 7.09 (d, J = 7.8 Hz, 2H, 2

CH (Ar)), 7.26 (d, J = 7.7Hz, 2H, 2 CH (Ar)), 7.58 (s, 1H, CH (H-8)); LRMS (MS-ES) calcd for

C29H42N6O3 [M+H] m/z = 523.33, fnd. 523.40.

tert-butyl4-cyclohexylbenzyl(9-(2-hydroxyethyl)-6-(isopentylamino)-9H-purin-2-

yl)carbamate (4.10c). Deprotection of the siyl ether 4.9c was achieved using general procedure

I affording 4.10c as a viscous oil (81%): δH (400 MHz, DMSO-d6) 0.84 (d, J = 6.6 Hz, 6H,

dimethyl of the isopentyl group), 1.32 (d, J = 11.0 Hz, 4H, cyclohexyl and alkyl), 1.36 (s, 9H,

tert butyl (BOC)), 1.39-1.81 (m, 7H, cyclohexyl and alkyl), 2.43–2.47 (m, 1H, cyclohexyl), 3.39

(d, J = 7.4 Hz, 2H, isopentyl), 3.69 (q, J = 5.4 Hz, 2H, HOCH2CH2), 4.09 (t, J = 5.5 Hz, 2H,

HOCH2CH2), 4.90 (s, 2H, CH2Ar)), 4.97 (t, J = 5.4 Hz, 2H, ArNH-CH2), 7.07 (d, J = 7.9 Hz, 2H,

2 CH (Ar)), 7.21 (d, J = 7.8 Hz, 2H, 2 CH (Ar)), 7.96 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd

for C30H44N6O3 [M+H] m/z = 537.35, fnd. 537.40.

286

tert-butyl 4-cyclohexylbenzyl(9-(2-hydroxyethyl)-6-morpholino-9H-purin-2-yl)carbamate

(4.10d). Deprotection of the siyl ether 4.9d was achieved using general procedure I affording

4.10d as a (98%); δH (400 MHz, CDCl3) 0.75-1.41(m, 5H, cyclohexyl), 1.42 (s, 9H, BOC-tert-

butyl), 1.48-1.90 (m, 5H, cyclohexyl), 2.45 (s, 1H, cyclohexyl), 3.39 (s, 4H, morpholine), 3.73 (t,

J = 4.4 Hz, 4H, morpholine), 3.98-4.04 (m, 2H, HOCH2CH2N), 4.25-4.30 (m, 2H,

HOCH2CH2N), 5.09 (s, 2H, CH2Ar), 7.10 (d, J = 7.9 Hz, 2H, 2 CH (Ar)), 7.23 (d, J = 7.9 Hz,

2H, 2 CH (Ar)), 7.60 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd for C29H40N6O4 [M+H] m/z =

537.31, fnd. 537.42.

tert-butyl 4-cyclohexylbenzyl(6-((4-fluorophenyl)amino)-9-(2-hydroxyethyl)-9H-purin-2-

yl)carbamate (4.10e). Deprotection of the siyl ether 4.9e was achieved using general procedure

I affording 4.10e as a loose oil (98%); δH (400 MHz, CDCl3) 1.43 (s, 9H, C(CH3)3), 1.65-1.75

(m, 5H, cycohexyl), 1.80-1.86 (m, 5H, cyclohexyl), 2.44-2.49 (m, 1H, cyclohexyl), 4.29-4.34

(m, 2H, OHCH2CH2), 4.24 (t, J = 6.0 Hz, 1H, OH), 6.87 (t, J = 8.8 Hz, 2H, OHCH2CH2), 7.12

(d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.21 (d, J = 7.7 Hz, 2H, 2CH (Ar)), 7.53-7.57 (m, 2H, 2CH (Ar)),

7.63 (s, 2H, 2CH (Ar)), 7.69 (s, 1H, CH (H-8)); LRMS (MS-ES) calcd for C37H38FN6O3 [M+H]

m/z = 561.291 fnd. 561.34.

287

tert-butyl 4-cyclohexylbenzyl(6-((furan-2-ylmethyl)amino)-9-(2-hydroxyethyl)-9H-purin-2-

yl)carbamate (4.10f). Deprotection of the siyl ether 4.9f was achieved using general procedure I

affording 4.10f as a viscous oil (93%): δH (400 MHz, CDCl3) 0.80-1.41 (m, 5H, cyclohexyl),

1.43 (s, 9H, BOC-tertbutyl), 1.68-1.89 (m, 5H, cyclohexyl), 2.45 (s, 1H, cyclohexyl proton), 4.02

(s, 2H, HOCH2CH2N), 4.23-4.31 (m, 2H, HOCH2CH2N), 4.70 (s, 1H, hydroxyl), 5.15 (s, 2H,

benzyllic methylene), 6.14 (s, 1H, furylamine), 6.29 (t, J = 2.5 Hz, 1H, furylamine), 7.10 (d, J =

7.8 Hz, 2H, 2 CH (Ar)), 7.25 (d, J = 5.1 Hz, 2H, 2CH (Ar)), 7.34 (s, 1H, furylamine), 7.60 (s,

1H, CH (H-8)); LRMS (MS- ES) calcd for C30H38N6O4 [M+H] m/z = 547.30, fnd. 547.45.

2-(2-((4-cyclohexylbenzyl)amino)-6-(cyclopentylamino)-9H-purin-9-yl)ethylsulfamate

(4.11a). This intermediate was not observed. The general procedure J was used on intermediate

4.10a, which resulted in acylation and cleavage of the BOC group case which was purified

directly to final product 4.12a.

22-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-(isobutylamino)-9H-purin-9-

yl)ethyl sulfamate (4.11b). Purine 4.10b was reacted with 4.13 in accordance to general

procedure J to afford 4.11b as a greasy precipitate (87%); δH (400 MHz, CDCl3) 0.93 (d, J = 6.6

288

Hz, 6H, alkyl), 1.25 (m, 2H, alkyl), 1.39 (s, 9H, tert butyl), 1.82 (m, 4H, cyclohexyl), 2.45-2.47

(m, 1H, cyclohexyl), 3.34 (s, 2H, CH2), 4.47 (t, J = 5.0 Hz, 2H, SiOCH2CH2), 4.71 (t, J = 5.0 Hz,

2H, SiOCH2CH2), 5.07 (s, 2H, Ar-CH2), 5.59 (s, 2H, SO2NH2), 7.12 (d, J = 7.7 Hz, 2H, 2 CH

(Ar)), 7.28 (s, 2H, 2 CH (Ar)), 7.65 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd for C29H44N7O5S

[M+H] m/z = 602.30, fnd. 602.52.


yl)ethyl sulfamate (4.11c). Purine 4.10c was reacted with 4.13 in accordance to general

procedure J to afford 4.11c as a greasy white precipitate (65%): δH (400 MHz, CDCl3) 0.91 (d, J

= 6.5 Hz, 6H, dimethyl of the isopentyl group), 1.39 (s, 9H, BOC tert butyl group), 1.49 (d, J =

7.2 Hz, 1H, alkyl), 1.62-1.97 (m, 7H, cyclohexyl and alkyl), 2.45-2.47 (m, 1H, cyclohexyl), 3.54

(s, 1H, ArNH), 4.46 (t, J = 5.0 Hz, 2H, SOCH2CH2), 4.72 (t, J = 5.0 Hz, 2H, SiOCH2CH2), 5.09

(s, 2H, ArNH-CH2), 7.11 (d, J = 7.8 Hz, 2H, 2 CH (Ar)), 7.28 (d, J = 7.9 Hz, 2H, 2 CH (Ar)),

7.62 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd for C30H45N7O5S [M+H] m/z = 616.32, fnd.

616.23.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-morpholino-9H-purin-9-yl)ethyl

sulfamate (4.11d). Purine 4.10d was reacted with 4.13 in accordance to general procedure J to

289

afford 4.11d as a greasy precipitate (60%): IR (KBr, cm-1

) 3425, 3275, 2980, 2940, 2868, 1761,

1705, 1625, 1495, 1390, 1270, 1208; δH (400 MHz, CDCl3) 1.01-1.41 (m, 5H, cyclohexyl), 1.42

(s, 9H, BOC - tertbutyl), 1.49-1.89 (m, 5H, cyclohexyl), 2.45 (s, 1H, cyclohexyl), 3.10-3.60 (m,

8H, morpholine protons), 3.98-4.03 (m, 2H, SOCH2CH2), 4.16 (s, 2H, CH), 4.24-4.31 (m, 2H,

SOCH2CH2), 5.09 (s, 2H, NH2), 7.10 (d, J = 7.7 Hz, 2H, Ar(CH)), 7.23 (d, J = 7.7 Hz, 2H,

Ar(CH)), 7.60 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd for C29H40N6O4 [M+H] m/z = 537.31,

fnd. 537.42.

2-(2-((tert-butoxycarbonyl)(4-cyclohexylbenzyl)amino)-6-((4-fluorophenyl)amino)-9H-

purin-9-yl)ethyl sulfamate (4.11e). Purine 4.10e was reacted with 4.13 in accordance to general

procedure J to afford 4.11e as a greasy precipitate (81%): δH (400 MHz, CDCl3) 1.13-1.27 (m,

5H, cyclohexyl), 1.35 (s, 9H, CO2C(CH3)3), 1.61-1.74 (m, 5H, cyclohexyl), 2.37-2.45 (m, 1H,

cyclohexyl), 4.41-4.51 (m, 4H, OCH2CH2N), 4.97 (s, 2H, CH2-Ar), 7.01 (t, J = 8.7 Hz, 2H,

ArCH), 7.11 (d, J = 7.43 Hz, 2H, ArCH), 7.22 (d, J = 8.0 Hz, 2H, ArCH), 7.59 (s, 2H, SO3NH2),

7.86-7.89 (m, 2H, ArCH), 8.21 (s, 1H, ArCH), 10.01 (s, 1H, Ar-NH); LRMS (MS- ES) calcd for

C31H38FN7O5S [M-H] m/z = 639.26, fnd. 638.38.

290

2-(2-((4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)amino)-9H-purin-9-yl)ethyl

sulfamate (4.11f). Purine 4.10f was reacted with 4.13 in accordance to general procedure J to

afford 4.11f as a white precipitate (87%); δH (400 MHz, CDCl3) 1.04 (m, 5H, cyclohexyl), 1.40

(s, 9H, BOC-tert-butyl protons), 1.67-1.93 (m, 5H, cyclohexyl), 2.45 (s, 1H, cyclohexyl), 4.39 (s,

2H, OCH2CH2N), 4.65-4.77 (m, 2H, OCH2CH2N), 5.09 (s, 2H, benzyllic methylene), 5.79 (s,

2H, amino), 6.19 (s, 1H, furylamine), 6.30-6.35 (m, 1H, furylamine), 7.11 (d, J = 7.7 Hz, 2H, 2

CH(Ar)), 7.28 (s, 2H, 2 CH (Ar)), 7.35 (s, 1H, furylamine), 7.55 (s, 1H, CH (H-8)); LRMS (MS-

ES) calcd for C30H39N7O6S [M+H] m/z = 626.27, fnd. 626.37.

2-(2-((4-cyclohexylbenzyl)amino)-6-(cyclopentylamino)-9H-purin-9-yl)ethyl sulfamate

(4.12a). To a stirring solution of 4.10a (0.1 M) that was cooled to 0 oC NaH was added in one

portion (60% dispersion in mineral oil, 5.0 eq) to afford an opaque, off-white, homogeneous

solution after light effervescence. To this solution is added solid sulfamoyl chloride (2.5 eq, air

sensitive) under a nitrogen atmosphere. The solution contents were concentrated under reduced

pressure and diluted with a 1 M K2HPO4 solution followed by repeated extractions into EtOAc.

Thin layer chromatography indicated conversion to final molecule 4.12a, which was confirmed

by NMR. 4.122a was purified by HPLC and the product was lyophilized to form a white powder

(77%): IR (KBr, cm-1

) 3384, 2924, 2851, 1609, 1541, 1513, 1489, 1351, 1179, 1017, 912, 787,

551; δH (400 MHz, DMSO-d6) 1.12-1.25 (m, 2H, cyclohexyl), 1.25-1.41 (m, 4H, cyclohexyl),

1.41-1.57 (m, 4H, cyclopentyl), 1.58-1.68 (m, 9H, cyclopentyl/cyclohexyl), 2.35-2.46 (m, 1H,

cyclohexyl), 4.27 (t, J = 4.8 Hz, 2H, H2NSO3CH2CH2N), 4.33 (t, J = 4.9 Hz,

H2NSO3CH2CH2N),4.39 (d, J = 6.1 Hz, Ar-CH2), 6.85 (bs, 1H, cyclopentyl-NH), 7.05 (bs, 1H,

cyclohexylbenzyl-NH), 7.09 (d, J = 7.9 Hz, 2H, ArCH), 7.23 (d, J = 7.9 Hz, 2H, ArCH), 7.55 (s,

2H, H2NSO3), 7.64 (s, 1H, ArCH); δC (100 MHz, DMSO-d6) 23.4, 25.6, 26.3, 32.1, 34, 41.6,

43.5, 44.3, 66.6, 126.2, 127.4, 137.0, 138.9, 145.5, 159.1; HMS (MS-ES), calcd for C25H36N7O3S

291

[M+H] m/z = 514.2600, fnd. 514.2588; rpHPLC tR: condition (I) 14.026 (II) 35.274 min, purity

91.71% and 92.25%.

2-(2-((4-cyclohexylbenzyl)amino)-6-(isobutylamino)-9H-purin-9-yl)ethyl sulfamate (4.12b).

Purine 4.11b was BOC de-protected as per general procedure C to obtain 4.12b as a white solid

(88%): IR (KBr cm-1

) 3463, 3426, 3314, 2923, 2851, 1616, 1522, 1384, 1175, 1020, 919, 786,

550; δH (400 MHz, CDCl3)0.96 (d, J = 6.6 Hz, 6H, CH(CH3)2), 1.06-1.49 (m, 5H, cyclohexyl),

1.70-2.10 (m, 7H, cyclohexyl and alkyl), 2.48 (s, 1H, cyclohexyl), 3.37 (s, 2H,alkyl), 4.36 (t, J =

4.9 Hz, 2H, NH2SO3CH2CH2)), 4.51 (t, J = 5.0 Hz, 2H, NH2SO3CH2CH2)), 4.57 (d, J = 5.7 Hz,

2H, NH-CH2), 5.23 (s, 1H, NH), 5.78 (s, 1H, NH), 7.17 (d, J = 7.8 Hz, 2H, 2 CH (Ar)), 7.29 (s,

2H, 2 CH (Ar)), 7.45 (d, 1H, CH (H-8)); LRMS (MS- ES) calcd for C24H35N7O3S [M+H] m/z =

502.25, fnd. 502.42


yl)ethyl sulfamate (4.12c). Purine 4.11c was BOC deprotected as per general procedure C to

obtain 4.12c as a white solid (75%): IR (KBr, cm-1

) 3425, 3275, 2980, 2940, 2868, 1761, 1705,

1625, 1495, 1390, 1270, 1208; δH (400 MHz, MeOD) 0.92 (d, J = 6.6 Hz, 6H, CH(CH3)2) 1.18-

2.00 (m, 15H, alkyl and cyclopentyl), 2.46 (m, 1H, cyclohexyl), 3.44-3.60 (m, 2H, -NH2), 4.40

(dt, J = 8.3, 4.0 Hz, 4H, SOCH2CH2), 4.56 (s, 2H, ArNH-CH2), 7.13 (d, J = 8.1 Hz, 2H,

292

2Ar(CH)), 7.26 (d, J = 7.8 Hz, 2H, 2Ar(CH)), 7.69 (s, 1H, Ar(CH)); δc NMR (100 MHz, MeOD)

20.8, 23.0, 27.0, 27.3, 28.0, 35.8, 39.7, 43.5, 45.7, 46.2, 49.7, 54.8, 68.3, 114.2, 127.7, 128.4,

139.0, 139.38, 147.7, 156.2, 161.2; HMS (MS-ES), calcd for C25H37N7O3S [M+H] m/z =

516.2757, fnd. 516.2758; rpHPLC tR: condition (I) 15.891 (II) 36.656 min, purity 99.5% and

99.6%.

2-(2-((4-cyclohexylbenzyl)amino)-6-morpholino-9H-purin-9-yl)ethyl sulfamate (4.12d) .

Purine 4.11d was BOC deprotected as per general procedure C to obtain 4.12d as a white solid

(64%): δH (400 MHz, DMSO) 0.99-1.49 (m, 5H, cyclohexyl), 1.57 – 1.87 (m, 5H, cyclohexyl),

2.42-2.45 (m, 1H, cyclohexyl), 3.98-4.03 (m, 6H, morpholine and OCH2CH2N), 4.24 – 4.53 (m,

6H, morpholine and OCH2CH2N), 7.11 (d, J = 7.8 Hz, 2H, 2 CH (Ar)), 7.24 (d, J = 7.8 Hz, 2H, 2

CH (Ar)), 7.74 (s, 1H, CH (H-8)); δC (100 MHz, DMSO-d6) 25.5, 26.3, 34.0, 38.6, 38.8, 41.8,

43.5, 44.2, 45.1, 47.0, 47.2, 47.5, 47.7, 47.9, 66.1, 66.4, 126.2, 127.4, 137.11, 138.3, ; HMS

(MS-ES), calcd for C24H34N7O4S [M+H] m/z = 516.2393, fnd. 516.2396; rpHPLC tR: condition


2-(2-((4-cyclohexylbenzyl)amino)-6-((4-fluorophenyl)amino)-9H-purin-9-yl)ethyl sulfamate

293

(4.12e). Purine 4.11e was BOC deprotected as per general procedure C to obtain 4.12e as a white

solid (72%); δH (400 MHz, MeOD) 1.30-1.45 (m, 5H, cyclohexyl), 1.50-1.83 (m, 5H,

cyclohexyl), 2.49 (s, 1H, cyclohexyl), 4.50 (t, J = 5.0 Hz, 2H, OCH2CH2N), 4.59 (d, J = 5.0 Hz,

2H, OCH2CH2N ), 5.11 (s, 2H, CH2Ar), 6.97 (t, J = 8.6 Hz, 2H, CH (Ar)), 7.16 (d, J = 8.0 Hz,

2H, 2 CH (Ar)), 7.27 (d, J = 7.7 Hz, 2H (Ar)), 7.68 (dd, J = 8.9 and 4.8 Hz, 2H, 2 CH (Ar))),

8.15 (s, 1H, CH (H-8)); δc NMR (100 MHz, MeOD) 27.3, 28.0, 28.4, 35.8, 44.1, 45.7, 48.4, 49.6,

52.3, 68.3, 83.5, 101.4, 116.2, 116.4, 123.9, 127.7, 128.0, 128.2, 137.3, 143.6, 148.1, 156.2;

HMS (MS-ES), calcd for C26H31FN7O3S [M+H] m/z = 540.2193, fnd. 540.2205; rpHPLC tR:


2-(2-((4-cyclohexylbenzyl)amino)-6-((furan-2-ylmethyl)amino)-9H-purin-9-yl)ethyl

sulfamate (4.12f). Purine 4.11f was BOC deprotected as per general procedure C to obtain 4.12f

as a white solid (73%); δH (400 MHz, DMSO-d6) 1.03-1.48 (m, 5H, cyclohexyl), 1.59-1.88 (m,

5H, cyclohexyl), 2.43-2.49 (m, 1H, cyclohexyl), 4.29 (t, J = 5.2 Hz, 2H, OCH2CH2N), 4.35 (t, J

= 5.2 Hz, 2H, OCH2CH2N), 4.42 (d, J = 5.4 Hz, 2H, CH2Ar), 4.58 (s, 1H, ArNH), 6.15 (s, 1H,

ArNH), 6.31 (t, J = 2.6 Hz, 1H, furylamine), 7.10 (d, J = 7.8 Hz, 2H, 2 CH (Ar)), 7.24 (d, J = 7.7

Hz, 2H, 2 CH (Ar)), 7.50 (d, J = 1.8 Hz, 1H, furylamine), 7.56 (s, 1H, furylamine), 7.69 (s, 1H,

CH (H-8)); δC (100 MHz, DMSO-d6) 25.6, 26.3, 34.0, 38.8, 39.0, 41.6, 43.4, 44.1, 47.3, 47.5,

47.7, 66.5, 106.5, 110.3, 126.2, 127.5, 137.5, 141.5; HMS (MS-ES), calcd for C26H38N7O3S

[M+H] m/z = 526.2237, fnd. 526.2239; rpHPLC tR: condition (I) 12.579 (II) 34.259 min, purity

99.3% and 98.1%.

294

Sulfamoyl chloride (4.13)

To stirring solution of neat chlorosulfonylisocyante cooled to 0 °C under a nitrogen atmosphere

was added formic acid dropwise (2.0 eq) to afford a vigorous effervescent solution. When

solution settles it is removed from the 0oC bath and allowed to react for 24 h at room

temperature. Upon observation of sediment of white crystals the reaction contents are poured

into hexanes and vacuum filtered and product 4.13 was stored under nitrogen. (80%): LRMS

(MS- ES) calcd for C14H34O2Si2 [M-H] m/z = 114.95, fnd. 113.35.

2-(1-trityl-1H-tetrazol-5-yl)ethanol (4.14). 2-(1H-tetrazol-5-yl)ethanol (1.0 eq) was placed in a

stirring solution of CH2Cl2 and DBU (2.1 eq) was added in a single portion. Once the tetrazole

was fully dissolved, a 0.1 M solution of tritylchloride was added dropwise over 45 min. A single

major spot was observed according to TLC following the addition of trityl chloride. Solution was

concentrated using rotary evaporation and wetloaded onto an isolera column with a mobile phase

of CH2Cl2:EtOAc (9:1). Product 4.14 was isolated as a white, sticky solid (88%): IR (KBr, cm-1

)

3376, 3053, 2856, 1595, 1499, 1445, 1065; δH (400 MHz, CDCl3) 2.48 (t, J = 5.9 Hz, 1H, OH),

3.18 (t, J = 5.9 Hz, 1H, CH2CH2OH), 4.03 (dd, J = 5.6 and 5.7 Hz, 2H, CH2CH2OH), 7.05-7.11

(m, 6H, C(C6H5)3), 7.29- 7.39 (m, 9H, C(C6H5)3); LRMS (MS- ES) calcd for C22H20N4ONa

[M+Na] m/z = 379.15, fnd. 379.23.

2-(1-trityl-1H-tetrazol-5-yl)ethyl 4-methylbenzenesulfonate (4.15). Tetrazole 4.14 was

dissolved up in anhydrous CH2Cl2 to which re-distilled DIPEA (2.1 eq) was added. To the

295

stirring solution p-toluene sulfonyl chloride (1.1 eq) was added in one portion along with DMAP

(0.5 eq). Reaction deemed complete after 16 h. Reaction was concentrated down and wetloaded

onto a biotage isolera column (critical to re-dissolve crude material in CH2Cl2 before stepwise

addition of hexanes for the wet loading step). Column was run isocratically with

Hex:CH2Cl2:EtOAc (60:30:10) as the mobile phase. Product 4.15 isolated as a colorless oil

(70%): IR (KBr, cm-1

) 2950, 2628, 1650, 1631, 1405, 1360, 1206, 1177, 1095; δH (400 MHz,

CDCl3) 3.29 (t, J = 6.8 Hz, 2H, CH2), 4.43 (t, J = 6.8 Hz, 2H, CH2), 7.05-7.08 (m, 6H,

C(C6H5)3), 7.24-7.26 (m, 2H, C6H5), 7.30- 7.38 (m, 10H, C(C6H5)3 and C6H5), 7.69-7.71 (m, 2H,

C6H5); LRMS (MS- ES) calcd for C29H26N4NaO3S [M+H] m/z = 533.23, fnd. 533.16.

tert-butyl(6-chloro-9-(2-(1-trityl-1H-tetrazol-5-yl)ethyl)-9H-purin-2-yl)carbamate (4.16)

Purine 4.15 was dissolved up in a stirring mixture of DMF and K2CO3 (3.6 eq). Mixture was

heated to 50 °C on an oil bath. Tetrazole 5 was added in one portion and allowed for 16 h.

Distilled water was added to the reaction mixture and product was extracted into EtOAc. Organic

layer was washed with water and brine, dried using anhydrous Na2SO4, and filtered. Product was

concentrated, re-dissolved in a mixture of CH2Cl2:EtOAc, and wet loaded onto Biotage isolera

column. Column run to a final gradient of 3:2 CH2Cl2:EtOAc. Product 31 was isolated as a white

solid (61%): IR (KBr, cm-1

) 3246, 3059, 2976, 1751, 1609, 1572, 1445, 1206, 1149; δH

(400 MHz, CDCl3) 1.54 (s, 9H, C(CH3)3), 3.59 (t, J = 6.3 Hz, 2H, CH2), 4.69 (t, J = 6.3 Hz, 2H,

CH2), 6.98-7.01 (m, 6H, C(C6H5)3), 7.24-7.26 (m, 2H, C6H5), 7.29- 7.40 (m, 9H, C(C6H5)3), 7.65

(m, 1H, CH (H-8)); LRMS (MS- ES) calcd for C32H31ClN9O2 [M+H] m/z = 608.22, fnd. 608.40.

296

tert-butyl(6-chloro-9-(2-(1-trityl-1H-tetrazol-5-yl)ethyl)-9H-purin-2-yl)(4-

cyclohexylbenzyl)carbamate (4.17). Under conditions described by general procedure B, Purine

4.16 was efficiently converted to product 4.17 as an off-white powder (76%): IR (KBr, cm-1

)

3405, 3057, 2977, 2924, 2850, 1710, 1610, 1561, 1447, 1384, 1367, 1236, 1152; δH (400 MHz,

CDCl3) 1.29-1.33 (m, 5H, cyclohexyl), 1.46 (s, 9H, C(CH3)3), 1.70-1.80 (m, 5H, cyclohexyl),

2.38-2.44 (m, 1H, cyclohexyl), 3.51 (t, J = 6.4 Hz, 2H, NCH2CH2), 4.63 (t, J = 6.4 Hz, 2H,

NCH2CH2), 5.13 (s, 2H, CH2Ar), 7.00-7.02 ( m, 6H, C(C6H5)3), 7.07 (d, J = 8.1 Hz, 2H, C6H4),

7.26-7.38 (m, 11H, C(C6H5)3 and C6H4), 7.70 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd for

C45H47ClN9O2 [M+H] m/z = 780.35, fnd. 780.42.

tert-butyl 4-cyclohexylbenzyl(6-(cyclopentylamino)-9-(2-(1-trityl-1H-tetrazol-5-yl)ethyl)-

9H-purin-2-yl)carbamate (4.18a). Purine 4.17 was treated with cyclopentylamine according to

general procedure K, yielding the final product 4.18a as a white solid (66%): IR (KBr, cm-1

)

2924, 2850, 1690, 1615, 1446, 1384, 1282, 1235, 1154; δH (400 MHz, CDCl3) 1.24-1.46 (m, 9H,

5H (cyclohexyl) and 4H (cyclopentyl)), 1.41 (s, 9H, C(CH3)3), 1.62-1.81 (m, 8H, 5H

(cyclohexyl) and 3H (cyclopentyl)), 2.04 (bs, 2H (cyclopentyl)), 2.39-2.43 (m, 1H, CH

(cyclohexyl), 3.49 (t, J = 6.6 Hz, 2H, NCH2CH2), 4.56 (t, J = 6.6 Hz, 2H, NCH2CH2), 5.02 (s,

2H, CH2Ar), 4.25 (q, J = 7.1 Hz, 2H, CO2CH2CH3), 4.83 (bs, 2H, CH2Ar), 4.90 (s, 2H,

297

CH2CO2Et), 7.02-7.07 (m, 8H, C(C6H5)3 and C6H4), 7.26-7.37 (m, 11H, C(C6H5)3 and C6H4),

7.40 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd for C50H56N10O2 [M+H] m/z = 829.46, fnd.

829.66.

tert-butyl 4-cyclohexylbenzyl(6-(isobutylamino)-9-(2-(1-trityl-1H-tetrazol-5-yl)ethyl)-9H-

purin-2-yl)carbamate (4.18b). Purine 4.17b was treated with isobutylamine according to

general procedure K, yielding the final product 4.18b as a white solid (81%): IR (KBr, cm-1

)

2925, 2851, 1702, 1619, 1483, 1447, 1385, 1246, 1156; δH (400 MHz, CDCl3) 0.93 (s, 3H,

CH(CH3)2), 0.95 (s, 3H, CH(CH3)2), 1.30-1.37 (m, 5H, cyclohexyl), 1.41 (s, 9H, C(CH3)3), 1.70-

1.81 (m, 5H, cyclohexyl), 1.94 (heptet, J = 6.7 Hz, 1H, CH(CH3)2), 2.38-2.43 (m, 1H,

cyclohexyl), 3.37 (bs, 2H, NHCH2), 3.50 (t, J = 6.6 Hz, 2H, NCH2CH2), 4.56 (t, J = 6.6 Hz, 2H,

NCH2CH2), 5.02 (s, 2H, CH2Ar), 5.65 (bs, 1H, NH), 7.02-7.07 ( m, 8H, 6H C(C6H5)3 and 2H

C6H4), 7.28-7.37 (m, 11H, C(C6H5)3 and C6H4), 7.41 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd

for C49H57N10O2 [M+H] m/z = 817.46, fnd. 817.58.

tert-butyl 4-cyclohexylbenzyl(6-(isopentylamino)-9-(2-(1-trityl-1H-tetrazol-5-yl)ethyl)-9H-

298

purin-2-yl)carbamate (4.18c). Purine 4.17 was treated with isoamylamine according to general

procedure K, yielding the final product 4.18c as a white solid (85%): IR (KBr, cm-1

) 3418, 2926,

1699, 1620, 1446, 1384, 1242, 1157; δH (400 MHz, CDCl3) 0.92 (d, J = 6.6 Hz, 6H, CH(CH3)2),

1.31-1.37 (m, 5H, cyclohexyl), 1.41 (s, 9H, C(CH3)3), 1.49-1.54 (m, 1H, CH(CH3)2), 1.63-1.81

(m, 7H, 5H (cyclohexyl) and 2H (CH2CH(CH3)2)), 2.38-2.43 (m, 1H, cyclohexyl), 3.49 (t, J =

6.6 Hz, 2H, NCH2CH2), 3.58 (bs, 2H, NHCH2), 4.56 (t, J = 6.6 Hz, 2H, NCH2CH2), 5.04(s, 2H,

CH2Ar), 5.52 (bs, 1H, NH), 7.02-7.07 ( m, 8H, 6H (C(C6H5)3) and 2H (C6H4)), 7.28-7.37 (m,

11H, C(C6H5)3 and C6H4), 7.40 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd for C50H58N10O2

[M+H] m/z = 831.47, fnd. 831.48.

tert-butyl 4-cyclohexylbenzyl(6-morpholino-9-(2-(1-trityl-1H-tetrazol-5-yl)ethyl)-9H-purin-

2-yl)carbamate (4.18d). Purine 4.17 was treated with morpholine according to general

procedure K, yielding the final product 4.18e as a white solid (50%): IR (KBr, cm-1

) 3448, 2923,

2850, 1701, 1584, 1446, 1384, 1153; δH (400 MHz, CDCl3) 1.24-1.38 (m, 5H, cyclohexyl), 1.41

(s, 9H, C(CH3)3), 1.70-1.81 (m, 5H, cyclohexyl), 2.39-2.44 (m, 1H, cyclohexyl), 3.48 (t, J = 6.6

Hz, 2H, NCH2CH2), 3.76 (t, J = 6.5 Hz, 4H, morpholine), 4.17 (bs, 4H, morpholine), 4.61 (t, J =

6.5 Hz, 2H, NCH2CH2), 5.02 (s, 2H, CH2Ar), 7.01-7.07 ( m, 8H (C(C6H5)3) and 2H (C6H4)),


C49H55N10O3 [M+H] m/z = 831.44, fnd. 831.48.

299

tert-butyl 4-cyclohexylbenzyl(6-((4-fluorophenyl)amino)-9-(2-(1-trityl-1H-tetrazol-5-

yl)ethyl)-9H-purin-2-yl)carbamate (4.18e). Purine 4.17 was treated with 4-fluoroaniline

according to general procedure L, yielding the final product 4.18e as a white solid (30%): IR

(KBr, cm-1

) 3423, 2925, 2851, 1702, 1624, 1592, 1508, 1448, 1384, 1227, 1154; δH (400 MHz,

CDCl3) 1.33-1.38 (m, 5H, cyclohexyl), 1.41 (s, 9H, C(CH3)3), 1.70-1.82 (m, 5H, cyclohexyl),

2.39-2.45 (m, 1H, cyclohexyl), 3.53 (t, J = 6.5 Hz, 2H, NCH2CH2), 4.61 (t, J = 6.5 Hz, 2H,

NCH2CH2), 5.09 (s, 2H, CH2Ar), 6.92-6.96 (m, 2H, C6H4F), 7.00-7.02 ( m, 6H, C(C6H5)3), 7.09

(d, J = 8.1 Hz, 2H, C6H4), 7.26-7.36 (m, 11H, C(C6H5)3 and C6H4), 7.52 (s, 1H, CH (H-8)), 7.71-

7.74 (m, 2H, C6H4F); LRMS (MS- ES) calcd for C51H52FN10O2 [M+H] m/z = 855.42, fnd.

855.52.

tert-butyl4-cyclohexylbenzyl(6-((furan-2-ylmethyl)amino)-9-(2-(1-trityl-1H-tetrazol-5-

yl)ethyl)-9H-purin-2-yl)carbamate (4.18f). Purine 4.17 was treated with furfurylamine

according to general procedure K, yielding the final product 4.18f as a white solid (62%); IR

300

(KBr, cm-1

) 3265, 3059, 2924, 2850, 1701, 1618, 1594, 1446, 1384, 1152; δH (400 MHz, CDCl3)

1.27-1.37 (m, 5H, cyclohexyl), 1.44 (s, 9H, C(CH3)3), 1.70-1.80 (m, 5H, cyclohexyl), 2.39-2.44

(m, 1H, cyclohexyl), 3.40 (t, J = 6.6 Hz, 2H, NCH2CH2), 4.59 (t, J = 6.5 Hz, 2H, NCH2CH2),

4.75 (bs, 2H, CH2 (furfuryl)), 5.06 (s, 2H, CH2Ar), 6.23 (bs, 1H, CH (furfuryl)), 6.28 - 6.29 (m,

1H, CH (furfuryl)), 7.01-7.08 ( m, 8H (C(C6H5)3) and 2H (C6H4)), 7.24 (s, 1H, CH (furfuryl)),


C50H53N10O3 [M+H] m/z = 841.42, fnd. 841.61.

tert-butyl 4-cyclohexylbenzyl(6-(4-nitrophenoxy)-9-(2-(1-trityl-1H-tetrazol-5-yl)ethyl)-9H-

purin-2-yl)carbamate (4.18g). Purine 4.17 was treated with 4-nitrophenol according to general

procedure K, yielding the final product 4.18g as a white solid (32%): IR (KBr, cm-1

) 3439, 2924,

2850, 1707, 1570, 1446, 1384, 1344, 1231 δH (400 MHz, CDCl3) 1.24-1.39 (m, 5H, cyclohexyl),

1.36 (s, 9H, C(CH3)3), 1.71-1.85 (m, 5H, cyclohexyl), 2.41-2.46 (m, 1H, cyclohexyl), 3.55 (t, J =

6.4 Hz, 2H, NCH2CH2), 4.59 (t, J = 6.5 Hz, 2H, NCH2CH2), 4.95 (s, 2H, CH2Ar), 7.03-7.05 (m,

6H, C(C6H5)3), 7.09 (d, J = 8.1 Hz, 2H, CH2C6H4), 7.27-7.38 (m, 11H, C(C6H5)3 and C6H4), 7.45

(d, J = 9.2 Hz, 2H, OC6H4), 7.65 (7.41 (s, 1H, CH (H-8)) 8.22 (d, J = 9.2 Hz, 2H, OC6H4);

LRMS (MS- ES) calcd for C51H50N10O5Na [M+Na] m/z = 905.39, fnd. 905.47.

301

9-(2-(1H-tetrazol-5-yl)ethyl)-N2-(4-cyclohexylbenzyl)-N6-cyclopentyl-9H-purine-2,6-

diamine (4.19a). Purine 4.18a was treated with TFA as per general procedure M, yielding the

final product 4.19a as a white lyophilized solid (80%): IR (KBr, cm-1

) 3384, 2924, 2851,1676,

1636, 1448, 1384, 1351, 1203, 1139; δH (400 MHz, DMSO-d6) 1.28-1.53 (m, 9H, 5H

(cyclohexyl) and 4H (cyclopentyl)), 1.65-1.91 (m, 10 H, 5H (cyclohexyl) and 5H (cyclopentyl)),

2.41-2.45 (m, 1H, CH (cyclohexyl), 3.41-3.45 (m, 2H, NCH2CH2), 4.39-4.43 (m, 2H,

NCH2CH2), 4.41 (bs, 2H, CH2 (benzyl)), 7.09 (bs, 1H, NH), 7.11 (d, J = 7.9 Hz, 2H C6H4), 7.26

(d, J = 7.9 Hz, 2H, C6H4), 7.65 (s, 1H, CH (H-8)); δC (100 MHz, DMSO-d6) 23.4, 23.5, 25.6,

26.4, 32.1, 32.2, 34.1, 40.7, 43.5, 44.4, 126.3, 126.3, 127.7, 127.7, 129.4, 137.4, 138.3, 145.9,

145.9, 153.7 ; HMS (MS-ES), calcd for C26H35N10 [M+H] m/z = 487.3046, fnd. 487.3044;

rpHPLC tR: condition (I) 12.326 (II) 34.008, purity 96.6% and 94.6%.

9-(2-(1H-tetrazol-5-yl)ethyl)-N2-(4-cyclohexylbenzyl)-N6-isobutyl-9H-purine-2,6-diamine

(4.19b). Purine 4.18b was treated with TFA as per general procedure M, yielding the final

product 4.19b as a white lyophilized solid (69%): IR (KBr, cm-1

) 3404, 2924, 2851, 1615, 1514,

1447, 1384, 1351, 1262; δH (400 MHz, DMSO-d6) 0.82 (d, J = 6.3 Hz, 6H, CH2CH(CH3)2), 1.23-

1.37 (m, 5H, cyclohexyl), 1.66-1.76 (m, 5H, cyclohexyl), 1.83-1.87 (m, 1H, CH(CH3)2), 2.43-

2.50 (m, 1H, CH(CH3)2), 3.17 (bs, 2H, CH2CH(CH3)2), 3.39 (t, J = 6.9 Hz , 2H NCH2CH2), 4.37

302

(t, J = 7.1 Hz, 2H, NCH2CH2), 4.37 (bs, 2H, CH2 (benzyl)), 6.88 (bs, 1H, NH), 7.09 (d, J = 8.1

Hz, 2H, 2 CH (Ar)), 7.25 (d, J = 8.0 Hz, 2H, 2 CH (Ar)), 7.23 (bs, 1H, NH), 7.61 (s, 1H, CH (H-

8)); δC (100 MHz, DMSO-d6) 20.1, 23.68, 25.6, 26.3, 34.0, 43.4, 44.3, 78.6, 78.9, 79.2, 126.1,


C25H35N10 [M+H] m/z = 475.3046, fnd. 475.3037; rpHPLC tR: condition (I) 12.328 (II) 34.028


9-(2-(1H-tetrazol-5-yl)ethyl)-N2-(4-cyclohexylbenzyl)-N6-isopentyl-9H-purine-2,6-diamine

(4.19c). Purine 4.18c was treated with TFA as per general procedure M, yielding the final

product 4.19c as a white lyophilized solid (78%): IR (KBr, cm-1

) 3417, 2924, 2851, 1643, 1603,

1514, 1384, 1261,1126; δH (400 MHz, DMSO-d6) 0.95 (d, J = 6.6 Hz, 6H, CH(CH3)2), 1.31-1.43

(m, 5H, cyclohexyl), 1.55-1.58 (m, 1H, CH(CH3)2), 1.64-1.78 (m, 7H, 5H (cyclohexyl) and 2H

(CH2CH(CH3)2)), 2.39-2.44 (m, 1H, cyclohexyl), 3.33 (bs, 2H, CH2CH2CH), 3.38-3.42 (m, 2H,

NCH2CH2), 4.36-4.41 (m, 4H, 2H (NCH2CH2) and CH2(benzyl)), 6.86 (bs, 1H, NH), 7.09 (d, J

= 8.0 Hz, 2H, C6H4), 7.18 (s, 1H, NH), 7.25 (d, J = 7.9 Hz, 2H, C6H4), 7.52 (s, 1H, CH (H-8));

HMS (MS-ES), calcd for C26H37N10 [M+H] m/z = 489.3203, fnd. 489.3197; rpHPLC tR:


303

9-(2-(1H-tetrazol-5-yl)ethyl)-N-(4-cyclohexylbenzyl)-6-morpholino-9H-purin-2-amine

(4.19d). Purine 4.18d was treated with TFA as per general procedure M, yielding the final

product 4.19d as a white lyophilized solid (93%): IR (KBr, cm-1

) 3424, 3082, 1924, 2851, 2359,

1682, 1602, 1550, 1439, 1384, 1198, 1184; δH (400 MHz, DMSO-d6) 1.23-1.37 (m, 5H,

cyclohexyl), 1.66-1.76 (m, 5H, cyclohexyl), 2.39-2.44 (m, 1H, cyclohexyl), 3.50 (t, J = 6.8 Hz,

2H, NCH2CH2), 3.60-3.70 (m, 4H, morpholine), 4.11(bs, 4H, morpholine), 4.44-4.48 (m, 4H,

NHCH2CH2 and CH2Ar), 7.12 (d, J = 8.0 Hz, 2H, C6H4), 7.26 (d, J = 8.0 Hz, 2H, C6H4), 7.75 (s,

1H, CH (H-8)); δC (100 MHz, DMSO-d6) 23.4, 25.6, 26.3, 34.0, 40.8, 43.4, 44.3, 45.3, 113.0,


C25H33N10O [M+H] m/z = 489.2839, fnd. 489.2849; rpHPLC tR: condition (I) 9.251 (II) 31.975


9-(2-(1H-tetrazol-5-yl)ethyl)-N2-(4-cyclohexylbenzyl)-N6-(4-fluorophenyl)-9H-purine-2,6-

diamine (4.19e). Purine 4.18e was treated with TFA as per general procedure M, yielding the

final product 4.19e as a white lyophilized solid (74%): IR (KBr, cm-1

) 3444.9, 2962, 2924, 2851,

1629, 1592, 1507, 1384, 1262, 1223, 1098; δH (400 MHz, DMSO-d6) 1.25-1.37 (m, 5H,

(cyclohexyl)), 1.63-1.75 (m, 5H, (cyclohexyl)), 2.36-2.45 (m, 1H, (cyclohexyl)), 4.39 (s, 2H,

ArCH2), 4.41 (t, J = 6.3 Hz, 2H, NCH2CH2), 6.99 (t, J = 8.9 Hz, 2H, C6H4F), 7.11 (d, J = 8.0 Hz,

2H, C6H4), 7.25 (d, J = 7.8 Hz, C6H4), 7.70 (s, 1H, CH (H-8)), 7.79-7.90 (m, 2H, C6H4F); HMS

(MS-ES), calcd for C27H30F1N6 [M+H] m/z = 513.2639, fnd. 513.26567; rpHPLC tR: condition


304

9-(2-(1H-tetrazol-5-yl)ethyl)-N-(4-cyclohexylbenzyl)-6-(4-nitrophenoxy)-9H-purin-2-amine

(4.19g). Purine 4.18g was treated with TFA as per general procedure M, yielding the final

product 4.19g as a white lyophilized solid (49%): IR (KBr, cm-1

) 3415, 2924, 2851, 1631, 1576,

1447, 1384, 1231 1162; δH (400 MHz, CDCl3) 1.35-1.40 (m, 5H, cyclohexyl), 1.65-1.83 (m, 2H,

(CH2)3CH2CH3), 2.46-2.50 (m, 2H, CH2(CH2)3CH3), 3.59-3.63 (m, 2H, NCH2CH2), 4.51(bs, 2H,

CH2Ar), 4.59-4.63 (m, 2H, NCH2CH2), 4.90 (s, 2H, CH2CO2Et), 7.18 (bs, 1H, NH), 7.25-7.33

(m, 6H, 4 CH (benzyl) and 2 CH (nitrophenol)), 7.73 (s, 1H, CH (H-8)), 8.24-8.26 (m, 2H, CH

(nitrophenol)); δC (100 MHz, DMSO-d6) 23.4, 25.6, 26.37, 34.0, 41.0, 43.5, 44.4, 80.58, 113.6,

122.7, 125.3, 126.3, 126.7, 127.8, 137.6, 141.4, 144.3, 145.8, 147.8, 157.7, 158.4, 158.4; HMS

(MS-ES), calcd for C27H29N10O3 [M+H] m/z = 541.2417, fnd. 541.2418; rpHPLC tR: condition


ethyl 2-(2-((tert-butoxycarbonyl)amino)-6-morpholino-9H-purin-9-yl)acetate (4.20). Purine

3.1 was treated with morpholine according to general procedure C, yielding the product 4.20 as

an off-white solid (83%): m.p. = 69–85 °C; IR (KBr, cm-1

) 3689, 2978, 1750, 1583, 1517, 1472,

305

1367, 1268, 1221, 1151; δH (400 MHz, CDCl3) 1.30 (t, J = 7.2 Hz, 3H, CO2CH2CH3), 1.52 (s,

9H, C(CH3)3), 3.82 (t, J = 4.9 Hz, 4H, 2 CH2 (morpholine)), 4.24 (q, J = 7.2 Hz, 2H,

COCH2CH3), 4.27 (bs, 4H, 2CH2 (morpholine)), 4.89 (s, 2H, CH2CO2Et), 7.13 (s, 1H, NH),

7.69 (s, 1H, CH (H-8));LRMS (MS-ES), calcd for C18H27N6O5 [M+H] m/z = 407.20, fnd.

407.43.

ethyl 2-(2-amino-6-morpholino-9H-purin-9-yl)acetate (4.21). Purine 4.20 was treated with

TFA according to general procedure C, to yield product 4.21 as an off-white solid (94%): m.p. =

93-98 °C; IR (KBr, cm-1

) 3672, 2922, 1736, 1540, 1459, 1312, 1182; δH (400 MHz, CDCl3) 1.31

(t, J = 7.2 Hz, 3H, CO2CH2CH3), 3.82 (t, J = 4.9 Hz, 4H, 2 CH2 (morpholine)), 4.26 (q, J = 7.2

Hz, 2H, COCH2CH3), 4.29 (bs, 4H, 2CH2 (morpholine)), 4.92 (s, 2H, CH2CO2Et), 7.48 (s, 1H,

CH (H-8)); LRMS (MS-ES), calcd for C13H19N6O3 [M+H] m/z = 307.14, fnd. 307.28.

ethyl 2-(2-(cyclohexanecarboxamido)-6-morpholino-9H-purin-9-yl)acetate (4.22). Purine

4.21 was treated with cyclohexylcarbonylchloride according to general procedure N, to yield

product 4.22 as an off-white solid (74%): m.p. = 142-147 °C; IR (KBr, cm-1

) 3551, 3415, 3238,

2928, 2852, 1755, 1669, 1604, 1585, 1514, 1448, 1407, 1327, 1266; δH (400 MHz, CDCl3) 1.29

(t, J = 7.2 Hz, 3H, CO2CH2CH3), 1.28-1.32 (m, 3H, CH2 (cyclohexyl)), 1.49-1.58 (m, 2H,

(cyclohexyl)), 1.69-1.71 (m, 1H, (cyclohexyl)), 1.82-1.84 (m, 2H, (cyclohexyl)), 1.96-1.99 (m,

306

2H, (cyclohexyl)), 2.86-2.91 (m, 1H, CH), 3.82 (t, J = 4.9 Hz, 4H, 2 CH2 (morpholine)), 4.25 (q,

J = 7.2 Hz, 2H, CO2CH2CH3), 4.27 (bs, 4H, 2CH2 (morpholine)), 4.87 (s, 2H, CH2CO2Et), 7.69

(bs, 1H, NH), 7.70 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 14.3, 26.0, 29.5, 44.2, 45.3, 45.4,

45.5, 62.4, 67.2, 116.4, 138.5, 152.4, 152.7, 154.1, 167.5, 175.9; HMS (MS-ES), calcd for



2-(2-(cyclohexanecarboxamido)-6-morpholino-9H-purin-9-yl)acetic acid (4.23)

Purine 4.22 was treated according to general procedure D, to yield final product 4.23 as a white


) 3631, 2927, 2856, 1743, 1514, 1466, 1385,


1.61-1.78 (m, 5H, (cyclohexyl)), 2.61-2.75 (m, 1H, (cyclohexyl)), 3.82 (t, J = 4.6 Hz, 4H, 2 CH2

(morpholine)), 4.19 (bs, 4H, 2 CH2 (morpholine)), 4.74 (s, 2H, CH2CO2H), 7.99 (s, 1H, CH (H-

8)), 9.85 (s, 1H, NH); δC (100 MHz, DMSO-d6) 25.2, 25.4, 29.0, 43.8, 44.7, 45.0, 66.2, 140.2,


fnd. 389.1931; rpHPLC tR: condition (I) 10.978 (II) 17.891 min, purity 97.9 % and 98.0%.

307

(2-(2-(cyclohexanecarboxamido)-6-morpholino-9H-purin-9-yl)acetoxy)methyl pivalate

(4.24a). Purine 4.23 was treated with iodomethyl pivalate according to general procedure E,

yielding the final product 4.24a as a lyophilized white solid (53%): IR (KBr, cm-1

) 3441, 3229,

2928, 2851, 1774, 1751, 1665, 1604, 1586, 1515, 1384, 1315, 1262, 1113; δH (400 MHz, CDCl3)

1.24 (s, 9H, C(CH3)3), 1.27-1.33 (m, 3H, CH2 (cyclohexyl)), 1.48-1.56 (m, 2H, (cyclohexyl)),

1.68-1.70 (m, 1H, (cyclohexyl)), 1.81-1.83 (m, 2H, (cyclohexyl)), 1.97-2.00 (m, 2H,

(cyclohexyl)), 2.88-2.93 (m, 1H, CH), 3.83 (t, J = 4.9 Hz, 4H, 2 CH2 (morpholine)), 4.28 (bs,

4H, 2CH2 (morpholine)), 4.88 (s, 2H, CH2), 5.85 (s, 2H, CH2), 7.68 (bs, 1H, NH), 7.76 (s, 1H,

CH (H-8)); HMS (MS-ES), calcd for C24H35N6O6 [M+H] m/z = 503.2618, fnd. 503.2615;


acetoxymethyl 2-(2-(cyclohexanecarboxamido)-6-morpholino-9H-purin-9-yl)acetate (4.24b)

Purine 4.23 was treated with bromomethyl acetate according to general procedure E, yielding the

final product 4.24b as a lyophilized white solid (60%): δH (400 MHz, CDCl3) 1.18-1.38 (m, 3H,

cyclohexyl), 1.44-1.55 (m, 2H, cyclohexyl), 1.66-1.72 (m, 1H, cyclohexyl), 1.77-1.84 (m, 2H,

cyclohexyl), 1.92-1.99 (m, 2H, cyclohexyl), 2.13 (s, 3H, COCH3), 2.62-2.71 (m, 1H,

cyclohexyl), 3.84-3.89 (m, 4H, morpholine), 4.34 (bs, 4H, morpholine), 5.03 (s, 2H, CH2CO2),

5.81 (s, 2H, OCH2), 7.71 (s, 1H, CH (H-8)); δC (100 MHz, CDCl3) 20.4, 25.3, 25.5, 29.0, 44.6,

45.4, 66.6, 79.9, 115.7, 138.7, 148.4, 149.6, 152.1, 165.7, 169.3, 176.7; HMS (MS-ES), calcd for



308

tert-butyl (9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-morpholino-9H-purin-2-yl)carbamate

(4.25). Purine 4.7 (1.0 eq) was subjected to general procedure A, which yielded product 4.25 as a

viscous oil (83%): δH (400 MHz, CDCl3) 0.06 (s, 6H, Si(CH3)2), 0.85 (s, 9H, SiC(CH3)3, 3.80 (t,

J = 4.8 Hz, 4H, morpholine) 3.88 (t, J = 5.0 Hz, 2H, NCH2), 4.13 (t, J = 5.0 Hz, 2H,OCH2), 4.22

(bs, 4H, morpholine), 4.57 (s, 2H, NH2), 7.59 (s, 1H, CH (H-8)); LRMS (MS- ES) calcd for

C17H31N6O2Si [M+H] m/z = 379.22, fnd. 379.34.

9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-morpholino-9H-purin-2-amine (4.26). Purine 4.25

(1.0 eq) was dissolved up in CH2Cl2 and cooled to 0 °C in an ice water bath. AlCl3 (5.0 eq) was

added in a single portion. Reaction deemed complete after 30 min and quenched by dropwise

addition of saturated sodium bicarbonate solution. Reaction was extracted into CH2Cl2,

combined organic layers were then washed twice with saturated sodium bicarbonate and brine,

dried using Na2SO4, filtered, and concentrated under reduced pressure. Reaction was wet-loaded

onto a Biotage Isolera column with a mobile phase gradient of EtOAc and hexanes. A solid

white product 4.26 was obtained following concentration (56%): IR (KBr, cm-1

) 3440, 3328,

3216, 3007, 2954, 2930, 2857, 1630, 1574, 1489, 1239, 1107; δH (400 MHz, CDCl3) 0.06 (s, 6H,

Si(CH3)2), 0.85 (s, 9H, SiC(CH3)3), 3.80 (t, J = 4.8 Hz, 4H, morpholine) 3.88 (t, J = 5.0 Hz, 2H,

NCH2), 4.13 (t, J = 5.0 Hz, 2H,OCH2), 4.22 (bs, 4H, morpholine), 4.57 (s, 2H, NH2), 7.59 (s, 1H,

CH (H-8)); LRMS (MS- ES) calcd for C17H31N6O2Si [M+H] m/z = 379.22, fnd. 379.34.

309

N-(9-(2-((tert-butyldimethylsilyl)oxy)ethyl)-6-morpholino-9H-purin-2-

yl)cyclohexanecarboxamide (4.27). Purine 4.26 was treated with cyclohexylcarbonyl chloride

according to general procedure N, yielding product 4.27 as a colorless oil (90%): IR (KBr, cm-1

)

3406, 2929, 2854, 1594, 1449, 1384, 1259, 1114; δH (400 MHz, CDCl3) 0.06 (s, 6H, Si(CH3)2),

0.85 (s, 9H, SiC(CH3)3),1.21-1.34 (m, 4H, cyclohexane), 1.50-1.63 (m, 3H, cyclohexane), 1.80-

1.89 (m, 2H, cyclohexane), 2.40 (m, 2H, cyclohexane), 3.82 (t, J = 4.8 Hz, 4H, morpholine) 3.90

(t, J = 4.8 Hz, 2H, NCH2), 4.21 (t, J = 4.8 Hz, 2H,OCH2), 4.27 (bs, 4H, morpholine), 7.69 (s, 1H,

NH), 7.75 (s, 1H, CH (H-8)); LRMS (MS-ES) calcd for C24H41N6O3Si [M+H] m/z = 489.29,

fnd. 489.42.

N-(9-(2-hydroxyethyl)-6-morpholino-9H-purin-2-yl)cyclohexanecarboxamide (4.28). Purine

4.27 was treated with TBAF according to general procedure I, yielding the final product 4.28 as

a white solid (79%): IR (KBr, cm-1

) 3278, 2924, 2855, 1669, 1590, 1455, 1384, 1114; δH

(400 MHz, CDCl3) 1.18-1.29 (m, 4H, cyclohexane), 1.47-1.56 (m, 2H, cyclohexane), 1.60-1.70

(m, 1H, cyclohexane), 1.76-1.82 (m, 2H, cyclohexane), 1.85-1.96 (m, 2H, cyclohexane), 2.44

(bs, 1H, OH), 3.77 (t, J = 4.8 Hz, 4H, morpholine) 3.98 (t, J = 4.2 Hz, 2H, NCH2), 4.10-4.30 (m,

6H, OCH2 and morpholine), 7.62 (s, 1H, NH), 7.96 (s, 1H, CH (H-8)) ; LRMS (MS- ES) calcd

for C18H25N6O3 [M-H] m/z = 374.21, fnd. 373.20.

310

2-(2-(cyclohexanecarboxamido)-6-morpholino-9H-purin-9-yl)ethyl sulfamate (4.29). Purine

4.28 was reacted with 4.13 in accordance to general procedure K. The resulting product 4.29 was

lyophilized into a white, light powder (42%): IR (KBr, cm-1

) 3299, 2924, 2854, 1667, 1594,

1578, 1467, 1384, 1306, 1263, 1235, 1179; δH (400 MHz, DMSO-d6) 1.08-1.39 (m, 5H,

(cyclohexyl)), 1.60-1.79 (m, 5H, (cyclohexyl)), 2.62-2.68 (m, 1H, (cyclohexyl)), 3.69-3.71 (m,

4H, (morpholine)), 4.18 (bs, 2H, CH2N), 4.38-4.42 (m, 4H, (morpholine)), 6.73(bs, 2H, NH2),

7.55 (s, 2H, OCH2), 8.04 (s, 1H, CH (H-8)), 9.99 (s, 1H, NH); δC (100 MHz, DMSO-d6) 25.6,

25.8, 29.3, 42.5, 44.3, 66.5, 66.8, 116.2, 140.0, 151.9, 152.4, 153.1, 158.4, 174.9, 194.8; HMS

(MS-ES), calcd for C18H27N7O5S [M+H] m/z = 454.1873, fnd. 454.1886; rpHPLC tR: condition


9-(2-(1H-tetrazol-5-yl)ethyl)-6-morpholino-9H-purin-2-amine (4.30). Purine 4.16 was

treated with morpholine according to general procedure K, yielding the final product 4.30 as a

white solid (80%): IR (KBr, cm-1

) 3426, 2972, 2921, 2854, 1749, 1708, 1581, 1446, 1384, 1148;

δH (400 MHz, CDCl3) 1.52 (s, 9H, C(CH3)3), 3.53 (t, J = 6.5 Hz, 2H, NCH2CH2), 3.82 (t, J = 4.7

Hz, 4H, morpholine), 4.28 (bs, 4H, morpholine), 4.58 (t, J = 6.4 Hz, 2H, NCH2CH2), 7.00-7.03 (

m, 6H, C(C6H5)3), 7.29-7.36 (m, 10H, C(C6H5)3 and CH (H-8)); LRMS (MS- ES) calcd for

C36H39N10O3 [M+H] m/z = 659.31, fnd. 659.42.

311

9-(2-(1H-tetrazol-5-yl)ethyl)-6-morpholino-9H-purin-2-amine (4.31)

Purine 4.30 was treated with TFA as per general procedure N, yielding the product 4.31 as a off-

white solid (87%): IR (KBr, cm-1

) 3323, 3199, 2922, 2855, 1649, 1572, 1448, 1238, 1113; δH

(400 MHz, DMSO-d6) 3.35 (t, J = 7.1 Hz, 2H, NCH2CH2), 3.64 (t, J = 4.7 Hz, 4H, morpholine),

4.06 (bs, 4H, morpholine), 4.36 (t, J = 7.1 Hz, 2H, NCH2CH2), 5.93 (s, 2H, NH2), 7.59 (s, 1H,

CH (H-8)); LRMS (MS- ES) calcd for C12H15N10O [M-H] m/z = 315.15, fnd. 315.11.

N-(9-(2-(1H-tetrazol-5-yl)ethyl)-6-morpholino-9H-purin-2-yl)cyclohexanecarboxamide

(4.32)

Purine 4.31 was acylated with cyclohexylcarbonyl chloride in accordance to general procedure C

and lyophilized to produce 4.32 as a white powder (77%): IR (KBr, cm-1

) 2929, 2853, 1697,

1596, 1450, 1384, 1263, 1195, 1113; δH (400 MHz, DMSO-d6) 1.19-1.26 (m, 5H, cyclohexyl),

1.64-1.81 (m, 5H, cyclohexyl), 2.68-2.72 (m, 1H, cyclohexyl), 3.45 (t, J = 7.0 Hz, 2H,

NCH2CH2), 3.69 (t, J = 4.6 Hz, 4H, morpholine), 4.18 (bs, 4H, morpholine), 4.50 (t, J = 7.0 Hz,

2H, NCH2CH2), 7.92 (s, 1H, CH (H-8)), 9.88 (s, 1H, CONH); HMS (MS-ES), calcd for



an exploration into the molecular recognition of signal ... · synthesis of several final...

Documents