study and documentation of the local vine varieties in epirus
Post on 27-Dec-2015
35 Views
Preview:
DESCRIPTION
TRANSCRIPT
CROSS-BORDER NETWORK FOR THE PROMOTION OF WINE PRODUCTS
DELIVERABLE 3.1.3
Study and documentation of the local vine varieties in Epirus “Molecular Taxonomy and identification of indigenous vine varieties in Epirus”
1
GENERAL INTRODUCTION:
Greece is one of the richest European countries in regard to the diversity of
indigenous plant species. The country’s geographic position (a cross point of three
continents, Europe, Asia and Africa) and its vast topographic and geological
diversity have led to the generation of a big number of different biotopes, which
harbour a remarkable diversity of plant species (Stavropoulos et. al., 2006). Although
the Greek domain has been studied systematically for decades, a complete
knowledge of the Greek flora has not yet been achieved (Stavropoulos et. al., 2006).
As far as the study of vine varieties is concerned, the available studies, examine the
identification of these varieties based mainly on ampelographic techniques (Ntavidis,
1982; Kotinis, 1985), while studies employing molecular markers are very limited
(Stavrakakis et. al., 1997; Lefort and Roubelakis-Angelakis, 2000). It is a fact that the
future of Greek wine production is mainly based on the exploitation of indigenous
vine varieties, which are cultured in specific geographic locations and can lead to the
production of wines with particular organoleptic characters and discrete local
character (terroir wines; Fischer et. al., 1999 and references therein). Hence, the
necessity to gain as much knowledge as possible in regard to genetics of these local
vine varieties becomes obvious. For Greece, a country with centuries-long tradition
in viticulture, the production of high quality wines is of great economic importance,
especially since the introduction in the world market, of new competitors (California,
Australia, Chile, etc.) next to the traditional wine producing countries such as France,
Italy, Spain and Portugal.
In this context, the present study aims to contribute to the molecular
characterization and the genetic nature and the recording of red and white
indigenous grape varieties in Epirus. This study is expected to contribut to the
cloning of specific regions of the genome of several vine varieties and the exact
determination of its nucleotide sequence. These regions have not yet been examined
on Greek varieties and it is expected to contribute in the exact discrimination
amongst different varieties, considering the nature of their information content. (see
section “Systems of molecular taxonomy of varieties of vine”). Completion of this
study will achieve: firstly the further exploitation of, so far known vine varieties
cultivated in the area, (Dempina, Vlaxiko, Mpekari), as well as, the recording of
sporadic varieties, such as a few individual plants, which still survive, but are not
cultivated extensively. These plants survive nowadays with minimal cultivation care,
which originates mostly from traditional vine cultivation practices and due to the
acclimatization of these varieties to the conditions existing in Epirus. These are
varieties about which we have little knowledge and which have not been studied
properly. The study of these varieties is possible to increase their value both in
regard to viticulture view, as well as in respect of their wine quality.
The vine variety, the soil (“Chora” according to Theofrastos), the climatic
conditions and the applied vine cultivation techniques (systems of shaping,
supporting, trimming of fruition and cultivation practices) constitute the basic factors
of quality wine production. This rule acquires great importance, when aiming at the
production of quality wines.
It is generally accepted that, without the quality of the raw materials (grape),
quality wine production cannot be achieved, regardless of the current technology
used in winery.
In addition, if local wine varieties of DPO (Designation of Origin), PGI
(Protected Geographical Indication) are used, it is possible to produce local wines
with great added value and recognition, with their own special character,
competitive not only domestically, but also in international markets, which is a very
important matter for the economically weak region of Epirus.
Despite the wide expansion of some varieties (mostly of French origin and
secondly Spanish or Italian), which are considered international, or cosmopolitan, we
are must accept and evaluate the preferences of both vine growers and wine
producers, as well as of consumers for the use and consumption of traditional
European vine varieties.
In contrast to the practice followed over the last years, i.e. the cultivation of
international varieties and the production of so-called cosmopolitan wines, the trend
of highlighting old, forgotten, marginalized varieties of the Greek Vineyard rises
constantly. More and more often, vine growers and wine producers request and
prefer the use of better clones or types or variations of a cultivated vine variety, or
3
the use of forgotten, old, indigenous varieties. This request demands fully
documented studies in all levels, i.e. varietal, cultivation, oenological-winemaking, a
hard and complex task that cannot be dealt with unidimensionally. Experts in
viticulture, ampelography, plant virology, vine propagation, soil scientists and of
course oenologists, constitute the basis of this team for the specification of all of the
components for the rational use of the Greek varieties and the rebirth of the Greek
Vineyard.
Relevant ruling of the Hellenic Ministry of Rural Development and Food in
year 2012, determines the composition of such a team of experts of all required
specialties for the study, evaluation and classification of the vine varieties of Greece.
♦ WINE-GROWING IN EPIRUS AND WINE PRODUCTION
The district of Epirus occupies the north-west part of the country. The district
is consisted of the Counties Unions of Arta, Thesprotia, Ioanninon and Prevezas,
with seat in Ioannina.
It is the most mountainous district of Greece, with abnormal geomorphology
and unusual climatic conditions. The main factors contributing to the development
of these conditions are, its mountainous character, the proximity with sea water
southwest and the mountain range of Pindos eastward with its high altitude.
Traditionally, the cultivation of vine is inextricably connected with the lives
of Epirus residents. Vineyards are met almost throughout Epirus, in every place that
the microclimate allows cultivation of vines. Exquisite vineyards, with the soil and
climatic factors contribute synergistically to the quality and quantity of grapes
produced. Altitude of each region, rainfalls, temperature, humidity and winds
prevailing are the main reasons that support the existence of indigenous, local vine
varieties. According to the data provided for the county of Ioannina by El.
Lampsidis, an expert in viticulture, of the 4th Rural Inspection in 1958, extended
vineyards exist, in the area of Zitsa, Grammenoxoria, Ano Rou of river Kalamas -
now called Pogonio, and in the basin of Ioannina. To a smaller extent, vineyards exist
in the valley of river Aoos, the areas of Konitsa and Mastoroxorion and at Metsobo.
Agro-pastoralist of Epirus concern themselves with agriculture and stock rising
cocommitantly. During winter and spring they sown various cereals and pulses,
during summer various irrigated plants, while they cultivate vines, walnuts,
chestnuts and other fruits (Paul Helstead, 1995).
It seems that wine and “hooch” taxes are imposed very early in Epirus. Late
18th century and early 19th, citizens of Epirus pay their taxes for producing the so
called 'krasonomi'. At the early 19th century its price was 2 “parades” (currency at
the time) for every ounce of wine and 4 “parades” for every ounce of "hooch"
(Bakalis X. Thanasis, 2003).
Viticulture was developed even beyond the so called 'Zitsa". Before 1940, at
the Ano Ravenia of Pogoni, there was a vineyard that produced 350.000 "okades" of
grape per annum (unit of measurement of the mass at the time, Bakalis X. Thanasis,
2003). These vineyards were destroyed during the World War 2, both because of the
burning of many villages in the county of Pogoni during this war, and because of the
occurrence of diseases in the area, in the mid-20th century. Vineyards are completely
abandoned because of the immigration of the residents of Epirus to foreign countries.
Villages are desolated, because the growing old population left behind could not
cope with the rebirth of destroyed vineyards and the manual labor demanded for
their cultivation (Bakalhs X. Thanasis, 2003).
The renowned vineyard of Zitsa had unfortunately the same fate. In the
following years, after the war, many citizens were led to emigration, a situation
intensified by the occurrence epidemics striking the vineyards till early 1970
(http://el.wikipedia.org/wiki/Ζίτσα ). A phenomenon affecting striking, without
doubt, the whole of the Epirotic Vineyard. The cases of vine-growers at the time,
who had the courage, vision and taste, to defy the difficulties and try to cultivate
again, are just few.
In the late 1950's, Evaggelos Averof begins the implementation of his own
vision for the rebirth of the vineyards in Metsobo. He started planting on the steep
sides of Pindos, at 1000 meters of altitude, the first vines of the French variety
Cabernet Sauvignon. The rebirth of vine cultivation of Metsovo is now a fact. The
first wine is bottled in the cellar of his house at Metsovo, and is thus called "Averf’s
Cellar". On the first bottle’s label stand "Vines from France in Greek mountainous
soil…" a label designed by him. In the passage of time individual plants of rural
varieties are found and studied by the Averof Institute (http://www.katogi-
strofilia.gr/history.html).
5
In 1972, a Royal Decree establishes and sets the boundaries of the Wine Zone
of Zitsa, which comprises the vineyards of six local Communities, i.e. Zitsa, Karitsa,
Ligopsa, Gavrison, Protopapa and Klimatia, which constitute the today’s Zitsa
county (R.D. 183, GGP 40/Α/17.03.1972 and decree 228173, GGP 287/β/27.04.72). A
vineyard located from 600 m to 800 m of altitude on the basin of Zitsa and adjacent
hills, spreads in an area of 1.500 acres and grows in infertile, shallow limestone
grounds. The Zitsa vine zone has established its reputation as a wine-producing area,
while its products are well known both in the Greek Market, as well as
internationally. Wines are entitled to have the “Zitsa” DPO that are white, brut and
are made from the white variety Debina. It is an old rural variety of Epirus that, in
one version, is cultivated since late 16th century. We do not know the exact origin,
and also it is not mentioned by wine recorders of 18th-19th century (Stavrakakis N.
Manolis, 2010). According to the area tradition, Debina is mixed with the red
varieties Vlachiko and Bekari, creating a rose, demisec, sparkling wine with rich
aroma.
♦ VINE VARIETY CLASSIFICATION SYSTEMS
Ampelographic description
Ampelography, as a special sector of Viticulture, has as its object, either the
classic or the modern form of the description, discernment and evaluation of
cultivated varieties, with the ultimate purpose of their classification. Given the great
genetic diversity of cultivated varieties, their polyclonal composition and the large
number of synonyms that each variety displays, it is clear that the effort of defining
the typical sample of a variety is impeded, a typical sample, which would be the
reference standard of all other comparative studies, types or clones of the reference
variety.
Prior ampelographic research and studies of Greek ampelographers
(Orphanidis, Krimbas, Logothetis, Ntavidis, Vlachos), certainly constitute reference
points. The ampelographic description of varieties being studied is essential
regardless whether they are known or unknown varieties. The pre-condition for an
ampelographic description to be valid, is the complete implementation of the Code
of Ampelographic Studies of the International Organisation of Vine and Wine
(O.I.V.).
The ampelographic description presents great complexity and requires
special attention. Indicatively, it is mentioned that every ampelographic description
of each system, includes a great number of organs or parts of organs of individual
plants, in order to adequately determine their ampelographic characters and to
distinguish, identify or classify them. This number and the necessary detailed
description varies from case to case, depending on the specific goal of the individual
study. E.g., the list for banks conserving genetic material, include 21 characters, while
in the case of new varieties it requires the description of 78 characters, 40 of which
are compulsory. The code of the O.I.V. contains 121 characters (Stavrakakis N.
Manolis 2010).
As a cultivated grapevine variety we define the population of individual
plants derived by vegetative propagation (grafting, or inoculation) from more than
one parent plants, and which the viticultural empiricism united them under the
same name (Ntavidis 1982).
As already mentioned the cultivated vine variety is diverse and
systematically deviates from the botanical one. To address this problem, O.I.V.
introduced the ampelographic clone as a subject of description. As a clone is defined
a population of individuals derived by vegetative propagation from a parent plant
and have the same genotype and properties as the parent plant.
The importance of the knowledge about the clonal composition of cultivated
varieties, the evaluation, isolation and amplification of desired clones, has an
enormous importance for modern viticulture, particularly for the production of high
quality wines, but also for the ampelographic collections.
The clonal selection programs are especially costly, long term (over ten years)
and interdisciplinary, while the clonal selection protocols differ from country to
country in the degree accuracy, the tests and the number of the studied characters. A
key element of applying the clonal selection is the ampelographic knowledge of the
studied variety. In other words, the labelling of raw individuals and potential clones,
is essentially a complete ampelographic study, while the evaluation during the first
three years period includes all characters contained in the selected protocol.
7
Given the large number of Greek varieties, the polyclonality and genetic
diversity, the pressing need to allocate genuine, certified, healthy propagation
material and the interest for the improvement, or enlargement of the used varietal
potential, is essential for the rational orientation of the Greek vineyard, through the
re-evaluation both at the local and the regional level of the “recommended”,
“permitted” and eventually cultivated varieties (Greek and foreign). In the second
stage, it is required the ampelographic study of varieties deemed appropriate. And
in the third stage, the application of clonal selection programs for the isolation and
use of the most suitable clones.
In the countries with advanced vineculture, the implementation of such
programs has led to the isolation and the emergence of clones with specific
morphological and physiological characters with respect to grapes, berries, must and
their cultivating behavior.
Ampelographic characteristics of several cultivated varieties in the area of Epirus
DEBINA
Debina is a white variety, indigenous to the district of Ioannina, undoubtedly
the most remarkable. It usually occurs in the wine zone of Zitsa, from where it was
transferred to other areas. It is a vivid plant, robust, fertile, and productive, with an
average production ranging from 700 to 1200 kg per acre. In the zone where it is
produced, it exhibits a susceptibility to drought, mildew and botrytis and there is
also a problem with contagious degeneration.
It is traditionally configured to cup shape, although in the last years the
formation of vineyards in linear bilateral cord Royat has prevailed and is trimmed
near the two eyes.
Growth stars early April and rips around late September - early October. It
usually produces 2 grapes in each fruitful shoot, of medium to large size, with an
average weight about 400 gr, conical, spur, with dense grape growth. The grape is of
medium sizespherical, with yellow-green color, soft flesh and sweet to acidic taste,
which attracts wasps. This variety produces exquisite white brut wines, sparkling
and semi sparkling semisweet wines of DPO 'Zitsa', as well as the Local Wine of
Ioannina, after mixing with Vlachiko and Bekari (Spinthiropoulou Charoula 2000,
Stavrakakis N. Manolis 2010, Stavrakas Eu. Dimitrios 1998 and 2010).
VOTSIKA
It is a white variety indigenous to the district of Ioannina. Scattered
individual plants are found near the area of Konitsa, at the Valley of Aoos River and
its side rivers.
It is a productive plant of medium vigor. It is relative sensitive to drought.
It begins shooting during the last ten days of March and rips after mid-
August.
It usually produces a large grape in each shoot, of conical shape and finny,
with relatively small grapes growth and with medium ovoid yellow-green grapes
with tough bark.
Its must is rich in sugars and of medium acidity (Spinthiropoulou Charoula,
2000).
BABACHASAN
It is a white variety grown in very small numbers in the area of Konitsa, in the
Valley of Aoos River and its side rivers, and the district of Thesprotia.
It is a vivid, robust and productive plant, which usually carries a grape on
each fruiting vine that exceeds 500g, cylindrical, with dense grape growth.
It begins its shooting in mid-April and matures in September
(Spinthiropoulou Charoula, 2000).
VLACHIKO
It is a red variety that grows in a limited area in the district of Ioannina but it
is also found in other regions of Epirus in even smaller areas.
The plant is strong and productive. Usually carries two grapes on every
fruitful shoot, single paddle or double conic-cylindrical of normal density. The
grapes are medium sized and vividly colored.
Shooting begins in early-April and ripens in early-September.
9
It produces high-alcohol graded wines, with moderate acidity and color. It is
involved in the production of Local Wine of Ioannina and Metsovo (Spinthiropoulou
Charoula 2000, Stavrakas Eu. Dimitrios 2010).
BEKARI
It is a red variety grown in a small area mainly in the district of Ioannina.
It is a vigorous, robust and productive plant. It usually carries two grapes in
every fruitful shoot, large, cylindrical and of normal density. The grapes are
spherical, medium-sized and reddish colored.
Shooting begins in mid-March and matures in early September.
It is involved in the production of the Local Wine of Ioannina
(Spinthiropoulou Charoula 2000, Stavrakas Eu. Dimitrios 2010).
Systems of Molecular Classification of Vine varieties
From 1970 and later, the use of additional was employed for the identification
and classification of the vine varieties, which were based on the phenotypic
characters of the varieties used, such as biochemical methods. It mainly employed
the use of the electrophoretic separation of certain proteins (enzymes) of plant tissue.
Although such studies certainly contribute to the taxonomic characterization of an
organism, they are not enough in various cases. E.g., if a tissue contains two
isomorphs of a protein and the examined individual carries such a mutationof ,
which leads to the non-productionof one of the isomorphs in its tissues, then it can
lead to incorrect, or ambiguous results.
In order to gain a full classification image, the use of multiphase approaches
is required, in which we certainly also study genetic characters of the organism
under examination.
The last years, various molecular methods are used for this purpose, which
are based on genotype characteristics of the plants. Such methods are:
Polymorphisms of restriction fragments size DNA (RFLP, Restriction Fragment
Length Polymorphism), the random amplification of Polymorphic DNA (RAPD,
Random Amplified Polymorphic DNA), the amplified fragments length
polymorphism DNA (AFLP, Amplified Fragment Length Polymorphism DNA), the
microsatellite DNA, (SSR, Single Sequence Repeats, Stavrakakis N. Manolis, 2010).
As far as the genetic constitution of the Greek vine varieties is considered, as
afore mentioned the studies are: 1. Very limited in number (Stavrakakis et. al., 1997;
Lefort and Roubelakis-Angelakis, 2000). 2. Different methods and indexes are used
(RAPD, the Stavrakakis et. al., analysis of microsatellite DNA, the Lefort and
Roubelakis-Angelakis) and 3. Examination samples from different varieties and
different geographical areas.
As mentioned above, a full classification study should be multiphasic,
including multiple experimental approaches, phenetics (based on phenotypic
characteristics, morphological, anatomical, biochemical) and genetic (based on
genotypic characteristics). Therefore, the thus far published studies form a partial
molecular approach. These should be completed with other studies in which
different techniques and parts of the gene would be used.
Objectives of this study:
1. To contribute to the molecular taxonomy of vine varieties by using other
regions of the genome, as the ones used thus far. These regions include (Figure 1): a
small part of 3’ –edge of 18S rRNA gene (18S rDNA), the region of the Internal
Transcribed Spacer 1 (ITS1), the 5.8S rRNA gene, the Internal Transcribed Spacer 2
(ITS 2) and a small part of 5’-edge of 26S rRNA gene (26S rDNA).
Figure 1: Genetic structure of the rRNA operon in plants. E, denotes the positions of two EcoRI restriction sites in the corresponding region in fungi. Specifically, ITS1 is located between the 18S rRNA and the 5,8S rRNA genes, while ITS2 is located between genes encoding the 5,8S rRNA and the 26S rRNA. Baldwin, (1992), suggested that these regions are very suitable for molecular taxonomic purposes and the establishment of phylogenetic relationships of plants. One major reason for this suitability is the fact that ITS1 and 2 do not encode any product, and therefore, they can accumulate mutations, without affecting the plant’s
11
phenotype, while concomitantly allowing individual plants to diversify genetically. In contrast, other, vital, regions, such as ribosomal RNA genes, have a very limited capacity, if any at all, to accumulate mutations, because the latter lead usually to a lethal phenotype, since the cellular function of these RNA molecules is highly important for the process of protein biosynthesis. 2. Focused partial molecular study of varieties originating from the district of Ioannina, which until now have not been systematically studied. Therefore, this research contributes to the taxonomic study of grape varieties, general in Greece and specifically in Epirus. The practical importance of taxonomic and molecular research is: 1. The ability to install parental certified cultivations of vine varieties. 2. The ability to produce certified and guaranteed wines with an expected outcome in order to increase the commercial value of the produced wines. WORK PACKAGES: WORK PACKAGE 1 Sampling and morphologic analysis of the leaves from several local grapevine varieties.
Work package 1.1: Sampling Leaf samples were collected from various vine plants of the known and local varieties of Debina (white), Vlaxiko and Bekari (red), but also genetically undefined varieties from vineyards which are scattered in the Regional Unity of Ioannina (Epirus), the wider area of Zitsa, Konitsa and Metsovo. Wherever possible, aged “premna” were identified (by their root system), which trough out their life have been cut by winegrowers and have vegetated again.
Method: Leaves of about 10g were collected from at least five different plants per property or location. Wherever the number of plants was adequate, the sampling was random. The collected leaves were subjected to washing with a dilute detergent, firstly washed with tap water and then with deionized water. Then dried on filter paper, were classified according to the following table (Table 1) and were stored in refrigerator at -80oC.
Table 1: Detailed description of sampling Serial
number of the total
sample
Variety
Serial number of sample per
variety and location
Location / Comments
1 DEBINA Νο1 Mr Mpakolas Mattheos - Nikanor of Konitsa, individual plant about 95 years old
2 DEBINA Νο2 ≈ 3 DEBINA Νο3 ≈
4 DEBINA Νο4 ≈ 5 DEBINA Νο5 ≈ 6 VOTSIKA Νο1 ≈ 7 VOTSIKA Νο2 ≈ 8 VOTSIKA Νο3 ≈ 9 VOTSIKA Νο4 ≈ 10 VOTSIKA Νο5 ≈ 11 DΟVRINO Νο1 ≈ 12 DΟVRINO Νο2 ≈ 13 DΟVRINO Νο3 ≈ 14 DΟVRINO Νο4 ≈ 15 DΟVRINO Νο5 ≈ 16 ΜΑYROYDI KONITSAS Νο1 Mr Nikopoulos G.
Collected plants from desolated Turkish mansions
17 ΜΑYROYDI KONITSAS Νο2 ≈ 18 ΜΑYROYDI KONITSAS
ΜΑYROYDI KONITSAS Νο3 ≈
19 ΜΑYROYDI KONITSAS ΜΑYROYDI KONITSAS
Νο4 Manis Ilias Molybvoskepasto, individual plant about 70 years old
20 ΜΑYROYDI KONITSAS Νο5 Dafnis Athanasios Molybvoskepasto, individual plant about 40 years old
21 BABACHASAN Νο1 Mr Chousos K.
planting, 1993 22 BABACHASAN Νο2 Ms Betziou E.,
individual plant about 30 years old
23 BABACHASAN Νο3 Mr Nikopoulos G., Turkish vine
24 BABACHASAN Νο4 Mr Nikopoulos G. Turkish vine
25 BABACHASAN Νο5 Mr Nikopoulos G. Turkish vine
26 GOUDABA Νο1 Collection of Averof
Institute
13
27 GOUDABA Νο2 ≈ 28 GOUDABA Νο3 ≈ 29 GOUDABA Νο4 ≈ 30 GOUDABA Νο5 ≈ 31 DEBINA METSOVOU Νο1 ≈ 32 DEBINA METSOVOU Νο2 ≈ 33 DEBINA METSOVOU Νο3 ≈ 34 DEBINA METSOVOU Νο4 ≈ 35 DEBINA METSOVOU Νο5 ≈ 36 PYKNOASSA Νο1 ≈ 37 PYKNOASSA Νο2 ≈ 38 PYKNOASSA Νο3 ≈ 39 PYKNOASSA Νο4 ≈ 40 PYKNOASSA Νο5 ≈ 41 PROIMO METSOVOU Νο1 ≈ 42 PROIMO METSOVOU Νο2 ≈ 43 PROIMO METSOVOU Νο3 ≈ 44 PROIMO METSOVOU Νο4 ≈ 45 PROIMO METSOVOU Νο5 ≈ 46 DEBINA Νο1 Wine-making zone of
Zitsa 47 DEBINA Νο2 ≈ 48 DEBINA Νο3 ≈ 49 DEBINA Νο4 ≈ 50 DEBINA Νο5 ≈ 51 VLACHIKO Νο1 ≈ 52 VLACHIKO Νο2 ≈ 53 VLACHIKO Νο3 ≈ 54 VLACHIKO Νο4 ≈ 55 VLACHIKO Νο5 ≈ 56 BEKARI Νο1 ≈ 57 BEKARI Νο2 ≈ 58 BEKARI Νο3 ≈ 59 BEKARI Νο4 ≈ 60 BEKARI Νο5 ≈ The sampling took place since late September until late October. It should be
indicated that the leaves of strains 26- 45 showed local intense sepsis and fungal
populations, due to weather conditions. It is estimated that a revision of the
sampling should be done early spring with the appearance of new leaves per variety.
Figure 2: Debina from Konitsa
Figure 3: Votsika
15
Sample codes:
Plants were collected from the following varieties and locations: 1. Debina
(Konitsa codes: DeK 1-5), 2. Votsikas (Konitsa, VoK 1-5), 3. Ntovrino (Konitsa, DoK 1-
5), 4. Mavroudi (Konitsa codes: MaK 1-3, MaM 1-2), 5. Babachasan (Konishi, BaK 1-
5), 6. Gkoudaba (Metsovo, GuM 1-5), 7. Debina (Metsovo, DeM 1 - 5) 8. Pyknoassa
(Metsovo, PyM 1-5), 9. Dopio Proimo (Metsovo, EaM 1-5), 10. Vlachiko (Zitsa BlZ 1-
5) and 11. Bekari (Zitsa, BeZ 1-5).
Duration: 1 month
Deliverables: Leaves of vine varieties to be used for molecular taxonomy
(Work Package 2).
Work Package 1.2: Comparative analysis of leaf morphology and their
photosynthetic pigments’ contents.
The ampelographic characters of individuals of a variety may be used for the
classification of a variety. For this, it is possible to use multiple characters. In the
present study, ampelographic characters of leaves, used as criteria are as follows
(Figure 2, Drosou M, 2010):
1. The general shape of the leaves (heart-shaped, Reni form wedge or
circular).
2. Number and shape of the upper and lower invaginations of leaves.
3. Shape of the stem of the invagination (figure U, V or lyre-shaped).
4. Figure of teeth (curved hook or acid).
5. Figure of ribs (lateral or external).
Figure 10: Ampelographic leaf characters used in the morphological approach
Results and discussion:
The attempt to identify the varieties using the above ampelographic
characters proved unproductive, due to the fact that the leaves exhibited significant
diversity between individuals of the same species (Table 2). No unique characteristic
character of any variety was found.
Table 2: Analysis of the leaf morphology of local grapevine varieties
Plant code Overall leaf shape
Number of invaginations
Shape of stem-cleft
Teeth shape Venation
DoK1 circular 5 harp-like convex Bilateral DoK2 deltoid 5 U form convex Bilateral DoK3 deltoid 5 U form angled Bilateral DoK4 circular 5 harp-like angled External DoK5 deltoid 5 harp-like angled External GuM1 deltoid 5 U form angled Bilateral
Tooth
Lower invagination
Upper invagination
Form of the stem invagination
21
GuM2 deltoid 5 U form angled Bilateral GuM3 circular 5 U form angled Bilateral GuM4 deltoid 5 V form angled Bilateral GuM5 circular 5 harp-like angled Bilateral VoK1 circular 5 harp-like convex External VoK2 circular 5 V convex Bilateral VoK3 circular 5 U angled Bilateral VoK4 deltoid 7 harp-like convex Bilateral VoK5 circular 5 U angled Bilateral MaK1 circular 5 harp-like angled External MaK2 circular 5 V angled External MaK3 circular 5 U angled External MaM1 deltoid 5 harp-like angled External MaM2 deltoid 5 harp-like angled External DeK 1 Pentagonal 5 harp-like convex Bilateral DeK 2 Pentagonal 5 harp-like convex Bilateral DeK3 circular 5 harp-like convex Bilateral DeK4 Pentagonal 5 harp-like angled Bilateral DeK5 Pentagonal 5 harp-like angled Bilateral EaM 1 circular 0 harp-like angled External EaM 2 circular 0 V angled External EaM 3 circular 0 U convex External EaM 4 circular 0 V angled External EaM 5 circular 3 V angled External
BaK1 circular 3 V angled Bilateral BaK2 Pentagonal 5 harp-like convex Bilateral BaK3 Pentagonal 5 harp-like convex Bilateral BaK4 deltoid 7 harp-like angled Bilateral BaK5 deltoid 7 harp-like angled Bilateral
Biochemical analysis of the chlorophyll and carotene content of the leaves: A second phenetic (phenotype-based) approach was used to discriminate
between varieties, based on biochemical properties of the plants, i.e. the photosynthetic pigment-content (chlorophyll and carotene) of the leaves. Pigments were extracted with acetone from homogenized leaf tissue, and their concentration was determined photometrically. As shown in Table 3, these data were inconclusive as well, since the variability of the values among individual plants belonging to the same variety, which did not allow for any statistically significant conclusion.
Table 3: Photosynthetic pigment content of the leaves Plant code A470nm A646nm A663nm A720nm
DeM1 0.613 0.202 0.398 0.030
DeM2 0.472 0.175 0.394 0.023
DeM3 0.515 0.220 0.449 0.033
DeM4 1.017 0.370 0.804 0.034
DeM5 1.517 0.708 1.507 0.026
EaM1 1.277 0.467 0.990 0.037
EaM 1.053 0.313 0.668 0.028
EaM3 1.137 0.330 0.729 0.021
EaM4 0.780 0.278 0.626 0.018
EaM5 0.880 0.314 0.732 0.014
BaK1 1.328 0.548 1.292 0.022
BaK2 1.304 0.583 1.257 0.031
BaK3 1.418 0.637 1.345 0.019
BaK4 1.210 0.520 1.138 0.015
BaK5 1.371 0.613 1.315 0.018
DeK1 1.408 0.564 1.315 0.020
DeK2 1.487 0.716 1.551 0.018
DeK3 1.801 1.180 1.873 0.024
DeK4 1.721 0.913 1.777 0.023
DeK5 1.212 0.486 1.099 0.022
GuM1 1.138 0.435 1.007 0.025
GuM2 1.425 0.622 1.383 0.031
GuM3 1.223 0.536 1.221 0.027
GuM4 0.846 0.336 0.771 0.020
GuM5 1.503 0.672 1.509 0.023
DoK1 0.724 0.189 0.377 0.018
DoK2 0.888 0.313 0.704 0.015
DoK3 0.811 0.275 0.595 0.030
DoK4 0.928 0.329 0.743 0.023
DoK5 0.694 0.249 0.581 0.014
VoK1 1.799 1.116 1.879 0.013
23
VoK2 1.735 1.011 1.851 0.017
VoK3 1.256 0.529 1.270 0.016
VoK4 0.655 0.253 0.615 0.013
VoK5 0.711 0.240 0.591 0.013
PyM1 1.119 0.428 0.919 0.019
PyM2 1.348 0.497 1.015 0.026
PyM3 1.268 0.493 1.061 0.039
PyM4 1.762 0.838 1.597 0.031
PyM5 1.174 0.456 1.004 0.012
MaK1 1.463 0.601 1.311 0.019
MaK2 1.263 0.516 1.206 0.013
MaK3 1.090 0.420 0.952 0.016
MaM1 0.903 0.299 0.713 0.011
MaM2 1.056 0.417 0.938 0.014
Deliverables: 1. Table of morphological ampelographic characters of the leaves. 2. Table with concentrations of the photosynthetic pigments of leaves of the
examined grapevine varieties. WORK PACKAGE 2: Molecular identification of local grapevine varieties based on the sequence analysis of their ITS1 and ITS2 regions (Baldwin, 1992)
Material and Methods: Approximately 0.5 gr of leaf tissue from three to five individuals from each
variety/location was used to isolate genomic DNA according to Mylona, A, et al., 2008. Approximately 100-150 ng of genomic DNA were used in Polymerase Chain Reaction assays (Saiki, R.K., et al., 1988), to amplify the ITS regions, using primers VvF (GTCGCGAGAAGTCCACTGAA) and VvR (TCCGGACTACAATTCGGACG). Primers were designed based on data deposited in the GenBank (“Vitis Vinifera contig VV78X177628.4, whole genome shotgun sequence”. GenBank: AM462492.2). Reaction and amplification conditions were according to the recommendations of the polymerase’s manufacturer (KAPA HiFiTM, KAPABIOSYSTEMS, Boston, MA, USA). Resulting amplicons, were purified using Geneclean (MP Biomedicals, Solon, USA). Approximately 50 ng of amplicon DNA were sequenced (CeMIA, Larissa, Greece).
Sequences were aligned using the algorithm BLAST (Altschul et al. 1997) and phylogenetic trees were constructed using the algorithm ClustalW (EBI, EMBL)
Results and discussion: A representative gel (1% agarose 1XTAE) showing purified amplicons is
presented in Figure .
Figure 11: Agarose gel electrophoresis of produced amplicons (position indicate by the yellow arrow) Lanes: 1 and 15: 2.0 μl 100 bp ladder, 2: DeM1 [1.0 μl], 3: DeM2 [1.0 μl], 4: DeD1 [1.0 μl], DeD2 [1.0 μl], De26 [1.0 μl], GuM1 [1.0 μl], De1 [1.0 μl], De2 [1.0 μl], DoM1 [1.0 μl], DoM2 [1.0 μl], DoM3 [1.0 μl], BaK2 [1.0 μl], BaK1 [1.0 μl]. The yellow arrow indicates the position of the amplicons in the gel.
The sequencing results are presented below in Table 4 and in Figures 4 and 5. Figure 4 presents the phylogram of the individuals belonging to variety Debina, while Figure 5 presents the phylogram of all other varieties. Table 4: Percentage of identity of sequenced amplicons with related species
Plant code
% of identity Related species
1 BlΖ1 97% Vitis vinifera contig VV78X076350.4 2 BlΖ2 - No significant similarity found 3 BlΖ3 95 % Vitis vinifera contig VV78X076350.4 4 BlΖ4 - - 5 BlΖ5 - -
25
6 VoK1 76 % Vitis vinifera contig VV78X177628.4 7 VoK 2 86 % Vitis vinifera contig VV78X177628.4 8 VoK 3 78 % Vitis vinifera contig VV78X177628.4 9 VoK 4 76 % Vitis vinifera contig VV78X082551.7 10 VoK 5 81 % Vitis vinifera contig VV78X082551.7 11 DeK 1 86 % Vitis vinifera contig VV79X005930.2 12 DeK 2 89 % Vitis vinifera contig VV79X005930.2 13 DeK 3 88 % Vitis vinifera contig VV79X005930.2 14 DeB 1 84 % Vitis vinifera contig VV79X005930.2 15 DeB 2 80 % Vitis vinifera contig VV79X005930.2 16 DeB 3 79 % Vitis vinifera contig VV79X005930.2 17 DeM4.6 82 % Vitis vinifera contig VV79X005930.2 18 DeM 22 81 % Vitis vinifera contig VV78X082551.7 19 DeM 24 79 % Vitis vinifera contig VV79X005930.2 20 DeM 26 79 % Vitis vinifera contig VV79X005930.2 21 DeM 27 84 % Vitis vinifera contig VV79X005930.2 22 DeMo 1.2 97 % Vitis vinifera contig VV78X177628.4 23 DeMo2 82% Vitis vinifera contig VV79X005930.2 24 DeD 1 87 % Vitis vinifera contig VV79X005930.2 25 DeD 2 94 % Vitis vinifera contig VV78X177628.4 26 GuM 13 81 % Vitis vinifera contig VV79X005930.2 27 GuM 16 89 % Vitis vinifera contig VV79X005930.2 28 GuM 21 85 % Vitis vinifera contig VV79X005930.2 29 MaK 1 93 % Vitis vinifera contig VV78X177628.4 30 MaK 2 94 % Vitis vinifera contig VV78X076350.4 31 MaK 3 92 % Vitis vinifera contig VV78X076350.4 32 MaK 4 - - 33 MaK 5 84 % Vitis vinifera contig VV79X005930.2 34 PyM 1 82 % Vitis vinifera contig VV79X005930.2 35 PyM 1.3 80 % Vitis vinifera contig VV79X005930.2 36 PyM 2.3 79 % Vitis vinifera contig VV79X005930.2 37 PyM 3.4 76 % Vitis vinifera contig VV78X082551.7 38 PyM 4.8 80 % Vitis vinifera contig VV78X082551.7 39 DoK 1 76 % Vitis vinifera contig VV78X082551.7 40 DoK 2 89 % Vitis vinifera contig VV78X082551.7 41 DoK 3 81 % Vitis vinifera contig VV79X005930.2 42 BaK 1 96 % Vitis vinifera contig VV78X076350.4 43 BaK 2 85 % Vitis vinifera contig VV78X177628.4 44 BaK 5 70% Vitis vinifera contig VV78X082551.7 45 BeZ 1 95 % Vitis vinifera contig VV78X177628.4 46 BeZ 2 87% Vitis vinifera contig VV79X005930.2 47 BeZ 3 94 % Vitis vinifera contig VV78X177628.4 48 BeZ 4 - No significant similarity found 49 BeZ 5 83 % Vitis vinifera contig VV78X177628.4 50 EaM17 97 % Vitis vinifera contig VV78X082551.7 51 EaM18 97 % Vitis vinifera contig VV78X076350.4 52 EaM20 88 % Vitis vinifera contig VV78X082551.7 53 EaM22 96 % Vitis vinifera contig VV78X082551.7
54 EaM25 85 % Vitis vinifera contig VV78X177628.4 The data in Table 4 give the percentage of identity with sequences of Vitis
Vinifera deposited in the GenBank. Some individuals failed to show any similarity to any organism, due to difficulties in the sequencing procedure. For the same reason, individual plants belonging to the same variety show some variability in sequence, which is greater than expected, but still within the limits of natural variation within a variety.
Figure 12: Phylogram of the ITS regions from individuals belonging to variety Debina, cultivated in different regions of Epirus. Included, as outgroups, are also representative sequences, originating from other varieties [Vlachiko (Bl), Babachasan (Ba), Bekari (Be) Votsika (Vo), Dovrino (Do), Gudaba (Gu), Pycnoassa (Py) and Local Early (Ea)].
27
Figure 13: Phylogram of the ITS regions from individuals belonging to varieties Vlachiko (Bl), Babachasan (Ba), Bekari (Be), Votsika (Vo), Dovrino (Do), Goudaba (Gu), Pycnoassa (Py) and Local Early (Ea) cultivated in different regions of Epirus. As outgroups served representative sequences, originating from variety Debina, cultivated in different locations in Epirus.
Duration: 6 months
Deliverables: 1. ITS1 and ITS2 sequences of the examined varieties (Appendix) 2. Phylogenetic relationships among the examined varieties (Figures 4 and 5).
Conclusions:
The results presented on Table 4 and Figures 4 and 5 have to be considered as a first approach on the matter. It is highlighted that all cases demand: 1. The enlargement of the number of samples per variety and 2. The examination of other varieties, which will broaden the existing database and will allow safer comparisons. At this point it should be mentioned that the international existing database does not seem to include sequences of Greek vine varieties. The temporary conclusions extracted by these results are the following:
1. The examined plants of Debina variety show significant genotypic homogeneity, which does not seem to be affected by the fact that it is cultivated on different areas. Therefore, as long as the provisional result is confirmed, an experimental crop should be installed where the plants used will come from any area of already examined plants. 2. Varieties of Votsika and Vlachiko, appear to have significant internal genotypic homogeneity. Although it would be advisable to study more samples from different plants of these varieties, however it can be safely said that, whichever of these plants could be used for experimental crops and parent plants development. 3. The Bekari variety seems to be divided in two genotypic teams, one containing three individuals, while the other two. Again, more plants should be studied and plants from both teams should be cultivated. The products of these plants should undergo winemaking in small scale for several years and have their quality (e.g. organoleptic) and quantity characters examined to show their true commercial value, if any. 4. The Dovrino, Mavroudi, Goudaba and Babachasan varieties appear to have a not so insignificant genotypic heterogeneity on their specific regions, but the additional samples are required for examination to be confirmed or reject this result. In the case of these varieties he previous (Bekari) moves are recommended. 5. The Pyknoassa and Ntopio Proimo varieties both show a significant broaden genotypic heterogeneity, but which probably is due to the difficulties of the procedure of identifying nucleotide sequences in their ITS region. The repetition of these experiments is required and probably the expansion of the examination on more idnividuals.
29
Literature: • Altschul S.F., Madden T.L., Schäffer A.A., Zhang J., Zhang Z., Miller W., Lipman D. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res, 25: 3389-3402 • Baird N.A., Etter P.D., Atwood T.S., Currey M. C., Shiver A.L., Lewis Z.A., Selker E.U., Cresko W.A., Johnson E.A. (2008). Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers. PLoS ONE 3(10): e3376. doi:10.1371/journal.pone.0003376. • Βακάλης Χ. Θανάσης 2003: Τα Άνω Ραβένια και τα Δυτικότερα Ζαγοροχώρια, Εκδόσεις Μίλητος. • Baldwin, G.B. (1992). Phylogenetic Utility of the Internal Transcribed Spacers of Nuclear Ribosomal DNA in Plants: An example from the Compositae. Molecular Phylogenetics and Evolution, 1(1): 3-16. • Biniari, K. and M.N., Stavrakakis (2007). Genetic study of 46 Greek grape cultivars by random amplified polymorphic DNA markers (RAPD-PCR). ΧΧΧ th OIV World Congress (Budapest 10-16 June 2007). • Drosou, M. (2010). Ampelographic description of some varieties (Vitis vinifera L.) cultivated on the island of Thera. [MSc. Thesis, Department of Plant Production Science, Agricultural University of Athens, Athens, Greece. • Fischer U., D., Roth, and M., Christmann. (1999). The impact of geographic origin, vintage and wine estate on sensory properties of Vitis vinifera cv. Riesling wines. Food Quality and Preference, 10: 281-288. • Halstead, Paul. (1995). Μεσογειακή Ορεινή Οικονομία στην Πίνδο, Μετακινήσεις ανάμεσα στο Παρόν και το Παρελθόν. Α’ Επιστημονικό συμπόσιο - Η Επαρχία Κόνιτσας στο Χώρο και το Χρόνο. • Kotinis X., 1985. Ελληνικός Αμπελογραφικός Άτλας [Ampelographic Atlas of Greece, Greek with French summary], Athens: Ministry of Agriculture, Republic of Greece. • Lefort F. and K.A., Roubelakis-Angelakis. (2000). The Greek Vitis Database: A Multimedia Web-backed Genetic Database for Germplasm Management of Vitis Resources in Greece. Journal of Wine Research, 11(3): 233-242. • Mylona, A., K. Piliou, I. Smyrnioudis, and E. Hatziloukas. Molecular taxonomy of morphologically diverse cultivars of Pistacia lentiscus Var. Chia. (2008) The FEBS Journal, 275 (Suppl. 1): 361 • Ntavidis O.X., 1982. Ελληνική Αμπελολογία (Δοκίμιο). Τόμος Γ’. Στοιχεία Αμπελογραφίας. [Greek Grapevine Studies, Band 3, Elements of Ampelography, 2nd edition, Athens: Agricultural College of Athens.
• Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, T., Mullis K.B., and Erlich, H.A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239: 487-491. • Sambrook, J., and D.W., Russell. (2001). Molecular Cloning. A LABORATORY MANUAL (3rd EDITION). Cold Spring Harbour Laboratory, Cold Spring Harbor, New York, USA. • Σπινθηροπούλου Χαρούλα, 2000. Οινοποιήσιμες ποικιλίες του Ελληνικού Αμπελώνα, Εκδόσεις Olive Press. • Σταύρακας Ευστ. Δημήτριος 2010: Αμπελογραφία, Εκδόσεις Ζήτη. • Σταυρόπουλος N., Γκόγκας Δ., Χατζηαθανασίου A., Ζαγγίλης E., Δρακόπουλος Γ., Παϊταρίδου Δ., Τρίγκας Π., Θανόπουλος Ρ., Κουτσομήτρος Σ., Περδικάρης Α., Λουρίδα Β. και Αλέστα A., 2006. Ελλάδα: Δεύτερη Εθνική Έκθεση σχετικά με την κατάσταση των φυτογενετικών πόρων για τα τρόφιμα και τη γεωργία. Ελληνική Δημοκρατία, Υπουργείο Αγροτικής Ανάπτυξης και Τροφίμων, Αθήνα. http://www.minagric.gr/Greek/data/NatReport-2006_FAO_PGR_greek_final.pdf. • Σταυρακάκης Ν. Μανόλης, 2010: Αμπελογραφία, Εκδόσεις Τροπή. • Stavrakakis M.N, K., Biniari, and P., Hatzopoulos. (1997). Identification and discrimination of eight Greek grape cultivars (Vitis vinifera L.) by random amplified polymorphic DNA markers. Vitis, 36: 175-178. • Thomas, M.R., S. Matsumoto, P. Cain, and N.S. Scott. (1993). Repetitive DNA of grapevine: classes present and sequences suitable for cultivar identification. Theoritical and Applied Genetics, 86: 173-180. • http://el.wikipedia.org/wiki/%CE%96%CE%AF%CF%84%CF%83%CE%B1.
31
Appendix: Sequences of the ITS regions of the examined individual plants from the grapevine varieties >BlZ1 ATASSGGSCCSAWTYYMGGYTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGT >BlZ2 GGGAGGGTAAGAATTCCAKAACTAGTGTTKTCTCGWAGTMTWAACGCATTAAAAAGGGAAGAYATGCCTATTCTTTCTCCTACCAACTTCTGCTATTGMAGCTGAAAACCCAYAAACCTATCATTGMCCCARATCRRGAGTTACACACACAGCCASATTTGGACTGGACAMTTGGATGTTTTTTTATTKATTTGAGCTGTTMCRATTAACYTACGAACCTCMAACTTCCCACTGCATTCGTTGWAAACCYTTTAGAGCAATTTCACCATACAAAATCTCCTYTCTAGAGTAATASTCCTTGTTTTTCTACAAATTMATTCWTTATC >BlZ3 AGCAAGCGATCTMGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGG >BlZ4 ARTYRMMGCGATCYAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGWGTGGKKKGACCTGGCCCTWAWTGAAATKGGGMAAAAACTCACAGCCCGGAAAWGAGGGGGTYTAAGGAA >BlZ5 GRWWMRRMMGRMRGATYTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGGRCGAMGGTTTTKTTTMACYCWGGKAGGAATKCCCTYGSCMTAATTGATTGGATKCAAGAYTTG >VoK1 GTCGGACCGATCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGG
TCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGRCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSMGGGSGMGGGGSSTSKGGGGGGAGGGAGGKGKGGGGGGGCSACGGGWGGSKGGCCCCCRGGCTRGYGKGTCCTCGGSCTAATGGCTTCCGGCGACTCTTGGATTCAAAGAATTCTTGATTTCCGGGATTCTGCAATTTTTTGCTACKATCTTCTTTTGCTCCAGACTTTATCTATGCGATAGCCAAAATATYCTGTGTCKAGAGAAAYTAGKATTAGGCGAAAASACGACSAATCCCCAACGGGSCCAATCGAGACCGGKGCTACGGTAGGACGTTGCTTGGYTGGGAGGKTSCTTGGSKCCKTCCKTCSCTCGAKACGGTCKTCGCTCGACASCGCCGGCSCGTGCSSSCSGCASSACGTGCGCSGGGSATCACGGCGSCTCGCGATCCSGGGGACTCCCGAACGGGGGGAGGG >VoK2 AMMTTWRRRWAGGAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCTCCGAACGACCCGCGAACACGTTACAACTCACCGAGGGGGGGCGGAGMGCGGGSGCGAGCCCGTCKCCTCCGTCGCCCCTCCCCCCGTTCGGGAGGCCCCSGGAGCCCCSCCCSCCGYCKYGCCCCGCGCACGGGSGGGGGGSGGSCCGCGGSGGSCCTCTCKAGCGAACAACRAACCCCGGCGCGGAACGCGCCAAGGAACCTCACAACRAARCAACGCGCTCCCGTCKCCCCGGTCCCGATCGGGSGCGTCGGGGGGKCGTCGTCGTTTCACCAAAMACAAACRACTCTCGGSAACGGATATCTAGGCTCTCKCATCKATGAARAAMGTAKCAAAATGYGATACTTGGKGTGAATTGCAGAATCCCGTGAATCWTCKAGTCTTTGAACGCAAGTTGCGCCCGAARCCATTAKGCCGAGGGSACGCCTGCCTGGGSGTCACGCACCCGTCGCCCCCCCACACCTCCCTCCCCCCCGAAGSCCCGCGCCCGGGGACGGGAGGMTWAGAGGGGGCGGASATTGSCCTCCCGCGGGTGCCCCARACCSCGGTTGGCCGAAAATCRGTCCCCCGGCAACGTACGACTCRACGAGCGGSGGATTTCYCACGGCTCGGCGTCYTGWGCGTKACSCCKCCTCARGGGCCCCCCACKAGAAAGGWCCAAGACCCTCTATGKCGACCCCMGGTCAGGGGGACCCCCCTCTGAGATTTAASATATCAAAAAAYGGAAGGAAAASAMATTTTCAMGGMTTTCCCTKTMGCGGSGAGCGATTTKGGAAWAGYSCGGSTTARATTCGWCRKKYCAACRTCATTCCTGACCTTACTACAMTTTAASCCTYAAT >VoK3 CCTWMYTAAAAGGAGGAGAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCTCCGAACGACCCGCGAACACGTTACAACTCACCGAGGGGGGGCGGAGMGCGSGSGCGAGMSCSYSKCCTCCSYCKCCCCTCCCCCCGTTCGGGAGGSCCCSGGAGCCCCSCCCSCCSYCKYGYCCCGCGCRCGGGSGGGGGGGGGSCCGCGGSGGSCCTCTCKAGMGAAMAAMRAAMCCCGGSGCGSAAARCGCCAAGGAACCTCACAACRAARMAACRCGCTCCCSTCKCCCCGGKCCCGATCGGGCGCGTCGGGGGGGCGYCGYCKTTTCACCAAAMACAAACRACTCTCKSSAAMRGATATMTAKGSTCTCKCATCKATGAAAAAAGTAKMAAAATGYGATACTTGKKGTGAATTGYRSAATCCCSTGAATCATCKAGTCTTTGAACRCRAGTTGCGCCCSAAAMCMTTAKGSCSAGGGSACGCCTGYCTGGGGGTSWCGCACCCSTSKCCCCCCCACACCTCCCTCCCCCCCGAGGSCCCGCGCCCGAGGAGGGGAGGMGWAGAGKGGGSGGAGATTGSCCTCCCGCGGGSGTCCCAGACCSCGGKTGGCGSARAATCRGKCCCCCGCMGGCGTAGGCYACRACGAGMGGTGGATTTYYCACGGYTYGGTGTCGCSMGCGGCTCYTCKCCTCAGGGGCCCCCCACACTAKAGGTCSGAGACACTYKATGKGGAMCCCCCGKCTGAGGGTAYACTCTCTGAGTTAYAGATATCMATAATCGTATGAGAKTAGKCTTWTAKGGAGTCCCWTTCSCCGRKCCCCYCMACTTGAAAKTMGCAGSTTTTGTGTCTCTCCTTGAAGGCTATCTCTRTAAACGCATCCCTCTAACCCAATGG >VoK4
33
CTTWSAGKAAGGAGAAGTCGTACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCTCCGAACGACCCGCGAACACGTTACAACTCACCGAGGGGGGGCGGAGMGCGSGSGCGMGMSCSYSKCCTCTSTCKCCCCTCTCCCCGTTYGGGAGGSCCCSGGAGACCCSCCCSCCSYSKYGYGCCGCGCACGGGGGGGGGGGGGSCCSCGGSGGSCCTCTCKAGMGAACAAMRAAMCCCGGSGCGSAAARCGCCMAGGAACCTCTCAACRAARMAMCRCGCTCTCSTSKCCCCGGGCCCSATAGGGGGCGTSKGGGGGGGGYCKYSKTTTCWCMMAAMACAAACRASTCTCTSSRACRGATATCTATGSTCTCTCATCTATGAAAAAAGTRKMRMAATGYGATACTTGKGGTGAATTGTGSAATCTCGYGAATCATCKAGTCTTTGAACACRAGTTGTGCCCGAAAACMTTAKGSCSAGGGSACRCCTGTGTGGGGGTSWCRCACMCGTSKCCCCCCCACACCTCTCTCTCCCCKAGGRCCCGCGCCCGAGGACAGGAGGMGWAKAGWGGGCGGAGATWGYCSTCTCGTGGCGTGCCAGMYGTGGTGKCGGAGATCGCTCCCCRCMGAGTACGCSACGACACGCGYGATATCCACMGCTCTRCGTCKCGYGCGTCWCRTCWCTGAGAGSCSCACAGACRKCGAGASCTCGATGCGACCAGTCWGCGGACACTCTSAGTTASATTCATAGCGAGAAKAMCTACAGRTSCCTATRGAKSAGCACTGAAGCYAGCTSATCGSAGYACKCTSCATGCTRCTGARTTASAT >VoK5 CCMTAAAGGAGAGAGTCGTACAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCTCCGAACGACCCGCGAACACGTTACAACTCACCGAGGGGGGGCGGAGMGCGSGGGCGAGMCCSTCKCCTCCSTCKCCCCTCCCCCCGTTYGGGAGGSCCCSGGAGACCCGCCCSCCGYCKYGYCCCGCGCACGGGSGGGGGGSGGSCCSCGGGGGSCCTCTCTAGMGAACAACRAAMCCCGGSGCGSAACGCGCCMAGGAACCTCACAACAAAAMAACRCGCTCCCSTCKCCCCGGTCCCSATCGGGSGCGTSGGGGGGTSGTCKTCKTTTCWCCMAAMACAAACRACTCTCTSSAACRGATATCTAKGSTCTCTCATCKATGAAAAAMGTRKMAAAATGYGATACTTGKKGTGAATTGTRSAATCCCSTGAATCWTCTAGTCTTTGAACRCAAGTTGTGCCCGAAAMCATTTTGCCGAGGGSACRCCTGTCTGGGSGTCACGCACCCGTSKCCCCCCCACACCTCTCTCTCCCCCKAGGRCCCGCGCCCGGGGACAGGAGGATTAGAGRCGGCGGAGATTGGCCTCCCGCGGGCGCCCCAGACCGCGKTTGGYCRAKAAATGGTCCCCCGCYGACGCACGCCTCGACAAGAGTYGRATTTCKCACMGYTCYGMGTCKCSMGCGTYACGWCAASACAAGGGSGCCCGACAATATAGGTCGTMTACYYTCTATAGGGATAGCKTGTGTKATGKTACYCCCCCTSRATTTAAGARTATCAAGAAGKKRTAGTKKTTTYTTTKTTTAWGGGGTGASGATTTTAGAKATWTCAAAAYGCSRATWCTCCTWWTTYMGTYTSWYTGWTGATCTMTCTYTGATAWGGWSTCSTSSCYTSKATYAGAGT >DeK1 GGGGGSSSAAWTYYMGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGRSSTSKGGGGGGRSGRMGG >DeK2 GGGGAACWAACCCYASMTGGGAGGCTTCTACGGYCRGTCGCCATTCTACGGCTAASGTGAAGGGTTTGCTTTKGATTAATTACWCGATGCTTAAGCCACCCCAAAAGCTGTGATCTGGACTGGCGGCGGGGTTTTCACCAGTACYTTCCAGGCTGCCAGGTCRCGGKGCACCAAGCGACGGTCCTCCAASTARTTCATGCCCTGAAACAAAGAARACCCTGCTGTGAGGGACAGATCATCMTGGGAAGAARCTCTGCATCCGAATAAMCYYCM >DeK3
AGGATCTAGGCCGAAYTMGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGGGCGACGGGTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGATTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCTAGATATCCGTTGCCGAGAGTCGTTTGTGTTTGGTGAAACGACGACGACCCCCCGACGCGCCCGATCGGGACCGGGGCGACGGGAGCGCGTTGCTTCGTTGTGAGGTTCCTTGGCGCGTTCCGCGCCGGGGTTCGTTGTTCGCTCGAGAGGGCCGCCGCGGGCCGCCCCCCGCCCGTGCGCGGGGCACGACGGCGGGCGGGGCTCCCGGGGCCTCCCGAACGGGGGGAGGG >DeB1 AGGGCCCCRKWWTYWYMGYTGGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSMGGGGGMGGGRGSTSKGGGGGGRSGRMG >DeB2 ATCGTACGATCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSMGGGGGMGGGRGSTSKGGGGGGRSGRMGG >DeB3 AACGGCSSCAWWWWCMRMTTCGGMTCTTCCGGTTSGCTCGCCGTTACTAGGGGAATCCTTGKAAGTTTCTTTTCMTGTGGAAAGGGKAKGCTTAAACTCAGCGGGKGGKCCCGCCTGRCCTGGGGTCGSGATCGAGGGTCTCGGGYCKTTCTCGTGGGGGGCCCCTGAGGCGATTGACGCGCGCGACGACGAGCCGTGCGAAATCGACCGGTCGTCGWGGCGTACGTCGWTTCGGGACCGATTTTCTTCCACCAGCGAGCTGGTWCGCCCCCGGTAAGCCACAGTGCGCCCCCMCTCCGCCTCCCGACTGGGGGGGGGGGGGGTTTGGGGGGAAAAATGGMGGAAAGACGACTCTTAMATATTTCATTCCCWGTTGRAMCTGGTCCAGGGGAAARTTTCTAGGAAAGCCGAGGGTGACACCCCCCCGCCSGARGGGGGGACGAWTTRTGTTTATGTTTTTATACCGACCCCKTGCTTTKGGAGAAGGCTTTGAGCCTTCTCCCACTTATTAAAAAACCCGGCCGGGAATTCCCTCATTAATTTTGTTTGTCCGCCAGAAAAAGGGGGAARAAWAYAASCCCGCGTKGTTATTTYAATAAAKGCCCCCCCGCAWGGTTSCCTGTTGTTTTATTTAATATAGAGYTCWTTCCTTATCCTWTKTGCTGTTACAAAAAAAATATGARATGRGGSATTTTTGTTTSTSTTTTTCRTATASAGATAAGMTTGMTATTCCKACYCCRCCKMGACYTAATACWRTAAGRGGRTATGRTTKTTTCWTTTTTTATGRGGKGAGGATTYTAGAAATTATAAAAATCCCSAWYCCYCCWTMTCCCCKTAAATTKMTTATTATATTCTGGAWCGAGCTCCGGGCTCTCTGTSKTG >DeM4.6 GTGCCGATCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCC
35
CGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSAGGGGGAGGGRGGTGKGGGGGGGSGRMGGGKGSGKGRCGCCCMGGSAGGSGKGCCCYCGGSCTAATGGSTTCGGGSGCAACTTGCGTTCAAAGACTCKATGATTCACGGGATTCTGCAATTCMCACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCSAGAGCCTARATATCCGTTGCCSARAGTCKTTTGTGTTTGGTGAAACGACGACKACCCCCCGACGCGCCCRATCGGGACCGGGGCGACGGGAGCSCGTTGCTTCGTTGKGAGGTTCCTTGGCGCGTTCCGCGCCGGGGTTCGTTGTYCGCTCGAGAGGGCCGCCGCGGGMCGSCCCCCSCCCGTGCSSGGGGCASGACGGSSGGSGGGGMTCCCGGGGSCTCCCSAACSGGGGGAGGGGSGA >DeM22 GTCGTTCGATCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGRCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSMGGGGGMGGGRSSTSKGGGGGGRSGRMGGGKGSGKGASGCCCMGGSAGGSGKGCCCYCGGSCTAATGGSTTCKGGSGCAACTTGCKTTCAAAGACTCKATGATTCACGGGATTCTGCAATTCMCACCAAGTATCGCATTTTGCTACGTTCTTCWTCGATGCSAGAGCCTAGATATCCGTTGCCSARAGTCKTTTGTGTTTGGTGAAACKACGACSACCCCCCRACRCGCCCRATCSGGACCGGGGCGACKGGAGCGCGTTGCTTCGTTGKGAGGTTCCTTGGCGCGTTCCKCGCCKGGGTTCGTTGTYCGCTCGAGAGGGYCGCCGCGGGMCGCCCCCCSCCCKTGCKYGKSGYACGACGGCMGGSGGGGYTCCCKGSGCCTCCCSATCSGWGGGAGGGGSGAATW >DeM24 ATGGCCCGATCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGRCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSAGGGGGMGGGRGSTGKGGGGGGRSGRMGG >DeM26 GAGGCCGAWCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSAGGGGGAGGGAGGTGTGGGGGGGC >DeM27 AKKKSMGGRMAMKMAAWMWAGCTGSGCTCTTSCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSAGGGGGAGGGRGGTGKGGGGGGGSGACGGGKGSGTGACGCCCAGGSAG
GSKTGCCCTCRGSCTAATGGSTTCKGGSGCAACTTGCKTTCAAAGACTCKATGATTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCKATGCSAGARCCTAGATATSCGTTGCCSARAGTCGTTTGTGTTTGGTGAAACTACKACKACCCCCCRACRCGCCCGATCGGGACCGGGGCGAAKGGAGCGCGKTGCTTCGTTGGGAGGTTSCTTGGCKCCTTCCGTSCCTGGKTTCKTTGGGCYCTCGAGAAGGTCTCCGCGGGMCGATTTCACSCGGGTTTGTGCASTTCTTTTGG >DeMo1.2 AGGGCGGAATCYAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGG >DeMo2 GAGGCCGATCTAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGGGCGAAGGKKGCGTGACGCCCAGGCAGGCKTGCCCTCGGCCTAATGGSTTCGGGSGCAACTTGCGTTCAAARACTCSATGATTCACGGGATTCTGCAATTCACACCARGYATCGCWTTTTGCTACGTTCTTCATCGATGCAAWACCCTAAATATCCGTTGCCAAAAGWYTTTGGTGTTTGGTGAAASWATTACAACCCCCCYTTACSTCTGATCGGAACGTTG >DeD1 GTGGCGRATCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGGGCGAGGG >DeD2 GAGGCGATCTMGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGGGCGACGGGTGCGTGACGCCCMGGSAGGSGKGCCCTCGGSCTAATGGSTTCGGGCGCAACTTGCGTTCAAAGACTCKATGATTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCSAGAGCCTAGATATCCGTTGCCSARAGTCKTTTGTGTTTGGTGAAACGACKACGACCCCCCRACGCGCCCGATCGGGACCGGGGCGACGGGAGCGCGTTGCTTCGTTGTGAGGTTCCTTGGCGCGTTCCGCGCCKGGGTTCGTTGTYCGCTCGAGAGGGCCGCCGCGGGMCGYCCCCCSCCCGTGCGCGGGGCACGACGGCGGGSGGGGCTCCCGGGGCCTCCCSAACGGGGGGAGGGGSGWWC >GuM13
37
CGGGSGSSCCRWATYYMAGCTGGGCTCTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTKACGCGCGCGACGCCGAGCCGTGCRAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSMGGGSGMGGGRSSTSKGGGGGGRSGRMGGKKKSGKGAGGCCCAGGSWGGCGTGCCCTCRGGCTAATGGGTTCTGGCGCAACTTGCTTTCAAAGACTCTATGATTCACGGAATTCTGCATTTCCCACCAAGTWTCGTATTTTGCTACGWTCTTCTTCKATGCCAGAGCCTATATATCCGATGCCCARAGTCTYTTGTGCCKAGAGACACTACKACTACGTGACRACRCGCCCAATCGGGAACGGGGCGAART >GuM16 GTGGCCGAATCYAAGCTGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSMGGGSGMGGGRSSTSKGGGGGGRSGRMGGKKKSGKGRSG >GUM21 GGGYYWCGAAAGACCAATTSAGGGKGGGKYTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTKACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSAGGGGGAGGGASCTGKGGGGGGAGGAAGGKGGGGKGAGGCCACGGSWGGSKKGCCCCCRGGCTAATGGGTTCTGGSGCTAATTGCGTTCAAAGACTCTTGGATTCACGGGATTCTTGATTTCCCACCTTCATCRYATTTTGCTACKTTCTTCTTTTATGCCATAGCCTATATATCCGATACCCARAATAGYYTGTGCTKAGAGAAACKAGTACTACCCCAAAACACGACCACYCCSGACCGGGGCSACTGGAGAGCGGKGCTTCGGGGKGACGTTSCTTGGTTGGKTCTGTGCCTGGGTTCGTTGTCCGCTGGAGAGGGTCTCCGT >MaK1 TWGSWRGSRRTTYYARSCTGGGGSCTCYTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCTTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGTCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCCMGGGSGCGGGGCCTCGGGGGGGAGGGAGGTGTGGGGGGGCGACGGGTGCGTGACSCCCAGGCAGGCGTGCCCTCGGCCTAATGGCTTCSGGCGCAACTTGCGTTCAAAGACTCSATGATTCACGGGATTCTGCAATTCACACCAAGTATCGYATTTTGCTACRTTCTTCATCGATGCGAGAGCCTARATATCCGTTGCCKAGAGTCRTTTGTGTTTGGTGAAACGACGACSACCCCCCRACGCGCCCRATCGGGACCGGGGCGACGGGAGCGCGTTGCTTCGTTGTGAGGTTCCTTGGCGCGTTCCGCGCCGGGRTWCGTTGTTCGCTCGAGAGGGCCGCCGCGGGCCGCCCCCCGCCCGTGCGCGGGGSAYGACGGCGGGYGGGGMTCCCGGGGMCTCCCGAACGGGGGGAGGGG > MaK2 TATGAGTGGCGATYMGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTG
GTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSMGGGSGMGGGRSSTSKGGGGGGRGGRAGGKGKGG >MaK3 AKKWRTACAGCSAATCTMGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSMGGGSGMGGGRSSTSKGGGGGGAGGRAGG >MaK4 AKKRRRWRKRGGTAGSCSATYMGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCSCCTCCCGTCCSAGGGGGAGGGRSSTSKGGGG >MaK5 GTGGCCGATCTAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSMGGGSGMGGGRSSTSKGGGGGGRSGRMGGKGGSGKGRSGCCCMGGSAGGSGKGCCCTCGGSCTAATGGSTTCKGGSGCAACTTGCGTTCAAAGACTCKATGATTCACGGGATTCTGSAATTCMCACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCSAGAGCCTAGATATCCGTTGCCSARAGTCKTTTGTGTTTGGWGAAACKACGACKACCCCCCGACGCGCCCRATCGGGACCGGGGCGACKGGAGMSCGTTGCTTCKTTGKGAGGTTCCTTGGSGCGTTCCGYGCCTGGGTTCKTTGTTCSCTCGAGAGGGYCGCCGCGGGCCGCCCCCCKCCCGTGCGCKGGTCACGACGTTGGGCGGGGCTCCCGGGGCCCTTGAACSGGGGGACGSAAAACKRT >PyM1 CGGGGCCTWTTTCCCAAMCTTGGGGCTCTTCCCGGKTCGCTCGCCGTTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTKACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSRGGGGGRGGGRGSTGKGGGGGGRGGRAGGGGGGGGGGGGCCCCGGGWGGGGGGCCCCCMGGCYRGYGGGTTCSGGGSCAAATTGCTTTCMAAGAAMCTTGGAATTAAGGGATTCTTGATTTCCCACCAAGGATCGSATTTTGCTACYATCTTCATTTGTTCCAGACTCTATATATGCGATGGCCAAAATYTYTTGTGKTTGGAGAAATTAMYACYAGCCCCCSASACGACCAATCCGGAACGGGGCCAAKGGAGACCGGTGCTTCGGTWGGRSGTTSCTTGGSKGGGTYCKYCCCTGGGGTCKTTYTTYCCTSGAAAAGGYCCCCGCTCGACAGCCCCCCCCCGGGCCSSGSGCACCACGGGCGGSGGGGATTCCGGGGGCCGCCGATCCGGGGGACGCCTGAACGGRGGGASG
39
TTTTTTCTGTTTGTCGTAACAGATATKGTTTGTTRTTCCACGCCTCAWAAAGATAAGACKATAAAAGGTTTGTTATTTCTTTGKTARTGAGGWAAGGACTATAWAAATMAKACCCGCCTYTTCCTTCTAGTTTWAAAAAAACTAATATTAGCAACWAAAACCCTAAACTGGGGGTGTCTAMTRAYTTRAA >PyM1.3 GAGGGACGATCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSRGGGGGRGGGRGSTGKGGGGGGAGGAAGGGGKGGGGGGGCCCCGGSAGGSGKGCCCCCCGGCTWATGGGTTCYGGGGCAACTTGCGTTCAAAGAATCSATGATTCACKGAATTTTTCCTTTCCCACCAAGTTTTTTATTTTGCTACGGTCTTCMTTSATGCCATARCCTAAATATCCCWTAGCCAAAATAGGTTGGGGTTGGGGAAAYYACCACCACCCCCCKAAACGACCCATCCGGAACGGGGCYACYTGAATTCGGTGTTTCSGGRKGAAGATGCTTGAYGAAATCCSCCCCYGGGAAATTTKTTYATCKGGAMCCCGCCGCCTTCCTGYTCCTTGAATTAAGATTGCSACCACTACCGRGCCKGYTTGCCGTGCCTAMSAATATGSGGGGAGGGACTTTAWGTCTGTTTGTCKTATAYAGAKAWGGCTTGTTATWWCKACGCCTCATAGAGCTYAGACTATAARARGGTRTKATATTTTTTTTWTTTTTTGTGGKRAGGAGGATARAAAWCTTATAATACCYCCYMCCCCCCTTTYYYCMARCTGYYTGCAGATATWRTCCTGAMCTSTCWCAAAGYSCAACTSTGACAAAGTKG >PyM2.3 TAGGGACGATCYAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTKACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSRGGGSGRGGGRGSKSKGGGGGGRGGGAGGGGGGGGGGGGCCCCGGGRGGRTTGCCCTCCGGCCTCCGGGGTCTGGGACTAATTGCGTTCMAAGAATCGAAKAATGAAAGAATTATTGAAATCTCTCCTCAWGGGTTTTTTTGCYAGAGGAGGGGTTGTGTGCGAAATMTTTGWAAACAGTCCCCAAGGTSTTMTGGGGRGAGGGGCTGCTTGAGCTCCCCCAACAAARAARAAAACCGGMACGGGGCAGACCGTTAATAATTTSTTCKTTGCCASGYAAAATAGGGCGGATGAAAYAAGGCCYKGTKAAATTATTAARATGATGGCTCCKCGGCRGCTTCSTGGTGGTTGAATTAAGYTGCRGCAATTACCTKCCTATRTKTGCTTAASAAGAGTATGCAATGASGKACWKTAWGTCTGTTTGTCRYATAYAGAKAWGCTWGTTMTWMCGMCGCCTCATCKAGCTCAKACTATARWAGGTATGATRTTTCTTTAKTTRTGAGGTAAGGACKATARAAGATMATGATAWGMCKMYCMMCCYAGTTAYYMACTGTRYTAWGATAYYGWCCWGMAAYCRSTCMTGYAAATGTG >PyM3.4 GTGGGCGATCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSRGGGSGRGGGRSSKSKGGGGGGRSGRAGGGGGGGGGGGGCCCCGGGWGGSSKGCCCCCSGGCTAATGGGTTCSGGGGCMACTTGGGTTCAAAGACTCTATGATTCACGGGA
TTCTGGAATTCCCMCCTARTATCGYATTTTGCTACSTTCTTCWTTGATGCCAGAAYCTAKATATCCGWTGCCCAAAGTCKTTTGTGTTTGGWGAAACKACKACTACCCCCCRAMRCGACCAATCSGGGACGGGGCSACYGGAGMCCGTTGCTTCGTTGGGAGGTTSCTTGGSGCGGTCCGYSCCSGGGTTCSTTGKTCSCTCGAAARGGSCKCCGCGCGACASCCCCCGCCCGTGCSCSGGGCAMSACGGGCGGCGGGGMTCCCGGGGKCCTGCGATWCGGGGGAAGSSCCAACG >PyM4.8 GCGCCGATCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSRGGGSGRGGGRSSKSKGGGGGGRGGGAGGGGGGGGGGGGCCACRGGWGGSKKACCCCCCGGCTAACGGGTTCSGGGSCTAATTGCTTTYAAAAAATCTAARATTRAAAGAATTTTTGAATTCCGGGAARTGCATTTTTSCWAMGATCGTCTTTTGTTACAAAAMTTASCAAAGCGTTACCCAATATCTTTTGGGGTAAGGGAAAYSTCYACCARCCCCAACTACGACCAATCCGGAACGGGGCCAAYGGARATTTTTGYTATTGWGGCGAACTTGGSAGGAARAAWAAWTGCCGCGGAAAATTATTAAAATAGGGCCCCCCGGGAGGTTTCCKGCGCGTGTATTTAAAATTRCGGTWTTMCSMATCCCTGKGGTCTCSKAAACAAKAGAGYAYGGAGGGGCTTTMCAKTTTTTTTTTCTYATAMRMAAATGGTTGTTRTTACTACCTCCYCCTASAGCWMTAACTATASAAGGGAATGATTATTTTCTTTWTTTATTGKGGGKAGGGAKKAWRGAAATACAGATATGACATWTCCCCCTCGTTTTWKTAAWCTGAATGCWTAATATATAYGATMCWRGAACTGGAAAATCTTTGATTTKKTWTTWATGTTTT >DoK1 AGGGGRRAWWTCYYAGYTGGGGCTCTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGGGSGRMGGGKGSGTGACGCCCMRGSAGGSGTGCCCTCSGSCTAATGGSTTCSGGSGCAACTTGSGTTCAAAGACTCSATGATTCACGGGATTCTGSAATTCMCACCAAGTATCGCATTTTGCTACSTTCTTCMTCSATGCSAGAGCCTARATATCCGTTGSCSARAGTCSTTTGTGTTTGGTGAAACGACSACSACCCCCCGAMGCGCCCSATCGGGAMCGGGGCGACSGGAGCGCGTTGCTTCSTTGKGAGGKTCCTTGGCGCGTTCCGCSCCSGGGTTCSTTGTTCSCTCGAGARGGCCGCCGCGGGCCGCCCCCCSCCCGTGCSCGGGGCACGACGGYGGGCGGGGYTYCCGGGGSCTCCCSAACSGGGGGAGGGGC >DoK2 GAAGCGATCTMGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGRCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGGGSGACGGG >DoK3 GAGCCGATCTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCC
41
CGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGGGSGRMGG >BaM1 CCCGGCGAATTMYYAGGCTTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCSMGGGGGAGGGGGGTGTGGGGGGAGGGAGGKGKGGKGRGGCCAMGGSWGGSKKGCCCTCRGGCTRGTGGGTTCTGGSSCTACTGGCTTTCAAAGACTCTTGGATTCAAAGAATTCTGGATTTCMCGGATTCTATAATTTTTTGCTACKATCTTATTTTGTGCCATACTTTATATATGCGATASCCAAAATATTTTGTGTTTAGAGTAACTTGTACTAGGCGAARACACGACCAATCCSCAACGGGSCSAATGGAGASCGTTGCTACGGTAKSAGGTTGCTTGGYTCTGTCGKTSCTTGGSTTCTTTGTTSSCTCGATASGGTCKTCGCTCGACASCGCCSGCSCGTGCGCSCGCCAGSACGGGCGCSGGGSATCACGGSGSCTCGCGATCCSGGGGACTCCCGAACGGGGGGAGGK >BaM2 GTAGGCGGWTCTCAAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCGTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGCCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGMGGGGGGTGTGGGGGGASGGAGGKGGGGKGAGGCCACGGSWGGSKKGCCCCCAGGCTAGTGKGTCCTCGGSCAAMTGGCTTTCGGCGAAACTTGGATTCACGGACTTCTGGATTTCACACCTTCTATCGYATTTTGCTACKTTCTTCTTTTGCTCCAKTCTCTATATATGCGTTAGCCAAAATATTTTGTGCTTAGTGAYRTTAGTGTTAGGCCACAACACGACCACTCCSCAACGGGSCGAAKYGAGAGCGTGGCTACGGTAKSACGTTGCTTCGYGCTTTCCGCGCCTGGSTTCGTTGKTSSCGGGATACGTTGKTCGCTYGACAYGGCCCGCCCGTGCCCSGGGCCCCCCGTGCGGCGGGGMTCACGGSGSCTCGGGATCCGGGGGACGCYCGAACTSGGGGAG >BaM5 GAAATGACGGAGTCTCTAAGATCTTGTGTMTCTTTCCCAATTCTMGCGCCGTTACTAGGGGAATCCTTGTAAGTTTCYTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCTTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGTCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCCMGGGSGCGGGGCCTCSGGGGGGAGGGAGGTGTGGGGGGGCGACGGGTGCGTGACSCCCAGGCWGGCGTGCCCTCGGCCTAATGGCTTCSGGCGCAACTTGCGTTCAAAGACTCGATGATTCACGGGATTCTGCAATTCACACCAASTATCGYATTTTGCTACRTTCTTCATCKATGCGAGAGCCTARATATCCGTTGCCGAGAGTCGTTTGTGTTTGGTGAAACKACRACGACCCCCCRACGYGCCCRATCGGGGGCGGKGCGACGGGATCRCGTTGCTTCGTTGTGAGGTTTTTTGGMGCGTTTCTCGCCGGGGTACGTTGTTTTGCTCGAYAGGTCTKTCYCGGGYCGCCCCCTTCCTG >BeZ1
TKKWWRRRRRRAGCSTWYYMGCTGGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCTTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGTCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGGCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGGGGSGACGGGTGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCTAATGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGATTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCTAGATATCCGTTGCCRARAGTCGTTTGTGTTTGGKGAAACRACRACRACCCCCCRACSCGCCCRATCGGRACCGGGGCRACGGGAGCGCGTTGCTTCGTTGTGAGGTTCCTTGGCGCGTTCCGCGCCGGGGTTCGTTGTTCGCTCGAGAGGGCCGCCGCGGGCCGYCCCCCGCCCGTGCGCGGGGCACRACGGCGGGCGGGGCTCCCGGGGCCTCCCGAACGGGGGGGGAGG >BeZ2 TTGGGGSSSSGAWTYTYARCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCTTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGRCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGRGGTGTGGGGGGGGSRMSGGGKGSGGGASSCCCRGGMRGGSGGGCCCTCGGCCTAWGGGTTTCGGGCGCAATTTGSTTTCAAAAACTCRATAATTCACGGAATTCTGCATTTCMCACCARKATTCSMATTTTGCTACKTCCTTCTTCGATGCAAAAGCCTAAATATCCKTTGCCAAAAKYCKTTTGGGTTKGKKGAAMCRACAACAACCCCCCAACCSSCCCAATCGGAACSGGGSCAACGGRASCSSGTTGTTTCKTTGKGAGGTTCTTTGGSGCGTTCCSCSCCGGGGTTCKTTGTYCSTTCRAAAGGSCCSCSCSGGGCSGYCCCCCSCCCGTSCGCGGGGCACRACGGCGGGCGGGGYTCCCGGGSCYTCCCMAMCGGGGGRAGGGSRAA >BeZ3 ATTCAGAAGCGATCYAGCTGGGCTCTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCTTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGTCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGRCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGRGGGGGRGGGRGGTGTGGGGGGGGCRACGGGTGCKTGACGCCCAGGCAGGCGTGCCCTCGGCCTAATGGYTTCGGGCGCAACTTGCGTTCAAARACTCRATGATTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCRATGCRAGAGCCTARATATCCGTTGCCRARAGTCGTTTGTGTTTGGTGAAACRACRACRACCCCCCRACGCGCCCRATCGGRACCGGGGCRACGGGAGCGCGTTGCTTCGTTGTGAGGTTCCTTGGCGCGTTCCGCGCCGGGGTTCGTTGTTCGCTCGAGAGGGCCGCCGCGGGCCGYCCCCCGCCCGTGCGCGGGGCACRACGGCGGGCGGGGYTCCCGGGGCCTCCCGAACGGGGGGGAGG >BeZ4 CGGGKWTTWKGGGSCCSWAATSTYRRYTGGGGCTCTTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCTTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGRCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCT
43
CCCGTCCGAGGGGGAGGGRGGTGKGGGGGGGGSRACGGGTGCGKGACSCCCAGGCAGGCGKGCCCTCGGCCTAAKGGYTTCGGGCGCAACTTGCGTTCAAAGACTCGATGATTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTTGCTACGTTCTTCATCGATGCGAGAGCCTAGATATCCGTTGCCRAGAGTCGTTTGTGTTTGGKGAAACRACRACRACCCCCCGACGCGCCCGATCGGGACCGGGGCGACGGGAGCGCGTTGCTTCKTTGTGAGGTTCCTTGGSGCGTTCCGCGCCGGGGTTCGTTGTTCGCTCGAGAGGGCCGCCGCGGGCCGTCCCCCGCCCGTGCGCGGGGCACRACGGCGGGCGGGGYTCCCGGGGCCTCCCGAACGGGGGGAGGG >BeZ5 TGGGCGGAATYTCAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGRCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGRGGGGGRGGGRGGTGTGGGGGGGGSGACGGGGGSKTGASSCCCRGGMRGGSGGGCCCCCGGCCTATGGGTTTCGGGCCCACCTTGCTTTCAAAAACTCRATAATTCACGGAATTCTGCATTTCCCACCAAGTATCSCATTTTGCTCCKTCCTTCATCAATCCAAAAGCCTAAATTTCCKTTGCCAAAAGTCKTTGGGGTTGGGGGAAACAACAACAACCCCCCAASSCSCCCAAYSGGAACCGGGSSAACGGAAGCSCKTGGTTTCKTTKKAAGGTTCCTGGGSCCKTTCCSCSCCGGGKTTCKTGKTTCSTTCRRAAGGGCCSCSCCGGSCGSCCCCCCGCCCKKGCGCGGGSMACRACGGCGGSSGGGSYTCCCGGGSCTYCCCRAMSGGGGGGAGG >EaM17 TYCCTCTTTYGGRTTYAGSTGGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGRCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGRGGGRGGTGTGGGGGG >EaM18 TGCCCCTTAATAAGTTASGWYGGRCTCTTCTGGYRCGCTMGCCGCTGTAGGGGAATCCTTGTAGTTTCYTTTCCTCCGCTTATTGATWTGCTTAAACTCAGCGGGKGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCSAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGRCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGGG >EaM20 CYYTTACCTYAYAGWRRKMGCRRKWYYMGYTKGGYTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCRAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGRCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGG >EaM22 AWKWKRKRGRRGGGSCGWWTYYAGCTTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTT
CTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCGAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGRCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGTGTGGGGG >EaM25 GGYKWYRKRKRRRGGCCWATYWAGCTGGGCTCTTCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAACTCAGCGGGTGGTCCCGCCTGACCTGGGGTCGCGATCGAGGGTCTCGGGCCKTTCTCGTGGGGGGCCCCTGAGGCGACGTGACGCGCGCGACGYCGAGCCGTGCRAAATCCACCGCTCGTCGTGGCGTACGTCGCCGCGGGACCGATTTTCGRCCAACCGCGGGCTGGGGCGCCCACGGGAGGCCAATGTCCGCCCCCTCTCCGCCTCCCGTCCGAGGGGGAGGGAGGKGTGGGGGG
45
top related