slco1b1 (c.521t>c) and cyp3a4 (c.522-191c>t) genes ... · eng. hisham srsour for his...
Post on 18-Jul-2020
3 Views
Preview:
TRANSCRIPT
The Islamic University-Gaza
Scientific Research and Postgraduate Affairs
Faculty of Science - Biotechnology Department
SLCO1B1 (c.521T>C) and CYP3A4 (c.522-191C>T) genes polymorphism
and statin-induced muscle pain in coronary heart disease patients in Gaza
strip
Submitted in Partial Fulfillment for the Master Degree of Science in
Biotechnology.
BY
Yousef Jamal Alrantisi
Supervisors
Dr. Basim Ayesh Dr. Abdallah Abed
Assistant professor of Genetics Associate professor of
and Molecular Biology Human Genetics
2014 – 1435
i
Declaration
I hereby declare that this submission is my own work and that, to the best
of my knowledge and belief, it contains no material previously published
or written by another person nor material which to a substantial extent
has been accepted for the award of any other degree of university or other
institute, except where due acknowledgement has been made in the text.
Signature Date
Dec. 2014
Dec 2014
Copyright
All rights reserved © 2014: No part of this work can be copied, translated or
stored in retrieval system, without prior permission of the author.
ii
Dedication
This work is dedicated
To
My dear brother, Mohammed, who went missing
during his quest for further education
To my father Jamal Alrantisi
For his unfailing support,
To my mother Samera
To my wife Alaa
To all my brothers and sisters
To my sons Mohnnad and Mohammed
To my daughter Jana
To all Palestinian people…
iii
Acknowledgement
Utmost appreciation to the almighty Allah for divine
intervention in this academic endeavor.
Sincere gratitude is hereby extended to the following who never
ceased in helping until the paper is structured:
Dr. Basim Ayesh and Dr. Abdalla Abed for their supervision
and great guidance.
Dr. Mohammed Ashour for his continued support for the
furthering of science and education.
Julie Webb-Pullman for her contribution to the completion of
the thesis.
Dr. Mohammed Abu Awda for his valuable input.
Eng. Hisham Srsour For his continuous support and standing
beside me through the completion of the study.
My family and friends who encouraged and supported me to
complete this work.
Finally I would like to expression my deepest respect and
appreciation to my university, The Islamic University of Gaza,
and the faculty of science and all staff members who gave their
time and effort to accomplish this research.
iv
Abstract
Background:
Polymorphism in the genes SLCO1B1 (c.521T>C) and CYP3A4 (c.522-191C>T) have
been associated with statin-induced myopathy, an early precursor of which is muscle
pain. Carriers of both polymorphisms, including the newly identified CYP3A4 (c.522-
191C>T) (intron 6 SNP, rs35599367), defining the CYP3A4*22 allele, have been
found to require significantly lower statin doses to achieve optimal lipid control
without any side effects.
Objectives:
This study aimed to investigate the frequency of SLCO1B1 (c.521T>C) and CYP3A4
(c.522-191C>T) in the study population, and the impact of SLCO1B1 (c.521T>C) and
CYP3A4 (c.522-191C>T) on the risk of statin-induced muscle pain in coronary heart
disease patients in Gaza strip.
Methods:
Whole blood samples were collected from 123 cardiovascular patients receiving statin
therapy who presented to hospitals in the Gaza Strip, and DNA extraction was
performed. CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C) polymorphisms were
detected using sequence specific primers (SSP)-PCR.
Results:
CYP3A4 (c.522-191C>T) frequency of heterozygotes in the study sample was 18.7%
(frequency of the T allele, 10.2%). This gene also had an OR of 16.9 in relation to
muscle pain and statin therapy. SLCO1B1 (c.521T>C) frequency of heterozygotes in
the study sample was 26% (frequency of the C allele, 13.0%), and its OR in relation to
muscle pain and statin therapy was 56.8. The majority of patients who carried
mutations in one or both genes simultaneously, suffered from muscle pain.
v
Conclusion and recommendations:
Higher frequency of the CYP3A4 (c.522-191C>T) in the study population, and the
findings of vastly increased risk of muscle pain - thus potentially myopathy - when
either SLCO1B1 (c.521T>C) or CYP3A4 (c.522-191C>T) are found, but particularly
when both are present, have significant implications for clinical management.
Genotyping for this polymorphism prior to initiating statin therapy is thus
recommended as an important clinical tool in preventing irreversible muscle damage in
patients of the Gaza Strip. Treatment for those found to have the genes should include
prescribing lower doses of statins and close and continuous monitoring for muscle
pain, or the prescription of alternative medications. Further research with a larger
sample size is recommended to confirm the results.
Key words: CYP3A4, SLCO1B1, Statin, Myopathy, Polymorphism, Gaza strip.
vi
Arabic Abstract ملخص الذراست باللغت العزبيت
التي يسببها عالقتها بألم العضالثو (CYP3A4) و (SLCO1B1) تعذد اشكال الجيىيه
المزض الذيه يعاوىن مه أمزاض شزيان القلب التاجي في قطاع غزة عقار الستاتيه لذي
مقذمت:
SLCO1B1 (c.521T>C) CYP3A4 (c.522-191C>T)ارذثط خد ذعذد األشكال نكم ي اند
تإحذاز عمار االسراذ نالعرالل انعؼه ، أنى انعؼالخ، انظرج انثكزج نالعرالل انعؼه. لذ خذ أ
تحاخح CYP3A4*22 alleleانعزف ب CYP3A4 (c.522-191C>T)انحايه نذ األشكال يا شم
أعزاع خاثح. حكى انثان تسر انذ نذى د أياسح نرمهم خزعح عمار انسراذ نهر
الهذف:
SLCO1B1 (c.521T>C) CYP3A4ذفد ذ انذراسح إن فحض يعذل ارشار انشكه اند
(c.522-191C>T) ف عح انذراسح كذنك فحض ذؤثز خد كم يا عه احرانح اإلطاتح تآالو انعؼالخ
اع انمهة انراخح ف لطاع غزج.اناخى ع عمار انسراذ نذ انزػ انذ عا ي أيز
مىهج البحث:
يزغ تؤيزاع انمهة ي انذ رعاط عمار انسراذ انذ لذيا ان يسرشفاخ 123ذى خع عاخ دو ي
ذعذد اشكال اندلطاع غزج نهعالج، ثى ذى اسرخزاج انحغ ان ي ذا انعاخ. ذى فحض
(SLCO1B1) (CYP3A4) تاسرخذاو ذمح(SSP)-PCR.
الىتائج:
( ف عح انذراسح CYP3A4 (c.522-191C>T)أظزخ انرائح أ يعذل ارشار انشكم اند نهطفزج )
( أعه ي يدرعاخ دراسح اخز ذى دراسرا ي تاحث أخز، T 10.2%)يعذل ارشار األنم 18.7%
.16.9( نذا انشكم األنه كشدع ألنى انعؼالخ اناذح ع عمار انسراذ Odds ratioسثح األرخحح )
ارشار )يعذل %26( ف عح انذراسح SLCO1B1 (c.521T>C)يعذل ارشار انشكم اند نهطفزج )
انسراذ عمار ع اناذح انعؼالخ ألنى كشدع األنه انشكم نذا األرخحح ( سثحC 13.0% األنم
. غانثح انزػ انذ حه انشكم األنه الحذ أ كال اند يعا عا ي أنى انعؼالخ.56.8
vii
االستىتاجاث و التىصياث:
ف عح انذراسح كذنك أظزخ االرذفاع (CYP3A4 (c.522-191C>T)أظزخ انرائح ارذفاع سثح ارشار)
SLCO1B1ان احرانح حذز اعرالل عؼه ف حانح خد انكثز ف احرانح خطز أنى انعؼالخ تانر
(c.521T>C) أCYP3A4 (c.522-191C>T) نك تشكم خاص عذيا ك كالا يخد، دعم نا
اعكاساخ يح عه انرعايم اإلكهك يع انزع.
ت كسهح طثح ايح ف يع فحض انط اند نذا انرعذد انشكه لثم انشزع ترال عمار االسراذ يط
يزع ذهف انعؼالخ ف لطاع غزج.
خزعاخ يخفؼح ي طف أنالخ يشدعح ألنى انعؼالخذى ننحاالخ انر خذخ عالج ا ثغ أ شم
.انثذهح ي األدح طف داء أالو ف انعؼالخ، انسرز انثك انزطذ انعمالز انخفؼح نهكنسرزل
.نرؤكذ انرائحأكثز حدى عح يع زذ ي األتحازت ط
viii
List of Contents page
Declaration……………………………………..………………….……..… I
Dedication ………………………………………………………...……..… II
Acknowledgment………...…...………………………………….……..….. III
Abstract……………………….....…………………..……………..…......... IV
Arabic abstract………………………………………………….……......... VI
List Contents…………………………………………………………...…... VIII
List of tables……………………………………………………..…............. XII
List of figures………………………………………………….………...…. XIV
List of abbreviations ………….…………………….………..………..….. XV
Chapter 1: Introduction.……...……………...……………... 1
1.1 Overview.……………………...…...…………..……..….…………………. 1
1.2 Objectives…………………………………………………………………… 3
1.2.1 General objective……………………...…...………………..….…............... 3
1.2.2 Specific objectives………………………………………………………….. 3
1.3 Significance………………………………..……………………..…………. 3
Chapter 2: Literature review…………….…...………….......... 4
2.1 Principles of statin drug action…………………….…………………….….. 4
2.2 Polymorphism and its impact on statin drug response…….………….…… 5
2.2.1 Synonymous and nonsynonymous SNPs …………………………………... 5
2.3 Types of influx transporters ………………………………………………... 6
2.4 Organic anion-transporting polypeptides (OATPs))………………………... 6
2.4.1 OATP1B1…………………………………………………….…………….. 7
2.5 Characteristics of SLCO1B1……………………………………..………… 8
2.6 CYP enzymes………………………………………………………..……... 10
2.7 Cholesterol homeostasis……………………………..…………………..…. 11
2.8 The 3-hydroxy-3-methyl-glutaryl coenzyme A (HMG-CoA) reductase
inhibitors (statins) ………………………………………………………….. 14
2.8.1 The effectiveness of statins………………………………………………… 15
2.8.2 Statin family structures and their pharmacokinetic…………………............. 16
2.8.3 Simvastatin………………………………………………………………….. 17
ix
2.8.4 Side effects of statins……………………………………………………….. 19
Chapter 3 : Material and method……………………………... 23
3.1 Materials ……………………………...…………………………………….. 23
3.1.1 Equipment …………………………………………………………………. 23
3.1.2 Chemicals and Reagents……………………………………………………. 23
3.1.3 Primers used in this study…………………………………………………... 24
3.1.3.1 Primers for CYP3A4 (c.522-191C>T)……………………………………… 24
3.1.3.1 Primers for SLCO1B1 c.521T>C polymorphism………………………….. 24
3.1.4 Disposables…………………………………………………………………. 24
3.2 Methods…………………………………………………………………….. 25
3.2.1 Study design……………………………………..…………………………. 25
3.2.2 Study population……………………………...……………………….......... 25
3.2.3 Ethical considerations………………………………………………………. 25
3.2.4 Inclusion criteria……………………………………………………………. 26
3.2.5 Clinical data collection and assessment…………………………………….. 26
3.2.6 Blood sample collection…………………………………………………….. 26
3.2.7 DNA extraction ……………………………………………………………. 27
3.2.8 Procedure of CYP3A4 (c.522-191C>T) detection by PCR………………… 27
3.2.9 Procedure of SLCO1B1 c.521T>C polymorphism detection by PCR…….. 27
3.2.10 Quality control……………………………………………………………… 28
3.3 Data Analysis……………………………………………………………….. 28
Chapter 4: Results………………………................................... 29
4.1 Description of the study sample………..…………………………………… 29
4.1.1 Description by gender……………………………………………….……… 29
4.1.2 Description by age………………………………………...………………… 29
4.1.3 Description by region……………………………………………………….. 29
4.1.4 Description of clinical conditions of the study sample…………………….. 30
4.1.5 Description of cholesterol, lactate dehydrogenase and creatine kinase levels
in the study sample according to muscle pain………………………………. 31
4.2 Genotype……………………………………………………………………. 32
4.2.1 Description of CYP3A4 (c.522-191C>T)…………………………………... 32
x
4.2.2 Description of SLCO1B1 c.521T>C SNP………………………………….. 33
4.2.3 Description of compound genotype………………………………………… 33
4.3 Relationships………………………………………………………………... 34
4.3.1 Relationship between CYP3A4 (c.522-191C>T) and muscle pain………… 34
4.3.2 Relationship between SLCO1B1 c.521T>C SNP and muscle pain………… 35
4.3.3 Relationship between the compound genotype of CYP3A4 (c.522-191C>T)
and SLCO1B1 c.521T>C SNP and muscle pain…………………………… 35
4.3.4 Relationship between lactate dehydrogenase and muscle pain……………... 36
4.3.5 Relationship between creatine kinase and muscle pain…………………….. 37
4.3.6 Relationship between creatine kinase and CYP3A4 (c.522-191C>T)……… 37
4.3.7 Relationship between lactate dehydrogenase and CYP3A4 (c.522
191C>T)…………………………………………………………………….. 38
4.3.8 Relationship between lactate dehydrogenase and SLCO1B1 c.521T>C SNP 39
4.3.9 Relationship between creatine kinase and SLCO1B1 c.521T>C SNP……... 39
4.3.10 Relationship between the compound genotype of (CYP3A4 (c.522-
191C>T) and SLCO1B1 c.521T>C SNP) and lactate dehydrogenase……... 40
4.3.11 Relationship between the compound genotype of (CYP3A4 (c.522-
191C>T) and SLCO1B1 c.521T>C SNP) and creatine kinase……………... 41
Chapter 5: Discussion.................................................................. 43
5.1 CYP3A4 (c.522-191C>T)…………………………………………………... 43
5.2 SLCO1B1 (c.521T>C) ……………………………………………………... 44
5.3 Muscle Pain and Myopathy………………………………….……………... 44
5.4 Cholesterol Test and Muscle Pain…………………………………………... 45
5.5 CYP3A4 (c.522-191C>T) and Muscle Pain………………………………... 45
5.6 SLCO1B1 (c.521T>C) and Muscle Pain………………………….………... 46
5.7 Compound genotype of CYP3A4 (c.522-191C>T) and SLCO1B1
(c.521T>C) and Muscle Pain……………………………………...………... 46
5.8 Creatine Kinase and Muscle Pain…………………………………………... 47
5.9 Lactate Dehydrogenase with CYP3A4 (c.522-191C>T), and SLCO1B1
(c.521T>C) …………………………………………………………………. 47
5.10 Creatine Kinase with CYP3A4 (c.522-191C>T), and SLCO1B1
(c.521T>C)………………………………………………………………….. 48
xi
5.11 Compound Genotype of (CYP3A4 (c.522-191C>T) and SLCO1B1
(c.521T>C)) and Lactate Dehydrogenase………………………………….. 49
5.12 Compound Genotype of (CYP3A4 (c.522-191C>T) and SLCO1B1
(c.521T>C)) and Creatine Kinase…………………………………………... 49
Chapter 6: Conclusions & Recommendations……............... 50
6.1 Conclusions……………………..………....................................................... 50
6.2 Recommendations…………………………………...……………..……….. 51
References……………....…...……………............................... 52
Appendices…………………………………………………….…………… 60
Appendix 1: Helsinki committee an approval letter……………………….. 61
Appendix 2: Ministry of Health permission letter…………………………. 62
Appendix 3: Questionnaire………………………….................................... 63
xii
List of Tables Page
Table 2.1 Drug substrates for OATP1B1………………………………..…...…... 7
Table 2.2 Potential factors predisposing to statin-induced myopathy………....…. 20
Table 3.1 Equipment used in this study…………………………………….……. 23
Table 3.2 Chemicals and Reagents used in this study………………….……...… 23
Table 3.3 Primers for CYP3A4 (c.522-191C>T)………………...…….….…...… 24
Table 3.4 Primers and their sequences for SLCO1B1 c.521T>C polymorphism... 24
Table 3.5 Disposables………………………………………………….…..….…. 24
Table 3.6 Study tests………………………….…………………….…..………... 26
Table 4.1 Gender frequency of the study sample……………………..…..……… 29
Table 4.2 Description of males and females by age (years)………..….…..…....... 29
Table 4.3 Regional frequency of the study sample …………...……………….… 30
Table 4.4 Description of diabetes mellitus, hypertension, open-heart surgery and
muscle pain frequencies of the study sample………..……………..…. 30
Table 4.5 Description of cholesterol, lactate dehydrogenase and creatine kinase
levels in study sample………………...………….……………………. 31
Table 4.6 Frequency of CYP3A4 (c.522-191C>T) ………………………….….. 32
Table 4.7 Frequency of SLCO1B1 (c.521T>C)…….……….…..………………. 33
Table 4.8 Both genes frequency of the study sample……….……..…………..…. 34
Table 4.9 Relationship between CYP3A4 (c.522-191C>T) genotype and muscle
pain…………………………………..………………..………………. 34
Table 4.10 Relationship between SLCO1B1 (c.521T>C) genotype and muscle
pain…………………………………….…..…………..………………. 35
Table 4.11 Relationship between CYP3A4 (c.522-191C>T) and SLCO1B1
(c.521T>C) compound genotype and muscle pain………..……...……. 36
Table 4.12 Relationship between lactate dehydrogenase level (U/L) and muscle
pain…………………………………………….…….……..………….. 36
Table 4.13 Relationship between creatine kinase level (U/L) and muscle
pain……. 37
Table 4.14 Relationship between lactate dehydrogenase level (U/L) and CYP3A4
(c.522-191C>T) genotype………………….……………….………… 38
Table 4.15 Relationship between creatine kinase level (U/L) and CYP3A4 (c.522-
191C>T)……………………….………………………………………. 38
xiii
Table 4.16 Relationship between lactate dehydrogenase level (U/L) and
SLCO1B1 (c.521T>C) genotype………………………………………. 39
Table 4.17 Relationship between creatine kinase level (U/L) and SLCO1B1
(C.521T>C)…………………………….……………………………… 40
Table 4.18
Relationship between the compound genotype of CYP3A4 (c.522-
191C>T) and SLCO1B1 (c.521T>C) and lactate dehydrogenase level
(U/L)…………………………………..……………………….............
40
Table 4.19
Relationship between the compound genotype of CYP3A4 (c.522-
191C>T) and SLCO1B1 (c.521T>C) and lactate dehydrogenase level
(U/L)………………………………….…………………………..........
41
Table 4.20 Relationship between the compound genotype of CYP3A4 (c.522-
191C>T) and SLCO1B1 (c.521T>C), and creatine kinase level (U/L).. 42
xiv
List of Figures Page
Figure 2.1
Schematic presentation of the predicted secondary structure of
human OATP1B1, depicting the positions of known amino acid
changes……………………………………………….………..
8
Figure 2.2 Schematic representation of functionally distinctive SLCO1B1
haplotypes……………………………………………………....
10
Figure 2.3
The first and rate-limiting step in cholesterol synthesis is the
synthesis of mevalonate from acetate. Mevalonate is further
metabolized to squalene, which is cyclized to lanosterol. The
formation of cholesterol from lanosterol involves several
metabolic reactions in the late cholesterol biosynthesis
pathway…………………………………………………..…….
13
Figure 2.4 Chemical structure of cholesterol………………………………. 13
Figure 2.5 Simplified scheme of the biosynthetic pathway of cholesterol
and other cometabolites………………………………………… 16
Figure 2.6 Chemical structures of HMG-CoA and the investigated
statins…………………………………………………………… 17
Figure 4.1 Representative photograph showing agrose electrophoresis gel
of CYP3A4 (c.522-191C>T)…………………………………… 32
Figure 4.2 Representative photograph showing agrose electrophoresis gel
of SLCO1B1 (c.521T>C)………………………...….…………. 33
xv
Abbreviations and Definitions
3’-untranslated region 3’UTR
Angiotensin-converting enzyme ACE
Apolipoprotein Apo
Area under the curve AUC
Coronary heart disease CHD
Creatine kinase CK
Cardiovascular disease CVD
Coenzyme A CoA
Cytochrome P450 CYP
Database of single nucleotide polymorphisms dbSNP
Deoxyribonucleic acid DNA
Ethylenediaminetetraacetic acid EDTA
High-density lipoprotein HDL
Human embryonic kidney cells HEK293
Human cervical carcinoma cells, name derived from Henrietta
Lacks HeLa
Human immunodeficiency virus HIV
3-hydroxy-3-methylglutaryl HMG
HMG-CoA reductase HMG-CoAR
Intermediate-density lipoprotein IDL
Low-density lipoprotein LDL
LDL-cholesterol LDL-C
Liver-specific transporter LST
Multidrug and toxin extrusion transporter MATE
Multidrug resistance transporter MDR1
Messenger ribonucleic acid mRNA
Multidrug resistance-associated protein MRP
National Center for Biotechnology Information NCBI
Sodium-dependent taurocholate co-transporting protein NTCP
Organic anion-transporting polypeptide OATP
Organic cation transporter OCT
xvi
Organic cation/carnitine transporter OCTN
Odds ratio OR
Percutaneous coronary intervention PCI
Polymerase chain reaction PCR
Peptide transporter PEPT
Prediction du Risque Musculaire en Observationnel PRIMO
Standard deviation SD
Solute carrier SLC
Solute carrier organic anion transporter SLCO
Single nucleotide polymorphism SNP
Statistical Package for Social Science SPSS
Very-low-density lipoprotein VLDL
Chi-square test X2
1
CHAPTER 1
Introduction
1.1. Overview
The 3-hydroxy-3-methyl-glutaryl coenzyme A (HMG-CoA) reductase inhibitors
(statins) are essential drugs in the treatment of hypercholesterolemia (LaRosa et al.,
1999). They effectively lower cholesterol levels and consistently and significantly
reduce mortality and morbidity in patients with and without a history of coronary
artery disease (Shepherd et al., 1995; Sacks et al., 1996; Baigent et al., 2005).
In rare cases, statins can cause muscle pain or weakness in association with elevated
creatine kinase levels (i.e., myopathy), and occasionally, this leads to muscle
breakdown and myoglobin release (i.e., rhabdomyolysis), with a risk of renal failure
and death. (Thompson et al., 2003) The mechanisms by which statins cause myopathy
remain unknown but appear to be related to statin concentrations in the blood. The
incidence of myopathy is typically only about 1 case per 10,000 patients per year with
standard doses of statins (e.g., 20 to 40 mg of simvastatin daily), but it increases with
higher doses (e.g., 80 mg of simvastatin daily) and with concomitant use of certain
drugs (e.g., cyclosporine, which can inhibit statin metabolism). (Law and Rudnicka
2006, Armitage 2007)
Plasma membrane transporters have been implicated as important determinants of
intestinal absorption and hepatobiliary clearance, especially of hydrophilic statins.
Multiple organic aniontransporting polypeptide (OATP) family members are capable
of statin transport, and some of them are abundant in the liver, where they may be
involved in the hepatic uptake of statins from the sinusoidal blood (Abe et al., 1999;
Niemi 2007, 2011). OATP1B1 is an uptake transporter located in the basolateral
(sinusoidal) membrane of human hepatocytes and involved in the hepatic uptake of a
broad array of endogenous and foreign compounds, such as estrogen conjugates, bile
acids and statins (Hsiang et al., 1999; König et al., 2000).
2
Several single nucleotide polymorphisms (SNPs) in the gene encoding OATP1B1,
solute carrier organic anion transporter (SLCO1B1), have been discovered (Tirona et
al., 2001; König et al., 2006). Some of them, in particular the nonsynonymous
sequence variation SLCO1B1 c.521T>C (Val174Ala, rs4149056), defining the
SLCO1B1*5 allele, have been associated with reduced activity of OATP1B1 in vitro
(Tirona et al., 2001; Iwai et al., 2004; Kameyama et al., 2005; Nozawa et al., 2005),
and increased plasma concentrations of pravastatin, rosuvastatin, pitavastatin,
repaglinide and fexofenadine in vivo in humans (Nishizato et al., 2003; Mwinyi et al.,
2004; Niemi et al., 2004; 2005a,b, Chung et al., 2005; Lee et al., 2005a). The
frequency of the polymorphisms in SLCO1B1 appears to be heavily dependent on
ethnic background (Tirona et al., 2001; Lee et al., 2005a). Since statins exert their
cholesterol lowering effects by inhibiting the HMG-CoA reductase in the hepatocytes,
reduced OATP1B1-mediated uptake into the liver due to genetic polymorphism in the
encoding SLCO1B1 gene may both reduce their efficacy and increase their peripheral
plasma concentrations, thus enhancing the risk of systemic adverse effects, such as
myopathy (Niemi et al., 2004).
Cytochrome P450 (CYP) enzymes metabolize endogenous and xenobiotic compounds.
Belonging to the CYP3A subfamily, CYP3A4 is the most abundant CYP enzyme,
involved in metabolizing 45–60% of all currently used drugs, (Danielson 2002)
including several statins—cholesterol lowering HMG-CoA reductase inhibitors.
However, CYP3A4 activity or protein content shows 10–100-fold inter-individual
variations, (Westlind-Johnsson et al., 2003; Lamba et al., 2002) influencing drug
response and toxicity.
There is a strong correlation between statin dose, blood drug concentration, and lipid
response (Shitara and Sugiyama 2006; Jones et al., 2003). Genetic polymorphisms
that alter CYP3A4 enzyme activity are expected to affect blood drug level and lipid
response or side effects.
Genetic variants may play a vital role in determining response to statin therapy.
Carriers of a newly identified CYP3A4 (c.522-191C>T) (intron 6 SNP, rs35599367),
defining the CYP3A4*22 allele, required significantly lower statin doses (0.2–0.6
times less) for optimal lipid control. The analyses included atorvastatin (Lipitor),
3
simvastatin, and lovastatin (Mevacor), and the association was robust (P = .019).
(Wang et al., 2011)
1.2. Objectives
1.2.1. Main objectives
This study aims to investigate the impact of the SLCO1B1 c.521T>C SNP in the
SLCO1B1 gene and CYP3A4 (c.522-191C>T) on the risk of statin-induced muscle
pain in cardiac patients in Gaza strip and its relation with cholesterol levels in these
patients.
1.2.2. Specific objectives
1. To determine the frequency of SLCO1B1 C.521T>C SNP and CYP3A4 (c.522-
191C>T) in the population.
2. To evaluate the effects of SLCO1B1 C.521T>C SNP and CYP3A4 (c.522-
191C>T) on the statin induced muscle pain.
3. To collect and evaluate relevant clinical data of the target population
particularly data related to their genotype at the mentioned loci, statin treatment
and any side effect or recurrence of cardiovascular events.
1.3. Significance
This research is primarily devoted to improve people's lives, especially those of
hypercholesterolemia patients. This is the first time such research has been performed
on cardiovascular disease patients in the Gaza Strip. In addition, establishing a
relationship between SLCO1B1 C.521T>C and CYP3A4 (c.522-191C>T)
polymorphisms and statin induced muscle pain will help reduce the side effects of the
drug by enabling the adjustment of the dose commensurate with the status of each
patient. It will also increase community awareness about drugs and their possible side
effects.
4
CHAPTER 2
Literature review
Most patients in Gaza who have coronary heart disease take statin drug therapy to
lower their cholesterol level, because the high cholesterol level increases the risk of
coronary artery disease as well as the incidence of coronary atherosclerosis.
2.1. Principles of statin drug action
After oral administration, drugs pass through the intestinal wall and enter the portal
blood circulation. The portal blood takes the drugs into the liver, after which they reach
the systemic circulation and are distributed to the target sites. Drugs are eliminated
from the body by metabolism and excretion, usually via the liver into the bile or via the
kidneys into the urine. Drug pharmacokinetics is concerned with the stages of a drug in
the body, i.e. absorption, distribution, metabolism and excretion, while
pharmacodynamics refers to the biological effects of a drug on the body. Drug efficacy
and response are determined by a complex interplay of multiple processes regulating
drug pharmacokinetics and pharmacodynamics (Rowland and Tozer 1995).
The liver is the major organ of drug metabolism, in which enzymes located in the
endoplasmic reticulum and cytoplasm of hepatocytes catalyse drug biotransformation.
Other organs, e.g. the gut, kidneys, lung and skin, can also contribute to drug
metabolism (Krishna and Klotz 1994).
An orally administered drug can begin to be biotransformed in the gastrointestinal tract
by enterocytes and in the liver after passing through the portal circulation (first-pass
metabolism), which can considerably decrease the oral bioavailability of many drugs
(Shen et al., 1997).
Drug biotransformation is often divided into two phases, including phase I
functionalization and phase II conjugation reactions. Phase I enzymes insert a
functional group in their substrate, usually by oxidation, reduction and hydrolysis
reactions, leading generally to metabolites less active than the parent drug (Josephy et
5
al., 2005). These reactions are mainly catalysed by cytochrome P450 (CYP) enzymes.
Phase II reactions are usually conjugation reactions, in which drugs or their metabolites
are conjugated with endogenous molecules to produce more water-soluble compounds
in order to facilitate their excretion (Josephy et al., 2005).
Transporters expressed in plasma membranes facilitate the import of drugs into
metabolizing cells and export of the drug metabolites produced (Shitara et al., 2006).
2.2. Polymorphism and its impact on statin drug response
Previous studies have shown that nucleotide sequence variation (polymorphism) in
drug transporters plays a major role in interindividual differences in drug disposition.
Polymorphism leading to functional changes in drug transporters can affect the
pharmacokinetics and subsequent pharmacodynamics and toxicological effects of
drugs. It can also affect susceptibility to certain diseases (Ho and Kim 2005).
There are many mechanisms by which polymorphism can affect transporter phenotype.
Common polymorphisms include tandem repeated segments, large (copy number
variants) and small segmental deletions/insertions/duplications and substitutions
(SNPs). SNPs are an exceedingly common form of polymorphism that may account for
approximately 90% of all known sequence variation (Collins et al., 1998).
2.2.1 Synonymous and nonsynonymous SNPs
Functional SNPs that lead to changes in gene expression occur in all regions of the
genome. SNPs in the coding (exonic) regions of transporter genes can be
nonsynonymous, meaning that they lead to a change in encoded amino acids, or
synonymous (no amino acid change). Although both kinds of SNPs can have an impact
on transporter activity, it is widely accepted that nonsynonymous SNPs are more likely
to have functional consequences.
Nonsynonymous SNPs can lead to protein misfolding, polarity shift or improper
phosphorylation. SNPs in the noncoding regions of transporter genes are less
predictable and include variants in the intronic, promoter and 3’-untranslated region
(3’UTR). These variants can affect the splicing or regulation of transporter genes.
6
SNPs in the promoter region may modify transporter expression by altering the binding
sites for transcription factors (Chorley et al., 2008; Gradhand and Kim 2008).
2.3. Types of influx transporters
Influx (uptake) transporters facilitate the entry of drugs into cells. Uptake transporters
include the organic anion-transporting polypeptides (OATPs, SLCO), organic anion
transporters (OATs, SLC22A), organic cation transporters (OCTs, SLC22A), organic
cation/carnitine transporters (OCTNs, SLC22A), peptide transporters (PEPTs,
SLC15A) and sodium-dependent taurocholate cotransporting protein (NTCP,
SLC10A1) (Ho and Kim 2005; Zair et al., 2008). Multidrug and toxin extrusion
transporter 1 (MATE1, SLC47A1) and multidrug and toxin extrusion transporter 2-K
(MATE2-K, SLC47A2) also participate into the uptake of compounds into the cell
(Tanihara et al., 2007). All of these transporters belong to the superfamily of solute
carriers (SLCs) (Hagenbuch and Meier 2004; Hediger et al., 2004; Seithel et al.,
2008a).
Information on the other members of the OATP family is limited. Numerous genetic
polymorphisms in at least the OATP1B1- and OATP1B3-encoding genes SLCO1B1
and SLCO1B3 have been identified, some associated with altered transport function.
OATPs can be inhibited by cyclosporine, rifampicin, gemfibrozil and macrolides
(Niemi 2007).
2.4. Organic anion-transporting polypeptides (OATPs)
OATPs are encoded by genes of the SLCO superfamily (previously SLC21)
(Hagenbuch and Meier 2004). The genes encoding human OATP1 family members
are located in the short arm of chromosome 12, where they are organized in the order
SLCO1C1, SLCO1B3, SLCO1B1, and SLCO1A2 (Hagenbuch and Meier 2004).
Between SLCO1B3 and SLCO1B1, there is a gene entitled liver-specific organic anion
transporter 3TM12 (LST-3TM12, also known as LST3 and LST-3B), the function and
sites of expression of which are yet unknown. Genes encoding other OATPs are
scattered in chromosomes 3, 5, 8, 11, 15, and 20. No human diseases appear to be
associated with genetic variations of SLCO family genes.
7
2.4.1. OATP1B1
OATP1B1 (previously known as OATP2, OATP-C, and LST-1) is mainly expressed
on the sinusoidal membrane of human hepatocytes (Abe et al., 1999; Hsiang et al.,
1999; König et al., 2000). OATP1B1 mRNA has been detected also in other tissues,
including small intestinal enterocytes (Glaeser et al., 2007). OATP1B1 mediates the
influx of its substrates from blood into the hepatocytes and it may therefore be an
important step preceding elimination of drugs by metabolism or biliary excretion
(Niemi 2007).
Examples of in vitro OATP1B1 drug substrates include several HMG-CoA reductase
inhibitors, or statins, angiotensin-converting enzyme (ACE) inhibitors, and angiotensin
II receptor antagonists (Table 2.1). Rosiglitazone and pioglitazone have been identified
as potential substrates of OATP1B1 by in silico pharmacophore modeling (Chang et
al., 2005).
Table 2.1 Drug substrates for OATP1B1. (Pasanen et al., 2008) Substrate Km (μM)
Atorvastatin 12.4
Atrasentan –
Benzylpenicillin –
Bosentan 44
Caspofungin –
Cerivastatin –
Enalapril 262
Fluvastatin 1.4-3.5
Methotrexate –
Olmesartan 12.8-42.6
Pitavastatin 3.0
Pravastatin 13.7-35
Rifampicin 1.5-13
Rosuvastatin 4.0-7.3
SN-38 –
Temocapril –
Troglitazone sulfate –
Valsartan 1.39
Km, Michaelis-Menten kinetic constant;
SN-38, an active Metab lite of the anticancer drug irinotecan;
–, not provided.
8
2.5. Characteristics of SLCO1B1
The SLCO1B1 gene is located in chromosome 12 (gene locus 12p12). A large number
of SNPs, both nonsynonymous and synonymous, have been discovered in the
SLCO1B1 gene, and several of these affect transport function in vitro and in vivo
(Figure 2.1). Most of the SNPs associated with altered transport function span the
transmembrane domains or extracellular loop 5 of OATP1B1. In vitro experimental
systems expressing mutated OATP1B1 have been used to demonstrate the effects of
SNPs on the uptake clearance of OATP1B1 (Table 2.2) (Tirona et al., 2001; Iwai et
al., 2004; König et al., 2006). The effects of certain SLCO1B1 polymorphisms on
transport function appear to be substrate-dependent (Tirona et al., 2001).
Figure 2.1 Schematic presentation of the predicted secondary structure of human OATP1B1, depicting
the positions of known amino acid changes (Pasanen et al., 2008).
One of the most characterized SNPs in SLCO1B1, the c.521T>C SNP, predicts the
substitution of alanine for valine at amino acid 174 (Val174Ala). Another prevalent
SNP, c.388A>G, causes an amino acid change at position 130 (Asn130Asp) (Niemi et
al., 2004).
When the effects of SNPs on the respective phenotype are assessed, the underlying
haplotype structure should be taken into account. Moreover, at least in Europeans, the
haplotypes comprising c.388A>G and c.521T>C can be further subclassified by two
promoter region SNPs g.-11187G>A and g.-10499A>C into two other distinctive and
9
potentially functional significant haplotypes: *16 and *17 (Figure 2.2) (Niemi et al.,
2004).
The c.521C allele and the haplotypes *5 and *15 (containing the c.521T>C SNP) have
been associated with markedly reduced uptake activity in vitro of the OATP1B1
substrates oestrone- 3-sulphate, oestradiol-17ß-D-glucuronide, atorvastatin,
cerivastatin, pravastatin, the SN-38 metabolite of irinotecan and rifampicin (Tirona et
al., 2001, 2003; Iwai et al., 2004; Kameyama et al., 2005; Nozawa et al., 2005).
In addition, studies in humans have associated the c.521C allele with increased plasma
concentrations of the statins pravastatin, rosuvastatin and pitavastatin, the
antihistamine fexofenadine and the antidiabetic drug repaglinide (Nishizato et al.,
2003; Mwinyi et al., 2004; Niemi et al., 2004; 2005a,b, Chung et al., 2005; Lee et
al., 2005a).
It is becoming evident that the incidence of sequence variations in the SLCO1B1 gene
is heavily dependent on the ethnic background. The c.521T>C variant showed an allele
frequency of approximately 10–15% in Asian populations, 10–20% in Caucasians and
1–2% in African-American populations. The c.388A>G SNP showed an allele
frequency of approximately 30–45% in Caucasians, 70–80% in African-
American/Sub-Saharan African populations and 60–90% in Asian populations (Tirona
et al., 2001; Nozawa et al., 2002; Niemi et al., 2004; Lee et al., 2005a, Jada et al.,
2007).
10
Figure 2.2 Schematic representation of functionally distinctive SLCO1B1 haplotypes
2.6. CYP enzymes
CYP3A4 (cytochrome P450, family 3, subfamily A, polypeptide 4 ) encodes a member
of the cytochrome P450 superfamily of enzymes. CYP3A4 and CYP3A5 are believed
to be the predominant cytochrome P450s expressed in adult human liver, with
CYP3A4 thought to dominate in Whites and CYP3A5 in Blacks/African Americans.
The two have overlapping substrate specificities. CYP3A4 is responsible for the
metabolism of approximately 50-60% of clinical drugs used today, It is important for
the metabolism of steroid hormones (Niwa et al 1998; Shou et al., 1997).
The complete cDNA sequence was reported by Molowa et al., in 1986, and Inoue et
al., in 1992 mapped the gene to 7q22.1 by fluorescence in situ hybridization. The gene
is about 27 kb in length and contains 13 exons and 12 introns (Hashimoto et al.,
1993).
The CYP enzymes are a superfamily of haem-containing monooxygenases located in
the endoplasmic reticulum and involved in the metabolism of a large number of
organic compounds (Wrighton and Stevens 1992; Lewis 2004). Over 2700 individual
members of this enzyme family are known to exist. The degree of similarity in amino
11
acid sequence divides the CYP enzymes into families indicated by a number showing
> 40% identity with each other (e.g. CYP3), into subfamilies indicated by a letter
showing > 55% amino acid sequence identity (e.g. CYP3A) and into individual
enzymes in which the specific gene is indicated by a number (e.g. CYP3A4) (Nebert
and Russell 2002).
In humans, 57 CYP enzymes have been identified, most present in families CYP1–
CYP4. The CYP1, CYP2 and CYP3 families predominantly participate in the
metabolism of exogenous compounds, whereas the other CYP families are mainly
involved in endogenous metabolism (Lewis 2004).
The CYP3A subfamily comprises the CYP3A4, CYP3A5, CYP3A7 and CYP3A43
enzymes. CYP3A4 is the most abundant CYP enzyme in both the liver and intestine
and is the most important drugmetabolizing enzyme in humans (Nebert and Russell
2002; Wrighton et al., 2000). CYP3A5 is expressed mainly in the liver but also in
extrahepatic tissues such as the intestine and lung (Kivistö et al., 1996a, b).
CYP3A5 substrate specifity largely overlaps that of CYP3A4, but the catalytic activity
of CYP3A5 is usually smaller. Substrates of CYP3A include atorvastatin, simvastatin,
midazolam, triazolam, cyclosporine a, erythromycin and several calcium channel
blockers (Wrighton et al., 2000).
2.7. Cholesterol homeostasis
Cholesterol is a major component of mammalian cell membranes modulating fluidity
and maintaining the barrier between the cell and the environment. Cholesterol is also
essential for tissue growth, bile acid synthesis in the liver, vitamin D production in the
skin and steroid hormone synthesis in the adrenal glands, ovaries and testes (Brown
and Goldstein 1986).
The transport of cholesterol in the circulatory system is facilitated by lipoproteins.
Lipoproteins are spherical particles with a hydrophobic core of esterified cholesterol
and triglycerides and a surrounding hydrophilic shell of apolipoproteins (apos),
phospholipids and unesterified cholesterol. Plasma lipoproteins can be divided
12
according to their density in ultracentrifugation into chylomicrons (< 95 g/ml), very-
low-density lipoprotein (VLDL; 0.95–1.006 g/ml), intermediate-density lipoprotein
(IDL; 1.006–1.019 g/ml), low-density lipoprotein (LDL; 1.019– 1.063 g/ml) and high-
density lipoprotein (HDL; 1.063–1.210 g/l).
The apolipoproteins (A, B, C, E) serve as structural proteins, cofactors for enzymes
and ligands for cell surface receptors of lipoprotein particles, and as raw material for
production of lipoproteins. Lipoprotein receptors, prototypically LDL receptors located
on the surfaces of cells, bind LDL and carry cholesterol into the cells by receptor-
mediated endocytosis, where it is used by the cell or stored in the form of cytoplasmic
cholesteryl ester droplets (Brown and Goldstein 1983; Brown and Goldstein 1986;
Martini and Pallottini 2007).
In humans, cholesterol is acquired either by de novo synthesis or by absorption from
the diet. Accumulation of cholesterol in tissues due to increased dietary intake is
generally prevented by several feedback responses down-regulating absorption or
synthesis of cholesterol or enhancing cholesterol excretion (Gylling and Miettinen
1992).
High cholesterol intake exceeding the capacity of adaptive changes in cholesterol
metabolism generally increases the serum levels of total cholesterol and LDL-C,
accelerating the formation of atherosclerotic plaques and possibly leading to coronary
heart disease (Brown and Goldstein 1986).
13
Figure 2.3 The first and rate-limiting step in cholesterol synthesis is the synthesis of mevalonate from
acetate. Mevalonate is further metabolized to squalene, which is cyclized to lanosterol. The formation of
cholesterol from lanosterol involves several metabolic reactions in the late cholesterol biosynthesis
pathway. (Pasanen et al., 2008)
Figure 2.4 Chemical structure of cholesterol.
14
2.8. The 3-hydroxy-3-methyl-glutaryl coenzyme A (HMG-CoA)
reductase inhibitors (statins)
The sequelae of atherosclerotic vascular disease contribute significantly to the burden
of illness in developed nations. In Canada an estimated 36% of all deaths result from
cardiovascular disease (CVD). (The changing face of heart disease and stroke in
Canada 2000).
Antilipemic agents have proven to be particularly advantageous in both primary and
secondary prevention of CVD sequelae. (Scandinavian Simvastatin Survival Study
Group 1994; Shepherd et al., 1995) Among the various lipid-lowering medications
the 3-hydroxy-3- methylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors,
(HMGRI or ―statins‖) have emerged as the dominant class for the treatment of
hypercholesterolemia. (Maron et al., 2000) In addition to their ability to lower serum
cholesterol by inhibiting a rate-limiting enzyme in the cholesterol biosynthetic
pathway, statins have also been shown to target a variety of cellular processes that
modify endothelial function, inflammatory responses, plaque stabilization and
thrombogenesis (Beyer RE 1992; Rosenson and Lowe 1998). Relevant to these
functions are the findings that acute statin therapy decreases the incidence of
symptomatic ischemia in patients with acute coronary syndromes (Schwartz et al.,
2001).
Generally, the statins have a benign side-effect profile and are well tolerated. The most
serious adverse effects arise from cell damage in liver and skeletal muscle. Increases in
serum transaminases of hepatic origin are dose dependent and occur with a reported
frequency of approximately 1%, whereas myotoxicity, defined as myalgias and
elevated serum creatine kinase values (>10 times the upper limit of normal), occurs in
0.1% of patients.(Maron et al., 2000) Although hepatotoxicity is more common,
myotoxicity may pose a larger risk for sarcolemmal disruption (i.e., rhabdomyolysis)
and can lead to myoglobinuria and acute renal failure.( Dromer et al., 1992; Ozdemir
et al., 2000)
The incidence of myopathies is low, but the increasing use of statins implies that more
physicians will encounter this clinical entity. Attempting to understand the
15
pathophysiology of statins is of particular importance given the withdrawal of
cerivastatin from the market in August 2001 owing to an unacceptable incidence of
rhabdomyolysis and death. This review will consider the potential etiologies of statin
myopathies in relation to altered cholesterol biosynthesis and muscle physiology.
2.8.1. The effectiveness of statins
Statins are reversible competitive inhibitors of the HMG-CoA reductase enzyme,
which catalyses the first and rate-limiting step from HMG-CoA to mevalonate in de
novo cholesterol synthesis (Figure 2.5). Inhibition of this enzyme reduces cholesterol
synthesis in the hepatocytes, leading to a reduction in intracellular cholesterol
concentration and a responsive increase in LDL receptor expression on the hepatocyte
cell surface.
This results in increased extraction of LDL-C from the blood and decreased circulating
total cholesterol and LDL-C concentrations. A meta-analysis showed that statins can
lower LDL-C by an average of 1.8mmol/l, which reduces the risk of CHD events by
about 60% and stroke by 17% (Law et al., 2003). In addition to lowering plasma LDL-
C and total cholesterol levels, statins also moderately reduce triglyceride levels and
increase HDL-cholesterol levels (Kreisberg and Oberman 2002).
Statins have been shown to slow the progression or even promote regression of
coronary atherosclerosis, possibly due to shrinkage of the lipid core of the
atherosclerotic plaque, avoiding plaque rupture that would otherwise trigger intramural
haemorrhage and intraluminal thrombosis (Kreisberg and Oberman 2002; Liao
2002).
16
Figure 2.5 Simplified schemes of the biosynthetic pathway of cholesterol and other cometabolites.
2.8.2. Statin family structures and their pharmacokinetic
The chemical structures of fluvastatin, pravastatin, simvastatin, rosuvastatin and
atorvastatin are shown in Figure 2.6. These structures can be divided broadly into three
parts: an analogue of the natural substrate (HMG-CoA), a complex hydrophobic ring
structure that is covalently linked to the substrate analogue and involved in the binding
of statin to the reductase, and side groups on the rings that define the solubility and
other pharmacokinetic properties (Schachter 2005).
Crystal structures have shown that statins act by binding to the active site of the HMG-
CoA reductase enzyme, thus sterically preventing the substrate from binding. The
substrate-binding pocket of the enzyme undergoes a conformational change that
enables the hydrophobic ring structures of statins to be accommodated to the enzyme
(Istvan and Deisenhofer 2001).
The significance of the differences in the binding sites of different statins is not fully
understood, but the additional binding interactions of rosuvastatin with the HMG-CoA
reductase may explain in part its increased potency compared with other statins
(Schachter 2005).
17
Simvastatin is administered as a lipophilic lactone prodrug, whereas fluvastatin,
pravastatin, rosuvastatin and atorvastatin are given as active acid forms. Generally, the
lipophilic statins are more readily distributed into the peripheral tissues by passive
diffusion than hydrophilic statins such as pravastatin and rosuvastatin (Lennernäs and
Fager 1997; Hamelin and Turgeon 1998).
However, many statins are converted in the body to their lactone forms or metabolites
that can be more lipophilic than the parent acid form. Both acid and lactone forms as
well as metabolites can be important in statin interactions (Neuvonen et al., 2006).
Generally, lipophilic drugs appear to be more susceptible to oxidative metabolism by
CYP enzymes than hydrophilic drugs (Schachter 2005).
Figure 2.6 Chemical structures of HMG-CoA and the investigated statins
2.8.3. Simvastatin
Simvastatin is a semisynthetic derivative of lovastatin and is administered as a rather
lipophilic lactone prodrug (logP 4.7), of which approximately 60–85% is absorbed
from the gastrointestinal tract. The plasma protein binding of simvastatin is high (>
18
95%) compared with that of the more hydrophilic statins. The inactive parent
simvastatin lactone is either oxidized by CYP3A4 (and by CYP3A5) in the intestinal
mucosa and liver to more than 10 metabolites, or hydrolysed to simvastatin acid, the
main active metabolite of simvastatin (Vickers et al., 1990, Igel et al., 2002).
Active simvastatin acid is also further metabolized, mainly by CYP3A4 and CYP2C8
(Prueksaritanont et al., 2002, 2003). The active metabolites also account for the
HMG-CoA reductase inhibition (Schachter 2005).
Simvastatin is eliminated principally as metabolites into the bile. Simvastatin lactone is
not transported by OATP1B1, but simvastatin acid strongly inhibits OATP1B1-
mediated hepatic uptake of pravastatin, suggesting it to be an OATP1B1 substrate
(Hsiang et al., 1999; Chen et al., 2005). In addition, simvastatin acid is an MDR1
substrate (Chen et al., 2005).
CYP3A4 inhibitors markedly elevate the plasma concentrations of both simvastatin
and simvastatin acid (Neuvonen et al., 2006). For example, concomitant
administration of itraconazole increased the AUC of simvastatin by approximately 20-
fold (Neuvonen et al., 1998). On the other hand, gemfibrozil, which is an inhibitor of
CYP2C8 and OATP1B1, but not CYP3A4, increases the simvastatin acid AUC by
approximately 200%, but does not significantly affect the parent lactone form
(Backman et al., 2000).
The atorvastatin plasma concentrations have been significantly elevated when
administered concomitantly with CYP3A4 inhibitors, gemfibrozil and cyclosporine
(Hermann et al., 2004; Neuvonen et al., 2006). Gemfibrozil only moderately
increases the AUC values of atorvastatin and its active acid metabolites, whereas
cyclosporine has increased the AUC of atorvastatin 6- to 15-fold (Åsberg et al., 2001;
Hermann et al., 2004). Itraconazole has increased the AUC of atorvastatin 3-fold
(Kantola et al., 1998). Multiple-dose rifampicin decreases the atorvastatin AUC by
about 80% (Backman et al., 2005), but a single dose of rifampicin has increased the
atorvastatin AUC by over 600% (Lau et al., 2006, 2007). This is probably due to the
inhibition of OATP-mediated hepatic uptake of atorvastatin by rifampicin (Vavricka
et al., 2002).
19
2.8.4. Side effects of statins
In general, statins are regarded as a safe and well-tolerated class of drugs; serious
adverse events are rare (Pasternak et al., 2002). A small percentage of patients
experience asymptomatic, reversible increase in liver enzymes (notably alanine and
aspartate transaminases), but this increase is not generally associated with liver damage
(Armitage 2007).
Statins can also cause muscle pain or weakness (myalgia), sometimes in association
with elevated creatine kinase (CK) levels (myopathy), which may progress to muscle
breakdown (rhabdomyolysis), myoglobin release, renal failure and even death
(Vaklavas et al., 2008).
Asymptomatic elevation of CK can sometimes also occur with statin therapy, but the
clinical relevance of this is unclear. In addition, some patients receiving statin therapy
develop significant muscle symptoms with demonstrable weakness and histopathologic
findings of myopathy despite normal CK levels (Phillips et al., 2002).
The mechanisms by which statins cause these muscle-related adverse effects remain
largely unknown, but myopathy appears to be a class-effect of statins, dose-dependent
and associated with statin concentrations in the blood (Bradford et al., 1991; Dujovne
et al., 1991; Laaksonen 2006).
Nonspecific muscle aches or joint pains that are not associated with significant
increases in CK are reported generally by 1–5% of participants in placebo-controlled
trials, with no significant differences in reporting between the statin and the placebo
groups (Thompson et al., 2003; Armitage 2007). The incidence of statin-induced
myopathy is approximately 11 in 100000 person-years of follow-up, whereas
rhabdomyolysis is even more rare (approximately 3.4 per 100 000 person-years), but
the incidences of both increase with higher doses of statins and other predisposing
factors (Graham et al., 2004; Law and Rudnicka 2006; Armitage 2007). However,
accurate estimation of the occurrence of muscle-related symptoms less severe than
rhabdomyolysis is difficult, due to poor reporting and general exclusion of patient
groups prone to statin-induced myopathy from large clinical trials (Law and
Rudnicka 2006, Vaklavas et al., 2008).
20
It has been suggested that the frequencies of mild and moderate muscle symptoms with
high-dose statin therapy may be more common than as estimated from the large
clinical trials. For example, in the PRIMO (Prediction du Risque Musculaire en
Observationnel) study, 10.5% of patients receiving high-dose statin therapy
complained of muscle pain, and the highest rate (18.2%) was associated with high-dose
simvastatin treatment (Bruckert et al., 2005).
Most of the predisposing factors for statin-induced muscle-related adverse effects
promote myopathy by altering the metabolism and increasing the bioavailability of
statins (Table 2.2). Comedication with drugs that share common metabolic pathways
can significantly increase the likelihood of muscle toxicity (Thompson et al., 2003;
Law and Rudnicka 2006; Neuvonen et al., 2006; Armitage 2007).
Table 2.2 Potential factors predisposing to statin-induced myopathy
Alcoholconsumption
Coadministration of interacting drugs (CYP3A4 inhibitors, fibrates, cyclosporine, amiodarone)a
Diabetes
Genetic differences in drug disposition genesb
Increasing age
Increasing statin dose
Female gender
Renal insufficiency
Hepatic dysfunction
Hypothyroidism
Perioperative period
Metabolic muscle diseases
Polymyalgia rheumatica
Steroid use
Strenuous exercise
This table was adapted from (Pasanen et al., 2008)
Genetic differences in drug metabolizing enzymes or drug transporters can also
predispose to statin myotoxicity. An article published associated SLCO1B1
polymorphism with a considerably elevated risk for myopathy (SEARCH
Collaborative Group 2008). In this study, two sets of patient and control groups from
large trials involving approximately 12 000 and 20 000 participants were treated with
80 mg and 40 mg of simvastatin per day, respectively. A strong association was found
between myopathy and two tightly linked variants in SLCO1B1, the other one being
21
the c.521T>C variant. The odds ratio for myopathy was 4.5 per copy of the c.521C
allele, and 16.9 in c.521CC, compared with the c.521TT homozygotes. In this large-
scale study, approximately 60% of the simvastatin-induced myopathy cases were
attributable to the c.521 variant allele.
In a previous Japanese study, the SLCO1B1*15 haplotype also containing the
c.521T>C SNP (c.388G-c.521G) was associated with pravastatin-induced myopathy
(Morimoto et al., 2004, 2005).
Little is known about the precise mechanisms through which statins are transported
into skeletal muscle cells and how they produce muscle injury. The inhibition of
HMG-CoA reductase by statins also reduces the production of downstream
intermediate metabolites in the cholesterol synthesis pathway, including isoprenoid
cometabolites (Figure 2.5). This in turn may interfere with protein modification at
multiple levels and affect protein prenylation and glycosylation, leading to depletion of
muscle fibres from growth signals and susceptibility to mechanical stress (Thompson
et al., 2003; Dirks and Jones 2006; Shitara and Sugiyama 2006).
Statin-induced myopathy may also be associated with mitochondrial dysfunction, since
ubiquinone biosynthesis is interrupted (Laaksonen 2006; Littarru and Langsjoen
2007). High-dose statin therapy has been shown to lead to changes in skeletal muscle
sterol metabolism and to decrease mitochondrial volume and mitochondrial DNA in
skeletal muscle (Päivä et al., 2005; Schick et al., 2007).
In previous studies, the SLCO1B1 c.521C allele has been associated with increased
plasma concentrations of pravastatin, rosuvastatin and pitavastatin (Nishizato et al.,
2003; Mwinyi et al., 2004; Niemi et al., 2004; Chung et al., 2005; Lee et al., 2005a).
In addition, the acute effect of pravastatin on hepatic cholesterol synthesis was
significantly reduced in carriers of the *17 haplotype (g.-11187A-g.-10499A-c.388G-
c.521C) (Niemi et al., 2005c), although this effect was not seen in a 3-week multiple-
dose pravastatin study (Igel et al., 2006). On the other hand, the c.521TC genotype has
been associated with a reduced cholesterol-lowering efficacy in Japanese patients using
simvastatin, atorvastatin or pravastatin (Tachibana-Iimori et al., 2004). Moreover, the
c.521T>C variant and the c.388A>G variant were associated with a slightly attenuated
22
response (1.28% ± 0.25% smaller reduction in LDL-C per c.521C allele) and a slightly
enhanced response (0.62% ± 0.18% larger reduction in LDL-C per c.388G allele) in 4–
6 weeks of simvastatin therapy, respectively (Heart Protection Study Collaborative
Group 2002; SEARCH Collaborative Group 2008). This is consistent with studies
that have associated the SLCO1B1 (c.521T>C) variant with decreased activity of
OATP1B1 and the SLCO1B1*1B haplotype with increased activity of OATP1B1
(Mwinyi et al., 2004, 2008; Maeda et al., 2006).
23
CHAPTER 3
Materials and methods
3.1. Materials
3.1.1. Equipments (Table 3.1)
Table 3.1 Equipment used in this study.
Instrument Manufacturer
TPersonal thermocycler. Biometra – Germany
Minispin Microfuge. Eppendorf – Germany
Power Supply Consort 200V 200mA 20W. Anachem – UK
Vortex mixer. Unico – Spain
DRY BLOCK THERMOSTAT TDB-100. BOECO – Latvia
Water bath. Gemmy – Taiwan
Centrifuge. LW Scintific – USA
3.1.2. List of reagents and chemicals (Table 3.2)
Table 3.2 Chemicals and Reagents used in this study:
Reagents and Chemicals Manufacturer
Primers Metabion, Germany
Wizard Genomic DNA purification kit Promega, USA
50 bp DNA ladder New England Biolabs, England
GoTaq Green Master Mix Promega, USA
Agarose Promega, USA
Ethedium promide Promega, USA
Isopropanol Sigma-Aldrich, China
70% ethanol Israel
24
3.1.3. Primers used in this study
3.1.3.1. Primers for CYP3A4 (c.522-191C>T).
Table 3.3 Primers for CYP3A4 (c.522-191C>T).
ID Description Sequence (5’ 3’)
Amplicone
size (bp)
WT Wild-type specific : AGTGTCTCCATCACACCCACC
247 MT Mutant specific : AGTGTCTCCATCACACCCACT
R Common reverse TGATCACATCCATGCTGTAG
Mismatch was intentionally introduced at the penultimate primer position (underlined)
to increase the specificity of reaction.
3.1.3.2. Primers for SLCO1B1 (c.521T>C) polymorphism.
Table 3.4 Primers and their sequences for SLCO1B1 (c.521T>C) polymorphism
(Zhang W. et al., 2007).
ID Description Sequence (5’ 3’) Amplicone
size (bp)
F Common forward AAGTAGTTAAATTTGTAATAGAAATGC
TT: 260 + 179
TC: 260 + 123 +
179
CC: 260 + 123
WT Wild-type specific GGGTCATACATGTGGATATAAGT
MT Mutant specific AAGCATATTACCCATGAACG
R Common reverse GTAGACAAAGGGAAAGTGATCATA
All primers were reconstituted in normal nuclease-free water and adjusted to a
concentration of 100 µM.
3.1.4. Disposables
Table 3.5 A list of disposables consumed in the study
Item Manufacturer
Sterile 1.5ml microcentrifuge tubes Different manufacturers
Sterile thin-wall polypropylene PCR
tubes with attached caps for labeling Different manufacturers
Micropipette tips (different sizes from Different manufacturers
25
0.2µ to1000µ)
2.5 K3 EDTA tubes BD Vacutainer – USA
Syringe 5 ml Homed – China
23 Gauge needle Homed – China
3.2. Methods
3.2.1 Study Design
The study utilised a cross-sectional convenience sample. The study population
included: all patients attending the European Gaza Hospital cardiac catheterization
department for follow up after percutaneous coronary intervention (PCI) and who were
being managed with a statin drug; cardiac patients in the cardiology department at
Shifa Hospital; and cardiac patients in the cardiology department at Nasser Hospital
between April 1, 2014 and June 1, 2014.
3.2.2 Study Population
A total of 123 patients from the European Gaza Hospital cardiac catheterization
department, the cardiology department at Shifa Hospital, and Nasser Hospital.
The sample covered the five main Governorates of Gaza strip: North Gaza, Gaza City,
Mid-Zone, Khan Younis and Rafah. During the statistical analysis we've integrated
North and Gaza governorates under the name of North governorates and Khan Younis
and Rafah governorates under the name of South governorates. The sample consisted
of 81 males and 42 females with ages ranging from 34 years to 86 years, with a mean
age of 60.0±10.1 years.
3.2.3 Ethical Considerations
Approval of the Helsinki Committee was obtained (Appendix 1) to perform this study
and collect blood samples from patients. The approval of MOH (Appendix 2) was
obtained to collect samples from Al-Shifa Hospital and the Gaza-European Hospital.
The aims and objectives of the study were explained to patients, and oral consent was
obtained for participation in this study and for the collection of blood samples for
analysis.
26
3.2.4 Inclusion criteria:
1. Acute Coronary Syndrome patients who underwent PCI.
2. Unrelated men and women.
3. Treated with statin.
3.2.5. Clinical data collection and assessment
Personal and clinical data were collected from the patient, and the patients’ hospital
medical record. The data included gender, age, geographical location, medications,
laboratory tests, history of recurrent complications related to their medical condition,
the presence/absence of muscle pain.
In addition, six months after blood sample collection, the patients were questioned to
ascertain the presence of muscle pain which had commenced after statin therapy was
initiated, and confounding factors such as predisposing medication or substance abuse
were excluded.
Data was recorded on a written form (Appendix 3) provided for each patient after
explaining the aim of the study and oral consent was obtained to participate in the
study and have blood samples collected.
The reference intervals for medical tests obtained from the patient's record are listed in
Table 3.6.
Table 3.6 The study tests
Test reference values
Cholesterol < 200 mg/dl
Lactate Dehydrogenase 225-450 U/L
Creatine Kinase Female: 26-155 U/L
Male:26-190 U/L
3.2.6. Blood sample collection
Whole blood samples were collected from 123 patients in EDTA tubes.
Approximately 5 ml venous blood samples was collected in each tube from each
patient and subjected to DNA extraction.
27
3.2.7. DNA extraction
DNA was extracted from blood samples using the Wizard Genomic DNA Kit from
Promega, USA according to the manufacturer’s recommendations.
Briefly, RBCs from 300 µl blood samples were lysed by 900 µl of cell lysis solution in
1.5 ml microcentrifuge tube, mixed by inversion and left for 10 minutes. The WBCs
were pelleted by centrifugation for 20 seconds at 14000 rpm and the supernatant was
discarded. The WBCs were lysed using 300 µl of the nuclei lyses solution, and mixed
by inversion. Proteins were precipitated by adding 100 µl protein precipitation buffer
and mixed by vortex for 20 seconds, then centrifuged at 14000 rpm for 3 minutes. The
supernatant containing the nucleic acid was transferred to a new tube containing 300 µl
of isopropanol and the DNA was pelleted by vortex for 20 seconds followed by
centrifugation at 14000 rpm for 1 minute. The pelleted DNA was washed by 300 µl of
70 % ethanol and centrifuged at 14000 rpm for 1 minute. The ethanol was aspirated
and discarded, and the pellet air-dried for 10-15 minutes. Finally the DNA pellet was
resuspended in 80 µl of the provided alkaline rehydration solution and rehydrated at 65
ºC for 1 hour. The quantity and quality of DNA were assessed spectrophotometrically.
3.2.8. Procedure of CYP3A4 (c.522-191C>T) detection by PCR
For the CYP3A4 (c.522-191C>T), PCR was carried out in a 20 µl volume containing
50-100 ng of extracted DNA, 5 pmol of each primer (Table 3.3) and 10 µl of 2X
GoTaq Green master mix.
The cycling profile consisted of an initial denaturation step at 94 °C for 5 minutes;
followed with 37 cycles of 94 °C for 30 seconds, 56 °C for 30 seconds, and 72 °C for
60 seconds; and a 10-minute final extension at 72 °C. The 247-bp PCR products were
subjected to electrophoresis in 2% agarose gel, visualized on a UV transilluminator and
photographed with a high resolution camera.
3.2.9. Procedure of SLCO1B1 (c.521T>C) polymorphism detection by PCR
For the SLCO1B1 (c.521T>C) polymorphism, PCR was carried out in a 30 µl volume
containing 50-100 ng of extracted DNA, 10 pmol of each primer (Table 3.4), 15 µl of
2X GoTaq Green master mix.
28
The cycling profile used consisted of an initial denaturation step at 94 °C for 5
minutes; followed with 37 cycles of 94 °C for 30 seconds, 52 °C for 40 seconds, and
72 °C for 40 seconds; and a 10-minute final extension at 72 °C. The 260-bp, 174-bp,
and 123-bp products were subjected to electrophoresis in 2% agarose gel, visualized on
a UV transilluminator and photographed with a high resolution camera.
3.2.10. Quality control
Blank control samples were applied in each run of PCR along with patients’ samples
without addition of any DNA material but using a nuclease free water instead. The
blank samples were treated side by side with the patients’ samples allover the
procedure. Only PCR tests which showed no amplification products in the blank were
considered valid.
3.3. Data Analysis
Collected data were reviewed for completeness and accuracy, tabulated and analyzed
using the Statistical Package for Social Science (SPSS) software version 17 and
appropriate statistical procedures. To ensure the accuracy and completeness of all
questions, frequency distribution and cross tabulation were done for the entire data.
Descriptive statistics were used for summarization of data. For quantitative variables,
mean and standard deviation were calculated. T-test was used for comparing the means
between the different groups of cases. And the Chi-square (χ2) test was used for
analysis of categorical data.
29
CHAPTER 4
Results
4.1. Description of the study sample
4.1.1. Description by gender
Table 4.1 illustrates the gender frequency of the study sample, with 81 males
constituting 65.9%, and 42 females constituting 34.1%.
Table 4.1 Gender frequency of the study sample
Gender Frequency Percent (%)
Male 81 65.9
Female 42 34.1
Total 123 100.0
4.1.2. Description by age
Table 4.2 describes the mean age of the study population distributed as males and
females. The ages of the males ranged from 34 years to 80 years, with a mean of 57.58
years and a standard deviation of 9.82 years.
The ages of the females ranged from 45 years to 86 years, with a mean of 64.69 years
and a standard deviation of 9.06 years.
Table 4.2 Description of males and females by age (years)
Males Females
Mean 57.58 64.69
Std. Deviation 9.82 9.06
4.1.3. Description by region in the study population
Table 4.3 illustrates the frequency by region of the study sample, with 47 participants
from North governorates (38.2%), 24 from Middle governorates (19.5%), and 52 from
South governorates (42.3%).
30
Table 4.3 Regional frequency of the study sample
Region Frequency Percent (%)
North governorates 47 38.2
Middle governorates 24 19.5
South governorates 52 42.3
Total 123 100.0
4.1.4. Description of clinical conditions of the study sample
Table 4.4 describes the distribution of the study sample based on their clinical status.
The results show that the frequency of diabetes mellitus is 75 patients (61%) suffered
from diabetes mellitus, and 48 (39%) did not.
The frequency of hypertension in the study sample is 83 suffered from hypertension
(67%), and 40 (32%) did not.
The frequency by open-heart surgery of the study sample is 5 people had undergone
open-heart surgery (4.1%) while 118 had not (95.9%).
The frequency of muscle pain in the study sample 6 months after initiation of statin
therapy is 49 people had muscle pain (39.8%) while 74 had not (60.2%).
Table 4.4 Description of diabetes mellitus, hypertension, open-heart
surgery and muscle pain frequencies of the study sample
Diabetes Mellitus Frequency Percent (%)
No 48 39.0
Yes 75 61.0
Total 123 100.0
Hypertension
No 40 32.5
Yes 83 67.5
Total 123 100.0
31
Open-Heart Surgery
No 118 95.9
Yes 5 4.1
Total 123 100.0
Muscle Pain
No 74 60.2
Yes 49 39.8
Total 123 100.0
4.1.5. Description of cholesterol, lactate dehydrogenase and creatine kinase levels
in the study sample according to muscle pain
Table 4.5 illustrates the mean and standard deviation of cholesterol, lactate
dehydrogenase and creatine kinase levels in the study sample according to muscle pain,
showing that the mean of cholesterol level is not different in patients who had muscle
pain (206.13 mg/dl) and those who had not (206.12 mg/dl).
The mean of lactate dehydrogenase level is (594.53 U/L) in patients who had muscle
pain and (435.89 U/L) in those who had not.
The mean of creatine kinase level is (248.65 U/L) in patients who had muscle pain and
(263.33 U/L) in those who had not.
Table 4.5 Description of cholesterol, lactate dehydrogenase and creatine kinase levels
in study sample.
Mean ± Std. Deviation P value*
Muscle pain No muscle pain
cholesterol (mg/dl) 206.12 ± 47.88 206.13 ± 63.81
lactate dehydrogenase(U/L) 594.53 ± 213.36 435.89 ± 170.80 0.00
creatine kinase(U/L) 248.65 ± 168.74 263.33 ± 336.96 0.78
*P-value of less than 0.05 was considered significant.
32
4.2. Genotype
4.2.1. Description of CYP3A4 (c.522-191C>T) genotype
Table 4.6 illustrates the frequency of CYP3A4 (c.522-191C>T) in the study sample,
with 99 Wild Type constituting 80.5%, 23 Heterozygous constituting 18.7%, and 1
Homozygous constituting 0.8%. A representative gel photograph of CYP3A4 (c.522-
191C>T) PCR result is showed in figure 4.1.
Figure 4.1 representative photograph showing agarose electrophoresis gel of
CYP3A4 (c.522-191C>T)
Lanes 1-5 are patients samples, N is non-template blank and M is 50 bp ladder. Wildtype and mutant
sets were performed for each sample. The expected amplicon size is 247 bp.
Table 4.6 Frequency of CYP3A4 (c.522-191C>T)
Frequency Percent (%)
Wild Type 99 80.5
Heterozygous 23 18.7
Homozygous 1 0.8
Total 123 100.0
The calculated allelic frequency of the susceptibility allele (T) was 10.16 % and the
Wild Type allele (C) was 89.84%. Both alleles are in Hardy-Weinberg Equilibrium (P-
Value = 0.79).
33
4.2.2. Description of SLCO1B1 (c.521T>C) genotype
Table 4.7 illustrates the frequency of SLCO1B1 (c.521T>C) in the study sample, with
91 Wild Type constituting 74% and 32 Heterozygous constituting 26% and no
homozygots. A representative gel photograph of SLCO1B1 (c.521T>C) PCR result is
showed in figure 4.2.
Figure 4.2 representative photograph showing agarose electrophoresis gel of
SLCO1B1 (c.521T>C)
Lanes 1-11 are patients samples, N is non-template blank, M is 50 bp ladder, C is amplification control
band (260 bp), Wt is wild-type specific band and (179bp) and Mt is mutant specific band (123bp).
Table 4.7 Frequency of SLCO1B1 (c.521T>C)
The calculated allelic frequency of the susceptibility allele (C) was 13.01 % and the
Wild Type allele (T) was 86.99%. Both alleles are in Hardy-Weinberg Equilibrium (P-
Value = 0.09).
4.2.3. Description of the compound genotype
Taking the genotypes obtained for both genes CYP3A4 (c.522-191C>T) and
SLCO1B1 (c.521T>C) together resulted in 5 combinations as illustrated in table 4.8.
The combinations are as follows: 75 people (Wild Type/Wild Type) 61.0%, 16 people
(Heterozygous/Wild Type) 13.0%, 1 person (Homozygous/Heterozygous) 0.8%, 25
people (Wild Type/Heterozygous) 20.3% and 6 people (Heterozygous/Heterozygous)
4.9%.
Frequency Percent (%)
Wild Type 91 74.0
Heterozygous 32 26.0
Total 123 100.0
34
Table 4.8 Both genes frequency of the study sample
CYP3A4/ SLCO1B1 Frequency Percent (%)
(Wild Type / Wild Type) 75 61.0
(Heterozygous/ Wild Type) 16 13.0
(Homozygous/ Heterozygous) 1 0.8
(Wild Type/ Heterozygous) 25 20.3
(Heterozygous/ Heterozygous) 6 4.9
Total 123 100.0
4.3. Relationships
4.3.1. Relationship between CYP3A4 (c.522-191C>T) and muscle pain
The results show that 28 people from the study sample with Wild Type suffered from
muscle pain, (28.3%), and 71 (71.7%) did not. On the other hand, 20 people from the
study sample with a Heterozygous genotype suffered from muscle pain (87%) and
three (13%) did not, and the one homozygote patient suffered from muscle pain. The
distribution was statistically significant (P-value= 0.00, odds ratio for heterozygous =
16.9) as shown in table 4.9.
Table 4.9 Relationship between CYP3A4 (c.522-191C>T) genotype and muscle pain
CYP3A4 (c.522-
191C>T)
Muscle pain P
value*
odds
ratio 95% C.I.
No Yes
0.00 16.9
Lower Upper
Wild Type
Number
(Percent
(%))
71
(71.7%)
28
(28.3%)
4.65
61.40
Heterozygous 3
(13.0%)
20
(87.0%)
Homozygous 0
(0.0%)
1
(100.0%)
Total 74
(60.2%)
49
(39.8%)
*P-value of less than 0.05 was considered significant.
35
4.3.2. Relationship between SLCO1B1 (c.521T>C) and muscle pain
The results showed that 19 people from the study sample with Wild Type genotype
suffered from muscle pain (20.9%) and 72 (79.1%) did not. On the other hand, 30
people from the study sample with Heterozygous genotype suffered from muscle pain,
a rate of 93.8%, and 2 (6.3%) did not. the distribution was statistically significant (P-
value= 0.00, odds ratio for heterozygous = 56.8) as shown in table 4.10.
Table 4.10 Relationship between SLCO1B1 (c.521T>C) genotype and muscle pain
SLCO1B1 (c.521T>C ) Muscle pain
P
value*
odds
ratio 95% C.I.
No Yes
0.00 56.8
Lower Upper
Wild Type
Number
(Percent
(%))
72
(79.1%)
19
(20.9%)
12.45
259.37
Heterozygous
2
(6.3%)
30
(93.8%)
Total 74
(60.2%)
49
(39.8%)
*P-value of less than 0.05 was considered significant.
4.3.3. Relationship between the compound genotype of CYP3A4 (c.522-191C>T)
and SLCO1B1 (c.521T>C) and muscle pain
Table 4.11 illustrates the relationship between the five categories of CYP3A4 (c.522-
191C>T) and SLCO1B1 (C.521T>C) compound genotype and muscle pain.
The results showed that six from the Wild Type/Wild Type group suffered from
muscle pain, a rate of 8%, and 69 (92%) did not; 13 from the Heterozygous/Wild Type
group suffered from muscle pain, a rate of 81.3%, and 3 (18.8%) did not; one from the
Homozygous/Heterozygous group suffers from muscle pain, a rate of 100%; 23 from
the Wild Type/Heterozygous group suffered from muscle pain, a rate of 92%, and two
(8%) did not; and six from the Heterozygous/Heterozygous group suffered from
muscle pain, a rate of 100%. The distribution was statistically significant (P-value=
0.00).
36
Table 4.11 Relationship between CYP3A4 (c.522-191C>T) and SLCO1B1
(c.521T>C) compound genotype and muscle pain
CYP3A4 (c.522-191C>T) /
SLCO1B1 (c.521T>C)
Muscle pain P value*
No Yes
(Wild Type/Wild Type)
Number
(Percent
(%))
69 (92.0%) 6 (8.0%)
0.00
(Heterozygous/Wild Type) 3 (18.8%) 13 (81.3%)
(Homozygous/Heterozygous) 0 (0%) 1 (100%)
(Wild Type/Heterozygous) 2 (8.0%) 23 (92.0%)
(Heterozygous/Heterozygous) 0 (.0%) 6 (100.0%)
Total 74 (60.2%) 49 (39.8%)
*P-value of less than 0.05 was considered significant.
4.3.4. Relationship between lactate dehydrogenase level and muscle pain
When we studied the relationship between lactate dehydrogenase and muscle pain by
comparing the mean of its level we found a statistically significant relationship (P-
value= 0.00), as shown in table 4.5. The level of lactate dehydrogenase was higher in
patients with muscle pain than those without.
When we classified the results of the lactate dehydrogenase test into normal and
abnormal and performed a statistical analysis the results showed that 9 people from the
study sample with normal lactate dehydrogenase suffered from muscle pain, a rate of
15%, and 51 (85%) did not. In comparison, 40 people from the study sample with
abnormal lactate dehydrogenase suffered from muscle pain, a rate of 63.5%, and 23
(36.5%) did not. The relationship was statistically significant (P-value= 0.00), as
shown in table 4.12.
Table 4.12 Relationship between lactate dehydrogenase level (U/L) and muscle pain.
Lactate Dehydrogenase Muscle pain P value*
No Yes
0.00 Normal
Number
(Percent (%))
51 (85.0%) 9 (15.0%)
Abnormal 23 (36.5%) 40 (63.5%)
Total 74 (60.2%) 49 (39.8%)
*P-value of less than 0.05 was considered significant.
37
4.3.5. Relationship between creatine kinase level and muscle pain
By comparing the mean of creatine kinase level in relation to suffering from muscle
pain the mean difference was not statistically significant (P-value= 0.78), as shown in
table 4.5.
When the creatine kinase test results were classified into normal and abnormal, the
results showed that 16 people from the study sample with normal creatine kinase
suffered from muscle pain, a rate of 25.8%, and 46 (74.2%) did not. on the other hand,
33 people from the study sample with abnormal creatine kinase suffered from muscle
pain, a rate of 54.1%, and 28 (45.9%) did not. The relationship was statistically
significant (P-value= 0.001), as shown in table 4.13.
Table 4.13 Relationship between creatine kinase level (U/L) and muscle pain
Creatine Kinase Muscle pain P value*
No Yes
0.001 Normal
Number
(Percent (%))
46 (74.2%) 16 (25.8%)
Abnormal 28 (45.9%) 33 (54.1%)
Total 74 (60.2%) 49 (39.8%)
*P-value of less than 0.05 was considered significant.
4.3.6. Relationship between lactate dehydrogenase level and CYP3A4 (c.522-
191C>T) genotype
When we classified the results of lactate dehydrogenase test into normal and abnormal
and performed a statistical analysis the results showed that the relationship between
lactate dehydrogenase level and CYP3A4 (c.522-191C>T) genotype in patients who
suffered from muscle pain and those who didn’t was not statistically significant (P-
values = 0.235 and 0.210 respectively), as shown in table 4.14.
38
Table 4.14 Relationship between lactate dehydrogenase level (U/L) and CYP3A4
(c.522-191C>T) genotype
Muscle
pain CYP3A4 (c.522-191C>T)
Lactate Dehydrogenase P value*
Normal Abnormal
0.235 NO
WT.
Number
(Percent (%))
48 (67.6%) 23 (32.4%)
Hetero. 3 (100%) 0 (0%)
Total 51 (68.9%) 23 (31.1%)
YES
WT. 3 (10.7%) 25 (89.3%)
0.210 Hetero. 6 (30.0%) 14 (70.0%)
Homo. 0 (0%) 1 (100%)
Total 9 (18.4%) 40 (81.6%)
*P-value of less than 0.05 was considered significant.
4.3.7. Relationship between creatine kinase level and CYP3A4 (c.522-191C>T)
genotype
When the creatine kinase test results were classified into normal and abnormal, the
results showed that the relationship between creatine kinase level and CYP3A4 (c.522-
191C>T) genotype in patients who suffered from muscle pain was not statistically
significant (P-value= 0.552), but it was statistically significant (P-value= 0.023) in
patients who did not suffer from muscle pain, as shown in table 4.15.
Table 4.15 Relationship between creatine kinase level (U/L) and CYP3A4 (c.522-
191C>T)
Muscle
pain CYP3A4 (c.522-191C>T)
Creatine Kinase P value*
Normal Abnormal
0.023 NO
WT.
Number
(Percent (%))
46 (64.8%) 25 (35.2%)
Hetero. 0 (0%) 3 (100%)
Total 46 (62.2%) 28 (37.8%)
YES
WT. 8 (28.6%) 20 (71.4%)
0.552 Hetero. 8 (40.0%) 12 (60.0%)
Homo. 0 (0%) 1 (100%)
Total 16 (32.7%) 33 (67.3%)
*P-value of less than 0.05 was considered significant.
39
4.3.8. Relationship between lactate dehydrogenase level and SLCO1B1
(c.521T>C) genotype
When we classified the results of the lactate dehydrogenase level test into normal and
abnormal and performed a statistical analysis the results showed that the correlation
between lactate dehydrogenase and SLCO1B1 (c.521T>C) in patients who had muscle
pain was statistically significant (P-value= 0.050), but not statistically significant (P-
value= 0.336) in patients who did not have muscle pain, as shown in table 4.16.
Table 4.16 Relationship between lactate dehydrogenase level (U/L) and SLCO1B1
(c.521T>C) genotype
Muscle
pain SLCO1B1 (C.521T>C)
Lactate Dehydrogenase P value*
Normal Abnormal
0.336 NO
WT.
Number
(Percent (%))
49 (68.1%) 23 (31.9%)
Hetero. 2 (100%) 0 (0%)
Total 51 (68.9%) 23 (31.1%)
YES
WT. 6 (31.6%) 13 (68.4%)
0.050 Hetero. 3 (10.0%) 27 (90.0%)
Total 9 (18.4%) 40 (81.6%)
*P-value of less than 0.05 was considered significant.
4.3.9. Relationship between creatine kinase level and SLCO1B1 (c.521T>C)
genotype
When the creatine kinase test results were classified into normal and abnormal, the
results showed that the relationship between creatine kinase level and SLCO1B1
(c.521T>C) genotype was not statistically significant in patients who suffered from
muscle pain and those who did not (P-values = 0.719 and 0.261 respectively), as
shown in table 4.17.
40
Table 4.17 Relationship between creatine kinase level (U/L) and SLCO1B1
(C.521T>C)
Muscle
pain SLCO1B1 (C.521T>C)
Creatine Kinase P value*
Normal Abnormal
0.719 NO
WT.
Number
(Percent (%))
45 (62.5%) 27 (37.5%)
Hetero. 1 (50%) 1 (50%)
Total 46 (62.2%) 28 (37.8%)
YES
WT. 8 (42.1%) 11 (57.9%)
0.261 Hetero. 8 (26.7%) 22 (73.3%)
Total 16 (32.7%) 33 (67.3%)
*P-value of less than 0.05 was considered significant.
4.3.10. Relationship between the compound genotype of CYP3A4 (c.522-191C>T)
and SLCO1B1 (c.521T>C) and lactate dehydrogenase level
When we studied the relationship between the compound genotype of CYP3A4 (c.522-
191C>T) and SLCO1B1 (c.521T>C) and lactate dehydrogenase level by comparing
means the results revealed that the relationship was statistically significant (P-value=
0.005). As shown in table 4.18, the levels were highest in Heterozygous/Heterozygous
and Wild Type/Heterozygous genotype and lowest in Wild Type/Wild Type and
Heterozygous/Wild Type.
Table 4.18 Relationship between the compound genotype of CYP3A4 (c.522-191C>T)
and SLCO1B1 (c.521T>C) and lactate dehydrogenase level (U/L)
*P-value of less than 0.05 was considered significant.
CYP3A4 (c.522-191C>T) /
SLCO1B1 (c.521T>C) Mean
Std.
Deviation P value*
(Wild Type/Wild Type) 459.84 180.82
0.005
(Heterozygous/Wild Type) 450.62 154.78
(Homozygous/Heterozygous) 495.00 .
(Wild Type/Heterozygous) 616.60 241.98
(Heterozygous/Heterozygous) 630.00 232.92
Total 499.08 203.59
41
When the lactate dehydrogenase test results were classified into normal and abnormal,
the distribution was statistically significant (P-value=0.00). As shown in table 4.19,
most of the Heterozygous/Heterozygous and Wild Type/Heterozygous had abnormal
levels (83.3% and 84.0% respectively) compared to Wild Type/Wild Type and
Heterozygous/Wild Type (37.3% and 50% respectively).
Table 4.19 Relationship between the compound genotype of CYP3A4 (c.522-191C>T)
and SLCO1B1 (c.521T>C) and lactate dehydrogenase level (U/L)
CYP3A4 (c.522-191C>T) /
SLCO1B1 (C.521T>C)
Lactate Dehydrogenase P value*
Normal Abnormal
(Wild Type/Wild Type)
Number
(Percent (%))
47 (62.7%) 28 (37.3%)
0.000
(Heterozygous/Wild Type) 8 (50.0%) 8 (50.0%)
(Homozygous/Heterozygous) 0 (0%) 1 (100%)
(Wild Type/Heterozygous) 4 (16.0%) 21 (84.0%)
(Heterozygous/Heterozygous) 1 (16.7%) 5 (83.3%)
Total 60 (48.8%) 63 (51.2%)
*P-value of less than 0.05 was considered significant.
4.3.11. Relationship between the compound genotype of CYP3A4 (c.522-191C>T)
and SLCO1B1 (c.521T>C) and creatine kinase level
When we classified the results of the creatine kinase test into normal and abnormal and
performed a statistical analysis the results showed that the correlation between
compound genotype of CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C), and
creatine kinase was statistically significant (P-value=0.027). As shown in table 4.20
most of the Heterozygous/Heterozygous and Wild Type/Heterozygous had abnormal
levels (83.3% and 68% respectively) compared to Wild Type/Wild Type and
Heterozygous/Wild Type (38.7% and 56.3% respectively).
42
Table 4.20 Relationship between the compound genotype of CYP3A4 (c.522-191C>T)
and SLCO1B1 (c.521T>C), and creatine kinase level (U/L)
CYP3A4 (c.522-191C>T) /
SLCO1B1 (c.521T>C)
Creatine Kinase P value*
Normal Abnormal
(Wild Type / Wild Type)
Number
(Percent (%))
46 (61.3%) 29 (38.7%)
0.027
(Heterozygous/Wild Type) 7 (43.8%) 9 (56.3%)
(Homozygous/ Heterozygous) 0 (.0%) 1 (100%)
(Wild Type/ Heterozygous) 8 (32.0%) 17 (68.0%)
(Heterozygous/ Heterozygous) 1 (16.7%) 5 (83.3%)
Total 62 (50.4%) 61 (49.6%)
*P-value of less than 0.05 was considered significant.
43
CHAPTER 5
Discussion
Previous studies have indicated the existence of a relationship between SLCO1B1
(c.521T>C) and CYP3A4 (c.522-191C>T) and statin-induced myopathy. As most
patients in Gaza who have coronary heart disease take statin drug therapy to lower
their cholesterol levels, it is very important to determine the impact of the carriage of
SLCO1B1 (c.521T>C) and CYP3A4 (c.522-191C>T) on the risk of statin-induced
muscle pain, which is an early indicator of myopathy. This could allow the
development of appropriate interventions to prevent the development of myopathy in
these susceptible patients.
5.1. CYP3A4 (c.522-191C>T)
CYP3A4 (c.522-191C>T) frequency in the study sample was 99 Wild Type
constituting 80.5%, 23 Heterozygous constituting 18.7%, and 1 Homozygous
constituting 0.8%.
Allelic frequency calculations showed that the susceptibility allele (T) was 10.16 %,
which is higher than that reported by the National Center for Biotechnology
Information (NCBI) database of single nucleotide polymorphisms (dbSNP)
(MAF/MinorAlleleCount of 1.5% and average heterozygousoty of 3%)(NCBI 2014). It
is also higher than Caucasian (6.1%-8.3%) (Okubo at al. 2013), Japanese (5%–7%),
African Americans (4.3%), Chinese (4.3%), and Caucasians (8.3%) (Thompson et al.,
2004) Both alleles were within the Hardy-Weinberg Equilibrium Model (P-Value =
0.79).
No previous study in the reviewed literature has reported CYP3A4 (c.522-191C>T)
polymorphism frequency in the Arab population. This study thus contributes important
new data to the knowledge base, as well as to the management of Arab patients, whose
needs have now been demonstrated to be higher than those of other populations.
44
5.2. SLCO1B1 (c.521T>C)
SLCO1B1 (c.521T>C) frequency of the study sample was 91 Wild Type constituting
74%, and 32 Heterozygous constituting 26%.
The calculated allelic frequency of the susceptibility allele (C) was 13.01 % and the
Wild Type allele (T) was 86.99%. Both alleles are within the Hardy-Weinberg
Equilibrium Model (P-Value = 0.09).
SLCO1B1 (c.521T>C) frequency in this study falls in the middle compared to results
of previous studies: 24% in Native American populations, 20% in the Middle East,
18% in Europe, 12% in East Asia, 9.4% in Central/South Asia, 1.9% in Sub-Saharan
Africa, 15% in the Kerala population and 15-16% in populations of Caucasian decent
(Pasanen et al., 2008; Lakshmi et al., 2014; Santos et al., 2011; Donnelly et al.,
2011). A study of different ethnic groups in Brazil reported the allele to be present in
the highest numbers in American-Indians (28.3% heterozygous and 9.9% homozygous)
and lowest in African descent subjects (5.7% and 0%), in contrast to Mulatto (14.9%
and 2.4%) and Caucasian descent (14.8% and 4.1%) (Santos et al., 2011).
5.3. Muscle Pain and Myopathy
Of the 123 cardiac patients who were taking a statin drug and who were asked about
the presence of muscle pain and difficulty walking six months after initiating the drug,
49 people subsequently reported they have muscle pain (39.8%) while 74 did not
(60.2%).
Their muscle pain was confirmed by significant elevation of lactate dehydrogenase
level, a result that concords with those of Yousaf and Powell 2012, who found that
levels of lactate dehydrogenase are elevated in people with muscle pain. When the
relationship between lactate dehydrogenase and muscle pain was considered, the
results revealed a statistically significant elevation of mean lactate dehydrogenase level
among patients suffering from muscle pain compared to those who aren’t (P-value=
0.00). and when the results of the lactate dehydrogenase test were classified into
normal and abnormal and a statistical analysis performed, the results showed that the
45
relationship between lactate dehydrogenase and muscle pain was statistically
significant (P-value= 0.00).
The previously-reported relationship between myopathy and patient reports of muscle
pain and weakness (Thompson et al., 2003) combined with the results of this study, ie
reports of muscle pain and difficulty walking at six months after initiation of statin
therapy, suggest that the existence of these factors after statin therapy initiation may be
an early indication for myopathy, thus a sentinel event to consider treatment
modification.
5.4. Cholesterol Test and Muscle Pain
Cholesterol screening was conducted for all patients, and the results showed that the
mean level of cholesterol was not significantly different in patients who had muscle
pain and in those without muscle pain.
This result is to be expected because statin drugs are designed to lower cholesterol
levels, and after at least six months of therapy, the levels should be near normal. It
also confirms that the patients in the study had used the drug for a sufficient time.
5.5. CYP3A4 (c.522-191C>T) and Muscle Pain
The relation between CYP3A4 (c.522-191C>T) and muscle pain in this study was
statistically significant (P-value= 0.00). The majority of those carrying the
susceptibility T - allele (hetero- or homozygous) complained of muscle pain compared
to homozygous wild-type (odds ratio for heterozygous = 16.9).
Although this study did not measure statin plasma concentrations, the relationship
between genetic variation in CYP3A4, plasma statin concentrations and myopathy,
therefore muscle pain, has already been established. (Kitzmiller et al., 2014;
Thompson et al., 2003)
Genetic variation in CYP3A4 has been shown to be associated with plasma simvastatin
concentrations (Kitzmiller et al., 2014), and a previous study showed that increased
plasma concentrations of simvastatin significantly increased the risk of myopathy
46
(Thompson et al., 2003). Another previous study showed that the CYP3A4*22
polymorphism was associated with reduced CYP3A4 protein expression levels and
resulted in decreased CYP3A4-dependent activities in human livers which resulted in
increased plasma statin concentrations thus enhancing the risk of systemic adverse
effects, such as myopathy (Okubo et al., 2013).
5.6. SLCO1B1 (c.521T>C) and Muscle Pain
The correlation between SLCO1B1 (c.521T>C) and muscle pain in this study was
statistically significant (P-value= 0.00), and is compatible with previous studies that
indicated that the SLCO1B1 (c.521T>C) allele causes lower statin uptake in the liver,
and is a risk factor for statin-induced myopathy (Santos et al., 2011; Donnelly et al.,
2011). Moreover, Voora et al showed that SLCO1B1*5 genotype was associated with
statin-induced side effects (Voora et al., 2009).
Access into the liver is an important step in the elimination of many endogenous
compounds and xenobiotics, including most drugs. Statins exert their cholesterol-
lowering effects by inhibiting the HMG-CoA reductase in the hepatocytes. Therefore,
reduced OATP1B1-mediated uptake into the liver due to genetic polymorphism in the
encoding SLCO1B1 gene may both reduce statins efficacy and increase their
peripheral plasma concentrations, thus enhancing the risk of systemic adverse effects,
such as myopathy (Niemi et al., 2004). This supports our study’s findings of a
relationship between SLCO1B1 (c.521T>C) and muscle pain, a precursor to myopathy.
A further endorsement of the results is that the single-nucleotide polymorphism,
SLCO1B1 (c.521T>C) or rs4149056T>C, in SLCO1B1 as Ramsey terms it, increases
systemic exposure to simvastatin and the risk of muscle toxicity. (Ramsey et al., 2014)
5.7. Compound genotype of CYP3A4 (c.522-191C>T) and SLCO1B1
(c.521T>C) and Muscle Pain
The relationship between CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C) and
muscle pain in this study was statistically significant (P-value= 0.00). This is a
particularly important finding because previous researchers have only studied either
CYP3A4 (c.522-191C>T) alone, or SLCO1B1 (c.521T>C) alone.
47
All of the Heterozygous/Heterozygous (100%) and most of Wild Type/Heterozygous
and Heterozygous/Wild Type had muscle pain (92% and 81.3% respectively) reported
suffering from muscle pain compared to Wild Type/Wild Type (8%).
In heterozygous individuals with either CYP3A4 (c.522-191C>T) or SLCO1B1
(c.521T>C) the incidence of muscle pain is considerably elevated. However, the
presence of both in a heterozygous individual sees muscle pain reach 100%, suggesting
that these individuals are at extremely high risk.
However, there were only six Heterozygous/Heterozygous cases, which limits the
generalizability of the results.
5.8. Creatine Kinase and Muscle Pain
When we classified the results of the creatine kinase test into normal and abnormal and
performed a statistical analysis, the correlation between creatine kinase and muscle
pain was statistically significant (P-value= 0.00).
These results are compatible with previous studies indicating that statins can cause
muscle pain or weakness (myalgia), sometimes in association with elevated creatine
kinase (CK) levels, myopathy which may progress to muscle breakdown
(rhabdomyolysis), myoglobin release, renal failure and even death (Vaklavas et al.,
2008).
5.9. Lactate Dehydrogenase with CYP3A4 (c.522-191C>T), and
SLCO1B1 (c.521T>C)
When we classified the results of lactate dehydrogenase test into normal and abnormal
and performed a statistical analysis our results showed that the correlation between
lactate dehydrogenase level and CYP3A4 (c.522-191C>T) in patients who had muscle
pain and those who had not was not statistically significant (P-value= 0.235, P-value=
0.210) respectively.
This result was the opposite of the second gene (SLCO1B1 (c.521T>C)), which
showed that the relationship between lactate dehydrogenase and SLCO1B1
48
(c.521T>C) in patients with muscle pain was statistically significant (P-value= 0.050),
and was not statistically significant (P-value= 0.336) in patients who did not have
muscle pain.
In addition, the results showed that in patients who had muscle pain 90% of
heterozygotes for SLCO1B1 (c.521T>C) had abnormal lactate dehydrogenase,
compared to 68.4% of wild type patients (table 4.23).
This result shows that the presence of the allele SLCO1B1 (c.521T>C) in patients who
had muscle pain increased the level of lactate dehydrogenase and thus increased the
risk for myopathy.
5.10. Creatine Kinase with CYP3A4 (c.522-191C>T), and SLCO1B1
(c.521T>C)
The study results showed that the correlation between creatine kinase level and
CYP3A4 (c.522-191C>T) in patients who suffered from muscle pain was not
statistically significant (P-value= 0.552). However, it was statistically significant (P-
value= 0.023) in patients who did not suffer from muscle pain. The results of
correlation between creatine kinase and SLCO1B1 (c.521T>C) in patients who
suffered from muscle pain and those who did not was not statistically significant (P-
value= 0.719, P-value= 0.261) respectively.
The results also showed that in patients who had muscle pain 73.3% of heterozygotes
for SLCO1B1 (c.521T>C) had abnormal creatine kinase level, compared to 57.9% of
wild type patients (table 4.24).
These results, when considered together, show that the presence of the allele
SLCO1B1 (c.521T>C) in patients who had muscle pain increased the level of creatine
kinase and thus increased the risk of myopathy.
49
5.11. Compound Genotype of (CYP3A4 (c.522-191C>T) and
SLCO1B1 (c.521T>C)) and Lactate Dehydrogenase
The study results showed that the relationship between the compound genotype of
(CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C)) and lactate dehydrogenase
level was statistically significant (P-value= 0.00).
Most noteworthy is that 83.3% of study sample with heterozygousoty in the two genes
had abnormal lactate dehydrogenase levels, compared to 37.3% of study sample wild
type for the two genes had abnormal lactate dehydrogenase levels. Thus the presence
of compound heterozygosoty in an individual patient elevates the level of lactate
dehydrogenase which increases the risk of muscle pain and myopathy (table 4.26).
5.12. Compound Genotype of (CYP3A4 (c.522-191C>T) and
SLCO1B1 (c.521T>C)) and Creatine Kinase
The study results showed that the relationship between the compound genotype of
CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C) and creatine kinase level was
statistically significant (P-value= 0.027).
Again, 83.3% of the study sample with heterozygousoty in the two genes had abnormal
levels of lactate dehydrogenase, while 38.7% with wild type in the two genes had
abnormal lactate dehydrogenase levels. Thus, the presence of compound heterozygosis
elevates the level of creatine kinase, which increases the risk of muscle pain and
myopathy (table 4.27).
50
CHAPTER 6
Conclusions and Recommendations
6.1. Conclusions
This study made two new and unique contributions to the current body of scientific
knowledge: the higher frequency of CYP3A4 (c.522-191C>T) in the Arab population;
and the cumulative effect of the presence of both CYP3A4 (c.522-191C>T) and
SLCO1B1 (c.521T>C).
It also clearly demonstrated that independently of each other, there is a statistically
significant relationship between the presence of CYP3A4 (c.522-191C>T) and muscle
pain, and between SLCO1B1 (c.521T>C) and muscle pain, an established precursor to
myopathy.
In terms of relative importance, the study showed that SLCO1B1 (c.521T>C) is more
important than CYP3A4 (c.522-191C>T), as the presence of SLCO1B1 (c.521T>C)
increased the level of lactate dehydrogenase and creatine kinase, elevated levels of
which are found in those suffering from muscle pain.
While the OR of 16.9 for the presence of CYP3A4 (c.522-191C>T) will be of some
concern to clinical decision-makers, the OR of 56.8 for SLCO1B1 (c.521T>C) is of
considerable interest and importance for medical management.
Further, in the presence of both CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C),
the relationship between the presence of the SNPs and muscle pain reached 100%, a
result so high that it would be clinically negligent not to consider it when making
treatment decisions for these patients. However, as there were only six
Heterozygous/Heterozygous cases, the generalizability of the results is somewhat
limited. Further research with a larger sample size is therefore recommended to
confirm these results.
51
6.2. Recommendations
Considering the above factors together with the higher frequency of CYP3A4 (c.522-
191C>T) in the Arab population revealed by this study, we can conclude that Gazan
patients taking statins are at a considerably higher risk of developing muscle pain thus
possibly myopathy, and every effort should be made to reduce this risk.
Genotyping for this polymorphism prior to initiating statin therapy is therefore
recommended as an important clinical tool in preventing this irreversible muscle
damage in cardiac patients in the Gaza Strip.
When either SLCO1B1 (c.521T>C) or CYP3A4 (c.522-191C>T) are found, but
especially when both are present, consideration should be given to prescribing lower
doses of statins, or prescribing alternative cholesterol-lowering medications.
If statins are favored, these patients should be closely and continuously monitored for
muscle pain, and alternative interventions implemented at the earliest opportunity.
52
References
Abe T, Kakyo M, Tokui T, Nakagomi R, Nishio T, Nakai D, Nomura H, Unno M, Suzuki M,
Naitoh T, Matsuno S, Yawo H, (1999). Identification of a novel gene family encoding human liver-
specific organic anion transporter LST-1. J Biol Chem 274:17159-63.
Armitage J. (2007). The safety of statins in clinical practice. Lancet 370:1781-90.
Åsberg A, Hartmann A, Fjeldsa E, Bergan S, Holdaas H. (2001). Bilateral pharmacokinetic
interaction between cyclosporine A and atorvastatin in renal transplant recipients. Am J Transplant
1:382-6.
Backman JT, Kyrklund C, Kivistö KT, Wang JS, Neuvonen PJ, (2000). Plasma concentrations of
active simvastatin acid are increased by gemfibrozil. Clin Pharmacol Ther 68:122-9.
Backman JT, Luurila H, Neuvonen M, Neuvonen PJ, (2005). Rifampin markedly decreases and
gemfibrozil increases the plasma concentrations of atorvastatin and its metabolites. Clin Pharmacol
Ther 78:154-67.
Baigent C, Keech A, Kearney PM, Blackwell L, Buck G, Pollicino C, Kirby A, Sourjina T, Peto R,
Collins R, Simes R, (2005). Efficacy and safety of cholesterol-lowering treatment: prospective meta-
analysis of data from 90,056 participants in 14 randomised trials of statins. Lancet 366:1267-78.
Beyer RE. (1992). An analysis of the role of coenzyme Q in free radical generation and as an
antioxidant. Biochem Cell Biol 70:390-403.
Bradford RH, Shear CL, Chremos AN, Dujovne C, Downton M, Franklin FA, Gould AL, Hesney
M, Higgins J, Hurley DP, et al., (1991). Expanded Clinical Evaluation of Lovastatin (EXCEL) study
results. I.Efficacy in modifying plasma lipoproteins and adverse event profile in 8245 patients with
moderate hypercholesterolemia. Arch Intern Med 151:43-9.
Brown MS, Goldstein JL. (1986). A receptor-mediated pathway for cholesterol homeostasis. Science
232:34-47.
Bruckert E, Hayem G, Dejager S, Yau C, Begaud B. (2005). Mild to moderate muscular symptoms
with highdosage statin therapy in hyperlipidemic patients--the PRIMO study. Cardiovasc Drugs Ther
19:403-14.
Chang C, Pang KS, Swaan PW, Ekins S. (2005). Comparative pharmacophore modeling of organic
anion transporting polypeptides: a meta-analysis of rat Oatp1a1 and human OATP1B1. J Pharmacol
Exp Ther 314:533-41.
Chen C, Mireles RJ, Campbell SD, Lin J, Mills JB, Xu JJ, Smolarek TA. (2005). Differential
interaction of 3-hydroxy-3-methylglutaryl-coa reductase inhibitors with ABCB1, ABCC2, and
OATP1B1. Drug Metab Dispos 33:537-46.
Chorley BN, Wang X, Campbell MR, Pittman GS, Noureddine MA, Bell DA. (2008). Discovery and
verification of functional single nucleotide polymorphisms in regulatory genomic regions: current and
developing technologies. Mutat Res 659:147-57.
Chung JY, Cho JY, Yu KS, Kim JR, Oh DS, Jung HR, Lim KS, Moon KH, Shin SG, Jang IJ,
(2005). Effect of OATP1B1 (SLCO1B1) variant alleles on the pharmacokinetics of pitavastatin in
healthy volunteers. Clin Pharmacol Ther 78:342-50.
Collins FS, Brooks LD, Chakravarti A. (1998). A DNA polymorphism discovery resource for research
on human genetic variation. Genome Res 8:1229-31.
Daly AK. (2003). Pharmacogenetics of the major polymorphic metabolizing enzymes. Fundam Clin
Pharmacol 17:27-41.
53
Danielson PB. (2002). The cytochrome P450 superfamily: biochemistry, evolution and drug metabolism
in humans. Curr Drug Metab 3:561–597.
Dirks AJ, Jones KM. (2006). Statin-induced apoptosis and skeletal myopathy. Am J Physiol Cell
Physiol 291:C1208-12.
Donnelly LA, Doney AS, Tavendale R, Lang CC, Pearson ER, Colhoun HM, et al., (2011). Common nonsynonymous substitutions in SLCO1B1 predispose to statin intolerance in routinely treated
individuals with type 2 diabetes: Ago-DARTS study. Clin Pharmacol Ther. 89:210–6.
Dromer C, Vedrenne C, Billey T, Pages M, Fournie B, Fournie A. (1992). Rhabdomyolysis due to
simvastin. Apropos of a case with review of the literature. Rev Rhum Mal Osteoartic 59:281-3.
Dujovne CA, Chremos AN, Pool JL, Schnaper H, Bradford RH, Shear CL, Higgins J, Downton M,
Franklin FA, Nash DT, et al., (1991). Expanded clinical evaluation of lovastatin (EXCEL) study
results: IV. Additional perspectives on the tolerability of lovastatin. Am J Med 91:25S-30S.
Glaeser H, Bailey DG, Dresser GK, Gregor JC, Schwarz UI, McGrath JS, Jolicoeur E, Lee W,
Leake BF, Tirona RG, Kim RB. (2007). Intestinal drug transporter expression and the impact of
grapefruit juice in humans. Clin Pharmacol Ther 81:362-70.
Gradhand U, Kim RB.(2008). Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP
(ABCG2). Drug Metab Rev 40:317-54.
Graham DJ, Staffa JA, Shatin D, Andrade SE, Schech SD, La Grenade L, Gurwitz JH, Chan KA,
Goodman MJ, Platt R. (2004). Incidence of hospitalized rhabdomyolysis in patients treated with lipid-
lowering drugs. Jama 292:2585-90.
Gylling H, Miettinen TA. (1992). Cholesterol absorption and synthesis related to low density
lipoprotein metabolism during varying cholesterol intake in men with different apoE phenotypes. J Lipid
Re 33:1361-71.
Hagenbuch B, Meier PJ. (2004). Organic anion transporting polypeptides of the OATP/ SLC21 family:
phylogenetic classification as OATP/ SLCO superfamily, new nomenclature and molecular/functional
properties. Pflugers Arch 447:653-65.
Hamelin BA, Turgeon J. (1998). Hydrophilicity/lipophilicity: relevance for the pharmacology and
clinical effects of HMG-CoA reductase inhibitors. Trends Pharmacol Sci 19:26-37.
Hashimoto H, Toide K, Kitamura R, Fujita M, Tagawa S, Itoh S, Kamataki T. (1993). Gene
structure of CYP3A4, an adult-specific form of cytochrome P450 in human livers, and its transcriptional
control. Eur J Biochem. 218(2):585-95.
Heart Protection Study Collaborative Group. (2002). MRC/BHF Heart Protection Study of
cholesterol lowering with simvastatin in 20,536 high-risk individuals: a randomised placebo-controlled
trial. Lancet 360:7-22.
Hediger MA, Romero MF, Peng JB, Rolfs A, Takanaga H, Bruford EA. (2004). The ABCs of solute
carriers: physiological, pathological and therapeutic implications of human membrane transport
proteinsIntroduction. Pflugers Arch 447:465-8.
Hermann M, Asberg A, Christensen H, Holdaas H, Hartmann A, Reubsaet JL. (2004). Substantially elevated levels of atorvastatin and metabolites in cyclosporine-treated renal transplant
recipients. Clin Pharmacol Ther 76:388-91.
Ho RH, Kim RB. (2005). Transporters and drug therapy: implications for drug disposition and
disease. Clin Pharmacol Ther 78:260-77.
54
Hsiang B, Zhu Y, Wang Z, Wu Y, Sasseville V, Yang WP, Kirchgessner TG. (1999). A novel human
hepatic organic anion transporting polypeptide (OATP2). Identification of a liver-specific human
organic anion transporting polypeptide and identification of rat and human hydroxymethylglutaryl-CoA
reductase inhibitor transporters. J Biol Chem 274:37161-8.
Igel M, Sudhop T, von Bergmann K. (2002). Pharmacology of 3-hydroxy-3-methylglutaryl-coenzyme
A reductase inhibitors (statins), including rosuvastatin and pitavastatin. J Clin Pharmacol 42:835-45.
Igel M, Arnold KA, Niemi M, Hofmann U, Schwab M, Lütjohann D, von Bergmann K,
Eichelbaum M, Kivistö KT. (2006). Impact of the SLCO1B1 polymorphism on the pharmacokinetics
and lipidlowering efficacy of multiple-dose pravastatin. Clin Pharmacol Ther 79:419-26.
Inoue K, Inazawa J, Nakagawa H, Shimada T, Yamazaki H, Guengerich FP, Abe T. (1992). Assignment of the human cytochrome P-450 nifedipine oxidase gene (CYP3A4) to chromosome 7 at
band q22.1 by fluorescence in situ hybridization. Jpn J Hum Genet. 37(2):133-8.
Istvan ES, Deisenhofer J. (2001). Structural mechanism for statin inhibition of HMG-CoA reductase.
Science 292:1160-4.
Iwai M, Suzuki H, Ieiri I, Otsubo K, Sugiyama Y. (2004). Functional analysis of single nucleotide
polymorphisms of hepatic organic anion transporter OATP1B1 (OATP-C). Pharmacogenetics 14:749-
57.
Jada SR, Xiaochen S, Yan LY, Xiaoqiang X, Lal S, Zhou SF, Ooi LL, Chowbay B. (2007).
Pharmacogenetics of SLCO1B1: haplotypes, htSNPs and hepatic expression in three distinct Asian
populations. Eur J Clin Pharmacol 63:555-63.
Jones PH, Davidson MH, Stein EA, Bays HE, McKenney JM, Miller E, et al., (2003). Comparison
of the efficacy and safety of rosuvastatin versus atorvastatin, simvastatin, and pravastatin across doses
(STELLAR* Trial). Am J Cardiol 92:152–160.
Josephy DP, Guengerich PF, Miners JO. (2005). "Phase I and Phase II" drug metabolism:
terminology that we should phase out? Drug Metab Rev 37:575-80.
Kameyama Y, Yamashita K, Kobayashi K, Hosokawa M, Chiba K. (2005). Functional
characterization of SLCO1B1 (OATP-C) variants, SLCO1B1*5, SLCO1B1*15 and
SLCO1B1*15+C1007G, by using transient expression systems of HeLa and HEK293 cells.
Pharmacogenet Genomics 15:513-22.
Kantola T, Kivistö KT, Neuvonen PJ. (1998). Effect of itraconazole on the pharmacokinetics of
atorvastatin. Clin Pharmacol Ther 64:58-65.
Kitzmiller JP, Luzum JA, Baldassarre D, Krauss RM, Medina MW. (2014).CYP3A4*22 and
CYP3A5*3 are associated with increased levels of plasma simvastatin concentrations in the cholesterol
and pharmacogenetics study cohort. Pharmacogenetics and genomics, 24(10):486-91.
Kivistö KT, Bookjans G, Fromm MF, Griese EU, Münzel P, Kroemer HK. (1996a). Expression of
CYP3A4, CYP3A5 and CYP3A7 in human duodenal tissue. Br J Clin Pharmacol 42:387-9.
Kivistö KT, Griese EU, Fritz P, Linder A, Hakkola J, Raunio H, Beaune P, Kroemer HK. (1996b).
Expression of cytochrome P 450 3A enzymes in human lung: a combined RT-PCR and
immunohistochemical analysis of normal tissue and lung tumours. Naunyn Schmiedebergs Arch
Pharmacol 353:207-12.
Kreisberg RA, Oberman A. (2002). Clinical review 141: lipids and atherosclerosis: lessons learned
from randomized controlled trials of lipid lowering and other relevant studies. J Clin Endocrinol Metab
87:423-37.
Krishna DR, Klotz U. (1994). Extrahepatic metabolism of drugs in humans. Clin Pharmacokinet
26:144-60.
55
König J, Cui Y, Nies AT, Keppler D. (2000). A novel human organic anion transporting polypeptide
localized to the basolateral hepatocyte membrane. Am J Physiol Gastrointest Liver Physiol 278:G156-
64.
König J, Seithel A, Gradhand U, Fromm MF. (2006). Pharmacogenomics of human OATP
transporters. Naunyn Schmiedebergs Arch Pharmacol 372:432-43.
Laaksonen R. (2006). On the mechanisms of statin-induced myopathy. Clin Pharmacol Ther 79:529-31.
Lakshmi Mahadevan, Ancy Yesudas, P. K. Sajesh, S. Revu, Prasanna Kumar, Devi Santhosh, Sam
Santhosh, J. M. Sashikumar, V. K. Gopalakrishnan, Joji Boben, and Changanamkandath R.
(2014). Prevalence of genetic variants associated with cardiovascular disease risk and drug response in
the Southern Indian population of Kerala. Indian J Hum Genet. 20(2): 175–184. Lamba JK, Lin YS, Schuetz EG, Thummel KE. (2002). Genetic contribution to variable human
CYP3Amediated metabolism. Adv Drug Deliv Rev 54:1271-94.
LaRosa JC, He J, Vupputuri S. (1999). Effect of statins on risk of coronary disease: a meta-analysis of
randomized controlled trials. Jama 282:2340-6.
Lau YY, Huang Y, Frassetto L, Benet LZ. (2006). Effect of OATP1B Transporter Inhibition on the
Pharmacokinetics of Atorvastatin in Healthy Volunteers. Clin Pharmacol Ther 81(2):194-204
Lau YY, Huang Y, Frassetto L, Benet LZ. (2007). Effect of OATP1B transporter inhibition on the
pharmacokinetics of atorvastatin in healthy volunteers. Clin Pharmacol Ther 81:194-204.
Law M, Rudnicka AR. (2006). Statin safety: a systematic review. Am J Cardiol 97:52C-60C.
Law MR, Wald NJ, Rudnicka AR. (2003). Quantifying effect of statins on low density lipoprotein
cholesterol, ischaemic heart disease, and stroke: systematic review and meta-analysis. Bmj 326:1423.
Lee E, Ryan S, Birmingham B, Zalikowski J, March R, Ambrose H, Moore R, Lee C, Chen Y,
Schneck D. (2005a). Rosuvastatin pharmacokinetics and pharmacogenetics in white and Asian subjects
residing in the same environment. Clin Pharmacol Ther 78:330-41.
Lennernäs H, Fager G. (1997). Pharmacodynamics and pharmacokinetics of the HMG-CoA reductase
inhibitors. Similarities and differences. Clin Pharmacokinet 32:403-25.
Lewis DF. (2004). 57 varieties: the human cytochromes P450. Pharmacogenomics 5:305-18.
Liao JK. (2002). Beyond lipid lowering: the role of statins in vascular protection. Int J Cardiol 86:5-18.
Littarru GP, Langsjoen P. (2007). Coenzyme Q10 and statins: biochemical and clinical implications.
Mitochondrion 7 Suppl:S168-74.
Maeda K, Ieiri I, Yasuda K, Fujino A, Fujiwara H, Otsubo K, Hirano M, Watanabe T, Kitamura
Y, Kusuhara H, Sugiyama Y. (2006). Effects of organic anion transporting polypeptide 1B1 haplotype
on pharmacokinetics of pravastatin, valsartan, and temocapril. Clin Pharmacol Ther 79:427-39.
Maron DJ, Fazio S, Linton MF. (2000). Current perspectives on statins. Circulation 101:207-13.
Martini C, Pallottini V. (2007). Cholesterol: from feeding to gene regulation. Genes Nutr 2:181-93.
Molowa DT, Schuetz EG, Wrighton SA, Watkins PB, Kremers P, Mendez-Picon G, Parker GA,
Guzelian PS. (1986). Complete cDNA sequence of a cytochrome P-450 inducible by glucocorticoids in
human liver. Proc Natl Acad Sci U S A. 83(14):5311-5.
Morimoto K, Oishi T, Ueda S, Ueda M, Hosokawa M, Chiba K. (2004). A novel variant allele of
OATP-C (SLCO1B1) found in a Japanese patient with pravastatin-induced myopathy. Drug Metab
Pharmacokinet 19:453-5.
56
Morimoto K, Ueda S, Seki N, Igawa Y, Kameyama Y, Shimizu A, Oishi T, Hosokawa M, Iesato K,
Mori S, Saito Y, Chiba K. (2005). OATP-C(OATP01B1)*15 is associated with statin-induced
myopathy in hypercholesterolemic patients. Clin Pharmacol Ther 77:21.
Mwinyi J, Johne A, Bauer S, Roots I, Gerloff T. (2004). Evidence for inverse effects of OATP-C
(SLC21A6) 5 and 1b haplotypes on pravastatin kinetics. Clin Pharmacol Ther 75:415-21.
Mwinyi J, Kopke K, Schaefer M, Roots I, Gerloff T. (2008). Comparison of SLCO1B1 sequence
variability among German, Turkish, and African populations. Eur J Clin Pharmacol 64:257-66.
Nebert DW, Russell DW. (2002). Clinical importance of the cytochromes P450. Lancet 360:1155-62.
National Center for Biotechnology Information. (2014). Database of single nuclioide polymorphisms. (http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35599367 (accessed on 5 December 2014)).
Neuvonen PJ, Kantola T, Kivistö KT. (1998). Simvastatin but not pravastatin is very susceptible to
interaction with the CYP3A4 inhibitor itraconazole. Clin Pharmacol Ther 63:332-41.
Neuvonen PJ, Niemi M, Backman JT. (2006). Drug interactions with lipid-lowering drugs:
mechanisms and clinical relevance. Clin Pharmacol Ther 80:565-81.
Niemi M, Schaeffeler E, Lang T, Fromm MF, Neuvonen M, Kyrklund C, Backman JT, Kerb R,
Schwab M, Neuvonen PJ, Eichelbaum M, Kivistö KT. (2004). High plasma pravastatin
concentrations are associated with single nucleotide polymorphisms and haplotypes of organic anion
transporting polypeptide-C (OATP-C, SLCO1B1). Pharmacogenetics 14:429-40.
Niemi M, Backman JT, Kajosaari LI, Leathart JB, Neuvonen M, Daly AK, Eichelbaum M, Kivistö
KT, Neuvonen PJ. (2005a). Polymorphic organic anion transporting polypeptide 1B1 is a major
determinant of repaglinide pharmacokinetics. Clin Pharmacol Ther 77:468-78.
Niemi M, Kivistö KT, Hofmann U, Schwab M, Eichelbaum M, Fromm MF. (2005b). Fexofenadine
pharmacokinetics are associated with a polymorphism of the SLCO1B1 gene (encoding OATP1B1). Br J
Clin Pharmacol 59:602-4.
Niemi M, Neuvonen PJ, Hofmann U, Backman JT, Schwab M, Lütjohann D, von Bergmann K,
Eichelbaum M, Kivistö KT. (2005c). Acute effects of pravastatin on cholesterol synthesis are
associated with SLCO1B1 (encoding OATP1B1) haplotype *17. Pharmacogenet Genomics 15:303-9.
Niemi M. (2007). Role of OATP transporters in the disposition of drugs. Pharmacogenomics 8:787-802.
Niemi M, Pasanen MK, Neuvonen PJ. (2011). Organic anion transporting polypeptide 1B1: A
genetically polymorphic transporter of major importance for hepatic drug uptake. Pharmacol Rev.
63:157–81.
Nishizato Y, Ieiri I, Suzuki H, Kimura M, Kawabata K, Hirota T, Takane H, Irie S, Kusuhara H,
Niwa T, Yabusaki Y, Honma K, Matsuo N, Tatsuta K, Ishibashi F, Katagiri M. (1998). Contribution of human hepatic cytochrome P450 isoforms to regioselective hydroxylation of steroid
hormones. Xenobiotica. 28(6):539-47.
Nozawa T, Nakajima M, Tamai I, Noda K, Nezu J, Sai Y, Tsuji A, Yokoi T. (2002). Genetic
polymorphisms of human organic anion transporters OATP-C (SLC21A6) and OATP-B (SLC21A9):
allele frequencies in the Japanese population and functional analysis. J Pharmacol Exp Ther 302:804-
13.
Nozawa T, Minami H, Sugiura S, Tsuji A, Tamai I. (2005). Role of organic anion transporter
OATP1B1 (OATP-C) in hepatic uptake of irinotecan and its active metabolite, 7-ethyl-10-
hydroxycamptothecin: in vitro evidence and effect of single nucleotide polymorphisms. Drug Metab
Dispos 33:434-9.
57
Okubo M, Murayama N, Shimizu M, Shimada T, Guengerich FP, Yamazaki H. (2013). The
CYP3A4 intron 6 C.T polymorphism (CYP3A4*22) is associated with reduced CYP3A4 protein level and
function in human 8kliver microsomes. J Toxicol Sci. 38(3):349–354.
Ozdemir O, Boran M, Gokce V, Uzun Y, Kocak B, Korkmaz S. (2000). A case with severe
rhabdomyolysis and renal failure associated with cerivastatin-gemfibrozil combination therapy — a
case report. Angiology 51:695-7
Pasanen MK, Neuvonen PJ, Niemi M. (2008). Global analysis of genetic variation in SLCO1B1. Pharmacogenomics 9:19-33.
Pasternak RC, Smith SC, Jr, Bairey-Merz CN, Grundy SM, Cleeman JI, Lenfant C. (2002).
ACC/AHA/NHLBI Clinical Advisory on the Use and Safety of Statins. Circulation 106:1024-8.
Phillips PS, Haas RH, Bannykh S, Hathaway S, Gray NL, Kimura BJ, Vladutiu GD, England JD.
(2002). Statin-associated myopathy with normal creatine kinase levels. Ann Intern Med 137:581-5.
Prueksaritanont T, Subramanian R, Fang X, Ma B, Qiu Y, Lin JH, Pearson PG, Baillie TA.
(2002). Glucuronidation of statins in animals and humans: a novel mechanism of statin lactonization.
Drug Metab Dispos 30:505-12.
Prueksaritanont T, Ma B, Yu N. (2003). The human hepatic metabolism of simvastatin hydroxy acid is
mediated primarily by CYP3A, and not CYP2D6. Br J Clin Pharmacol 56:120-4.
Päivä H, Thelen KM, Van Coster R, Smet J, De Paepe B, Mattila KM, Laakso J, Lehtimäki T, von
Bergmann K, Lütjohann D, Laaksonen R. (2005). High-dose statins and skeletal muscle metabolism
in humans: a randomized, controlled trial. Clin Pharmacol Ther 78:60-8.
Ramsey Laura B, Johnson Samuel G, Caudle Kelly E, Haidar Cyrine E, Voora Deepak, Wilke
Russell A, Maxwell Whitney D, McLeod Howard L, Krauss Ronald et all. (2014). The Clinical
Pharmacogenetics Implementation Consortium guideline for SLCO1B1 and simvastatin-induced
myopathy. Clin Pharmacol Ther 96(4): 423–428
Rosenson RS, Lowe GD. (1998). Effects of lipids and lipoproteins on thrombosis and rheology. Atherosclerosis 140:271-80.
Rowland M, Tozer TN. (1995). Clinical Pharmacokinetics: concepts and applications. Baltimore:
Williams & Wilkins.
Sacks FM, Pfeffer MA, Moye LA, Rouleau JL, Rutherford JD, Cole TG, Brown L, Warnica JW,
Arnold JM, Wun CC, Davis BR, Braunwald E. (1996). The effect of pravastatin on coronary events
after myocardial infarction in patients with average cholesterol levels. Cholesterol and Recurrent
Events Trial investigators. N Engl J Med 335:1001-9.
Santos PC, Soares RA, Nascimento RM, Machado-Coelho GL, Mill JG, Krieger JE, et al., (2011). SLCO1B1 rs4149056 polymorphism associated with statin-induced myopathy is differently distributed
according to ethnicity in the Brazilian general population: Amerindians as a high risk ethnic group. BMC Med Genet 12:136.
Scandinavian Simvastatin Survival Study Group. (1994). Randomised trial of cholesterol lowering in
4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). Lancet
344:1383-9.
Schachter M. (2005). Chemical, pharmacokinetic and pharmacodynamic properties of statins: an
update. Fundam Clin Pharmacol 19:117-25.
Schick BA, Laaksonen R, Frohlich JJ, Päivä H, Lehtimäki T, Humphries KH, Cote HC. (2007). Decreased skeletal muscle mitochondrial DNA in patients treated with high-dose simvastatin. Clin
Pharmacol Ther 81:650-3.
58
Schwartz GG, Olsson AG, Ezekowitz MD, Ganz P, Oliver MF, Waters D, et al., (2001). Effects of
atorvastatin on early recurrent ischemic events in acute coronary syndromes: the MIRACL study: a
randomized controlled trial. JAMA 285:1711-8.
SEARCH Collaborative Group. (2008). SLCO1B1 Variants and Statin-Induced Myopathy -- A
Genomewide Study. N Engl J Med 359:789–99.
Seithel A, Glaeser H, Fromm MF, König J. (2008). The functional consequences of genetic variations
in transporter genes encoding human organic anion-transporting polypeptide family members. Expert
Opin Drug Metab Toxicol 4:51-64.
Shen DD, Kunze KL, Thummel KE. (1997). Enzyme-catalyzed processes of first-pass hepatic and
intestinal drug extraction. Adv Drug Deliv Rev 27:99-127.
Shepherd J, Cobbe SM, Ford I, Isles CG, Lorimer AR, MacFarlane PW, McKillop JH, Packard
CJ. (1995). Prevention of coronary heart disease with pravastatin in men with hypercholesterolemia.
West of Scotland Coronary Prevention Study Group. N Engl J Med 333:1301-7.
Shitara Y, Horie T, Sugiyama Y. (2006). Transporters as a determinant of drug clearance and tissue
distribution. Eur J Pharm Sci 27:425-46.
Shitara Y, Sugiyama Y. (2006). Pharmacokinetic and pharmacodynamic alterations of 3-hydroxy-3-
methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors: drug-drug interactions and
interindividual differences in transporter and metabolic enzyme functions. Pharmacol Ther 112:71-105.
Shou M, Korzekwa KR, Brooks EN, Krausz KW, Gonzalez FJ, Gelboin HV. (1997). Role of human
hepatic cytochrome P450 1A2 and 3A4 in the metabolic activation of estrone. Carcinogenesis 18(1):207-
14.
Tachibana-Iimori R, Tabara Y, Kusuhara H, Kohara K, Kawamoto R, Nakura J, Tokunaga K,
Kondo I, Sugiyama Y, Miki T. (2004). Effect of genetic polymorphism of OATP-C (SLCO1B1) on
lipidlowering response to HMG-CoA reductase inhibitors. Drug Metab Pharmacokinet 19:375-80.
Tanihara Y, Masuda S, Sato T, Katsura T, Ogawa O, Inui K. (2007). Substrate specificity of MATE1
and MATE2-K, human multidrug and toxin extrusions/H(+)-organic cation antiporters. Biochem
Pharmacol 74:359-71.
The changing face of heart disease and stroke in Canada 2000. Executive summary. Ottawa: Health
Canada. Available: www.hc-sc.gc.ca/hpb/lcdc/bcrdd /hdsc2000/index.html. Accessed Aug. 31, 2001.
Thompson PD, Clarkson P, Karas RH. (2003). Statin-associated myopathy. Jama 289:1681-90.
Thompson EE, Kuttab-Boulos H, Witonsky D, Yang L, Roe BA, Di Rienzo A. (2004). CYP3A
variation and the evolution of salt-sensitivity variants. Am J Hum Genet. 75:1059–1069.
Tirona RG, Leake BF, Merino G, Kim RB. (2001). Polymorphisms in OATP-C: identification of
multiple allelic variants associated with altered transport activity among European- and African-
Americans. J Biol Chem 276:35669-75.
Tirona RG, Leake BF, Wolkoff AW, Kim RB. (2003). Human organic anion transporting
polypeptide-C (SLC21A6) is a major determinant of rifampin-mediated pregnane X receptor activation.
J Pharmacol Exp Ther 304:223-8.
Urasaki Y, Urae A, Higuchi S, Otsubo K, Sugiyama Y. (2003). Polymorphisms of OATP-C
(SLC21A6) and OAT3 (SLC22A8) genes: consequences for pravastatin pharmacokinetics. Clin
Pharmacol Ther 73:554-65.
Vaklavas C, Chatzizisis YS, Ziakas A, Zamboulis C, Giannoglou GD. (2008). Molecular basis of
statinassociated myopathy. Atherosclerosis 202(1):18-28.
59
Voora D, Shah SH, Spasojevic I, Ali S, Reed CR, Salisbury BA, Ginsburg GS. (2009). The
SLCO1B1*5 genetic variant is associated with statin-induced side effects. J Am Coll Cardiol.
54(17):1609-16.
Vavricka SR, Van Montfoort J, Ha HR, Meier PJ, Fattinger K. (2002). Interactions of rifamycin SV
and rifampicin with organic anion uptake systems of human liver. Hepatology 36:164-72.
Vickers S, Duncan CA, Chen IW, Rosegay A, Duggan DE. (1990). Metabolic disposition studies on
simvastatin, a cholesterol-lowering prodrug. Drug Metab Dispos 18:138-45.
Wang D, Guo Y, Wrighton SA, Cooke GE, Sadee W. (2011). Intronic polymorphism in CYP3A4
affects hepatic expression and response to statin drugs. Pharmacogenomics J. 11:274–286.
Westlind-Johnsson A, Malmebo S, Johansson A, Otter C, Andersson TB, Johansson I, et al.,
(2003). Comparative analysis of CYP3A expression in human liver suggests only a minor role for
CYP3A5 in drug metabolism. Drug Metab Dispos 31:755–761.
Wrighton SA, Stevens JC. (1992). The human hepatic cytochromes P450 involved in drug metabolism.
Crit Rev Toxicol 22:1-21.
Wrighton SA, Schuetz EG, Thummel KE, Shen DD, Korzekwa KR, Watkins PB. (2000). The
human CYP3A subfamily: practical considerations. Drug Metab Rev 32:339-61.
Yousaf M. and Powell M. (2012). The Effects of Heart and Skeletal Muscle Inflammation and
Cardiomyopathy Syndrome on Creatine Kinase and Lactate Dehydrogenase Levels in Atlantic Salmon
(Salmo salar). Scientific World Journal 741302.
Zair ZM, Eloranta JJ, Stieger B, Kullak-Ublick GA. (2008). Pharmacogenetics of OATP
(SLC21/SLCO), OAT and OCT (SLC22) and PEPT (SLC15) transporters in the intestine, liver and
kidney. Pharmacogenomics 9:597-624.
Zhang W, He YJ, Gan Z, Fan L, Li Q, Wang A, Liu ZQ, Deng S, Huang YF, Xu LY, Zhou HH. (2007). OATP1B1 polymorphism is a major determinant of serum bilirubin level but not associated with
rifampicin-mediated bilirubin elevation. Clin Exp Pharmacol Physiol 34: 1240–1244
60
Appendices
61
Appendix 1
62
Appendix 2
63
Appendix 3
Personal Data Date
Name Age Hospital Number
Mobile Gender Residence Area
Medical Data
Diseases
Yes No Year
Diabetes Mellitus
Hypertension
Myopathy
No Yes COMMENTS
م ذشعز تؤنى ف عؼالخ االلذاو االذ
م ذشعز احاا تظعتح ف انش
اندسى ال ذسرطع انماو تاألشطح انيح م ذشعز تإراق عاو ف
م االالو يزذثطح تانذاء
64
Surgical Operation
Yes No Years #
PCI (stand)
Open Heart Surgery
Medication
Yes No dose /day Period
Clopidogrel
Aspirin
Statine
Laboratory Data
Test Conc. Test Conc.
WBC Cholesterol
RBC T.G
Hemoglobin CK
HCT CK-MB
Platelets count: ALT
PT AST
% Urea
INR Creatinine
PTT LDH
FBS or RBS HBV
top related