The Islamic University-Gaza

Scientific Research and Postgraduate Affairs

Faculty of Science - Biotechnology Department

SLCO1B1 (c.521T>C) and CYP3A4 (c.522-191C>T) genes polymorphism

and statin-induced muscle pain in coronary heart disease patients in Gaza

strip

Submitted in Partial Fulfillment for the Master Degree of Science in

Biotechnology.

BY

Yousef Jamal Alrantisi

Supervisors

Dr. Basim Ayesh Dr. Abdallah Abed

Assistant professor of Genetics Associate professor of

and Molecular Biology Human Genetics

2014 – 1435

i

Declaration

I hereby declare that this submission is my own work and that, to the best

of my knowledge and belief, it contains no material previously published

or written by another person nor material which to a substantial extent

has been accepted for the award of any other degree of university or other

institute, except where due acknowledgement has been made in the text.

Signature Date

Dec. 2014

Dec 2014

Copyright

All rights reserved © 2014: No part of this work can be copied, translated or

stored in retrieval system, without prior permission of the author.

ii

Dedication

This work is dedicated

To

My dear brother, Mohammed, who went missing

during his quest for further education

To my father Jamal Alrantisi

For his unfailing support,

To my mother Samera

To my wife Alaa

To all my brothers and sisters

To my sons Mohnnad and Mohammed

To my daughter Jana

To all Palestinian people…

iii

Acknowledgement

Utmost appreciation to the almighty Allah for divine

intervention in this academic endeavor.

Sincere gratitude is hereby extended to the following who never

ceased in helping until the paper is structured:

Dr. Basim Ayesh and Dr. Abdalla Abed for their supervision

and great guidance.

Dr. Mohammed Ashour for his continued support for the

furthering of science and education.

Julie Webb-Pullman for her contribution to the completion of

the thesis.

Dr. Mohammed Abu Awda for his valuable input.

Eng. Hisham Srsour For his continuous support and standing

beside me through the completion of the study.

My family and friends who encouraged and supported me to

complete this work.

Finally I would like to expression my deepest respect and

appreciation to my university, The Islamic University of Gaza,

and the faculty of science and all staff members who gave their

time and effort to accomplish this research.

iv

Abstract

Background:

Polymorphism in the genes SLCO1B1 (c.521T>C) and CYP3A4 (c.522-191C>T) have

been associated with statin-induced myopathy, an early precursor of which is muscle

pain. Carriers of both polymorphisms, including the newly identified CYP3A4 (c.522-

191C>T) (intron 6 SNP, rs35599367), defining the CYP3A4*22 allele, have been

found to require significantly lower statin doses to achieve optimal lipid control

without any side effects.

Objectives:

This study aimed to investigate the frequency of SLCO1B1 (c.521T>C) and CYP3A4

(c.522-191C>T) in the study population, and the impact of SLCO1B1 (c.521T>C) and

CYP3A4 (c.522-191C>T) on the risk of statin-induced muscle pain in coronary heart

disease patients in Gaza strip.

Methods:

Whole blood samples were collected from 123 cardiovascular patients receiving statin

therapy who presented to hospitals in the Gaza Strip, and DNA extraction was

performed. CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C) polymorphisms were

detected using sequence specific primers (SSP)-PCR.

Results:

CYP3A4 (c.522-191C>T) frequency of heterozygotes in the study sample was 18.7%

(frequency of the T allele, 10.2%). This gene also had an OR of 16.9 in relation to

muscle pain and statin therapy. SLCO1B1 (c.521T>C) frequency of heterozygotes in

the study sample was 26% (frequency of the C allele, 13.0%), and its OR in relation to

muscle pain and statin therapy was 56.8. The majority of patients who carried

mutations in one or both genes simultaneously, suffered from muscle pain.

v

Conclusion and recommendations:

Higher frequency of the CYP3A4 (c.522-191C>T) in the study population, and the

findings of vastly increased risk of muscle pain - thus potentially myopathy - when

either SLCO1B1 (c.521T>C) or CYP3A4 (c.522-191C>T) are found, but particularly

when both are present, have significant implications for clinical management.

Genotyping for this polymorphism prior to initiating statin therapy is thus

recommended as an important clinical tool in preventing irreversible muscle damage in

patients of the Gaza Strip. Treatment for those found to have the genes should include

prescribing lower doses of statins and close and continuous monitoring for muscle

pain, or the prescription of alternative medications. Further research with a larger

sample size is recommended to confirm the results.

Key words: CYP3A4, SLCO1B1, Statin, Myopathy, Polymorphism, Gaza strip.

vi

Arabic Abstract ملخص الذراست باللغت العزبيت

التي يسببها عالقتها بألم العضالثو (CYP3A4) و (SLCO1B1) تعذد اشكال الجيىيه

المزض الذيه يعاوىن مه أمزاض شزيان القلب التاجي في قطاع غزة عقار الستاتيه لذي

مقذمت:

SLCO1B1 (c.521T>C) CYP3A4 (c.522-191C>T)ارذثط خد ذعذد األشكال نكم ي اند

تإحذاز عمار االسراذ نالعرالل انعؼه ، أنى انعؼالخ، انظرج انثكزج نالعرالل انعؼه. لذ خذ أ

تحاخح CYP3A4*22 alleleانعزف ب CYP3A4 (c.522-191C>T)انحايه نذ األشكال يا شم

أعزاع خاثح. حكى انثان تسر انذ نذى د أياسح نرمهم خزعح عمار انسراذ نهر

الهذف:

SLCO1B1 (c.521T>C) CYP3A4ذفد ذ انذراسح إن فحض يعذل ارشار انشكه اند

(c.522-191C>T) ف عح انذراسح كذنك فحض ذؤثز خد كم يا عه احرانح اإلطاتح تآالو انعؼالخ

اع انمهة انراخح ف لطاع غزج.اناخى ع عمار انسراذ نذ انزػ انذ عا ي أيز

مىهج البحث:

يزغ تؤيزاع انمهة ي انذ رعاط عمار انسراذ انذ لذيا ان يسرشفاخ 123ذى خع عاخ دو ي

ذعذد اشكال اندلطاع غزج نهعالج، ثى ذى اسرخزاج انحغ ان ي ذا انعاخ. ذى فحض

(SLCO1B1) (CYP3A4) تاسرخذاو ذمح(SSP)-PCR.

الىتائج:

( ف عح انذراسح CYP3A4 (c.522-191C>T)أظزخ انرائح أ يعذل ارشار انشكم اند نهطفزج )

( أعه ي يدرعاخ دراسح اخز ذى دراسرا ي تاحث أخز، T 10.2%)يعذل ارشار األنم 18.7%

.16.9( نذا انشكم األنه كشدع ألنى انعؼالخ اناذح ع عمار انسراذ Odds ratioسثح األرخحح )

ارشار )يعذل %26( ف عح انذراسح SLCO1B1 (c.521T>C)يعذل ارشار انشكم اند نهطفزج )

انسراذ عمار ع اناذح انعؼالخ ألنى كشدع األنه انشكم نذا األرخحح ( سثحC 13.0% األنم

. غانثح انزػ انذ حه انشكم األنه الحذ أ كال اند يعا عا ي أنى انعؼالخ.56.8

vii

االستىتاجاث و التىصياث:

ف عح انذراسح كذنك أظزخ االرذفاع (CYP3A4 (c.522-191C>T)أظزخ انرائح ارذفاع سثح ارشار)

SLCO1B1ان احرانح حذز اعرالل عؼه ف حانح خد انكثز ف احرانح خطز أنى انعؼالخ تانر

(c.521T>C) أCYP3A4 (c.522-191C>T) نك تشكم خاص عذيا ك كالا يخد، دعم نا

اعكاساخ يح عه انرعايم اإلكهك يع انزع.

ت كسهح طثح ايح ف يع فحض انط اند نذا انرعذد انشكه لثم انشزع ترال عمار االسراذ يط

يزع ذهف انعؼالخ ف لطاع غزج.

خزعاخ يخفؼح ي طف أنالخ يشدعح ألنى انعؼالخذى ننحاالخ انر خذخ عالج ا ثغ أ شم

.انثذهح ي األدح طف داء أالو ف انعؼالخ، انسرز انثك انزطذ انعمالز انخفؼح نهكنسرزل

.نرؤكذ انرائحأكثز حدى عح يع زذ ي األتحازت ط

viii

List of Contents page

Declaration……………………………………..………………….……..… I

Dedication ………………………………………………………...……..… II

Acknowledgment………...…...………………………………….……..….. III

Abstract……………………….....…………………..……………..…......... IV

Arabic abstract………………………………………………….……......... VI

List Contents…………………………………………………………...…... VIII

List of tables……………………………………………………..…............. XII

List of figures………………………………………………….………...…. XIV

List of abbreviations ………….…………………….………..………..….. XV

Chapter 1: Introduction.……...……………...……………... 1

1.1 Overview.……………………...…...…………..……..….…………………. 1

1.2 Objectives…………………………………………………………………… 3

1.2.1 General objective……………………...…...………………..….…............... 3

1.2.2 Specific objectives………………………………………………………….. 3

1.3 Significance………………………………..……………………..…………. 3

Chapter 2: Literature review…………….…...………….......... 4

2.1 Principles of statin drug action…………………….…………………….….. 4

2.2 Polymorphism and its impact on statin drug response…….………….…… 5

2.2.1 Synonymous and nonsynonymous SNPs …………………………………... 5

2.3 Types of influx transporters ………………………………………………... 6

2.4 Organic anion-transporting polypeptides (OATPs))………………………... 6

2.4.1 OATP1B1…………………………………………………….…………….. 7

2.5 Characteristics of SLCO1B1……………………………………..………… 8

2.6 CYP enzymes………………………………………………………..……... 10

2.7 Cholesterol homeostasis……………………………..…………………..…. 11

2.8 The 3-hydroxy-3-methyl-glutaryl coenzyme A (HMG-CoA) reductase

inhibitors (statins) ………………………………………………………….. 14

2.8.1 The effectiveness of statins………………………………………………… 15

2.8.2 Statin family structures and their pharmacokinetic…………………............. 16

2.8.3 Simvastatin………………………………………………………………….. 17

ix

2.8.4 Side effects of statins……………………………………………………….. 19

Chapter 3 : Material and method……………………………... 23

3.1 Materials ……………………………...…………………………………….. 23

3.1.1 Equipment …………………………………………………………………. 23

3.1.2 Chemicals and Reagents……………………………………………………. 23

3.1.3 Primers used in this study…………………………………………………... 24

3.1.3.1 Primers for CYP3A4 (c.522-191C>T)……………………………………… 24

3.1.3.1 Primers for SLCO1B1 c.521T>C polymorphism………………………….. 24

3.1.4 Disposables…………………………………………………………………. 24

3.2 Methods…………………………………………………………………….. 25

3.2.1 Study design……………………………………..…………………………. 25

3.2.2 Study population……………………………...……………………….......... 25

3.2.3 Ethical considerations………………………………………………………. 25

3.2.4 Inclusion criteria……………………………………………………………. 26

3.2.5 Clinical data collection and assessment…………………………………….. 26

3.2.6 Blood sample collection…………………………………………………….. 26

3.2.7 DNA extraction ……………………………………………………………. 27

3.2.8 Procedure of CYP3A4 (c.522-191C>T) detection by PCR………………… 27

3.2.9 Procedure of SLCO1B1 c.521T>C polymorphism detection by PCR…….. 27

3.2.10 Quality control……………………………………………………………… 28

3.3 Data Analysis……………………………………………………………….. 28

Chapter 4: Results………………………................................... 29

4.1 Description of the study sample………..…………………………………… 29

4.1.1 Description by gender……………………………………………….……… 29

4.1.2 Description by age………………………………………...………………… 29

4.1.3 Description by region……………………………………………………….. 29

4.1.4 Description of clinical conditions of the study sample…………………….. 30

4.1.5 Description of cholesterol, lactate dehydrogenase and creatine kinase levels

in the study sample according to muscle pain………………………………. 31

4.2 Genotype……………………………………………………………………. 32

4.2.1 Description of CYP3A4 (c.522-191C>T)…………………………………... 32

x

4.2.2 Description of SLCO1B1 c.521T>C SNP………………………………….. 33

4.2.3 Description of compound genotype………………………………………… 33

4.3 Relationships………………………………………………………………... 34

4.3.1 Relationship between CYP3A4 (c.522-191C>T) and muscle pain………… 34

4.3.2 Relationship between SLCO1B1 c.521T>C SNP and muscle pain………… 35

4.3.3 Relationship between the compound genotype of CYP3A4 (c.522-191C>T)

and SLCO1B1 c.521T>C SNP and muscle pain…………………………… 35

4.3.4 Relationship between lactate dehydrogenase and muscle pain……………... 36

4.3.5 Relationship between creatine kinase and muscle pain…………………….. 37

4.3.6 Relationship between creatine kinase and CYP3A4 (c.522-191C>T)……… 37

4.3.7 Relationship between lactate dehydrogenase and CYP3A4 (c.522

191C>T)…………………………………………………………………….. 38

4.3.8 Relationship between lactate dehydrogenase and SLCO1B1 c.521T>C SNP 39

4.3.9 Relationship between creatine kinase and SLCO1B1 c.521T>C SNP……... 39

4.3.10 Relationship between the compound genotype of (CYP3A4 (c.522-

191C>T) and SLCO1B1 c.521T>C SNP) and lactate dehydrogenase……... 40

4.3.11 Relationship between the compound genotype of (CYP3A4 (c.522-

191C>T) and SLCO1B1 c.521T>C SNP) and creatine kinase……………... 41

Chapter 5: Discussion.................................................................. 43

5.1 CYP3A4 (c.522-191C>T)…………………………………………………... 43

5.2 SLCO1B1 (c.521T>C) ……………………………………………………... 44

5.3 Muscle Pain and Myopathy………………………………….……………... 44

5.4 Cholesterol Test and Muscle Pain…………………………………………... 45

5.5 CYP3A4 (c.522-191C>T) and Muscle Pain………………………………... 45

5.6 SLCO1B1 (c.521T>C) and Muscle Pain………………………….………... 46

5.7 Compound genotype of CYP3A4 (c.522-191C>T) and SLCO1B1

(c.521T>C) and Muscle Pain……………………………………...………... 46

5.8 Creatine Kinase and Muscle Pain…………………………………………... 47

5.9 Lactate Dehydrogenase with CYP3A4 (c.522-191C>T), and SLCO1B1

(c.521T>C) …………………………………………………………………. 47

5.10 Creatine Kinase with CYP3A4 (c.522-191C>T), and SLCO1B1

(c.521T>C)………………………………………………………………….. 48

xi

5.11 Compound Genotype of (CYP3A4 (c.522-191C>T) and SLCO1B1

(c.521T>C)) and Lactate Dehydrogenase………………………………….. 49

5.12 Compound Genotype of (CYP3A4 (c.522-191C>T) and SLCO1B1

(c.521T>C)) and Creatine Kinase…………………………………………... 49

Chapter 6: Conclusions & Recommendations……............... 50

6.1 Conclusions……………………..………....................................................... 50

6.2 Recommendations…………………………………...……………..……….. 51

References……………....…...……………............................... 52

Appendices…………………………………………………….…………… 60

Appendix 1: Helsinki committee an approval letter……………………….. 61

Appendix 2: Ministry of Health permission letter…………………………. 62

Appendix 3: Questionnaire………………………….................................... 63

xii

List of Tables Page

Table 2.1 Drug substrates for OATP1B1………………………………..…...…... 7

Table 2.2 Potential factors predisposing to statin-induced myopathy………....…. 20

Table 3.1 Equipment used in this study…………………………………….……. 23

Table 3.2 Chemicals and Reagents used in this study………………….……...… 23

Table 3.3 Primers for CYP3A4 (c.522-191C>T)………………...…….….…...… 24

Table 3.4 Primers and their sequences for SLCO1B1 c.521T>C polymorphism... 24

Table 3.5 Disposables………………………………………………….…..….…. 24

Table 3.6 Study tests………………………….…………………….…..………... 26

Table 4.1 Gender frequency of the study sample……………………..…..……… 29

Table 4.2 Description of males and females by age (years)………..….…..…....... 29

Table 4.3 Regional frequency of the study sample …………...……………….… 30

Table 4.4 Description of diabetes mellitus, hypertension, open-heart surgery and

muscle pain frequencies of the study sample………..……………..…. 30

Table 4.5 Description of cholesterol, lactate dehydrogenase and creatine kinase

levels in study sample………………...………….……………………. 31

Table 4.6 Frequency of CYP3A4 (c.522-191C>T) ………………………….….. 32

Table 4.7 Frequency of SLCO1B1 (c.521T>C)…….……….…..………………. 33

Table 4.8 Both genes frequency of the study sample……….……..…………..…. 34

Table 4.9 Relationship between CYP3A4 (c.522-191C>T) genotype and muscle

pain…………………………………..………………..………………. 34

Table 4.10 Relationship between SLCO1B1 (c.521T>C) genotype and muscle

pain…………………………………….…..…………..………………. 35

Table 4.11 Relationship between CYP3A4 (c.522-191C>T) and SLCO1B1

(c.521T>C) compound genotype and muscle pain………..……...……. 36

Table 4.12 Relationship between lactate dehydrogenase level (U/L) and muscle

pain…………………………………………….…….……..………….. 36

Table 4.13 Relationship between creatine kinase level (U/L) and muscle

pain……. 37

Table 4.14 Relationship between lactate dehydrogenase level (U/L) and CYP3A4

(c.522-191C>T) genotype………………….……………….………… 38

Table 4.15 Relationship between creatine kinase level (U/L) and CYP3A4 (c.522-

191C>T)……………………….………………………………………. 38

xiii

Table 4.16 Relationship between lactate dehydrogenase level (U/L) and

SLCO1B1 (c.521T>C) genotype………………………………………. 39

Table 4.17 Relationship between creatine kinase level (U/L) and SLCO1B1

(C.521T>C)…………………………….……………………………… 40

Table 4.18

Relationship between the compound genotype of CYP3A4 (c.522-

191C>T) and SLCO1B1 (c.521T>C) and lactate dehydrogenase level

(U/L)…………………………………..……………………….............

40

Table 4.19

Relationship between the compound genotype of CYP3A4 (c.522-

191C>T) and SLCO1B1 (c.521T>C) and lactate dehydrogenase level

(U/L)………………………………….…………………………..........

41

Table 4.20 Relationship between the compound genotype of CYP3A4 (c.522-

191C>T) and SLCO1B1 (c.521T>C), and creatine kinase level (U/L).. 42

xiv

List of Figures Page

Figure 2.1

Schematic presentation of the predicted secondary structure of

human OATP1B1, depicting the positions of known amino acid

changes……………………………………………….………..

8

Figure 2.2 Schematic representation of functionally distinctive SLCO1B1

haplotypes……………………………………………………....

10

Figure 2.3

The first and rate-limiting step in cholesterol synthesis is the

synthesis of mevalonate from acetate. Mevalonate is further

metabolized to squalene, which is cyclized to lanosterol. The

formation of cholesterol from lanosterol involves several

metabolic reactions in the late cholesterol biosynthesis

pathway…………………………………………………..…….

13

Figure 2.4 Chemical structure of cholesterol………………………………. 13

Figure 2.5 Simplified scheme of the biosynthetic pathway of cholesterol

and other cometabolites………………………………………… 16

Figure 2.6 Chemical structures of HMG-CoA and the investigated

statins…………………………………………………………… 17

Figure 4.1 Representative photograph showing agrose electrophoresis gel

of CYP3A4 (c.522-191C>T)…………………………………… 32

Figure 4.2 Representative photograph showing agrose electrophoresis gel

of SLCO1B1 (c.521T>C)………………………...….…………. 33

xv

Abbreviations and Definitions

3’-untranslated region 3’UTR

Angiotensin-converting enzyme ACE

Apolipoprotein Apo

Area under the curve AUC

Coronary heart disease CHD

Creatine kinase CK

Cardiovascular disease CVD

Coenzyme A CoA

Cytochrome P450 CYP

Database of single nucleotide polymorphisms dbSNP

Deoxyribonucleic acid DNA

Ethylenediaminetetraacetic acid EDTA

High-density lipoprotein HDL

Human embryonic kidney cells HEK293

Human cervical carcinoma cells, name derived from Henrietta

Lacks HeLa

Human immunodeficiency virus HIV

3-hydroxy-3-methylglutaryl HMG

HMG-CoA reductase HMG-CoAR

Intermediate-density lipoprotein IDL

Low-density lipoprotein LDL

LDL-cholesterol LDL-C

Liver-specific transporter LST

Multidrug and toxin extrusion transporter MATE

Multidrug resistance transporter MDR1

Messenger ribonucleic acid mRNA

Multidrug resistance-associated protein MRP

National Center for Biotechnology Information NCBI

Sodium-dependent taurocholate co-transporting protein NTCP

Organic anion-transporting polypeptide OATP

Organic cation transporter OCT

xvi

Organic cation/carnitine transporter OCTN

Odds ratio OR

Percutaneous coronary intervention PCI

Polymerase chain reaction PCR

Peptide transporter PEPT

Prediction du Risque Musculaire en Observationnel PRIMO

Standard deviation SD

Solute carrier SLC

Solute carrier organic anion transporter SLCO

Single nucleotide polymorphism SNP

Statistical Package for Social Science SPSS

Very-low-density lipoprotein VLDL

Chi-square test X2

1

CHAPTER 1

Introduction

1.1. Overview

The 3-hydroxy-3-methyl-glutaryl coenzyme A (HMG-CoA) reductase inhibitors

(statins) are essential drugs in the treatment of hypercholesterolemia (LaRosa et al.,

1999). They effectively lower cholesterol levels and consistently and significantly

reduce mortality and morbidity in patients with and without a history of coronary

artery disease (Shepherd et al., 1995; Sacks et al., 1996; Baigent et al., 2005).

In rare cases, statins can cause muscle pain or weakness in association with elevated

creatine kinase levels (i.e., myopathy), and occasionally, this leads to muscle

breakdown and myoglobin release (i.e., rhabdomyolysis), with a risk of renal failure

and death. (Thompson et al., 2003) The mechanisms by which statins cause myopathy

remain unknown but appear to be related to statin concentrations in the blood. The

incidence of myopathy is typically only about 1 case per 10,000 patients per year with

standard doses of statins (e.g., 20 to 40 mg of simvastatin daily), but it increases with

higher doses (e.g., 80 mg of simvastatin daily) and with concomitant use of certain

drugs (e.g., cyclosporine, which can inhibit statin metabolism). (Law and Rudnicka

2006, Armitage 2007)

Plasma membrane transporters have been implicated as important determinants of

intestinal absorption and hepatobiliary clearance, especially of hydrophilic statins.

Multiple organic aniontransporting polypeptide (OATP) family members are capable

of statin transport, and some of them are abundant in the liver, where they may be

involved in the hepatic uptake of statins from the sinusoidal blood (Abe et al., 1999;

Niemi 2007, 2011). OATP1B1 is an uptake transporter located in the basolateral

(sinusoidal) membrane of human hepatocytes and involved in the hepatic uptake of a

broad array of endogenous and foreign compounds, such as estrogen conjugates, bile

acids and statins (Hsiang et al., 1999; König et al., 2000).

2

Several single nucleotide polymorphisms (SNPs) in the gene encoding OATP1B1,

solute carrier organic anion transporter (SLCO1B1), have been discovered (Tirona et

al., 2001; König et al., 2006). Some of them, in particular the nonsynonymous

sequence variation SLCO1B1 c.521T>C (Val174Ala, rs4149056), defining the

SLCO1B1*5 allele, have been associated with reduced activity of OATP1B1 in vitro

(Tirona et al., 2001; Iwai et al., 2004; Kameyama et al., 2005; Nozawa et al., 2005),

and increased plasma concentrations of pravastatin, rosuvastatin, pitavastatin,

repaglinide and fexofenadine in vivo in humans (Nishizato et al., 2003; Mwinyi et al.,

2004; Niemi et al., 2004; 2005a,b, Chung et al., 2005; Lee et al., 2005a). The

frequency of the polymorphisms in SLCO1B1 appears to be heavily dependent on

ethnic background (Tirona et al., 2001; Lee et al., 2005a). Since statins exert their

cholesterol lowering effects by inhibiting the HMG-CoA reductase in the hepatocytes,

reduced OATP1B1-mediated uptake into the liver due to genetic polymorphism in the

encoding SLCO1B1 gene may both reduce their efficacy and increase their peripheral

plasma concentrations, thus enhancing the risk of systemic adverse effects, such as

myopathy (Niemi et al., 2004).

Cytochrome P450 (CYP) enzymes metabolize endogenous and xenobiotic compounds.

Belonging to the CYP3A subfamily, CYP3A4 is the most abundant CYP enzyme,

involved in metabolizing 45–60% of all currently used drugs, (Danielson 2002)

including several statins—cholesterol lowering HMG-CoA reductase inhibitors.

However, CYP3A4 activity or protein content shows 10–100-fold inter-individual

variations, (Westlind-Johnsson et al., 2003; Lamba et al., 2002) influencing drug

response and toxicity.

There is a strong correlation between statin dose, blood drug concentration, and lipid

response (Shitara and Sugiyama 2006; Jones et al., 2003). Genetic polymorphisms

that alter CYP3A4 enzyme activity are expected to affect blood drug level and lipid

response or side effects.

Genetic variants may play a vital role in determining response to statin therapy.

Carriers of a newly identified CYP3A4 (c.522-191C>T) (intron 6 SNP, rs35599367),

defining the CYP3A4*22 allele, required significantly lower statin doses (0.2–0.6

times less) for optimal lipid control. The analyses included atorvastatin (Lipitor),

3

simvastatin, and lovastatin (Mevacor), and the association was robust (P = .019).

(Wang et al., 2011)

1.2. Objectives

1.2.1. Main objectives

This study aims to investigate the impact of the SLCO1B1 c.521T>C SNP in the

SLCO1B1 gene and CYP3A4 (c.522-191C>T) on the risk of statin-induced muscle

pain in cardiac patients in Gaza strip and its relation with cholesterol levels in these

patients.

1.2.2. Specific objectives

1. To determine the frequency of SLCO1B1 C.521T>C SNP and CYP3A4 (c.522-

191C>T) in the population.

2. To evaluate the effects of SLCO1B1 C.521T>C SNP and CYP3A4 (c.522-

191C>T) on the statin induced muscle pain.

3. To collect and evaluate relevant clinical data of the target population

particularly data related to their genotype at the mentioned loci, statin treatment

and any side effect or recurrence of cardiovascular events.

1.3. Significance

This research is primarily devoted to improve people's lives, especially those of

hypercholesterolemia patients. This is the first time such research has been performed

on cardiovascular disease patients in the Gaza Strip. In addition, establishing a

relationship between SLCO1B1 C.521T>C and CYP3A4 (c.522-191C>T)

polymorphisms and statin induced muscle pain will help reduce the side effects of the

drug by enabling the adjustment of the dose commensurate with the status of each

patient. It will also increase community awareness about drugs and their possible side

effects.

4

CHAPTER 2

Literature review

Most patients in Gaza who have coronary heart disease take statin drug therapy to

lower their cholesterol level, because the high cholesterol level increases the risk of

coronary artery disease as well as the incidence of coronary atherosclerosis.

2.1. Principles of statin drug action

After oral administration, drugs pass through the intestinal wall and enter the portal

blood circulation. The portal blood takes the drugs into the liver, after which they reach

the systemic circulation and are distributed to the target sites. Drugs are eliminated

from the body by metabolism and excretion, usually via the liver into the bile or via the

kidneys into the urine. Drug pharmacokinetics is concerned with the stages of a drug in

the body, i.e. absorption, distribution, metabolism and excretion, while

pharmacodynamics refers to the biological effects of a drug on the body. Drug efficacy

and response are determined by a complex interplay of multiple processes regulating

drug pharmacokinetics and pharmacodynamics (Rowland and Tozer 1995).

The liver is the major organ of drug metabolism, in which enzymes located in the

endoplasmic reticulum and cytoplasm of hepatocytes catalyse drug biotransformation.

Other organs, e.g. the gut, kidneys, lung and skin, can also contribute to drug

metabolism (Krishna and Klotz 1994).

An orally administered drug can begin to be biotransformed in the gastrointestinal tract

by enterocytes and in the liver after passing through the portal circulation (first-pass

metabolism), which can considerably decrease the oral bioavailability of many drugs

(Shen et al., 1997).

Drug biotransformation is often divided into two phases, including phase I

functionalization and phase II conjugation reactions. Phase I enzymes insert a

functional group in their substrate, usually by oxidation, reduction and hydrolysis

reactions, leading generally to metabolites less active than the parent drug (Josephy et

5

al., 2005). These reactions are mainly catalysed by cytochrome P450 (CYP) enzymes.

Phase II reactions are usually conjugation reactions, in which drugs or their metabolites

are conjugated with endogenous molecules to produce more water-soluble compounds

in order to facilitate their excretion (Josephy et al., 2005).

Transporters expressed in plasma membranes facilitate the import of drugs into

metabolizing cells and export of the drug metabolites produced (Shitara et al., 2006).

2.2. Polymorphism and its impact on statin drug response

Previous studies have shown that nucleotide sequence variation (polymorphism) in

drug transporters plays a major role in interindividual differences in drug disposition.

Polymorphism leading to functional changes in drug transporters can affect the

pharmacokinetics and subsequent pharmacodynamics and toxicological effects of

drugs. It can also affect susceptibility to certain diseases (Ho and Kim 2005).

There are many mechanisms by which polymorphism can affect transporter phenotype.

Common polymorphisms include tandem repeated segments, large (copy number

variants) and small segmental deletions/insertions/duplications and substitutions

(SNPs). SNPs are an exceedingly common form of polymorphism that may account for

approximately 90% of all known sequence variation (Collins et al., 1998).

2.2.1 Synonymous and nonsynonymous SNPs

Functional SNPs that lead to changes in gene expression occur in all regions of the

genome. SNPs in the coding (exonic) regions of transporter genes can be

nonsynonymous, meaning that they lead to a change in encoded amino acids, or

synonymous (no amino acid change). Although both kinds of SNPs can have an impact

on transporter activity, it is widely accepted that nonsynonymous SNPs are more likely

to have functional consequences.

Nonsynonymous SNPs can lead to protein misfolding, polarity shift or improper

phosphorylation. SNPs in the noncoding regions of transporter genes are less

predictable and include variants in the intronic, promoter and 3’-untranslated region

(3’UTR). These variants can affect the splicing or regulation of transporter genes.

6

SNPs in the promoter region may modify transporter expression by altering the binding

sites for transcription factors (Chorley et al., 2008; Gradhand and Kim 2008).

2.3. Types of influx transporters

Influx (uptake) transporters facilitate the entry of drugs into cells. Uptake transporters

include the organic anion-transporting polypeptides (OATPs, SLCO), organic anion

transporters (OATs, SLC22A), organic cation transporters (OCTs, SLC22A), organic

cation/carnitine transporters (OCTNs, SLC22A), peptide transporters (PEPTs,

SLC15A) and sodium-dependent taurocholate cotransporting protein (NTCP,

SLC10A1) (Ho and Kim 2005; Zair et al., 2008). Multidrug and toxin extrusion

transporter 1 (MATE1, SLC47A1) and multidrug and toxin extrusion transporter 2-K

(MATE2-K, SLC47A2) also participate into the uptake of compounds into the cell

(Tanihara et al., 2007). All of these transporters belong to the superfamily of solute

carriers (SLCs) (Hagenbuch and Meier 2004; Hediger et al., 2004; Seithel et al.,

2008a).

Information on the other members of the OATP family is limited. Numerous genetic

polymorphisms in at least the OATP1B1- and OATP1B3-encoding genes SLCO1B1

and SLCO1B3 have been identified, some associated with altered transport function.

OATPs can be inhibited by cyclosporine, rifampicin, gemfibrozil and macrolides

(Niemi 2007).

2.4. Organic anion-transporting polypeptides (OATPs)

OATPs are encoded by genes of the SLCO superfamily (previously SLC21)

(Hagenbuch and Meier 2004). The genes encoding human OATP1 family members

are located in the short arm of chromosome 12, where they are organized in the order

SLCO1C1, SLCO1B3, SLCO1B1, and SLCO1A2 (Hagenbuch and Meier 2004).

Between SLCO1B3 and SLCO1B1, there is a gene entitled liver-specific organic anion

transporter 3TM12 (LST-3TM12, also known as LST3 and LST-3B), the function and

sites of expression of which are yet unknown. Genes encoding other OATPs are

scattered in chromosomes 3, 5, 8, 11, 15, and 20. No human diseases appear to be

associated with genetic variations of SLCO family genes.

7

2.4.1. OATP1B1

OATP1B1 (previously known as OATP2, OATP-C, and LST-1) is mainly expressed

on the sinusoidal membrane of human hepatocytes (Abe et al., 1999; Hsiang et al.,

1999; König et al., 2000). OATP1B1 mRNA has been detected also in other tissues,

including small intestinal enterocytes (Glaeser et al., 2007). OATP1B1 mediates the

influx of its substrates from blood into the hepatocytes and it may therefore be an

important step preceding elimination of drugs by metabolism or biliary excretion

(Niemi 2007).

Examples of in vitro OATP1B1 drug substrates include several HMG-CoA reductase

inhibitors, or statins, angiotensin-converting enzyme (ACE) inhibitors, and angiotensin

II receptor antagonists (Table 2.1). Rosiglitazone and pioglitazone have been identified

as potential substrates of OATP1B1 by in silico pharmacophore modeling (Chang et

al., 2005).

Table 2.1 Drug substrates for OATP1B1. (Pasanen et al., 2008) Substrate Km (μM)

Atorvastatin 12.4

Atrasentan –

Benzylpenicillin –

Bosentan 44

Caspofungin –

Cerivastatin –

Enalapril 262

Fluvastatin 1.4-3.5

Methotrexate –

Olmesartan 12.8-42.6

Pitavastatin 3.0

Pravastatin 13.7-35

Rifampicin 1.5-13

Rosuvastatin 4.0-7.3

SN-38 –

Temocapril –

Troglitazone sulfate –

Valsartan 1.39

Km, Michaelis-Menten kinetic constant;

SN-38, an active Metab lite of the anticancer drug irinotecan;

–, not provided.

8

2.5. Characteristics of SLCO1B1

The SLCO1B1 gene is located in chromosome 12 (gene locus 12p12). A large number

of SNPs, both nonsynonymous and synonymous, have been discovered in the

SLCO1B1 gene, and several of these affect transport function in vitro and in vivo

(Figure 2.1). Most of the SNPs associated with altered transport function span the

transmembrane domains or extracellular loop 5 of OATP1B1. In vitro experimental

systems expressing mutated OATP1B1 have been used to demonstrate the effects of

SNPs on the uptake clearance of OATP1B1 (Table 2.2) (Tirona et al., 2001; Iwai et

al., 2004; König et al., 2006). The effects of certain SLCO1B1 polymorphisms on

transport function appear to be substrate-dependent (Tirona et al., 2001).

Figure 2.1 Schematic presentation of the predicted secondary structure of human OATP1B1, depicting

the positions of known amino acid changes (Pasanen et al., 2008).

One of the most characterized SNPs in SLCO1B1, the c.521T>C SNP, predicts the

substitution of alanine for valine at amino acid 174 (Val174Ala). Another prevalent

SNP, c.388A>G, causes an amino acid change at position 130 (Asn130Asp) (Niemi et

al., 2004).

When the effects of SNPs on the respective phenotype are assessed, the underlying

haplotype structure should be taken into account. Moreover, at least in Europeans, the

haplotypes comprising c.388A>G and c.521T>C can be further subclassified by two

promoter region SNPs g.-11187G>A and g.-10499A>C into two other distinctive and

9

potentially functional significant haplotypes: *16 and *17 (Figure 2.2) (Niemi et al.,

2004).

The c.521C allele and the haplotypes *5 and *15 (containing the c.521T>C SNP) have

been associated with markedly reduced uptake activity in vitro of the OATP1B1

substrates oestrone- 3-sulphate, oestradiol-17ß-D-glucuronide, atorvastatin,

cerivastatin, pravastatin, the SN-38 metabolite of irinotecan and rifampicin (Tirona et

al., 2001, 2003; Iwai et al., 2004; Kameyama et al., 2005; Nozawa et al., 2005).

In addition, studies in humans have associated the c.521C allele with increased plasma

concentrations of the statins pravastatin, rosuvastatin and pitavastatin, the

antihistamine fexofenadine and the antidiabetic drug repaglinide (Nishizato et al.,

2003; Mwinyi et al., 2004; Niemi et al., 2004; 2005a,b, Chung et al., 2005; Lee et

al., 2005a).

It is becoming evident that the incidence of sequence variations in the SLCO1B1 gene

is heavily dependent on the ethnic background. The c.521T>C variant showed an allele

frequency of approximately 10–15% in Asian populations, 10–20% in Caucasians and

1–2% in African-American populations. The c.388A>G SNP showed an allele

frequency of approximately 30–45% in Caucasians, 70–80% in African-

American/Sub-Saharan African populations and 60–90% in Asian populations (Tirona

et al., 2001; Nozawa et al., 2002; Niemi et al., 2004; Lee et al., 2005a, Jada et al.,

2007).

10

Figure 2.2 Schematic representation of functionally distinctive SLCO1B1 haplotypes

2.6. CYP enzymes

CYP3A4 (cytochrome P450, family 3, subfamily A, polypeptide 4 ) encodes a member

of the cytochrome P450 superfamily of enzymes. CYP3A4 and CYP3A5 are believed

to be the predominant cytochrome P450s expressed in adult human liver, with

CYP3A4 thought to dominate in Whites and CYP3A5 in Blacks/African Americans.

The two have overlapping substrate specificities. CYP3A4 is responsible for the

metabolism of approximately 50-60% of clinical drugs used today, It is important for

the metabolism of steroid hormones (Niwa et al 1998; Shou et al., 1997).

The complete cDNA sequence was reported by Molowa et al., in 1986, and Inoue et

al., in 1992 mapped the gene to 7q22.1 by fluorescence in situ hybridization. The gene

is about 27 kb in length and contains 13 exons and 12 introns (Hashimoto et al.,

1993).

The CYP enzymes are a superfamily of haem-containing monooxygenases located in

the endoplasmic reticulum and involved in the metabolism of a large number of

organic compounds (Wrighton and Stevens 1992; Lewis 2004). Over 2700 individual

members of this enzyme family are known to exist. The degree of similarity in amino

11

acid sequence divides the CYP enzymes into families indicated by a number showing

> 40% identity with each other (e.g. CYP3), into subfamilies indicated by a letter

showing > 55% amino acid sequence identity (e.g. CYP3A) and into individual

enzymes in which the specific gene is indicated by a number (e.g. CYP3A4) (Nebert

and Russell 2002).

In humans, 57 CYP enzymes have been identified, most present in families CYP1–

CYP4. The CYP1, CYP2 and CYP3 families predominantly participate in the

metabolism of exogenous compounds, whereas the other CYP families are mainly

involved in endogenous metabolism (Lewis 2004).

The CYP3A subfamily comprises the CYP3A4, CYP3A5, CYP3A7 and CYP3A43

enzymes. CYP3A4 is the most abundant CYP enzyme in both the liver and intestine

and is the most important drugmetabolizing enzyme in humans (Nebert and Russell

2002; Wrighton et al., 2000). CYP3A5 is expressed mainly in the liver but also in

extrahepatic tissues such as the intestine and lung (Kivistö et al., 1996a, b).

CYP3A5 substrate specifity largely overlaps that of CYP3A4, but the catalytic activity

of CYP3A5 is usually smaller. Substrates of CYP3A include atorvastatin, simvastatin,

midazolam, triazolam, cyclosporine a, erythromycin and several calcium channel

blockers (Wrighton et al., 2000).

2.7. Cholesterol homeostasis

Cholesterol is a major component of mammalian cell membranes modulating fluidity

and maintaining the barrier between the cell and the environment. Cholesterol is also

essential for tissue growth, bile acid synthesis in the liver, vitamin D production in the

skin and steroid hormone synthesis in the adrenal glands, ovaries and testes (Brown

and Goldstein 1986).

The transport of cholesterol in the circulatory system is facilitated by lipoproteins.

Lipoproteins are spherical particles with a hydrophobic core of esterified cholesterol

and triglycerides and a surrounding hydrophilic shell of apolipoproteins (apos),

phospholipids and unesterified cholesterol. Plasma lipoproteins can be divided

12

according to their density in ultracentrifugation into chylomicrons (< 95 g/ml), very-

low-density lipoprotein (VLDL; 0.95–1.006 g/ml), intermediate-density lipoprotein

(IDL; 1.006–1.019 g/ml), low-density lipoprotein (LDL; 1.019– 1.063 g/ml) and high-

density lipoprotein (HDL; 1.063–1.210 g/l).

The apolipoproteins (A, B, C, E) serve as structural proteins, cofactors for enzymes

and ligands for cell surface receptors of lipoprotein particles, and as raw material for

production of lipoproteins. Lipoprotein receptors, prototypically LDL receptors located

on the surfaces of cells, bind LDL and carry cholesterol into the cells by receptor-

mediated endocytosis, where it is used by the cell or stored in the form of cytoplasmic

cholesteryl ester droplets (Brown and Goldstein 1983; Brown and Goldstein 1986;

Martini and Pallottini 2007).

In humans, cholesterol is acquired either by de novo synthesis or by absorption from

the diet. Accumulation of cholesterol in tissues due to increased dietary intake is

generally prevented by several feedback responses down-regulating absorption or

synthesis of cholesterol or enhancing cholesterol excretion (Gylling and Miettinen

1992).

High cholesterol intake exceeding the capacity of adaptive changes in cholesterol

metabolism generally increases the serum levels of total cholesterol and LDL-C,

accelerating the formation of atherosclerotic plaques and possibly leading to coronary

heart disease (Brown and Goldstein 1986).

13

Figure 2.3 The first and rate-limiting step in cholesterol synthesis is the synthesis of mevalonate from

acetate. Mevalonate is further metabolized to squalene, which is cyclized to lanosterol. The formation of

cholesterol from lanosterol involves several metabolic reactions in the late cholesterol biosynthesis

pathway. (Pasanen et al., 2008)

Figure 2.4 Chemical structure of cholesterol.

14

2.8. The 3-hydroxy-3-methyl-glutaryl coenzyme A (HMG-CoA)

reductase inhibitors (statins)

The sequelae of atherosclerotic vascular disease contribute significantly to the burden

of illness in developed nations. In Canada an estimated 36% of all deaths result from

cardiovascular disease (CVD). (The changing face of heart disease and stroke in

Canada 2000).

Antilipemic agents have proven to be particularly advantageous in both primary and

secondary prevention of CVD sequelae. (Scandinavian Simvastatin Survival Study

Group 1994; Shepherd et al., 1995) Among the various lipid-lowering medications

the 3-hydroxy-3- methylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors,

(HMGRI or ―statins‖) have emerged as the dominant class for the treatment of

hypercholesterolemia. (Maron et al., 2000) In addition to their ability to lower serum

cholesterol by inhibiting a rate-limiting enzyme in the cholesterol biosynthetic

pathway, statins have also been shown to target a variety of cellular processes that

modify endothelial function, inflammatory responses, plaque stabilization and

thrombogenesis (Beyer RE 1992; Rosenson and Lowe 1998). Relevant to these

functions are the findings that acute statin therapy decreases the incidence of

symptomatic ischemia in patients with acute coronary syndromes (Schwartz et al.,

2001).

Generally, the statins have a benign side-effect profile and are well tolerated. The most

serious adverse effects arise from cell damage in liver and skeletal muscle. Increases in

serum transaminases of hepatic origin are dose dependent and occur with a reported

frequency of approximately 1%, whereas myotoxicity, defined as myalgias and

elevated serum creatine kinase values (>10 times the upper limit of normal), occurs in

0.1% of patients.(Maron et al., 2000) Although hepatotoxicity is more common,

myotoxicity may pose a larger risk for sarcolemmal disruption (i.e., rhabdomyolysis)

and can lead to myoglobinuria and acute renal failure.( Dromer et al., 1992; Ozdemir

et al., 2000)

The incidence of myopathies is low, but the increasing use of statins implies that more

physicians will encounter this clinical entity. Attempting to understand the

15

pathophysiology of statins is of particular importance given the withdrawal of

cerivastatin from the market in August 2001 owing to an unacceptable incidence of

rhabdomyolysis and death. This review will consider the potential etiologies of statin

myopathies in relation to altered cholesterol biosynthesis and muscle physiology.

2.8.1. The effectiveness of statins

Statins are reversible competitive inhibitors of the HMG-CoA reductase enzyme,

which catalyses the first and rate-limiting step from HMG-CoA to mevalonate in de

novo cholesterol synthesis (Figure 2.5). Inhibition of this enzyme reduces cholesterol

synthesis in the hepatocytes, leading to a reduction in intracellular cholesterol

concentration and a responsive increase in LDL receptor expression on the hepatocyte

cell surface.

This results in increased extraction of LDL-C from the blood and decreased circulating

total cholesterol and LDL-C concentrations. A meta-analysis showed that statins can

lower LDL-C by an average of 1.8mmol/l, which reduces the risk of CHD events by

about 60% and stroke by 17% (Law et al., 2003). In addition to lowering plasma LDL-

C and total cholesterol levels, statins also moderately reduce triglyceride levels and

increase HDL-cholesterol levels (Kreisberg and Oberman 2002).

Statins have been shown to slow the progression or even promote regression of

coronary atherosclerosis, possibly due to shrinkage of the lipid core of the

atherosclerotic plaque, avoiding plaque rupture that would otherwise trigger intramural

haemorrhage and intraluminal thrombosis (Kreisberg and Oberman 2002; Liao

2002).

16

Figure 2.5 Simplified schemes of the biosynthetic pathway of cholesterol and other cometabolites.

2.8.2. Statin family structures and their pharmacokinetic

The chemical structures of fluvastatin, pravastatin, simvastatin, rosuvastatin and

atorvastatin are shown in Figure 2.6. These structures can be divided broadly into three

parts: an analogue of the natural substrate (HMG-CoA), a complex hydrophobic ring

structure that is covalently linked to the substrate analogue and involved in the binding

of statin to the reductase, and side groups on the rings that define the solubility and

other pharmacokinetic properties (Schachter 2005).

Crystal structures have shown that statins act by binding to the active site of the HMG-

CoA reductase enzyme, thus sterically preventing the substrate from binding. The

substrate-binding pocket of the enzyme undergoes a conformational change that

enables the hydrophobic ring structures of statins to be accommodated to the enzyme

(Istvan and Deisenhofer 2001).

The significance of the differences in the binding sites of different statins is not fully

understood, but the additional binding interactions of rosuvastatin with the HMG-CoA

reductase may explain in part its increased potency compared with other statins

(Schachter 2005).

17

Simvastatin is administered as a lipophilic lactone prodrug, whereas fluvastatin,

pravastatin, rosuvastatin and atorvastatin are given as active acid forms. Generally, the

lipophilic statins are more readily distributed into the peripheral tissues by passive

diffusion than hydrophilic statins such as pravastatin and rosuvastatin (Lennernäs and

Fager 1997; Hamelin and Turgeon 1998).

However, many statins are converted in the body to their lactone forms or metabolites

that can be more lipophilic than the parent acid form. Both acid and lactone forms as

well as metabolites can be important in statin interactions (Neuvonen et al., 2006).

Generally, lipophilic drugs appear to be more susceptible to oxidative metabolism by

CYP enzymes than hydrophilic drugs (Schachter 2005).

Figure 2.6 Chemical structures of HMG-CoA and the investigated statins

2.8.3. Simvastatin

Simvastatin is a semisynthetic derivative of lovastatin and is administered as a rather

lipophilic lactone prodrug (logP 4.7), of which approximately 60–85% is absorbed

from the gastrointestinal tract. The plasma protein binding of simvastatin is high (>

18

95%) compared with that of the more hydrophilic statins. The inactive parent

simvastatin lactone is either oxidized by CYP3A4 (and by CYP3A5) in the intestinal

mucosa and liver to more than 10 metabolites, or hydrolysed to simvastatin acid, the

main active metabolite of simvastatin (Vickers et al., 1990, Igel et al., 2002).

Active simvastatin acid is also further metabolized, mainly by CYP3A4 and CYP2C8

(Prueksaritanont et al., 2002, 2003). The active metabolites also account for the

HMG-CoA reductase inhibition (Schachter 2005).

Simvastatin is eliminated principally as metabolites into the bile. Simvastatin lactone is

not transported by OATP1B1, but simvastatin acid strongly inhibits OATP1B1-

mediated hepatic uptake of pravastatin, suggesting it to be an OATP1B1 substrate

(Hsiang et al., 1999; Chen et al., 2005). In addition, simvastatin acid is an MDR1

substrate (Chen et al., 2005).

CYP3A4 inhibitors markedly elevate the plasma concentrations of both simvastatin

and simvastatin acid (Neuvonen et al., 2006). For example, concomitant

administration of itraconazole increased the AUC of simvastatin by approximately 20-

fold (Neuvonen et al., 1998). On the other hand, gemfibrozil, which is an inhibitor of

CYP2C8 and OATP1B1, but not CYP3A4, increases the simvastatin acid AUC by

approximately 200%, but does not significantly affect the parent lactone form

(Backman et al., 2000).

The atorvastatin plasma concentrations have been significantly elevated when

administered concomitantly with CYP3A4 inhibitors, gemfibrozil and cyclosporine

(Hermann et al., 2004; Neuvonen et al., 2006). Gemfibrozil only moderately

increases the AUC values of atorvastatin and its active acid metabolites, whereas

cyclosporine has increased the AUC of atorvastatin 6- to 15-fold (Åsberg et al., 2001;

Hermann et al., 2004). Itraconazole has increased the AUC of atorvastatin 3-fold

(Kantola et al., 1998). Multiple-dose rifampicin decreases the atorvastatin AUC by

about 80% (Backman et al., 2005), but a single dose of rifampicin has increased the

atorvastatin AUC by over 600% (Lau et al., 2006, 2007). This is probably due to the

inhibition of OATP-mediated hepatic uptake of atorvastatin by rifampicin (Vavricka

et al., 2002).

19

2.8.4. Side effects of statins

In general, statins are regarded as a safe and well-tolerated class of drugs; serious

adverse events are rare (Pasternak et al., 2002). A small percentage of patients

experience asymptomatic, reversible increase in liver enzymes (notably alanine and

aspartate transaminases), but this increase is not generally associated with liver damage

(Armitage 2007).

Statins can also cause muscle pain or weakness (myalgia), sometimes in association

with elevated creatine kinase (CK) levels (myopathy), which may progress to muscle

breakdown (rhabdomyolysis), myoglobin release, renal failure and even death

(Vaklavas et al., 2008).

Asymptomatic elevation of CK can sometimes also occur with statin therapy, but the

clinical relevance of this is unclear. In addition, some patients receiving statin therapy

develop significant muscle symptoms with demonstrable weakness and histopathologic

findings of myopathy despite normal CK levels (Phillips et al., 2002).

The mechanisms by which statins cause these muscle-related adverse effects remain

largely unknown, but myopathy appears to be a class-effect of statins, dose-dependent

and associated with statin concentrations in the blood (Bradford et al., 1991; Dujovne

et al., 1991; Laaksonen 2006).

Nonspecific muscle aches or joint pains that are not associated with significant

increases in CK are reported generally by 1–5% of participants in placebo-controlled

trials, with no significant differences in reporting between the statin and the placebo

groups (Thompson et al., 2003; Armitage 2007). The incidence of statin-induced

myopathy is approximately 11 in 100000 person-years of follow-up, whereas

rhabdomyolysis is even more rare (approximately 3.4 per 100 000 person-years), but

the incidences of both increase with higher doses of statins and other predisposing

factors (Graham et al., 2004; Law and Rudnicka 2006; Armitage 2007). However,

accurate estimation of the occurrence of muscle-related symptoms less severe than

rhabdomyolysis is difficult, due to poor reporting and general exclusion of patient

groups prone to statin-induced myopathy from large clinical trials (Law and

Rudnicka 2006, Vaklavas et al., 2008).

20

It has been suggested that the frequencies of mild and moderate muscle symptoms with

high-dose statin therapy may be more common than as estimated from the large

clinical trials. For example, in the PRIMO (Prediction du Risque Musculaire en

Observationnel) study, 10.5% of patients receiving high-dose statin therapy

complained of muscle pain, and the highest rate (18.2%) was associated with high-dose

simvastatin treatment (Bruckert et al., 2005).

Most of the predisposing factors for statin-induced muscle-related adverse effects

promote myopathy by altering the metabolism and increasing the bioavailability of

statins (Table 2.2). Comedication with drugs that share common metabolic pathways

can significantly increase the likelihood of muscle toxicity (Thompson et al., 2003;

Law and Rudnicka 2006; Neuvonen et al., 2006; Armitage 2007).

Table 2.2 Potential factors predisposing to statin-induced myopathy

Alcoholconsumption

Coadministration of interacting drugs (CYP3A4 inhibitors, fibrates, cyclosporine, amiodarone)a

Diabetes

Genetic differences in drug disposition genesb

Increasing age

Increasing statin dose

Female gender

Renal insufficiency

Hepatic dysfunction

Hypothyroidism

Perioperative period

Metabolic muscle diseases

Polymyalgia rheumatica

Steroid use

Strenuous exercise

This table was adapted from (Pasanen et al., 2008)

Genetic differences in drug metabolizing enzymes or drug transporters can also

predispose to statin myotoxicity. An article published associated SLCO1B1

polymorphism with a considerably elevated risk for myopathy (SEARCH

Collaborative Group 2008). In this study, two sets of patient and control groups from

large trials involving approximately 12 000 and 20 000 participants were treated with

80 mg and 40 mg of simvastatin per day, respectively. A strong association was found

between myopathy and two tightly linked variants in SLCO1B1, the other one being

21

the c.521T>C variant. The odds ratio for myopathy was 4.5 per copy of the c.521C

allele, and 16.9 in c.521CC, compared with the c.521TT homozygotes. In this large-

scale study, approximately 60% of the simvastatin-induced myopathy cases were

attributable to the c.521 variant allele.

In a previous Japanese study, the SLCO1B1*15 haplotype also containing the

c.521T>C SNP (c.388G-c.521G) was associated with pravastatin-induced myopathy

(Morimoto et al., 2004, 2005).

Little is known about the precise mechanisms through which statins are transported

into skeletal muscle cells and how they produce muscle injury. The inhibition of

HMG-CoA reductase by statins also reduces the production of downstream

intermediate metabolites in the cholesterol synthesis pathway, including isoprenoid

cometabolites (Figure 2.5). This in turn may interfere with protein modification at

multiple levels and affect protein prenylation and glycosylation, leading to depletion of

muscle fibres from growth signals and susceptibility to mechanical stress (Thompson

et al., 2003; Dirks and Jones 2006; Shitara and Sugiyama 2006).

Statin-induced myopathy may also be associated with mitochondrial dysfunction, since

ubiquinone biosynthesis is interrupted (Laaksonen 2006; Littarru and Langsjoen

2007). High-dose statin therapy has been shown to lead to changes in skeletal muscle

sterol metabolism and to decrease mitochondrial volume and mitochondrial DNA in

skeletal muscle (Päivä et al., 2005; Schick et al., 2007).

In previous studies, the SLCO1B1 c.521C allele has been associated with increased

plasma concentrations of pravastatin, rosuvastatin and pitavastatin (Nishizato et al.,

2003; Mwinyi et al., 2004; Niemi et al., 2004; Chung et al., 2005; Lee et al., 2005a).

In addition, the acute effect of pravastatin on hepatic cholesterol synthesis was

significantly reduced in carriers of the *17 haplotype (g.-11187A-g.-10499A-c.388G-

c.521C) (Niemi et al., 2005c), although this effect was not seen in a 3-week multiple-

dose pravastatin study (Igel et al., 2006). On the other hand, the c.521TC genotype has

been associated with a reduced cholesterol-lowering efficacy in Japanese patients using

simvastatin, atorvastatin or pravastatin (Tachibana-Iimori et al., 2004). Moreover, the

c.521T>C variant and the c.388A>G variant were associated with a slightly attenuated

22

response (1.28% ± 0.25% smaller reduction in LDL-C per c.521C allele) and a slightly

enhanced response (0.62% ± 0.18% larger reduction in LDL-C per c.388G allele) in 4–

6 weeks of simvastatin therapy, respectively (Heart Protection Study Collaborative

Group 2002; SEARCH Collaborative Group 2008). This is consistent with studies

that have associated the SLCO1B1 (c.521T>C) variant with decreased activity of

OATP1B1 and the SLCO1B1*1B haplotype with increased activity of OATP1B1

(Mwinyi et al., 2004, 2008; Maeda et al., 2006).

23

CHAPTER 3

Materials and methods

3.1. Materials

3.1.1. Equipments (Table 3.1)

Table 3.1 Equipment used in this study.

Instrument Manufacturer

TPersonal thermocycler. Biometra – Germany

Minispin Microfuge. Eppendorf – Germany

Power Supply Consort 200V 200mA 20W. Anachem – UK

Vortex mixer. Unico – Spain

DRY BLOCK THERMOSTAT TDB-100. BOECO – Latvia

Water bath. Gemmy – Taiwan

Centrifuge. LW Scintific – USA

3.1.2. List of reagents and chemicals (Table 3.2)

Table 3.2 Chemicals and Reagents used in this study:

Reagents and Chemicals Manufacturer

Primers Metabion, Germany

Wizard Genomic DNA purification kit Promega, USA

50 bp DNA ladder New England Biolabs, England

GoTaq Green Master Mix Promega, USA

Agarose Promega, USA

Ethedium promide Promega, USA

Isopropanol Sigma-Aldrich, China

70% ethanol Israel

24

3.1.3. Primers used in this study

3.1.3.1. Primers for CYP3A4 (c.522-191C>T).

Table 3.3 Primers for CYP3A4 (c.522-191C>T).

ID Description Sequence (5’ 3’)

Amplicone

size (bp)

WT Wild-type specific : AGTGTCTCCATCACACCCACC

247 MT Mutant specific : AGTGTCTCCATCACACCCACT

R Common reverse TGATCACATCCATGCTGTAG

Mismatch was intentionally introduced at the penultimate primer position (underlined)

to increase the specificity of reaction.

3.1.3.2. Primers for SLCO1B1 (c.521T>C) polymorphism.

Table 3.4 Primers and their sequences for SLCO1B1 (c.521T>C) polymorphism

(Zhang W. et al., 2007).

ID Description Sequence (5’ 3’) Amplicone

size (bp)

F Common forward AAGTAGTTAAATTTGTAATAGAAATGC

TT: 260 + 179

TC: 260 + 123 +

179

CC: 260 + 123

WT Wild-type specific GGGTCATACATGTGGATATAAGT

MT Mutant specific AAGCATATTACCCATGAACG

R Common reverse GTAGACAAAGGGAAAGTGATCATA

All primers were reconstituted in normal nuclease-free water and adjusted to a

concentration of 100 µM.

3.1.4. Disposables

Table 3.5 A list of disposables consumed in the study

Item Manufacturer

Sterile 1.5ml microcentrifuge tubes Different manufacturers

Sterile thin-wall polypropylene PCR

tubes with attached caps for labeling Different manufacturers

Micropipette tips (different sizes from Different manufacturers

25

0.2µ to1000µ)

2.5 K3 EDTA tubes BD Vacutainer – USA

Syringe 5 ml Homed – China

23 Gauge needle Homed – China

3.2. Methods

3.2.1 Study Design

The study utilised a cross-sectional convenience sample. The study population

included: all patients attending the European Gaza Hospital cardiac catheterization

department for follow up after percutaneous coronary intervention (PCI) and who were

being managed with a statin drug; cardiac patients in the cardiology department at

Shifa Hospital; and cardiac patients in the cardiology department at Nasser Hospital

between April 1, 2014 and June 1, 2014.

3.2.2 Study Population

A total of 123 patients from the European Gaza Hospital cardiac catheterization

department, the cardiology department at Shifa Hospital, and Nasser Hospital.

The sample covered the five main Governorates of Gaza strip: North Gaza, Gaza City,

Mid-Zone, Khan Younis and Rafah. During the statistical analysis we've integrated

North and Gaza governorates under the name of North governorates and Khan Younis

and Rafah governorates under the name of South governorates. The sample consisted

of 81 males and 42 females with ages ranging from 34 years to 86 years, with a mean

age of 60.0±10.1 years.

3.2.3 Ethical Considerations

Approval of the Helsinki Committee was obtained (Appendix 1) to perform this study

and collect blood samples from patients. The approval of MOH (Appendix 2) was

obtained to collect samples from Al-Shifa Hospital and the Gaza-European Hospital.

The aims and objectives of the study were explained to patients, and oral consent was

obtained for participation in this study and for the collection of blood samples for

analysis.

26

3.2.4 Inclusion criteria:

1. Acute Coronary Syndrome patients who underwent PCI.

2. Unrelated men and women.

3. Treated with statin.

3.2.5. Clinical data collection and assessment

Personal and clinical data were collected from the patient, and the patients’ hospital

medical record. The data included gender, age, geographical location, medications,

laboratory tests, history of recurrent complications related to their medical condition,

the presence/absence of muscle pain.

In addition, six months after blood sample collection, the patients were questioned to

ascertain the presence of muscle pain which had commenced after statin therapy was

initiated, and confounding factors such as predisposing medication or substance abuse

were excluded.

Data was recorded on a written form (Appendix 3) provided for each patient after

explaining the aim of the study and oral consent was obtained to participate in the

study and have blood samples collected.

The reference intervals for medical tests obtained from the patient's record are listed in

Table 3.6.

Table 3.6 The study tests

Test reference values

Cholesterol < 200 mg/dl

Lactate Dehydrogenase 225-450 U/L

Creatine Kinase Female: 26-155 U/L

Male:26-190 U/L

3.2.6. Blood sample collection

Whole blood samples were collected from 123 patients in EDTA tubes.

Approximately 5 ml venous blood samples was collected in each tube from each

patient and subjected to DNA extraction.

27

3.2.7. DNA extraction

DNA was extracted from blood samples using the Wizard Genomic DNA Kit from

Promega, USA according to the manufacturer’s recommendations.

Briefly, RBCs from 300 µl blood samples were lysed by 900 µl of cell lysis solution in

1.5 ml microcentrifuge tube, mixed by inversion and left for 10 minutes. The WBCs

were pelleted by centrifugation for 20 seconds at 14000 rpm and the supernatant was

discarded. The WBCs were lysed using 300 µl of the nuclei lyses solution, and mixed

by inversion. Proteins were precipitated by adding 100 µl protein precipitation buffer

and mixed by vortex for 20 seconds, then centrifuged at 14000 rpm for 3 minutes. The

supernatant containing the nucleic acid was transferred to a new tube containing 300 µl

of isopropanol and the DNA was pelleted by vortex for 20 seconds followed by

centrifugation at 14000 rpm for 1 minute. The pelleted DNA was washed by 300 µl of

70 % ethanol and centrifuged at 14000 rpm for 1 minute. The ethanol was aspirated

and discarded, and the pellet air-dried for 10-15 minutes. Finally the DNA pellet was

resuspended in 80 µl of the provided alkaline rehydration solution and rehydrated at 65

ºC for 1 hour. The quantity and quality of DNA were assessed spectrophotometrically.

3.2.8. Procedure of CYP3A4 (c.522-191C>T) detection by PCR

For the CYP3A4 (c.522-191C>T), PCR was carried out in a 20 µl volume containing

50-100 ng of extracted DNA, 5 pmol of each primer (Table 3.3) and 10 µl of 2X

GoTaq Green master mix.

The cycling profile consisted of an initial denaturation step at 94 °C for 5 minutes;

followed with 37 cycles of 94 °C for 30 seconds, 56 °C for 30 seconds, and 72 °C for

60 seconds; and a 10-minute final extension at 72 °C. The 247-bp PCR products were

subjected to electrophoresis in 2% agarose gel, visualized on a UV transilluminator and

photographed with a high resolution camera.

3.2.9. Procedure of SLCO1B1 (c.521T>C) polymorphism detection by PCR

For the SLCO1B1 (c.521T>C) polymorphism, PCR was carried out in a 30 µl volume

containing 50-100 ng of extracted DNA, 10 pmol of each primer (Table 3.4), 15 µl of

2X GoTaq Green master mix.

28

The cycling profile used consisted of an initial denaturation step at 94 °C for 5

minutes; followed with 37 cycles of 94 °C for 30 seconds, 52 °C for 40 seconds, and

72 °C for 40 seconds; and a 10-minute final extension at 72 °C. The 260-bp, 174-bp,

and 123-bp products were subjected to electrophoresis in 2% agarose gel, visualized on

a UV transilluminator and photographed with a high resolution camera.

3.2.10. Quality control

Blank control samples were applied in each run of PCR along with patients’ samples

without addition of any DNA material but using a nuclease free water instead. The

blank samples were treated side by side with the patients’ samples allover the

procedure. Only PCR tests which showed no amplification products in the blank were

considered valid.

3.3. Data Analysis

Collected data were reviewed for completeness and accuracy, tabulated and analyzed

using the Statistical Package for Social Science (SPSS) software version 17 and

appropriate statistical procedures. To ensure the accuracy and completeness of all

questions, frequency distribution and cross tabulation were done for the entire data.

Descriptive statistics were used for summarization of data. For quantitative variables,

mean and standard deviation were calculated. T-test was used for comparing the means

between the different groups of cases. And the Chi-square (χ2) test was used for

analysis of categorical data.

29

CHAPTER 4

Results

4.1. Description of the study sample

4.1.1. Description by gender

Table 4.1 illustrates the gender frequency of the study sample, with 81 males

constituting 65.9%, and 42 females constituting 34.1%.

Table 4.1 Gender frequency of the study sample

Gender Frequency Percent (%)

Male 81 65.9

Female 42 34.1

Total 123 100.0

4.1.2. Description by age

Table 4.2 describes the mean age of the study population distributed as males and

females. The ages of the males ranged from 34 years to 80 years, with a mean of 57.58

years and a standard deviation of 9.82 years.

The ages of the females ranged from 45 years to 86 years, with a mean of 64.69 years

and a standard deviation of 9.06 years.

Table 4.2 Description of males and females by age (years)

Males Females

Mean 57.58 64.69

Std. Deviation 9.82 9.06

4.1.3. Description by region in the study population

Table 4.3 illustrates the frequency by region of the study sample, with 47 participants

from North governorates (38.2%), 24 from Middle governorates (19.5%), and 52 from

South governorates (42.3%).

30

Table 4.3 Regional frequency of the study sample

Region Frequency Percent (%)

North governorates 47 38.2

Middle governorates 24 19.5

South governorates 52 42.3

Total 123 100.0

4.1.4. Description of clinical conditions of the study sample

Table 4.4 describes the distribution of the study sample based on their clinical status.

The results show that the frequency of diabetes mellitus is 75 patients (61%) suffered

from diabetes mellitus, and 48 (39%) did not.

The frequency of hypertension in the study sample is 83 suffered from hypertension

(67%), and 40 (32%) did not.

The frequency by open-heart surgery of the study sample is 5 people had undergone

open-heart surgery (4.1%) while 118 had not (95.9%).

The frequency of muscle pain in the study sample 6 months after initiation of statin

therapy is 49 people had muscle pain (39.8%) while 74 had not (60.2%).

Table 4.4 Description of diabetes mellitus, hypertension, open-heart

surgery and muscle pain frequencies of the study sample

Diabetes Mellitus Frequency Percent (%)

No 48 39.0

Yes 75 61.0

Total 123 100.0

Hypertension

No 40 32.5

Yes 83 67.5

Total 123 100.0

31

Open-Heart Surgery

No 118 95.9

Yes 5 4.1

Total 123 100.0

Muscle Pain

No 74 60.2

Yes 49 39.8

Total 123 100.0

4.1.5. Description of cholesterol, lactate dehydrogenase and creatine kinase levels

in the study sample according to muscle pain

Table 4.5 illustrates the mean and standard deviation of cholesterol, lactate

dehydrogenase and creatine kinase levels in the study sample according to muscle pain,

showing that the mean of cholesterol level is not different in patients who had muscle

pain (206.13 mg/dl) and those who had not (206.12 mg/dl).

The mean of lactate dehydrogenase level is (594.53 U/L) in patients who had muscle

pain and (435.89 U/L) in those who had not.

The mean of creatine kinase level is (248.65 U/L) in patients who had muscle pain and

(263.33 U/L) in those who had not.

Table 4.5 Description of cholesterol, lactate dehydrogenase and creatine kinase levels

in study sample.

Mean ± Std. Deviation P value*

Muscle pain No muscle pain

cholesterol (mg/dl) 206.12 ± 47.88 206.13 ± 63.81

lactate dehydrogenase(U/L) 594.53 ± 213.36 435.89 ± 170.80 0.00

creatine kinase(U/L) 248.65 ± 168.74 263.33 ± 336.96 0.78

*P-value of less than 0.05 was considered significant.

32

4.2. Genotype

4.2.1. Description of CYP3A4 (c.522-191C>T) genotype

Table 4.6 illustrates the frequency of CYP3A4 (c.522-191C>T) in the study sample,

with 99 Wild Type constituting 80.5%, 23 Heterozygous constituting 18.7%, and 1

Homozygous constituting 0.8%. A representative gel photograph of CYP3A4 (c.522-

191C>T) PCR result is showed in figure 4.1.

Figure 4.1 representative photograph showing agarose electrophoresis gel of

CYP3A4 (c.522-191C>T)

Lanes 1-5 are patients samples, N is non-template blank and M is 50 bp ladder. Wildtype and mutant

sets were performed for each sample. The expected amplicon size is 247 bp.

Table 4.6 Frequency of CYP3A4 (c.522-191C>T)

Frequency Percent (%)

Wild Type 99 80.5

Heterozygous 23 18.7

Homozygous 1 0.8

Total 123 100.0

The calculated allelic frequency of the susceptibility allele (T) was 10.16 % and the

Wild Type allele (C) was 89.84%. Both alleles are in Hardy-Weinberg Equilibrium (P-

Value = 0.79).

33

4.2.2. Description of SLCO1B1 (c.521T>C) genotype

Table 4.7 illustrates the frequency of SLCO1B1 (c.521T>C) in the study sample, with

91 Wild Type constituting 74% and 32 Heterozygous constituting 26% and no

homozygots. A representative gel photograph of SLCO1B1 (c.521T>C) PCR result is

showed in figure 4.2.

Figure 4.2 representative photograph showing agarose electrophoresis gel of

SLCO1B1 (c.521T>C)

Lanes 1-11 are patients samples, N is non-template blank, M is 50 bp ladder, C is amplification control

band (260 bp), Wt is wild-type specific band and (179bp) and Mt is mutant specific band (123bp).

Table 4.7 Frequency of SLCO1B1 (c.521T>C)

The calculated allelic frequency of the susceptibility allele (C) was 13.01 % and the

Wild Type allele (T) was 86.99%. Both alleles are in Hardy-Weinberg Equilibrium (P-

Value = 0.09).

4.2.3. Description of the compound genotype

Taking the genotypes obtained for both genes CYP3A4 (c.522-191C>T) and

SLCO1B1 (c.521T>C) together resulted in 5 combinations as illustrated in table 4.8.

The combinations are as follows: 75 people (Wild Type/Wild Type) 61.0%, 16 people

(Heterozygous/Wild Type) 13.0%, 1 person (Homozygous/Heterozygous) 0.8%, 25

people (Wild Type/Heterozygous) 20.3% and 6 people (Heterozygous/Heterozygous)

4.9%.

Frequency Percent (%)

Wild Type 91 74.0

Heterozygous 32 26.0

Total 123 100.0

34

Table 4.8 Both genes frequency of the study sample

CYP3A4/ SLCO1B1 Frequency Percent (%)

(Wild Type / Wild Type) 75 61.0

(Heterozygous/ Wild Type) 16 13.0

(Homozygous/ Heterozygous) 1 0.8

(Wild Type/ Heterozygous) 25 20.3

(Heterozygous/ Heterozygous) 6 4.9

Total 123 100.0

4.3. Relationships

4.3.1. Relationship between CYP3A4 (c.522-191C>T) and muscle pain

The results show that 28 people from the study sample with Wild Type suffered from

muscle pain, (28.3%), and 71 (71.7%) did not. On the other hand, 20 people from the

study sample with a Heterozygous genotype suffered from muscle pain (87%) and

three (13%) did not, and the one homozygote patient suffered from muscle pain. The

distribution was statistically significant (P-value= 0.00, odds ratio for heterozygous =

16.9) as shown in table 4.9.

Table 4.9 Relationship between CYP3A4 (c.522-191C>T) genotype and muscle pain

CYP3A4 (c.522-

191C>T)

Muscle pain P

value*

odds

ratio 95% C.I.

No Yes

0.00 16.9

Lower Upper

Wild Type

Number

(Percent

(%))

71

(71.7%)

28

(28.3%)

4.65

61.40

Heterozygous 3

(13.0%)

20

(87.0%)

Homozygous 0

(0.0%)

1

(100.0%)

Total 74

(60.2%)

49

(39.8%)

*P-value of less than 0.05 was considered significant.

35

4.3.2. Relationship between SLCO1B1 (c.521T>C) and muscle pain

The results showed that 19 people from the study sample with Wild Type genotype

suffered from muscle pain (20.9%) and 72 (79.1%) did not. On the other hand, 30

people from the study sample with Heterozygous genotype suffered from muscle pain,

a rate of 93.8%, and 2 (6.3%) did not. the distribution was statistically significant (P-

value= 0.00, odds ratio for heterozygous = 56.8) as shown in table 4.10.

Table 4.10 Relationship between SLCO1B1 (c.521T>C) genotype and muscle pain

SLCO1B1 (c.521T>C ) Muscle pain

P

value*

odds

ratio 95% C.I.

No Yes

0.00 56.8

Lower Upper

Wild Type

Number

(Percent

(%))

72

(79.1%)

19

(20.9%)

12.45

259.37

Heterozygous

2

(6.3%)

30

(93.8%)

Total 74

(60.2%)

49

(39.8%)

*P-value of less than 0.05 was considered significant.

4.3.3. Relationship between the compound genotype of CYP3A4 (c.522-191C>T)

and SLCO1B1 (c.521T>C) and muscle pain

Table 4.11 illustrates the relationship between the five categories of CYP3A4 (c.522-

191C>T) and SLCO1B1 (C.521T>C) compound genotype and muscle pain.

The results showed that six from the Wild Type/Wild Type group suffered from

muscle pain, a rate of 8%, and 69 (92%) did not; 13 from the Heterozygous/Wild Type

group suffered from muscle pain, a rate of 81.3%, and 3 (18.8%) did not; one from the

Homozygous/Heterozygous group suffers from muscle pain, a rate of 100%; 23 from

the Wild Type/Heterozygous group suffered from muscle pain, a rate of 92%, and two

(8%) did not; and six from the Heterozygous/Heterozygous group suffered from

muscle pain, a rate of 100%. The distribution was statistically significant (P-value=

0.00).

36

Table 4.11 Relationship between CYP3A4 (c.522-191C>T) and SLCO1B1

(c.521T>C) compound genotype and muscle pain

CYP3A4 (c.522-191C>T) /

SLCO1B1 (c.521T>C)

Muscle pain P value*

No Yes

(Wild Type/Wild Type)

Number

(Percent

(%))

69 (92.0%) 6 (8.0%)

0.00

(Heterozygous/Wild Type) 3 (18.8%) 13 (81.3%)

(Homozygous/Heterozygous) 0 (0%) 1 (100%)

(Wild Type/Heterozygous) 2 (8.0%) 23 (92.0%)

(Heterozygous/Heterozygous) 0 (.0%) 6 (100.0%)

Total 74 (60.2%) 49 (39.8%)

*P-value of less than 0.05 was considered significant.

4.3.4. Relationship between lactate dehydrogenase level and muscle pain

When we studied the relationship between lactate dehydrogenase and muscle pain by

comparing the mean of its level we found a statistically significant relationship (P-

value= 0.00), as shown in table 4.5. The level of lactate dehydrogenase was higher in

patients with muscle pain than those without.

When we classified the results of the lactate dehydrogenase test into normal and

abnormal and performed a statistical analysis the results showed that 9 people from the

study sample with normal lactate dehydrogenase suffered from muscle pain, a rate of

15%, and 51 (85%) did not. In comparison, 40 people from the study sample with

abnormal lactate dehydrogenase suffered from muscle pain, a rate of 63.5%, and 23

(36.5%) did not. The relationship was statistically significant (P-value= 0.00), as

shown in table 4.12.

Table 4.12 Relationship between lactate dehydrogenase level (U/L) and muscle pain.

Lactate Dehydrogenase Muscle pain P value*

No Yes

0.00 Normal

Number

(Percent (%))

51 (85.0%) 9 (15.0%)

Abnormal 23 (36.5%) 40 (63.5%)

Total 74 (60.2%) 49 (39.8%)

*P-value of less than 0.05 was considered significant.

37

4.3.5. Relationship between creatine kinase level and muscle pain

By comparing the mean of creatine kinase level in relation to suffering from muscle

pain the mean difference was not statistically significant (P-value= 0.78), as shown in

table 4.5.

When the creatine kinase test results were classified into normal and abnormal, the

results showed that 16 people from the study sample with normal creatine kinase

suffered from muscle pain, a rate of 25.8%, and 46 (74.2%) did not. on the other hand,

33 people from the study sample with abnormal creatine kinase suffered from muscle

pain, a rate of 54.1%, and 28 (45.9%) did not. The relationship was statistically

significant (P-value= 0.001), as shown in table 4.13.

Table 4.13 Relationship between creatine kinase level (U/L) and muscle pain

Creatine Kinase Muscle pain P value*

No Yes

0.001 Normal

Number

(Percent (%))

46 (74.2%) 16 (25.8%)

Abnormal 28 (45.9%) 33 (54.1%)

Total 74 (60.2%) 49 (39.8%)

*P-value of less than 0.05 was considered significant.

4.3.6. Relationship between lactate dehydrogenase level and CYP3A4 (c.522-

191C>T) genotype

When we classified the results of lactate dehydrogenase test into normal and abnormal

and performed a statistical analysis the results showed that the relationship between

lactate dehydrogenase level and CYP3A4 (c.522-191C>T) genotype in patients who

suffered from muscle pain and those who didn’t was not statistically significant (P-

values = 0.235 and 0.210 respectively), as shown in table 4.14.

38

Table 4.14 Relationship between lactate dehydrogenase level (U/L) and CYP3A4

(c.522-191C>T) genotype

Muscle

pain CYP3A4 (c.522-191C>T)

Lactate Dehydrogenase P value*

Normal Abnormal

0.235 NO

WT.

Number

(Percent (%))

48 (67.6%) 23 (32.4%)

Hetero. 3 (100%) 0 (0%)

Total 51 (68.9%) 23 (31.1%)

YES

WT. 3 (10.7%) 25 (89.3%)

0.210 Hetero. 6 (30.0%) 14 (70.0%)

Homo. 0 (0%) 1 (100%)

Total 9 (18.4%) 40 (81.6%)

*P-value of less than 0.05 was considered significant.

4.3.7. Relationship between creatine kinase level and CYP3A4 (c.522-191C>T)

genotype

When the creatine kinase test results were classified into normal and abnormal, the

results showed that the relationship between creatine kinase level and CYP3A4 (c.522-

191C>T) genotype in patients who suffered from muscle pain was not statistically

significant (P-value= 0.552), but it was statistically significant (P-value= 0.023) in

patients who did not suffer from muscle pain, as shown in table 4.15.

Table 4.15 Relationship between creatine kinase level (U/L) and CYP3A4 (c.522-

191C>T)

Muscle

pain CYP3A4 (c.522-191C>T)

Creatine Kinase P value*

Normal Abnormal

0.023 NO

WT.

Number

(Percent (%))

46 (64.8%) 25 (35.2%)

Hetero. 0 (0%) 3 (100%)

Total 46 (62.2%) 28 (37.8%)

YES

WT. 8 (28.6%) 20 (71.4%)

0.552 Hetero. 8 (40.0%) 12 (60.0%)

Homo. 0 (0%) 1 (100%)

Total 16 (32.7%) 33 (67.3%)

*P-value of less than 0.05 was considered significant.

39

4.3.8. Relationship between lactate dehydrogenase level and SLCO1B1

(c.521T>C) genotype

When we classified the results of the lactate dehydrogenase level test into normal and

abnormal and performed a statistical analysis the results showed that the correlation

between lactate dehydrogenase and SLCO1B1 (c.521T>C) in patients who had muscle

pain was statistically significant (P-value= 0.050), but not statistically significant (P-

value= 0.336) in patients who did not have muscle pain, as shown in table 4.16.

Table 4.16 Relationship between lactate dehydrogenase level (U/L) and SLCO1B1

(c.521T>C) genotype

Muscle

pain SLCO1B1 (C.521T>C)

Lactate Dehydrogenase P value*

Normal Abnormal

0.336 NO

WT.

Number

(Percent (%))

49 (68.1%) 23 (31.9%)

Hetero. 2 (100%) 0 (0%)

Total 51 (68.9%) 23 (31.1%)

YES

WT. 6 (31.6%) 13 (68.4%)

0.050 Hetero. 3 (10.0%) 27 (90.0%)

Total 9 (18.4%) 40 (81.6%)

*P-value of less than 0.05 was considered significant.

4.3.9. Relationship between creatine kinase level and SLCO1B1 (c.521T>C)

genotype

When the creatine kinase test results were classified into normal and abnormal, the

results showed that the relationship between creatine kinase level and SLCO1B1

(c.521T>C) genotype was not statistically significant in patients who suffered from

muscle pain and those who did not (P-values = 0.719 and 0.261 respectively), as

shown in table 4.17.

40

Table 4.17 Relationship between creatine kinase level (U/L) and SLCO1B1

(C.521T>C)

Muscle

pain SLCO1B1 (C.521T>C)

Creatine Kinase P value*

Normal Abnormal

0.719 NO

WT.

Number

(Percent (%))

45 (62.5%) 27 (37.5%)

Hetero. 1 (50%) 1 (50%)

Total 46 (62.2%) 28 (37.8%)

YES

WT. 8 (42.1%) 11 (57.9%)

0.261 Hetero. 8 (26.7%) 22 (73.3%)

Total 16 (32.7%) 33 (67.3%)

*P-value of less than 0.05 was considered significant.

4.3.10. Relationship between the compound genotype of CYP3A4 (c.522-191C>T)

and SLCO1B1 (c.521T>C) and lactate dehydrogenase level

When we studied the relationship between the compound genotype of CYP3A4 (c.522-

191C>T) and SLCO1B1 (c.521T>C) and lactate dehydrogenase level by comparing

means the results revealed that the relationship was statistically significant (P-value=

0.005). As shown in table 4.18, the levels were highest in Heterozygous/Heterozygous

and Wild Type/Heterozygous genotype and lowest in Wild Type/Wild Type and

Heterozygous/Wild Type.

Table 4.18 Relationship between the compound genotype of CYP3A4 (c.522-191C>T)

and SLCO1B1 (c.521T>C) and lactate dehydrogenase level (U/L)

*P-value of less than 0.05 was considered significant.

CYP3A4 (c.522-191C>T) /

SLCO1B1 (c.521T>C) Mean

Std.

Deviation P value*

(Wild Type/Wild Type) 459.84 180.82

0.005

(Heterozygous/Wild Type) 450.62 154.78

(Homozygous/Heterozygous) 495.00 .

(Wild Type/Heterozygous) 616.60 241.98

(Heterozygous/Heterozygous) 630.00 232.92

Total 499.08 203.59

41

When the lactate dehydrogenase test results were classified into normal and abnormal,

the distribution was statistically significant (P-value=0.00). As shown in table 4.19,

most of the Heterozygous/Heterozygous and Wild Type/Heterozygous had abnormal

levels (83.3% and 84.0% respectively) compared to Wild Type/Wild Type and

Heterozygous/Wild Type (37.3% and 50% respectively).

Table 4.19 Relationship between the compound genotype of CYP3A4 (c.522-191C>T)

and SLCO1B1 (c.521T>C) and lactate dehydrogenase level (U/L)

CYP3A4 (c.522-191C>T) /

SLCO1B1 (C.521T>C)

Lactate Dehydrogenase P value*

Normal Abnormal

(Wild Type/Wild Type)

Number

(Percent (%))

47 (62.7%) 28 (37.3%)

0.000

(Heterozygous/Wild Type) 8 (50.0%) 8 (50.0%)

(Homozygous/Heterozygous) 0 (0%) 1 (100%)

(Wild Type/Heterozygous) 4 (16.0%) 21 (84.0%)

(Heterozygous/Heterozygous) 1 (16.7%) 5 (83.3%)

Total 60 (48.8%) 63 (51.2%)

*P-value of less than 0.05 was considered significant.

4.3.11. Relationship between the compound genotype of CYP3A4 (c.522-191C>T)

and SLCO1B1 (c.521T>C) and creatine kinase level

When we classified the results of the creatine kinase test into normal and abnormal and

performed a statistical analysis the results showed that the correlation between

compound genotype of CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C), and

creatine kinase was statistically significant (P-value=0.027). As shown in table 4.20

most of the Heterozygous/Heterozygous and Wild Type/Heterozygous had abnormal

levels (83.3% and 68% respectively) compared to Wild Type/Wild Type and

Heterozygous/Wild Type (38.7% and 56.3% respectively).

42

Table 4.20 Relationship between the compound genotype of CYP3A4 (c.522-191C>T)

and SLCO1B1 (c.521T>C), and creatine kinase level (U/L)

CYP3A4 (c.522-191C>T) /

SLCO1B1 (c.521T>C)

Creatine Kinase P value*

Normal Abnormal

(Wild Type / Wild Type)

Number

(Percent (%))

46 (61.3%) 29 (38.7%)

0.027

(Heterozygous/Wild Type) 7 (43.8%) 9 (56.3%)

(Homozygous/ Heterozygous) 0 (.0%) 1 (100%)

(Wild Type/ Heterozygous) 8 (32.0%) 17 (68.0%)

(Heterozygous/ Heterozygous) 1 (16.7%) 5 (83.3%)

Total 62 (50.4%) 61 (49.6%)

*P-value of less than 0.05 was considered significant.

43

CHAPTER 5

Discussion

Previous studies have indicated the existence of a relationship between SLCO1B1

(c.521T>C) and CYP3A4 (c.522-191C>T) and statin-induced myopathy. As most

patients in Gaza who have coronary heart disease take statin drug therapy to lower

their cholesterol levels, it is very important to determine the impact of the carriage of

SLCO1B1 (c.521T>C) and CYP3A4 (c.522-191C>T) on the risk of statin-induced

muscle pain, which is an early indicator of myopathy. This could allow the

development of appropriate interventions to prevent the development of myopathy in

these susceptible patients.

5.1. CYP3A4 (c.522-191C>T)

CYP3A4 (c.522-191C>T) frequency in the study sample was 99 Wild Type

constituting 80.5%, 23 Heterozygous constituting 18.7%, and 1 Homozygous

constituting 0.8%.

Allelic frequency calculations showed that the susceptibility allele (T) was 10.16 %,

which is higher than that reported by the National Center for Biotechnology

Information (NCBI) database of single nucleotide polymorphisms (dbSNP)

(MAF/MinorAlleleCount of 1.5% and average heterozygousoty of 3%)(NCBI 2014). It

is also higher than Caucasian (6.1%-8.3%) (Okubo at al. 2013), Japanese (5%–7%),

African Americans (4.3%), Chinese (4.3%), and Caucasians (8.3%) (Thompson et al.,

2004) Both alleles were within the Hardy-Weinberg Equilibrium Model (P-Value =

0.79).

No previous study in the reviewed literature has reported CYP3A4 (c.522-191C>T)

polymorphism frequency in the Arab population. This study thus contributes important

new data to the knowledge base, as well as to the management of Arab patients, whose

needs have now been demonstrated to be higher than those of other populations.

44

5.2. SLCO1B1 (c.521T>C)

SLCO1B1 (c.521T>C) frequency of the study sample was 91 Wild Type constituting

74%, and 32 Heterozygous constituting 26%.

The calculated allelic frequency of the susceptibility allele (C) was 13.01 % and the

Wild Type allele (T) was 86.99%. Both alleles are within the Hardy-Weinberg

Equilibrium Model (P-Value = 0.09).

SLCO1B1 (c.521T>C) frequency in this study falls in the middle compared to results

of previous studies: 24% in Native American populations, 20% in the Middle East,

18% in Europe, 12% in East Asia, 9.4% in Central/South Asia, 1.9% in Sub-Saharan

Africa, 15% in the Kerala population and 15-16% in populations of Caucasian decent

(Pasanen et al., 2008; Lakshmi et al., 2014; Santos et al., 2011; Donnelly et al.,

2011). A study of different ethnic groups in Brazil reported the allele to be present in

the highest numbers in American-Indians (28.3% heterozygous and 9.9% homozygous)

and lowest in African descent subjects (5.7% and 0%), in contrast to Mulatto (14.9%

and 2.4%) and Caucasian descent (14.8% and 4.1%) (Santos et al., 2011).

5.3. Muscle Pain and Myopathy

Of the 123 cardiac patients who were taking a statin drug and who were asked about

the presence of muscle pain and difficulty walking six months after initiating the drug,

49 people subsequently reported they have muscle pain (39.8%) while 74 did not

(60.2%).

Their muscle pain was confirmed by significant elevation of lactate dehydrogenase

level, a result that concords with those of Yousaf and Powell 2012, who found that

levels of lactate dehydrogenase are elevated in people with muscle pain. When the

relationship between lactate dehydrogenase and muscle pain was considered, the

results revealed a statistically significant elevation of mean lactate dehydrogenase level

among patients suffering from muscle pain compared to those who aren’t (P-value=

0.00). and when the results of the lactate dehydrogenase test were classified into

normal and abnormal and a statistical analysis performed, the results showed that the

45

relationship between lactate dehydrogenase and muscle pain was statistically

significant (P-value= 0.00).

The previously-reported relationship between myopathy and patient reports of muscle

pain and weakness (Thompson et al., 2003) combined with the results of this study, ie

reports of muscle pain and difficulty walking at six months after initiation of statin

therapy, suggest that the existence of these factors after statin therapy initiation may be

an early indication for myopathy, thus a sentinel event to consider treatment

modification.

5.4. Cholesterol Test and Muscle Pain

Cholesterol screening was conducted for all patients, and the results showed that the

mean level of cholesterol was not significantly different in patients who had muscle

pain and in those without muscle pain.

This result is to be expected because statin drugs are designed to lower cholesterol

levels, and after at least six months of therapy, the levels should be near normal. It

also confirms that the patients in the study had used the drug for a sufficient time.

5.5. CYP3A4 (c.522-191C>T) and Muscle Pain

The relation between CYP3A4 (c.522-191C>T) and muscle pain in this study was

statistically significant (P-value= 0.00). The majority of those carrying the

susceptibility T - allele (hetero- or homozygous) complained of muscle pain compared

to homozygous wild-type (odds ratio for heterozygous = 16.9).

Although this study did not measure statin plasma concentrations, the relationship

between genetic variation in CYP3A4, plasma statin concentrations and myopathy,

therefore muscle pain, has already been established. (Kitzmiller et al., 2014;

Thompson et al., 2003)

Genetic variation in CYP3A4 has been shown to be associated with plasma simvastatin

concentrations (Kitzmiller et al., 2014), and a previous study showed that increased

plasma concentrations of simvastatin significantly increased the risk of myopathy

46

(Thompson et al., 2003). Another previous study showed that the CYP3A4*22

polymorphism was associated with reduced CYP3A4 protein expression levels and

resulted in decreased CYP3A4-dependent activities in human livers which resulted in

increased plasma statin concentrations thus enhancing the risk of systemic adverse

effects, such as myopathy (Okubo et al., 2013).

5.6. SLCO1B1 (c.521T>C) and Muscle Pain

The correlation between SLCO1B1 (c.521T>C) and muscle pain in this study was

statistically significant (P-value= 0.00), and is compatible with previous studies that

indicated that the SLCO1B1 (c.521T>C) allele causes lower statin uptake in the liver,

and is a risk factor for statin-induced myopathy (Santos et al., 2011; Donnelly et al.,

2011). Moreover, Voora et al showed that SLCO1B1*5 genotype was associated with

statin-induced side effects (Voora et al., 2009).

Access into the liver is an important step in the elimination of many endogenous

compounds and xenobiotics, including most drugs. Statins exert their cholesterol-

lowering effects by inhibiting the HMG-CoA reductase in the hepatocytes. Therefore,

reduced OATP1B1-mediated uptake into the liver due to genetic polymorphism in the

encoding SLCO1B1 gene may both reduce statins efficacy and increase their

peripheral plasma concentrations, thus enhancing the risk of systemic adverse effects,

such as myopathy (Niemi et al., 2004). This supports our study’s findings of a

relationship between SLCO1B1 (c.521T>C) and muscle pain, a precursor to myopathy.

A further endorsement of the results is that the single-nucleotide polymorphism,

SLCO1B1 (c.521T>C) or rs4149056T>C, in SLCO1B1 as Ramsey terms it, increases

systemic exposure to simvastatin and the risk of muscle toxicity. (Ramsey et al., 2014)

5.7. Compound genotype of CYP3A4 (c.522-191C>T) and SLCO1B1

(c.521T>C) and Muscle Pain

The relationship between CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C) and

muscle pain in this study was statistically significant (P-value= 0.00). This is a

particularly important finding because previous researchers have only studied either

CYP3A4 (c.522-191C>T) alone, or SLCO1B1 (c.521T>C) alone.

47

All of the Heterozygous/Heterozygous (100%) and most of Wild Type/Heterozygous

and Heterozygous/Wild Type had muscle pain (92% and 81.3% respectively) reported

suffering from muscle pain compared to Wild Type/Wild Type (8%).

In heterozygous individuals with either CYP3A4 (c.522-191C>T) or SLCO1B1

(c.521T>C) the incidence of muscle pain is considerably elevated. However, the

presence of both in a heterozygous individual sees muscle pain reach 100%, suggesting

that these individuals are at extremely high risk.

However, there were only six Heterozygous/Heterozygous cases, which limits the

generalizability of the results.

5.8. Creatine Kinase and Muscle Pain

When we classified the results of the creatine kinase test into normal and abnormal and

performed a statistical analysis, the correlation between creatine kinase and muscle

pain was statistically significant (P-value= 0.00).

These results are compatible with previous studies indicating that statins can cause

muscle pain or weakness (myalgia), sometimes in association with elevated creatine

kinase (CK) levels, myopathy which may progress to muscle breakdown

(rhabdomyolysis), myoglobin release, renal failure and even death (Vaklavas et al.,

2008).

5.9. Lactate Dehydrogenase with CYP3A4 (c.522-191C>T), and

SLCO1B1 (c.521T>C)

When we classified the results of lactate dehydrogenase test into normal and abnormal

and performed a statistical analysis our results showed that the correlation between

lactate dehydrogenase level and CYP3A4 (c.522-191C>T) in patients who had muscle

pain and those who had not was not statistically significant (P-value= 0.235, P-value=

0.210) respectively.

This result was the opposite of the second gene (SLCO1B1 (c.521T>C)), which

showed that the relationship between lactate dehydrogenase and SLCO1B1

48

(c.521T>C) in patients with muscle pain was statistically significant (P-value= 0.050),

and was not statistically significant (P-value= 0.336) in patients who did not have

muscle pain.

In addition, the results showed that in patients who had muscle pain 90% of

heterozygotes for SLCO1B1 (c.521T>C) had abnormal lactate dehydrogenase,

compared to 68.4% of wild type patients (table 4.23).

This result shows that the presence of the allele SLCO1B1 (c.521T>C) in patients who

had muscle pain increased the level of lactate dehydrogenase and thus increased the

risk for myopathy.

5.10. Creatine Kinase with CYP3A4 (c.522-191C>T), and SLCO1B1

(c.521T>C)

The study results showed that the correlation between creatine kinase level and

CYP3A4 (c.522-191C>T) in patients who suffered from muscle pain was not

statistically significant (P-value= 0.552). However, it was statistically significant (P-

value= 0.023) in patients who did not suffer from muscle pain. The results of

correlation between creatine kinase and SLCO1B1 (c.521T>C) in patients who

suffered from muscle pain and those who did not was not statistically significant (P-

value= 0.719, P-value= 0.261) respectively.

The results also showed that in patients who had muscle pain 73.3% of heterozygotes

for SLCO1B1 (c.521T>C) had abnormal creatine kinase level, compared to 57.9% of

wild type patients (table 4.24).

These results, when considered together, show that the presence of the allele

SLCO1B1 (c.521T>C) in patients who had muscle pain increased the level of creatine

kinase and thus increased the risk of myopathy.

49

5.11. Compound Genotype of (CYP3A4 (c.522-191C>T) and

SLCO1B1 (c.521T>C)) and Lactate Dehydrogenase

The study results showed that the relationship between the compound genotype of

(CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C)) and lactate dehydrogenase

level was statistically significant (P-value= 0.00).

Most noteworthy is that 83.3% of study sample with heterozygousoty in the two genes

had abnormal lactate dehydrogenase levels, compared to 37.3% of study sample wild

type for the two genes had abnormal lactate dehydrogenase levels. Thus the presence

of compound heterozygosoty in an individual patient elevates the level of lactate

dehydrogenase which increases the risk of muscle pain and myopathy (table 4.26).

5.12. Compound Genotype of (CYP3A4 (c.522-191C>T) and

SLCO1B1 (c.521T>C)) and Creatine Kinase

The study results showed that the relationship between the compound genotype of

CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C) and creatine kinase level was

statistically significant (P-value= 0.027).

Again, 83.3% of the study sample with heterozygousoty in the two genes had abnormal

levels of lactate dehydrogenase, while 38.7% with wild type in the two genes had

abnormal lactate dehydrogenase levels. Thus, the presence of compound heterozygosis

elevates the level of creatine kinase, which increases the risk of muscle pain and

myopathy (table 4.27).

50

CHAPTER 6

Conclusions and Recommendations

6.1. Conclusions

This study made two new and unique contributions to the current body of scientific

knowledge: the higher frequency of CYP3A4 (c.522-191C>T) in the Arab population;

and the cumulative effect of the presence of both CYP3A4 (c.522-191C>T) and

SLCO1B1 (c.521T>C).

It also clearly demonstrated that independently of each other, there is a statistically

significant relationship between the presence of CYP3A4 (c.522-191C>T) and muscle

pain, and between SLCO1B1 (c.521T>C) and muscle pain, an established precursor to

myopathy.

In terms of relative importance, the study showed that SLCO1B1 (c.521T>C) is more

important than CYP3A4 (c.522-191C>T), as the presence of SLCO1B1 (c.521T>C)

increased the level of lactate dehydrogenase and creatine kinase, elevated levels of

which are found in those suffering from muscle pain.

While the OR of 16.9 for the presence of CYP3A4 (c.522-191C>T) will be of some

concern to clinical decision-makers, the OR of 56.8 for SLCO1B1 (c.521T>C) is of

considerable interest and importance for medical management.

Further, in the presence of both CYP3A4 (c.522-191C>T) and SLCO1B1 (c.521T>C),

the relationship between the presence of the SNPs and muscle pain reached 100%, a

result so high that it would be clinically negligent not to consider it when making

treatment decisions for these patients. However, as there were only six

Heterozygous/Heterozygous cases, the generalizability of the results is somewhat

limited. Further research with a larger sample size is therefore recommended to

confirm these results.

51

6.2. Recommendations

Considering the above factors together with the higher frequency of CYP3A4 (c.522-

191C>T) in the Arab population revealed by this study, we can conclude that Gazan

patients taking statins are at a considerably higher risk of developing muscle pain thus

possibly myopathy, and every effort should be made to reduce this risk.

Genotyping for this polymorphism prior to initiating statin therapy is therefore

recommended as an important clinical tool in preventing this irreversible muscle

damage in cardiac patients in the Gaza Strip.

When either SLCO1B1 (c.521T>C) or CYP3A4 (c.522-191C>T) are found, but

especially when both are present, consideration should be given to prescribing lower

doses of statins, or prescribing alternative cholesterol-lowering medications.

If statins are favored, these patients should be closely and continuously monitored for

muscle pain, and alternative interventions implemented at the earliest opportunity.

52

References

Abe T, Kakyo M, Tokui T, Nakagomi R, Nishio T, Nakai D, Nomura H, Unno M, Suzuki M,

Naitoh T, Matsuno S, Yawo H, (1999). Identification of a novel gene family encoding human liver-

specific organic anion transporter LST-1. J Biol Chem 274:17159-63.

Armitage J. (2007). The safety of statins in clinical practice. Lancet 370:1781-90.

Åsberg A, Hartmann A, Fjeldsa E, Bergan S, Holdaas H. (2001). Bilateral pharmacokinetic

interaction between cyclosporine A and atorvastatin in renal transplant recipients. Am J Transplant

1:382-6.

Backman JT, Kyrklund C, Kivistö KT, Wang JS, Neuvonen PJ, (2000). Plasma concentrations of

active simvastatin acid are increased by gemfibrozil. Clin Pharmacol Ther 68:122-9.

Backman JT, Luurila H, Neuvonen M, Neuvonen PJ, (2005). Rifampin markedly decreases and

gemfibrozil increases the plasma concentrations of atorvastatin and its metabolites. Clin Pharmacol

Ther 78:154-67.

Baigent C, Keech A, Kearney PM, Blackwell L, Buck G, Pollicino C, Kirby A, Sourjina T, Peto R,

Collins R, Simes R, (2005). Efficacy and safety of cholesterol-lowering treatment: prospective meta-

analysis of data from 90,056 participants in 14 randomised trials of statins. Lancet 366:1267-78.

Beyer RE. (1992). An analysis of the role of coenzyme Q in free radical generation and as an

antioxidant. Biochem Cell Biol 70:390-403.

Bradford RH, Shear CL, Chremos AN, Dujovne C, Downton M, Franklin FA, Gould AL, Hesney

M, Higgins J, Hurley DP, et al., (1991). Expanded Clinical Evaluation of Lovastatin (EXCEL) study

results. I.Efficacy in modifying plasma lipoproteins and adverse event profile in 8245 patients with

moderate hypercholesterolemia. Arch Intern Med 151:43-9.

Brown MS, Goldstein JL. (1986). A receptor-mediated pathway for cholesterol homeostasis. Science

232:34-47.

Bruckert E, Hayem G, Dejager S, Yau C, Begaud B. (2005). Mild to moderate muscular symptoms

with highdosage statin therapy in hyperlipidemic patients--the PRIMO study. Cardiovasc Drugs Ther

19:403-14.

Chang C, Pang KS, Swaan PW, Ekins S. (2005). Comparative pharmacophore modeling of organic

anion transporting polypeptides: a meta-analysis of rat Oatp1a1 and human OATP1B1. J Pharmacol

Exp Ther 314:533-41.

Chen C, Mireles RJ, Campbell SD, Lin J, Mills JB, Xu JJ, Smolarek TA. (2005). Differential

interaction of 3-hydroxy-3-methylglutaryl-coa reductase inhibitors with ABCB1, ABCC2, and

OATP1B1. Drug Metab Dispos 33:537-46.

Chorley BN, Wang X, Campbell MR, Pittman GS, Noureddine MA, Bell DA. (2008). Discovery and

verification of functional single nucleotide polymorphisms in regulatory genomic regions: current and

developing technologies. Mutat Res 659:147-57.

Chung JY, Cho JY, Yu KS, Kim JR, Oh DS, Jung HR, Lim KS, Moon KH, Shin SG, Jang IJ,

(2005). Effect of OATP1B1 (SLCO1B1) variant alleles on the pharmacokinetics of pitavastatin in

healthy volunteers. Clin Pharmacol Ther 78:342-50.

Collins FS, Brooks LD, Chakravarti A. (1998). A DNA polymorphism discovery resource for research

on human genetic variation. Genome Res 8:1229-31.

Daly AK. (2003). Pharmacogenetics of the major polymorphic metabolizing enzymes. Fundam Clin

Pharmacol 17:27-41.

53

Danielson PB. (2002). The cytochrome P450 superfamily: biochemistry, evolution and drug metabolism

in humans. Curr Drug Metab 3:561–597.

Dirks AJ, Jones KM. (2006). Statin-induced apoptosis and skeletal myopathy. Am J Physiol Cell

Physiol 291:C1208-12.

Donnelly LA, Doney AS, Tavendale R, Lang CC, Pearson ER, Colhoun HM, et al., (2011). Common nonsynonymous substitutions in SLCO1B1 predispose to statin intolerance in routinely treated

individuals with type 2 diabetes: Ago-DARTS study. Clin Pharmacol Ther. 89:210–6.

Dromer C, Vedrenne C, Billey T, Pages M, Fournie B, Fournie A. (1992). Rhabdomyolysis due to

simvastin. Apropos of a case with review of the literature. Rev Rhum Mal Osteoartic 59:281-3.

Dujovne CA, Chremos AN, Pool JL, Schnaper H, Bradford RH, Shear CL, Higgins J, Downton M,

Franklin FA, Nash DT, et al., (1991). Expanded clinical evaluation of lovastatin (EXCEL) study

results: IV. Additional perspectives on the tolerability of lovastatin. Am J Med 91:25S-30S.

Glaeser H, Bailey DG, Dresser GK, Gregor JC, Schwarz UI, McGrath JS, Jolicoeur E, Lee W,

Leake BF, Tirona RG, Kim RB. (2007). Intestinal drug transporter expression and the impact of

grapefruit juice in humans. Clin Pharmacol Ther 81:362-70.

Gradhand U, Kim RB.(2008). Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP

(ABCG2). Drug Metab Rev 40:317-54.

Graham DJ, Staffa JA, Shatin D, Andrade SE, Schech SD, La Grenade L, Gurwitz JH, Chan KA,

Goodman MJ, Platt R. (2004). Incidence of hospitalized rhabdomyolysis in patients treated with lipid-

lowering drugs. Jama 292:2585-90.

Gylling H, Miettinen TA. (1992). Cholesterol absorption and synthesis related to low density

lipoprotein metabolism during varying cholesterol intake in men with different apoE phenotypes. J Lipid

Re 33:1361-71.

Hagenbuch B, Meier PJ. (2004). Organic anion transporting polypeptides of the OATP/ SLC21 family:

phylogenetic classification as OATP/ SLCO superfamily, new nomenclature and molecular/functional

properties. Pflugers Arch 447:653-65.

Hamelin BA, Turgeon J. (1998). Hydrophilicity/lipophilicity: relevance for the pharmacology and

clinical effects of HMG-CoA reductase inhibitors. Trends Pharmacol Sci 19:26-37.

Hashimoto H, Toide K, Kitamura R, Fujita M, Tagawa S, Itoh S, Kamataki T. (1993). Gene

structure of CYP3A4, an adult-specific form of cytochrome P450 in human livers, and its transcriptional

control. Eur J Biochem. 218(2):585-95.

Heart Protection Study Collaborative Group. (2002). MRC/BHF Heart Protection Study of

cholesterol lowering with simvastatin in 20,536 high-risk individuals: a randomised placebo-controlled

trial. Lancet 360:7-22.

Hediger MA, Romero MF, Peng JB, Rolfs A, Takanaga H, Bruford EA. (2004). The ABCs of solute

carriers: physiological, pathological and therapeutic implications of human membrane transport

proteinsIntroduction. Pflugers Arch 447:465-8.

Hermann M, Asberg A, Christensen H, Holdaas H, Hartmann A, Reubsaet JL. (2004). Substantially elevated levels of atorvastatin and metabolites in cyclosporine-treated renal transplant

recipients. Clin Pharmacol Ther 76:388-91.

Ho RH, Kim RB. (2005). Transporters and drug therapy: implications for drug disposition and

disease. Clin Pharmacol Ther 78:260-77.

54

Hsiang B, Zhu Y, Wang Z, Wu Y, Sasseville V, Yang WP, Kirchgessner TG. (1999). A novel human

hepatic organic anion transporting polypeptide (OATP2). Identification of a liver-specific human

organic anion transporting polypeptide and identification of rat and human hydroxymethylglutaryl-CoA

reductase inhibitor transporters. J Biol Chem 274:37161-8.

Igel M, Sudhop T, von Bergmann K. (2002). Pharmacology of 3-hydroxy-3-methylglutaryl-coenzyme

A reductase inhibitors (statins), including rosuvastatin and pitavastatin. J Clin Pharmacol 42:835-45.

Igel M, Arnold KA, Niemi M, Hofmann U, Schwab M, Lütjohann D, von Bergmann K,

Eichelbaum M, Kivistö KT. (2006). Impact of the SLCO1B1 polymorphism on the pharmacokinetics

and lipidlowering efficacy of multiple-dose pravastatin. Clin Pharmacol Ther 79:419-26.

Inoue K, Inazawa J, Nakagawa H, Shimada T, Yamazaki H, Guengerich FP, Abe T. (1992). Assignment of the human cytochrome P-450 nifedipine oxidase gene (CYP3A4) to chromosome 7 at

band q22.1 by fluorescence in situ hybridization. Jpn J Hum Genet. 37(2):133-8.

Istvan ES, Deisenhofer J. (2001). Structural mechanism for statin inhibition of HMG-CoA reductase.

Science 292:1160-4.

Iwai M, Suzuki H, Ieiri I, Otsubo K, Sugiyama Y. (2004). Functional analysis of single nucleotide

polymorphisms of hepatic organic anion transporter OATP1B1 (OATP-C). Pharmacogenetics 14:749-

57.

Jada SR, Xiaochen S, Yan LY, Xiaoqiang X, Lal S, Zhou SF, Ooi LL, Chowbay B. (2007).

Pharmacogenetics of SLCO1B1: haplotypes, htSNPs and hepatic expression in three distinct Asian

populations. Eur J Clin Pharmacol 63:555-63.

Jones PH, Davidson MH, Stein EA, Bays HE, McKenney JM, Miller E, et al., (2003). Comparison

of the efficacy and safety of rosuvastatin versus atorvastatin, simvastatin, and pravastatin across doses

(STELLAR* Trial). Am J Cardiol 92:152–160.

Josephy DP, Guengerich PF, Miners JO. (2005). "Phase I and Phase II" drug metabolism:

terminology that we should phase out? Drug Metab Rev 37:575-80.

Kameyama Y, Yamashita K, Kobayashi K, Hosokawa M, Chiba K. (2005). Functional

characterization of SLCO1B1 (OATP-C) variants, SLCO1B1*5, SLCO1B1*15 and

SLCO1B1*15+C1007G, by using transient expression systems of HeLa and HEK293 cells.

Pharmacogenet Genomics 15:513-22.

Kantola T, Kivistö KT, Neuvonen PJ. (1998). Effect of itraconazole on the pharmacokinetics of

atorvastatin. Clin Pharmacol Ther 64:58-65.

Kitzmiller JP, Luzum JA, Baldassarre D, Krauss RM, Medina MW. (2014).CYP3A4*22 and

CYP3A5*3 are associated with increased levels of plasma simvastatin concentrations in the cholesterol

and pharmacogenetics study cohort. Pharmacogenetics and genomics, 24(10):486-91.

Kivistö KT, Bookjans G, Fromm MF, Griese EU, Münzel P, Kroemer HK. (1996a). Expression of

CYP3A4, CYP3A5 and CYP3A7 in human duodenal tissue. Br J Clin Pharmacol 42:387-9.

Kivistö KT, Griese EU, Fritz P, Linder A, Hakkola J, Raunio H, Beaune P, Kroemer HK. (1996b).

Expression of cytochrome P 450 3A enzymes in human lung: a combined RT-PCR and

immunohistochemical analysis of normal tissue and lung tumours. Naunyn Schmiedebergs Arch

Pharmacol 353:207-12.

Kreisberg RA, Oberman A. (2002). Clinical review 141: lipids and atherosclerosis: lessons learned

from randomized controlled trials of lipid lowering and other relevant studies. J Clin Endocrinol Metab

87:423-37.

Krishna DR, Klotz U. (1994). Extrahepatic metabolism of drugs in humans. Clin Pharmacokinet

26:144-60.

55

König J, Cui Y, Nies AT, Keppler D. (2000). A novel human organic anion transporting polypeptide

localized to the basolateral hepatocyte membrane. Am J Physiol Gastrointest Liver Physiol 278:G156-

64.

König J, Seithel A, Gradhand U, Fromm MF. (2006). Pharmacogenomics of human OATP

transporters. Naunyn Schmiedebergs Arch Pharmacol 372:432-43.

Laaksonen R. (2006). On the mechanisms of statin-induced myopathy. Clin Pharmacol Ther 79:529-31.

Lakshmi Mahadevan, Ancy Yesudas, P. K. Sajesh, S. Revu, Prasanna Kumar, Devi Santhosh, Sam

Santhosh, J. M. Sashikumar, V. K. Gopalakrishnan, Joji Boben, and Changanamkandath R.

(2014). Prevalence of genetic variants associated with cardiovascular disease risk and drug response in

the Southern Indian population of Kerala. Indian J Hum Genet. 20(2): 175–184. Lamba JK, Lin YS, Schuetz EG, Thummel KE. (2002). Genetic contribution to variable human

CYP3Amediated metabolism. Adv Drug Deliv Rev 54:1271-94.

LaRosa JC, He J, Vupputuri S. (1999). Effect of statins on risk of coronary disease: a meta-analysis of

randomized controlled trials. Jama 282:2340-6.

Lau YY, Huang Y, Frassetto L, Benet LZ. (2006). Effect of OATP1B Transporter Inhibition on the

Pharmacokinetics of Atorvastatin in Healthy Volunteers. Clin Pharmacol Ther 81(2):194-204

Lau YY, Huang Y, Frassetto L, Benet LZ. (2007). Effect of OATP1B transporter inhibition on the

pharmacokinetics of atorvastatin in healthy volunteers. Clin Pharmacol Ther 81:194-204.

Law M, Rudnicka AR. (2006). Statin safety: a systematic review. Am J Cardiol 97:52C-60C.

Law MR, Wald NJ, Rudnicka AR. (2003). Quantifying effect of statins on low density lipoprotein

cholesterol, ischaemic heart disease, and stroke: systematic review and meta-analysis. Bmj 326:1423.

Lee E, Ryan S, Birmingham B, Zalikowski J, March R, Ambrose H, Moore R, Lee C, Chen Y,

Schneck D. (2005a). Rosuvastatin pharmacokinetics and pharmacogenetics in white and Asian subjects

residing in the same environment. Clin Pharmacol Ther 78:330-41.

Lennernäs H, Fager G. (1997). Pharmacodynamics and pharmacokinetics of the HMG-CoA reductase

inhibitors. Similarities and differences. Clin Pharmacokinet 32:403-25.

Lewis DF. (2004). 57 varieties: the human cytochromes P450. Pharmacogenomics 5:305-18.

Liao JK. (2002). Beyond lipid lowering: the role of statins in vascular protection. Int J Cardiol 86:5-18.

Littarru GP, Langsjoen P. (2007). Coenzyme Q10 and statins: biochemical and clinical implications.

Mitochondrion 7 Suppl:S168-74.

Maeda K, Ieiri I, Yasuda K, Fujino A, Fujiwara H, Otsubo K, Hirano M, Watanabe T, Kitamura

Y, Kusuhara H, Sugiyama Y. (2006). Effects of organic anion transporting polypeptide 1B1 haplotype

on pharmacokinetics of pravastatin, valsartan, and temocapril. Clin Pharmacol Ther 79:427-39.

Maron DJ, Fazio S, Linton MF. (2000). Current perspectives on statins. Circulation 101:207-13.

Martini C, Pallottini V. (2007). Cholesterol: from feeding to gene regulation. Genes Nutr 2:181-93.

Molowa DT, Schuetz EG, Wrighton SA, Watkins PB, Kremers P, Mendez-Picon G, Parker GA,

Guzelian PS. (1986). Complete cDNA sequence of a cytochrome P-450 inducible by glucocorticoids in

human liver. Proc Natl Acad Sci U S A. 83(14):5311-5.

Morimoto K, Oishi T, Ueda S, Ueda M, Hosokawa M, Chiba K. (2004). A novel variant allele of

OATP-C (SLCO1B1) found in a Japanese patient with pravastatin-induced myopathy. Drug Metab

Pharmacokinet 19:453-5.

56

Morimoto K, Ueda S, Seki N, Igawa Y, Kameyama Y, Shimizu A, Oishi T, Hosokawa M, Iesato K,

Mori S, Saito Y, Chiba K. (2005). OATP-C(OATP01B1)*15 is associated with statin-induced

myopathy in hypercholesterolemic patients. Clin Pharmacol Ther 77:21.

Mwinyi J, Johne A, Bauer S, Roots I, Gerloff T. (2004). Evidence for inverse effects of OATP-C

(SLC21A6) 5 and 1b haplotypes on pravastatin kinetics. Clin Pharmacol Ther 75:415-21.

Mwinyi J, Kopke K, Schaefer M, Roots I, Gerloff T. (2008). Comparison of SLCO1B1 sequence

variability among German, Turkish, and African populations. Eur J Clin Pharmacol 64:257-66.

Nebert DW, Russell DW. (2002). Clinical importance of the cytochromes P450. Lancet 360:1155-62.

National Center for Biotechnology Information. (2014). Database of single nuclioide polymorphisms. (http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35599367 (accessed on 5 December 2014)).

Neuvonen PJ, Kantola T, Kivistö KT. (1998). Simvastatin but not pravastatin is very susceptible to

interaction with the CYP3A4 inhibitor itraconazole. Clin Pharmacol Ther 63:332-41.

Neuvonen PJ, Niemi M, Backman JT. (2006). Drug interactions with lipid-lowering drugs:

mechanisms and clinical relevance. Clin Pharmacol Ther 80:565-81.

Niemi M, Schaeffeler E, Lang T, Fromm MF, Neuvonen M, Kyrklund C, Backman JT, Kerb R,

Schwab M, Neuvonen PJ, Eichelbaum M, Kivistö KT. (2004). High plasma pravastatin

concentrations are associated with single nucleotide polymorphisms and haplotypes of organic anion

transporting polypeptide-C (OATP-C, SLCO1B1). Pharmacogenetics 14:429-40.

Niemi M, Backman JT, Kajosaari LI, Leathart JB, Neuvonen M, Daly AK, Eichelbaum M, Kivistö

KT, Neuvonen PJ. (2005a). Polymorphic organic anion transporting polypeptide 1B1 is a major

determinant of repaglinide pharmacokinetics. Clin Pharmacol Ther 77:468-78.

Niemi M, Kivistö KT, Hofmann U, Schwab M, Eichelbaum M, Fromm MF. (2005b). Fexofenadine

pharmacokinetics are associated with a polymorphism of the SLCO1B1 gene (encoding OATP1B1). Br J

Clin Pharmacol 59:602-4.

Niemi M, Neuvonen PJ, Hofmann U, Backman JT, Schwab M, Lütjohann D, von Bergmann K,

Eichelbaum M, Kivistö KT. (2005c). Acute effects of pravastatin on cholesterol synthesis are

associated with SLCO1B1 (encoding OATP1B1) haplotype *17. Pharmacogenet Genomics 15:303-9.

Niemi M. (2007). Role of OATP transporters in the disposition of drugs. Pharmacogenomics 8:787-802.

Niemi M, Pasanen MK, Neuvonen PJ. (2011). Organic anion transporting polypeptide 1B1: A

genetically polymorphic transporter of major importance for hepatic drug uptake. Pharmacol Rev.

63:157–81.

Nishizato Y, Ieiri I, Suzuki H, Kimura M, Kawabata K, Hirota T, Takane H, Irie S, Kusuhara H,

Niwa T, Yabusaki Y, Honma K, Matsuo N, Tatsuta K, Ishibashi F, Katagiri M. (1998). Contribution of human hepatic cytochrome P450 isoforms to regioselective hydroxylation of steroid

hormones. Xenobiotica. 28(6):539-47.

Nozawa T, Nakajima M, Tamai I, Noda K, Nezu J, Sai Y, Tsuji A, Yokoi T. (2002). Genetic

polymorphisms of human organic anion transporters OATP-C (SLC21A6) and OATP-B (SLC21A9):

allele frequencies in the Japanese population and functional analysis. J Pharmacol Exp Ther 302:804-

13.

Nozawa T, Minami H, Sugiura S, Tsuji A, Tamai I. (2005). Role of organic anion transporter

OATP1B1 (OATP-C) in hepatic uptake of irinotecan and its active metabolite, 7-ethyl-10-

hydroxycamptothecin: in vitro evidence and effect of single nucleotide polymorphisms. Drug Metab

Dispos 33:434-9.

57

Okubo M, Murayama N, Shimizu M, Shimada T, Guengerich FP, Yamazaki H. (2013). The

CYP3A4 intron 6 C.T polymorphism (CYP3A4*22) is associated with reduced CYP3A4 protein level and

function in human 8kliver microsomes. J Toxicol Sci. 38(3):349–354.

Ozdemir O, Boran M, Gokce V, Uzun Y, Kocak B, Korkmaz S. (2000). A case with severe

rhabdomyolysis and renal failure associated with cerivastatin-gemfibrozil combination therapy — a

case report. Angiology 51:695-7

Pasanen MK, Neuvonen PJ, Niemi M. (2008). Global analysis of genetic variation in SLCO1B1. Pharmacogenomics 9:19-33.

Pasternak RC, Smith SC, Jr, Bairey-Merz CN, Grundy SM, Cleeman JI, Lenfant C. (2002).

ACC/AHA/NHLBI Clinical Advisory on the Use and Safety of Statins. Circulation 106:1024-8.

Phillips PS, Haas RH, Bannykh S, Hathaway S, Gray NL, Kimura BJ, Vladutiu GD, England JD.

(2002). Statin-associated myopathy with normal creatine kinase levels. Ann Intern Med 137:581-5.

Prueksaritanont T, Subramanian R, Fang X, Ma B, Qiu Y, Lin JH, Pearson PG, Baillie TA.

(2002). Glucuronidation of statins in animals and humans: a novel mechanism of statin lactonization.

Drug Metab Dispos 30:505-12.

Prueksaritanont T, Ma B, Yu N. (2003). The human hepatic metabolism of simvastatin hydroxy acid is

mediated primarily by CYP3A, and not CYP2D6. Br J Clin Pharmacol 56:120-4.

Päivä H, Thelen KM, Van Coster R, Smet J, De Paepe B, Mattila KM, Laakso J, Lehtimäki T, von

Bergmann K, Lütjohann D, Laaksonen R. (2005). High-dose statins and skeletal muscle metabolism

in humans: a randomized, controlled trial. Clin Pharmacol Ther 78:60-8.

Ramsey Laura B, Johnson Samuel G, Caudle Kelly E, Haidar Cyrine E, Voora Deepak, Wilke

Russell A, Maxwell Whitney D, McLeod Howard L, Krauss Ronald et all. (2014). The Clinical

Pharmacogenetics Implementation Consortium guideline for SLCO1B1 and simvastatin-induced

myopathy. Clin Pharmacol Ther 96(4): 423–428

Rosenson RS, Lowe GD. (1998). Effects of lipids and lipoproteins on thrombosis and rheology. Atherosclerosis 140:271-80.

Rowland M, Tozer TN. (1995). Clinical Pharmacokinetics: concepts and applications. Baltimore:

Williams & Wilkins.

Sacks FM, Pfeffer MA, Moye LA, Rouleau JL, Rutherford JD, Cole TG, Brown L, Warnica JW,

Arnold JM, Wun CC, Davis BR, Braunwald E. (1996). The effect of pravastatin on coronary events

after myocardial infarction in patients with average cholesterol levels. Cholesterol and Recurrent

Events Trial investigators. N Engl J Med 335:1001-9.

Santos PC, Soares RA, Nascimento RM, Machado-Coelho GL, Mill JG, Krieger JE, et al., (2011). SLCO1B1 rs4149056 polymorphism associated with statin-induced myopathy is differently distributed

according to ethnicity in the Brazilian general population: Amerindians as a high risk ethnic group. BMC Med Genet 12:136.

Scandinavian Simvastatin Survival Study Group. (1994). Randomised trial of cholesterol lowering in

4444 patients with coronary heart disease: the Scandinavian Simvastatin Survival Study (4S). Lancet

344:1383-9.

Schachter M. (2005). Chemical, pharmacokinetic and pharmacodynamic properties of statins: an

update. Fundam Clin Pharmacol 19:117-25.

Schick BA, Laaksonen R, Frohlich JJ, Päivä H, Lehtimäki T, Humphries KH, Cote HC. (2007). Decreased skeletal muscle mitochondrial DNA in patients treated with high-dose simvastatin. Clin

Pharmacol Ther 81:650-3.

58

Schwartz GG, Olsson AG, Ezekowitz MD, Ganz P, Oliver MF, Waters D, et al., (2001). Effects of

atorvastatin on early recurrent ischemic events in acute coronary syndromes: the MIRACL study: a

randomized controlled trial. JAMA 285:1711-8.

SEARCH Collaborative Group. (2008). SLCO1B1 Variants and Statin-Induced Myopathy -- A

Genomewide Study. N Engl J Med 359:789–99.

Seithel A, Glaeser H, Fromm MF, König J. (2008). The functional consequences of genetic variations

in transporter genes encoding human organic anion-transporting polypeptide family members. Expert

Opin Drug Metab Toxicol 4:51-64.

Shen DD, Kunze KL, Thummel KE. (1997). Enzyme-catalyzed processes of first-pass hepatic and

intestinal drug extraction. Adv Drug Deliv Rev 27:99-127.

Shepherd J, Cobbe SM, Ford I, Isles CG, Lorimer AR, MacFarlane PW, McKillop JH, Packard

CJ. (1995). Prevention of coronary heart disease with pravastatin in men with hypercholesterolemia.

West of Scotland Coronary Prevention Study Group. N Engl J Med 333:1301-7.

Shitara Y, Horie T, Sugiyama Y. (2006). Transporters as a determinant of drug clearance and tissue

distribution. Eur J Pharm Sci 27:425-46.

Shitara Y, Sugiyama Y. (2006). Pharmacokinetic and pharmacodynamic alterations of 3-hydroxy-3-

methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors: drug-drug interactions and

interindividual differences in transporter and metabolic enzyme functions. Pharmacol Ther 112:71-105.

Shou M, Korzekwa KR, Brooks EN, Krausz KW, Gonzalez FJ, Gelboin HV. (1997). Role of human

hepatic cytochrome P450 1A2 and 3A4 in the metabolic activation of estrone. Carcinogenesis 18(1):207-

14.

Tachibana-Iimori R, Tabara Y, Kusuhara H, Kohara K, Kawamoto R, Nakura J, Tokunaga K,

Kondo I, Sugiyama Y, Miki T. (2004). Effect of genetic polymorphism of OATP-C (SLCO1B1) on

lipidlowering response to HMG-CoA reductase inhibitors. Drug Metab Pharmacokinet 19:375-80.

Tanihara Y, Masuda S, Sato T, Katsura T, Ogawa O, Inui K. (2007). Substrate specificity of MATE1

and MATE2-K, human multidrug and toxin extrusions/H(+)-organic cation antiporters. Biochem

Pharmacol 74:359-71.

The changing face of heart disease and stroke in Canada 2000. Executive summary. Ottawa: Health

Canada. Available: www.hc-sc.gc.ca/hpb/lcdc/bcrdd /hdsc2000/index.html. Accessed Aug. 31, 2001.

Thompson PD, Clarkson P, Karas RH. (2003). Statin-associated myopathy. Jama 289:1681-90.

Thompson EE, Kuttab-Boulos H, Witonsky D, Yang L, Roe BA, Di Rienzo A. (2004). CYP3A

variation and the evolution of salt-sensitivity variants. Am J Hum Genet. 75:1059–1069.

Tirona RG, Leake BF, Merino G, Kim RB. (2001). Polymorphisms in OATP-C: identification of

multiple allelic variants associated with altered transport activity among European- and African-

Americans. J Biol Chem 276:35669-75.

Tirona RG, Leake BF, Wolkoff AW, Kim RB. (2003). Human organic anion transporting

polypeptide-C (SLC21A6) is a major determinant of rifampin-mediated pregnane X receptor activation.

J Pharmacol Exp Ther 304:223-8.

Urasaki Y, Urae A, Higuchi S, Otsubo K, Sugiyama Y. (2003). Polymorphisms of OATP-C

(SLC21A6) and OAT3 (SLC22A8) genes: consequences for pravastatin pharmacokinetics. Clin

Pharmacol Ther 73:554-65.

Vaklavas C, Chatzizisis YS, Ziakas A, Zamboulis C, Giannoglou GD. (2008). Molecular basis of

statinassociated myopathy. Atherosclerosis 202(1):18-28.

59

Voora D, Shah SH, Spasojevic I, Ali S, Reed CR, Salisbury BA, Ginsburg GS. (2009). The

SLCO1B1*5 genetic variant is associated with statin-induced side effects. J Am Coll Cardiol.

54(17):1609-16.

Vavricka SR, Van Montfoort J, Ha HR, Meier PJ, Fattinger K. (2002). Interactions of rifamycin SV

and rifampicin with organic anion uptake systems of human liver. Hepatology 36:164-72.

Vickers S, Duncan CA, Chen IW, Rosegay A, Duggan DE. (1990). Metabolic disposition studies on

simvastatin, a cholesterol-lowering prodrug. Drug Metab Dispos 18:138-45.

Wang D, Guo Y, Wrighton SA, Cooke GE, Sadee W. (2011). Intronic polymorphism in CYP3A4

affects hepatic expression and response to statin drugs. Pharmacogenomics J. 11:274–286.

Westlind-Johnsson A, Malmebo S, Johansson A, Otter C, Andersson TB, Johansson I, et al.,

(2003). Comparative analysis of CYP3A expression in human liver suggests only a minor role for

CYP3A5 in drug metabolism. Drug Metab Dispos 31:755–761.

Wrighton SA, Stevens JC. (1992). The human hepatic cytochromes P450 involved in drug metabolism.

Crit Rev Toxicol 22:1-21.

Wrighton SA, Schuetz EG, Thummel KE, Shen DD, Korzekwa KR, Watkins PB. (2000). The

human CYP3A subfamily: practical considerations. Drug Metab Rev 32:339-61.

Yousaf M. and Powell M. (2012). The Effects of Heart and Skeletal Muscle Inflammation and

Cardiomyopathy Syndrome on Creatine Kinase and Lactate Dehydrogenase Levels in Atlantic Salmon

(Salmo salar). Scientific World Journal 741302.

Zair ZM, Eloranta JJ, Stieger B, Kullak-Ublick GA. (2008). Pharmacogenetics of OATP

(SLC21/SLCO), OAT and OCT (SLC22) and PEPT (SLC15) transporters in the intestine, liver and

kidney. Pharmacogenomics 9:597-624.

Zhang W, He YJ, Gan Z, Fan L, Li Q, Wang A, Liu ZQ, Deng S, Huang YF, Xu LY, Zhou HH. (2007). OATP1B1 polymorphism is a major determinant of serum bilirubin level but not associated with

rifampicin-mediated bilirubin elevation. Clin Exp Pharmacol Physiol 34: 1240–1244

60

Appendices

61

Appendix 1

62

Appendix 2

63

Appendix 3

Personal Data Date

Name Age Hospital Number

Mobile Gender Residence Area

Medical Data

Diseases

Yes No Year

Diabetes Mellitus

Hypertension

Myopathy

No Yes COMMENTS

م ذشعز تؤنى ف عؼالخ االلذاو االذ

م ذشعز احاا تظعتح ف انش

اندسى ال ذسرطع انماو تاألشطح انيح م ذشعز تإراق عاو ف

م االالو يزذثطح تانذاء

64

Surgical Operation

Yes No Years #

PCI (stand)

Open Heart Surgery

Medication

Yes No dose /day Period

Clopidogrel

Aspirin

Statine

Laboratory Data

Test Conc. Test Conc.

WBC Cholesterol

RBC T.G

Hemoglobin CK

HCT CK-MB

Platelets count: ALT

PT AST

% Urea

INR Creatinine

PTT LDH

FBS or RBS HBV