· pdf file2 enhances carbohydrate assimilation at flowering ... used for the sugar...
Post on 27-Mar-2018
216 Views
Preview:
TRANSCRIPT
1 23
Indian Journal of Plant PhysiologyAn International Journal of PlantPhysiology ISSN 0019-5502 Ind J Plant Physiol.DOI 10.1007/s40502-016-0209-4
Elevated CO2 enhances carbohydrateassimilation at flowering stage and seedyield in chickpea (Cicer arietinum)
Puja Rai, Ashish K. Chaturvedi, DivyaShah, C. Viswanathan & Madan Pal
1 23
Your article is protected by copyright and all
rights are held exclusively by Indian Society
for Plant Physiology. This e-offprint is for
personal use only and shall not be self-
archived in electronic repositories. If you wish
to self-archive your article, please use the
accepted manuscript version for posting on
your own website. You may further deposit
the accepted manuscript version in any
repository, provided it is only made publicly
available 12 months after official publication
or later and provided acknowledgement is
given to the original source of publication
and a link is inserted to the published article
on Springer's website. The link must be
accompanied by the following text: "The final
publication is available at link.springer.com”.
ORIGINAL ARTICLE
Elevated CO2 enhances carbohydrate assimilation at floweringstage and seed yield in chickpea (Cicer arietinum)
Puja Rai1 • Ashish K. Chaturvedi1 • Divya Shah1 • C. Viswanathan1 •
Madan Pal1
Received: 22 September 2015 / Accepted: 28 January 2016
� Indian Society for Plant Physiology 2016
Abstract Rising atmospheric CO2 concentration can
stimulate plant growth through enhanced photosynthesis
and carbohydrate assimilation. A study was planned to
analyse the effects of elevated CO2 (eCO2)
(570 ± 45 lmol mol-1) on photosynthesis, carbohydrate
assimilation and photorespiratory enzymes and their gene
expression in desi (Pusa 1103) and kabuli (Pusa 1105)
chickpea genotypes. The findings showed higher rate of
photosynthesis in both desi and kabuli chickpea genotypes
under elevated CO2 and was accompanied with increased
starch and sugar concentration and rubisco activity.
Expression of rbcS and rbcL genes was higher under ele-
vated CO2 during flowering stage but non-significant
changes occurred in expression at podding stage. Shoot
biomass and seed yield was significantly higher in both
chickpea genotypes under eCO2. Glycolate oxidase activity
decreased under eCO2 and the reduction was greater in desi
compared to kabuli genotype, suggesting suppressed pho-
torespiration in both the chickpea genotypes. The finding of
this study concludes that chickpea crop can perform better
under eCO2 environment due to increased rate of photo-
synthesis and suppressed photorespiration. Between two
types of chickpea, desi may respond better to eCO2 owing
to its higher sink potential than kabuli types.
Keywords Elevated CO2 � Photosynthesis � Rubisco �Glycolate oxidase � Cicer arietinum
Introduction
Increasing CO2 is one of the important climate change
factor, which has contributed significantly to global
warming. It has increased linearly since pre-industrial
period and reached to the current level of 400 lmol mol-1
(IPCC 2014). Plants can cope up with high atmospheric
CO2 through its better utilization in the process of photo-
synthetic carbon assimilation and producing higher bio-
mass (Jaggard et al. 2010). Various studies on response to
elevated CO2 (eCO2) have confirmed that C3 crops can
perform better in terms of enhanced growth and produc-
tivity under high CO2 environment (Ainsworth et al. 2008;
Kumar et al. 2012; Wang et al. 2013). Enhanced rate of
photosynthesis, improved plant growth and yield are the
well known changes in high CO2 grown plants (Pal et al.
2012; Chen and Setter 2012; Kant et al. 2012) which
depends on capacity of plants to utilize extra C assimilates
and sink availability (Aranjuelo et al. 2011, 2013).
As compared with C4, C3 plants perform better under
eCO2 due to increased rubisco carboxylation efficiency and
suppression of photorespiration. Rubisco has affinity for
both CO2 and O2; a considerable amount of energy is
wasted through photorespiratory carbon cycle, at ambient
CO2 concentration (Sharkey 1988). The carbon losses
through photorespiratory carbon oxidation (PCO) have
been reported around 40 % (Kant et al. 2012). High
atmospheric CO2 in the atmosphere can suppresses pho-
torespiration and help the plants to save photosynthetic
carbon loss through PCO. Legumes have sink capacity and
potential to respond to eCO2 owing to their large carbon
demand for nodulation and biological N2 fixation processes
(Rogers et al. 2009). Ainsworth et al. (2002) have reported
enhanced photosynthesis and higher productivity in
legumes compared to non-legumes under eCO2.
& Ashish K. Chaturvedi
ashispc@gmail.com
& Madan Pal
madanpal@yahoo.com
1 Division of Plant Physiology, Indian Agricultural Research
Institute, New Delhi 110012, India
123
Ind J Plant Physiol.
DOI 10.1007/s40502-016-0209-4
Author's personal copy
Chickpea (Cicer arietinum L.) is an important legume
crop in South Asia, and ranks second among the world’s
food legumes in terms of area (FAO 2007). There are two
types of chickpea: (1) the small-seeded desi chickpea with
a dark and thick seed coat, and (2) the large-seeded kabuli
chickpea with a light-coloured and thin seed coat. As
compared to cereal crops and other legumes, the informa-
tion regarding growth, photosynthesis and photorespiratory
process in chickpea in respect of their enzymes activity and
gene expression under elevated CO2 is very scanty (Pal
et al. 2008). Since flower and pod drop are major con-
straints in chickpea due to limited carbohydrate supply. We
hypothesized that in cereals enhanced photosynthesis and
carbon assimilation under elevated CO2 may limit above
constraints. So, we planned to analyse the effects of eCO2
on carbohydrate supply, photosynthesis, photorespiration,
and the activity and gene expression of rubisco and gly-
colate oxidase (GO), growth and seed yield in desi and
Kabuli chickpea genotypes.
Materials and methods
Plant material and CO2 treatment
The experiment was carried out during the winter (rabi)
season of 2011–2012 at Indian Agricultural Research
Institute, New Delhi, India (28�350N latitude, 77�120Elongitude and 228.16 m above mean sea level). Seeds of
chickpea (Cicer arietinum L.) genotypes, viz., Pusa 1103
(desi) and Pusa 1105 (kabuli) were sown in soil inside
Open Top Chamber (OTC) by maintaining row-to-row and
plant-to-plant distance of 30 and 10 cm, respectively. All
recommended agronomic practices were followed and
irrigation was given as and when required to maintain
moisture level at field capacity and avoid any moisture
deficit stress.
Plants were exposed to elevated CO2 (eCO2) level of
570 ± 45 lmol mol-1 inside OTCs, as designed by Pal
et al. (2004). During the entire experimental period, tem-
perature and humidity inside all OTCs were recorded
continuously with the help of sensors as described by Saha
et al. (2011). Elevated CO2 exposure was started after the
emergence of the crop and continued till crop maturity
from 6:00 AM to 6:00 PM daily. For chamber control,
ambient CO2 (aCO2) (384 ± 30 lmol mol-1) only pure air
was injected instead of CO2–air mixture. There were three
OTCs for control and high CO2 exposure each.
Leaf gas exchange
Measurement of net CO2 assimilation rate was made on
three plants per treatment using portable photosynthesis
system (Li-6400, LI-COR, USA) during 9:30–11:30 h of
the day. For each plant three different fully expanded upper
leaflets were selected for measurement at flowering and
podding stage in both the genotypes. CO2 concentration in
leaf chamber was controlled with the LI-COR CO2 injec-
tion system and a saturating photosynthetic photon flux
density (PPFD) of 1200 lmol m-2 s-1 was supplied from
LED light source.
Biochemical estimations and enzyme assays
Fully expanded upper leaves were taken and frozen in
liquid nitrogen for sugar, starch and enzyme assay and gene
expression studies. For sugar and starch analysis leaves
were immediately plunged in 95 % ethanol and preserved
for subsequent analysis. Leaf sample (0.5 g) preserved in
95 % ethanol was boiled for sugar extraction. Extract was
used for the sugar determination following Nelson’s
arsenomolybdate (Nelson 1944) and improved copper
reagent of Somogyi (1952) methods. Starch was extracted
in residual samples using perchloric acid and refluxing by
isopropanol (80 %), and estimated according to Anthrone
method of Hodge and Hofreiter (1962).
For rubisco enzyme assay frozen leaf samples (100 mg)
were homogenized in 2 ml of extraction buffer (50 mM
Tris–HCl, 5 mM MgCl2, 10 mM DTT, pH 8.0) and
homogenate was centrifuged at 25,000 g for 5 min at 4 �Cand supernatant was used for enzyme assay. Activity was
measured in assay medium containing Tris–HCl
(100 mM), DTT (5 mM), BSA (0.2 %, w/v), MgCl2(40 mM), NaH14CO3 (20 mM), and RuBP (2.5 mM) in a
6-ml stoppered plastic vial. The vials were shaken and
incubated at 25 �C for 5 min and enzyme activity was
initiated by adding RUBP and incubated for 5 min at 25 �Cwith shaking. After incubation, vials were dried overnight
at 60 �C. Acid-sTable14C was determined by scintillation
counting (Servaites and Torisky 1984).
For GO assay 0.05 g frozen leaves were homogenized
and extracted in cold potassium phosphate buffer (0.05 M,
pH 8.0). The homogenate was centrifuged at 4 �C and
14,000g and used for assay. Assay medium consist of
100 ll potassium phosphate buffer (0.05 M, pH 8.0),
100 ll cold 1.6 % phenylhydrazine-hydrochloride, 100 llfreshly prepared FMN, 100 ll of enzyme extract and
double distilled water to make the final volume of 1.5 ml.
The sample tubes were incubated at 30 �C for 10 min using
water bath shaker and 50 ll glycolic acid (0.1 M) was
added in each tube and incubated at room temperature for
20 min. The reaction was stopped using 500 ll HCl
(12 N). Potassium ferricyanide (100 ll, 8 %) was added to
induce colour of glyoxylate phenylhydrazone and activity
was assayed by recoding absorbance at 324 nm (Zelitch
et al. 2009).
Ind J Plant Physiol.
123
Author's personal copy
Quantitative real-time PCR
cDNA sequences of GO genes of Pisumsativum, Phaseolus
vulgaris, Medicagotruncatula, Vignaunguiculata and Gly-
cine max were downloaded from National Centre for
Biotechnology Information (NCBI) and aligned using
ClustalW. Primer sequences (Table 1) were selected
manually from the conserved regions of all five legumes,
and the oligonucleotide properties were analyzed by using
oligoanalyzer 3.1 software (http://www.idtdna.com/analy
zer/Applications/OligoAnalyzer/). GO cDNA was cloned
into pGEM-T Easy vector (Promega) and sequenced from
both the genotypes. Sequences were submitted to NCBI
(Accession No. JN009800 and JN009801). Based on these
sequences, gene specific primers were designed for qRT-
PCR analysis (Table 1). Nucleotide sequences of Chickpea
for rubisco (rbcL and rbcS) were downloaded from NCBI
and real-timePCR analysis was performed to investigate
the expression pattern of go and rubisco (rbcLand rbcS)
mRNA transcripts at flowering and podding stages under
elevated CO2 (eCO2). Total RNA was extracted from leaf
samples using the RNeasy Plant mini kit (Qiagen, Ger-
many). First-strand cDNA synthesis was performed using
2 lg RNA with Maxima� First Strand cDNA Synthesis Kit
for Q-PCR (Fermentas). qRT-PCR was performed using
Mx3005PTM sequence detection system and software
(Stratagene, USA). Each RT-PCR reaction was set up in
25-ll total volumes, containing 12.5 ll SYBR Green
Master Mix (Fermentas), 10 pmol of primers and B500 ng
of cDNA sample. The RT-PCR reactions were carried out
with the following cycling parameters: 2 min at 50 �C,10 min at 95 �C, and 40 cycles of 15 s at 95 �C and 30 s at
55 �C and extension at 72 �C for 30 s. The relative mRNA
levels for each gene were computed with respect to the
internal standard, GAPDH (Glyceraldehyde-3-phosphate
dehydrogenase), to normalize for variance in the quality of
RNA and the amount of input cDNA. The DDCt method
was used for calculation of relative expression as described
by Yuan et al. (2006).
Statistical analysis
Experiment was conducted in completely randomized
design with three replicates each for aCO2 and eCO2. The
data were statistically verified with analysis of variation
(ANOVA) and the significance of differences between the
means was tested using Duncan’s post hoc test at the sig-
nificance level P B 0.05 using SPSS v.10 for Windows
(SPSS Inc., Chicago, USA).
Results and discussion
High atmospheric CO2 concentration can enhance rate of
photosynthesis (PN) and carbon supply in C3 plants and
increases their growth and productivity (Ainsworth et al.
2008; Rogers et al. 2009, Pal et al. 2012; Chen and Setter
2012). It can suppress PCO and saves carbon loss
(Aranjuelo et al. 2011). In the present study, two desi and
kabuli chickpea genotypes were exposed to elevated CO2
to study their photosynthetic responses. Both the geno-
types showed significantly enhanced rate of photosyn-
thesis (PN) and the response differed at flowering and
podding stages (Fig. 1). PN increased at both flowering
and podding stages and the enhancement was more in
desi chickpea (56 % at flowering and 39 % at podding)
compared to kabuli (33 % at flowering and 28 % at
podding). Such an increase in PN during flowering and
podding stages shows availability of potential sink in both
chickpea genotypes. Similar increase in PN due to eCO2
treatment has been reported in wheat (Tausz-Posch et al.
2013; Biswas et al. 2013), soybean (Locke et al. 2013;
Hao et al. 2012), barley (Wang et al. 2013), oat (Bhatt
et al. 2010) and rice (Pal et al. 2012).
Table 1 Primer sequences for cloning and Real time PCR expression analysis of glycolate oxidase and rubisco
Gene Primer sequence (50–30) Amplicon size (bp)
Primer to clone glycolate oxidase
Glycolate oxidase gox-F: GAGGATCAGTGGACTCTGCAAGA
gox-R: CACCTAGTGCCAATGCCTTGAAGA
815
qRT-PCR primers
Glycolate oxidase gox-F: 50 GGACCAAGCTAATGACTCTGGACT-30
gox-R: 50-GACACCCTTGACAAGAATTGGCAG-30124
Rubisco-1,5-bis phosphate carboxylase/oxygenase-large sub unit rbcL-F: 50-CCAATTCGGTGGAGGAACTTTAGG-30
rbcL-R: 50-CAAGATCACGTCCCTCATTACGAG-30113
Rubisco-1,5-bis phosphate carboxylase/oxygenase-small sub unit rbcS F: 50-TACCTTCCACCATTGACTGAAGAG-30
rbcS R: 50-TGAGTTGTTGTGCTCACGGTACAC-30126
Ind J Plant Physiol.
123
Author's personal copy
Fig. 1 Effect of elevated CO2
exposure on photosynthetic rate
(lmol CO2 m-2 s-1) in
chickpea genotypes at flowering
and podding stages. Data shown
are mean ± SE. Values that do
not share common letters are
significantly different by
Duncan’s post hoc test at
P B 0.05
Fig. 2 Effect of elevated CO2 exposure on total sugars (A) and starch concentration (B) of chickpea genotypes at flowering and podding stages.
Data shown are mean ± SE. Values that do not share common letters are significantly different by Duncan’s post hoc test at P B 0.05
Ind J Plant Physiol.
123
Author's personal copy
Our finding showed that higher rate of photosynthesis
was accompanied by increase in sugar and starch content
(Fig. 2) in both the genotypes. Increase in PN under eCO2
resulted in increase in carbohydrates in the leaves to sup-
port the growth of chickpea. Between two genotypes, desi
type showed 42 % increase in concentration of total sugars
under eCO2 over aCO2, while in kabuli the increase was
32 % (over aCO2) at flowering stage. On the other hand, at
podding stage, the increase in concentration of total sugars
under eCO2 was 22 and 26 % over aCO2 in kabuli and desi
types, respectively (Fig. 2A). Similarly, starch concentra-
tion increased significantly under eCO2 treatment in both
the genotypes at above growth stages (Fig. 2B). The
increase in starch concentration was more in Pusa 1103
(30 % at flowering and 24 % at podding) compared to Pusa
1105 (26 % at flowering and 23 % at podding). In
comparison to starch, increase in sugar concentration was
more at both the stages. Similar changes in carbohydrates
concentration under eCO2 has been reported in chickpea
(Pal et al. 2008) and mungbean (Pandurangam et al. 2006).
Accumulation of more sugars compared to starch in the
leaves under eCO2 may result in down regulation of PN(Pandurangam et al. 2006); however, in this study con-
centration of both carbohydrates was similar.
The process of photosynthesis and photorespiration are
mediated through rubisco in C3 plants, and high atmospheric
CO2 promote photosynthetic carbon reduction over PCO
(Long 1994). Elevated CO2 exposure enhanced rubisco
activity in both the genotypes and the enhancement was
greater in desi chickpea (17 %over aCO2) at flowering stage,
while there was 8 % increase in rubisco activity of kabuli
chickpea at flowering in eCO2 exposed plants. However, at
Fig. 3 Effect of elevated CO2 exposure on rubsico (A) and glycolate
oxidase (B) activity in the leaf tissues of chickpea genotypes at
flowering and podding stages. Data shown are mean ± SE. Values
that do not share common letters are significantly different by
Duncan’s post hoc test at P B 0.05
Ind J Plant Physiol.
123
Author's personal copy
podding stage, there were non-significant changes in rubsico
activity in both the genotypes under eCO2 exposure
(Fig. 3A). Similar enhancement in rubisco activity has been
reported inwheat cultivars in response to eCO2 (Biswas et al.
2013). Elevated CO2 resulted in reduced GO activity in both
the genotypes at flowering and podding stages. Between the
two genotypes the reduction in GO activity in desi type was
greater at both the stages (33 and 25 % at flowering and
podding stages, respectively), while in kabuli, the reduction
was lower than desi type and the magnitude of reduction was
almost similar at both the stages (15–16 % over aCO2)
(Fig. 3B). Activity of GO, which is involved in oxidation of
glycolate in peroxisome, reflects changes in photorespiration
(PCO) (Ogren 1984). In this study, we observed reduction in
GO activity in both the chickpea genotypes grown under
eCO2 environment, confirming suppression of the process of
photorespiration due to high CO2/O2 ratio at the site of
rubisco. Booker et al. (1997) have reported reduction in GO
activity under eCO2 in soybean as a measure of suppressed
photorespiration.
Expression level of large (rbcL) and small subunits
(rbcS) of rubisco was more at flowering stage in both
chickpea genotypes under eCO2. rbcL transcript levels
increased by[1.5-fold in desi and B1.5 in kabuli type at
flowering stage under eCO2 (Fig. 4). At podding stage
there was a significant increase in the rbcS transcript level,
while rbcL transcript level showed non-significant changes
in both the genotypes (Fig. 4). go transcript level changed
significantly under eCO2 in both the genotypes during
flowering and podding stages, however the increase was
more in desi compared to kabuli type during flowering
stage (Fig. 4). Repression of photosynthetic genes has been
reported in eCO2 grown plants, which vary between intra
and inter species (Moore et al. 1998). Similar increase in
transcript level of rbcS and rbcL has also been reported in
cucumber under eCO2 (Jiang et al. 2012). Many studies
have suggested reduction in expression level and rubisco
protein content due to feed back inhibition or photosyn-
thetic acclimation and sugars accumulation (Ghildiyal et al.
2001; Pandurangam et al. 2006). Cheng et al. (1998) have
suggested that plant growth under eCO2 can result in a
differential repression of rubisco genes in a species. In our
study, there was correlation in enhancement of photosyn-
thesis and rubisco activity with expression of rbcS and
rbcL under eCO2 during flowering stage, and it was greater
for desi chickpea genotype (Pusa 1103). Similar response
between PN and rubisco or rbcS and rbcL expression under
eCO2 in different crop species has been reported by Kant
et al. (2012) and Seneweera et al. (2011).
Both the genotypes showed positive relationship
between photosynthesis, seed yield and shoot biomass
under eCO2. However, the relationship of photosynthesis
with grain yield was stronger for desi (Pusa 1103)
(r2 = 0.84) compared to kabuli type (Pusa 1105)
(r2 = 0.59) (Fig. 5A), while the relationship of photosyn-
thesis with shoot biomass was stronger for Pusa 1105
(r2 = 0.74) compared to Pusa 1103 (r2 = 0.63) (Fig. 5B),
which suggests that kabuli type (Pusa 1105) responded
better in terms of vegetative growth and produced more
shoot dry weight but desi type (Pusa 1103) showed better
Fig. 4 Effect of elevated CO2 exposure on relative transcript level of glycolate oxidase (go), and large (rbcL) and small (rbcS) sub-units of
rubisco in leaf tissues of chickpea genotypes at flowering and podding stages. Data shown are fold changes under eCO2 over aCO2
Ind J Plant Physiol.
123
Author's personal copy
translocation to sink, resulting in increase in seed yield
under eCO2 environment. Similar growth and yield
responses to eCO2 have also been shown in other crop
species (Wang et al. 2013).
The findings of this study conclude that elevated CO2
can improve growth and seed yield in chickpea crop
through increased rate of photosynthesis and suppression of
photo-respiratory carbon-losses. Between the two types of
chickpea, desi can perform better owing to its high sink
potential in terms of production of more number of pods
than kabuli type.
Acknowledgments The authors acknowledge Indian Council of
Agricultural Research (ICAR) for providing financial grant under
National Initiative on Climate Resilient Agriculture (NICRA) project.
References
Ainsworth, E. A., Davey, P. A., & Bernacchi, C. J. (2002). A meta
analysis of elevated (CO2) effects on soybean (Glycine max)
physiology, growth and yield. Global Change Biology, 8,
695–709.
Ainsworth, E. A., Leakey, A. D. B., Ort, D. R., & Long, S. P. (2008).
FACE-ing the facts: inconsistencies and interdependence among
field, chamber and modeling studies of elevated [CO2] impacts
on crop yield and food supply. New Phytologist, 179, 5–9.
Aranjuelo, I., Cabrera-Bosquet, L., Morcuende, R., Avice, J. C.,
Nogues, S., Araus, J. L., et al. (2011). Does ear C sink strength
contribute to overcoming photosynthetic acclimation of wheat
plants exposed to elevated CO2? Journal of Experimental
Botany, 62, 3957–3969.
Aranjuelo, I., Sanz-Saez, A., Jauregui, I., Irigoyen, J. J., Araus, J. L.,
Sanchez-Dıaz, M., & Erice, G. (2013). Harvest index, a
Fig. 5 Relationship of leaf photosynthesis with seed weight (A) and shoot biomass (B) of chickpea genotypes Pusa 1103 and Pusa 1105 exposedto elevated CO2. Solid symbols are values from plants grown at aCO2 and open symbols are values from plants grown at eCO2
Ind J Plant Physiol.
123
Author's personal copy
parameter conditioning responsiveness of wheat plants to
elevated CO2. Journal of Experimental Botany, 64, 1879–1892.
Bhatt, R. K., Baig, M. J., & Tiwari, H. S. (2010). Elevated CO2
influences photosynthetic characteristics of Avena sativa L.
cultivars. Journal of Environmental Biology, 31, 813–818.
Biswas, D. K., Xu, H., Li, Y. G., Ma, B. L., & Jiang, G. M. (2013).
Modification of photosynthesis and growth responses to elevated
CO2 by ozone in two cultivars of winter wheat with different years
of release. Journal of Experimental Botany, 64, 1485–1496.
Booker, F. L., Reid, C. D., Harti-Brunschon, S., Fiscus, E. L., &
Miller, J. E. (1997). Photosynthesis and photorespiration in
soybean [Glycine max (L.) Merr.] chronically exposed to
elevated carbon dioxide and ozone. Journal of Experimental
Botany, 48, 1843–1852.
Chen, C., & Setter, T. L. (2012). Response of potato dry matter
assimilation and partitioning to elevated CO2 at various stages of
tuber initiation and growth. Environmental Experimental Botany,
80, 27–34.
Cheng, S. H., Moore, B., & Seemann, J. R. (1998). Effects of short-
and long-term elevated CO2 on the expression of ribulose-1,5-
bisphosphate carboxylase/oxygenase genes and carbohydrate
accumulation in leaves of Arabidopsis thaliana (L.) Heynh.
Plant Physiology, 116, 715–723.
Food and Agricultural Organization of the United Nations. (2007).
FAO Statistical Yearbook (Vol. 1 and 2). http://www.fao.org/
statistics/yearbook/vol_1_1/index.asp
Ghildiyal, M. C., Rafique, S., & Sharma-Natu, P. (2001). Photosynthetic
acclimation to elevated CO2 in relation to leaf saccharide
constituents in wheat and sunflower.Photosynthetica, 39, 447–452.
Hao, X. Y., Han, X., Lam, S. K., Wheeler, T., Ju, H., Wang, H. R.,
et al. (2012). Effects of fully open-air [CO2] elevation on leaf
ultrastructure, photosynthesis, and yield of two soybean culti-
vars. Photosynthetica, 50, 362–370.
Hodge, J. E., & Hofreiter, B. T. (1962). Analysis and preparation of
sugars. In: Whistler, R.L., & Miller, J.N.B. (Eds.), Methods in
carbohydrate chemistry (6th ed., pp. 356–378). New York:
Academic Press.
IPCC. (2014). Summary for Policymakers. In C. B. Field, V.
R. Barros, D. J. Dokken, K. J. Mach, M. D. Mastrandrea, T.
E. Bilir, M. Chatterjee, K. L. Ebi, Y. O. Estrada, R. C. Genova,
B. Girma, E. S. Kissel, A. N. Levy, S. MacCracken, P.
R. Mastrandrea & L. L. White (Eds.) Climate change 2014:
Impacts, adaptation, and vulnerability. Part A: Global and
sectoral aspects. Contribution of Working Group II to the fifth
assessment report of the intergovernmental panel on climate
change (pp. 1–32). Cambridge: Cambridge University Press.
Jaggard, K. W., Qi, A., & Ober, E. S. (2010). Possible changes to
arable crop yields by 2050. Philadelphia Transaction of Royal
Society B, 365, 2835–2851.
Jiang, Yu-Ping, Cheng, F., Zhou, Yan-Hong, Xiao-Jian, Xia, Shi, K.,
& Yu, J. Q. (2012). Interactive effects of CO2 enrichment and
brassinosteroid on CO2 assimilation and photosynthetic electron
transport in Cucumis sativus. Environmental Experimental
Botany, 75, 98–106.
Kant, S., Seneweera, S., Rodin, J.,Materne,M., Burch, D., Rothstein, S.
J., & Spangenberg, G. (2012). Improving yield potential in crops
under elevated CO2: Integrating the photosynthetic and nitrogen
utilization efficiencies. Frontiers in Plant Science, 3, 1–9.
Kumar, P., Rai, P., Chaturvedi, A. K., Khetarpal, S., & Pal, M. (2012).
High atmospheric CO2 delays leaf senescence and crop maturity
in chickpea (Cicer arietinum L.). Indian Journal of Plant
Physiology, 17, 254–258.
Locke, A. M., Sack, L., Bernacchi, C. J., & Ort, D. R. (2013).
Soybean leaf hydraulic conductance does not acclimate to
growth at elevated [CO2] or temperature in growth chambers or
in the field. Annals of Botany, 112, 911–918.
Long, S. P. (1994). The potential effects of concurrent increases in
temperature, CO2 and O3 on net photosynthesis, as mediated by
Rubisco. In R. G. Alscher & A. R. Wellburn (Eds.), Plant
response to the gaseous environment (pp. 21–38). London:
Chapman and Hall.
Moore, B. D., Cheng, S. H., Rice, J., & Seemann, J. R. (1998).
Sucrose cycling, Rubisco expression, and prediction of photo-
synthetic acclimation to elevated atmospheric CO2. Plant Cell
Environment, 21, 905–915.
Nelson, N. (1944). A photometric adaptation of the Somogyi method
for the determination of glucose. The Journal of Biological
Chemistry, 153, 375–380.
Ogren, W. L. (1984). Photorespiration: Pathways, regulation, and
modification. Annual Review of Plant Biology, 35, 415–442.
Pal, M., Jagadish, S. V. K., Craufard, P. Q., Fitzgerald, M., Lafarge,
T., & Wheeler, T. R. (2012). Effect of elevated CO2 and high
temperature on seed set and grain quality of rice. Journal of
Experimental Botany, 63, 3843–3852.
Pal, M., Pandian, V. K., Jain, V., Srivastava, A. C., Raj, A., &
Sengupta, U. K. (2004). Biomass production and nutritional
levels of berseem (Trifolium alexandrium) grown under elevated
CO2. Agriculture, Ecosystem & Environment, 101, 31–38.
Pal, M., Talwar, S., Deshmukh, P. S., Vishwanathan, C., Khetarpal,
S., Kumar, P., & Lutheria, D. (2008). Growth and yield of
chickpea genotypes under elevated carbon dioxide concentra-
tion. Indian Journal of Plant Physiology, 13, 367–374.
Pandurangam, V., Sharama-Natu, P., Sreekanth, B., & Ghildiyal, M.
C. (2006). Photosynthetic acclimation to elevated CO2 in
relation to Rubisco gene expression in three C3 species. Journal
of Experimental Biology, 44, 408–415.
Rogers, A., Ainsworth, E. A., & Leakey, A. D. B. (2009). Will
elevated carbon dioxide concentration amplify the benefits of
nitrogen fixation in legumes? Plant Physiology, 151, 1009–1016.
Saha, S., Chakraborty, D., Pal, M., & Nagrajan, S. (2011).
Impact of elevated CO2 on utilization of soil moisture and
associated soil biophysical parameters in pigeon pea (Cajanus-
cajan L.). Agriculture, Ecosystem & Environment, 142,
213–221.
Seneweera, S., Makino, A., Hirotsu, N., & Norton, S. Y. (2011). New
insight into photosynthetic acclimation to elevated CO2: The role
of leaf nitrogen and ribulose-1,5-bisphosphate carboxylase/oxy-
genase content in rice Leaves. Environmental Experimental
Botany, 71, 128–136.
Servaites, J. C., & Torisky, R. S. (1984). Activation state of ribulose
bisphosphate carboxylase in soybean leaves. Plant Physiology,
74, 681–686.
Sharkey, T. D. (1988). Estimating the rate of photorespiration in
leaves. Physiologia Plantarum, 73, 147–152.
Somogyi, M. (1952). Notes on sugar determination. The Journal of
Biological Chemistry, 195, 19–23.
Tausz-Posch, S., Borowiak, K., Dempsey, R. W., Norton, R. M.,
Seneweera, S., Fitzgeral, G. J., & Tausz, M. (2013). The effect of
elevatedCO2onphotochemistry and antioxidative defence capacity
in wheat depends on environmental growing conditions—A FACE
study. Environmental Experimental Botany, 88, 81–92.
Wang, L., Pedas, P., Eriksson, D., & Schjoerring, J. K. (2013).
Elevated atmospheric CO2 decreases the ammonia compensation
point of barley plants. Journal of Experimental Botany, 64,
2713–2724.
Yuan, J. S., Reed, A., Chen, F., & Stewart Jr, C.N. (2006). Statistical
analysis of real-time PCR data. BMC Bioinformatics, 7, 85.
Zelitch, I., Neil, P., Richard, B. S., Brown, P. P., & Brutnell, T. P.
(2009). High glycolate oxidase activity is required for survival of
maize in normal air. Plant Physiology, 149, 195–204.
Ind J Plant Physiol.
123
Author's personal copy
top related