1 23

Indian Journal of Plant PhysiologyAn International Journal of PlantPhysiology ISSN 0019-5502 Ind J Plant Physiol.DOI 10.1007/s40502-016-0209-4

Elevated CO2 enhances carbohydrateassimilation at flowering stage and seedyield in chickpea (Cicer arietinum)

Puja Rai, Ashish K. Chaturvedi, DivyaShah, C. Viswanathan & Madan Pal

1 23

Your article is protected by copyright and all

rights are held exclusively by Indian Society

for Plant Physiology. This e-offprint is for

personal use only and shall not be self-

archived in electronic repositories. If you wish

to self-archive your article, please use the

accepted manuscript version for posting on

your own website. You may further deposit

the accepted manuscript version in any

repository, provided it is only made publicly

available 12 months after official publication

or later and provided acknowledgement is

given to the original source of publication

and a link is inserted to the published article

on Springer's website. The link must be

accompanied by the following text: "The final

publication is available at link.springer.com”.

ORIGINAL ARTICLE

Elevated CO2 enhances carbohydrate assimilation at floweringstage and seed yield in chickpea (Cicer arietinum)

Puja Rai1 • Ashish K. Chaturvedi1 • Divya Shah1 • C. Viswanathan1 •

Madan Pal1

Received: 22 September 2015 / Accepted: 28 January 2016

� Indian Society for Plant Physiology 2016

Abstract Rising atmospheric CO2 concentration can

stimulate plant growth through enhanced photosynthesis

and carbohydrate assimilation. A study was planned to

analyse the effects of elevated CO2 (eCO2)

(570 ± 45 lmol mol-1) on photosynthesis, carbohydrate

assimilation and photorespiratory enzymes and their gene

expression in desi (Pusa 1103) and kabuli (Pusa 1105)

chickpea genotypes. The findings showed higher rate of

photosynthesis in both desi and kabuli chickpea genotypes

under elevated CO2 and was accompanied with increased

starch and sugar concentration and rubisco activity.

Expression of rbcS and rbcL genes was higher under ele-

vated CO2 during flowering stage but non-significant

changes occurred in expression at podding stage. Shoot

biomass and seed yield was significantly higher in both

chickpea genotypes under eCO2. Glycolate oxidase activity

decreased under eCO2 and the reduction was greater in desi

compared to kabuli genotype, suggesting suppressed pho-

torespiration in both the chickpea genotypes. The finding of

this study concludes that chickpea crop can perform better

under eCO2 environment due to increased rate of photo-

synthesis and suppressed photorespiration. Between two

types of chickpea, desi may respond better to eCO2 owing

to its higher sink potential than kabuli types.

Keywords Elevated CO2 � Photosynthesis � Rubisco �Glycolate oxidase � Cicer arietinum

Introduction

Increasing CO2 is one of the important climate change

factor, which has contributed significantly to global

warming. It has increased linearly since pre-industrial

period and reached to the current level of 400 lmol mol-1

(IPCC 2014). Plants can cope up with high atmospheric

CO2 through its better utilization in the process of photo-

synthetic carbon assimilation and producing higher bio-

mass (Jaggard et al. 2010). Various studies on response to

elevated CO2 (eCO2) have confirmed that C3 crops can

perform better in terms of enhanced growth and produc-

tivity under high CO2 environment (Ainsworth et al. 2008;

Kumar et al. 2012; Wang et al. 2013). Enhanced rate of

photosynthesis, improved plant growth and yield are the

well known changes in high CO2 grown plants (Pal et al.

2012; Chen and Setter 2012; Kant et al. 2012) which

depends on capacity of plants to utilize extra C assimilates

and sink availability (Aranjuelo et al. 2011, 2013).

As compared with C4, C3 plants perform better under

eCO2 due to increased rubisco carboxylation efficiency and

suppression of photorespiration. Rubisco has affinity for

both CO2 and O2; a considerable amount of energy is

wasted through photorespiratory carbon cycle, at ambient

CO2 concentration (Sharkey 1988). The carbon losses

through photorespiratory carbon oxidation (PCO) have

been reported around 40 % (Kant et al. 2012). High

atmospheric CO2 in the atmosphere can suppresses pho-

torespiration and help the plants to save photosynthetic

carbon loss through PCO. Legumes have sink capacity and

potential to respond to eCO2 owing to their large carbon

demand for nodulation and biological N2 fixation processes

(Rogers et al. 2009). Ainsworth et al. (2002) have reported

enhanced photosynthesis and higher productivity in

legumes compared to non-legumes under eCO2.

& Ashish K. Chaturvedi

ashispc@gmail.com

& Madan Pal

madanpal@yahoo.com

1 Division of Plant Physiology, Indian Agricultural Research

Institute, New Delhi 110012, India

123

Ind J Plant Physiol.

DOI 10.1007/s40502-016-0209-4

Author's personal copy

Chickpea (Cicer arietinum L.) is an important legume

crop in South Asia, and ranks second among the world’s

food legumes in terms of area (FAO 2007). There are two

types of chickpea: (1) the small-seeded desi chickpea with

a dark and thick seed coat, and (2) the large-seeded kabuli

chickpea with a light-coloured and thin seed coat. As

compared to cereal crops and other legumes, the informa-

tion regarding growth, photosynthesis and photorespiratory

process in chickpea in respect of their enzymes activity and

gene expression under elevated CO2 is very scanty (Pal

et al. 2008). Since flower and pod drop are major con-

straints in chickpea due to limited carbohydrate supply. We

hypothesized that in cereals enhanced photosynthesis and

carbon assimilation under elevated CO2 may limit above

constraints. So, we planned to analyse the effects of eCO2

on carbohydrate supply, photosynthesis, photorespiration,

and the activity and gene expression of rubisco and gly-

colate oxidase (GO), growth and seed yield in desi and

Kabuli chickpea genotypes.

Materials and methods

Plant material and CO2 treatment

The experiment was carried out during the winter (rabi)

season of 2011–2012 at Indian Agricultural Research

Institute, New Delhi, India (28�350N latitude, 77�120Elongitude and 228.16 m above mean sea level). Seeds of

chickpea (Cicer arietinum L.) genotypes, viz., Pusa 1103

(desi) and Pusa 1105 (kabuli) were sown in soil inside

Open Top Chamber (OTC) by maintaining row-to-row and

plant-to-plant distance of 30 and 10 cm, respectively. All

recommended agronomic practices were followed and

irrigation was given as and when required to maintain

moisture level at field capacity and avoid any moisture

deficit stress.

Plants were exposed to elevated CO2 (eCO2) level of

570 ± 45 lmol mol-1 inside OTCs, as designed by Pal

et al. (2004). During the entire experimental period, tem-

perature and humidity inside all OTCs were recorded

continuously with the help of sensors as described by Saha

et al. (2011). Elevated CO2 exposure was started after the

emergence of the crop and continued till crop maturity

from 6:00 AM to 6:00 PM daily. For chamber control,

ambient CO2 (aCO2) (384 ± 30 lmol mol-1) only pure air

was injected instead of CO2–air mixture. There were three

OTCs for control and high CO2 exposure each.

Leaf gas exchange

Measurement of net CO2 assimilation rate was made on

three plants per treatment using portable photosynthesis

system (Li-6400, LI-COR, USA) during 9:30–11:30 h of

the day. For each plant three different fully expanded upper

leaflets were selected for measurement at flowering and

podding stage in both the genotypes. CO2 concentration in

leaf chamber was controlled with the LI-COR CO2 injec-

tion system and a saturating photosynthetic photon flux

density (PPFD) of 1200 lmol m-2 s-1 was supplied from

LED light source.

Biochemical estimations and enzyme assays

Fully expanded upper leaves were taken and frozen in

liquid nitrogen for sugar, starch and enzyme assay and gene

expression studies. For sugar and starch analysis leaves

were immediately plunged in 95 % ethanol and preserved

for subsequent analysis. Leaf sample (0.5 g) preserved in

95 % ethanol was boiled for sugar extraction. Extract was

used for the sugar determination following Nelson’s

arsenomolybdate (Nelson 1944) and improved copper

reagent of Somogyi (1952) methods. Starch was extracted

in residual samples using perchloric acid and refluxing by

isopropanol (80 %), and estimated according to Anthrone

method of Hodge and Hofreiter (1962).

For rubisco enzyme assay frozen leaf samples (100 mg)

were homogenized in 2 ml of extraction buffer (50 mM

Tris–HCl, 5 mM MgCl2, 10 mM DTT, pH 8.0) and

homogenate was centrifuged at 25,000 g for 5 min at 4 �Cand supernatant was used for enzyme assay. Activity was

measured in assay medium containing Tris–HCl

(100 mM), DTT (5 mM), BSA (0.2 %, w/v), MgCl2(40 mM), NaH14CO3 (20 mM), and RuBP (2.5 mM) in a

6-ml stoppered plastic vial. The vials were shaken and

incubated at 25 �C for 5 min and enzyme activity was

initiated by adding RUBP and incubated for 5 min at 25 �Cwith shaking. After incubation, vials were dried overnight

at 60 �C. Acid-sTable14C was determined by scintillation

counting (Servaites and Torisky 1984).

For GO assay 0.05 g frozen leaves were homogenized

and extracted in cold potassium phosphate buffer (0.05 M,

pH 8.0). The homogenate was centrifuged at 4 �C and

14,000g and used for assay. Assay medium consist of

100 ll potassium phosphate buffer (0.05 M, pH 8.0),

100 ll cold 1.6 % phenylhydrazine-hydrochloride, 100 llfreshly prepared FMN, 100 ll of enzyme extract and

double distilled water to make the final volume of 1.5 ml.

The sample tubes were incubated at 30 �C for 10 min using

water bath shaker and 50 ll glycolic acid (0.1 M) was

added in each tube and incubated at room temperature for

20 min. The reaction was stopped using 500 ll HCl

(12 N). Potassium ferricyanide (100 ll, 8 %) was added to

induce colour of glyoxylate phenylhydrazone and activity

was assayed by recoding absorbance at 324 nm (Zelitch

et al. 2009).

Ind J Plant Physiol.

123

Author's personal copy

Quantitative real-time PCR

cDNA sequences of GO genes of Pisumsativum, Phaseolus

vulgaris, Medicagotruncatula, Vignaunguiculata and Gly-

cine max were downloaded from National Centre for

Biotechnology Information (NCBI) and aligned using

ClustalW. Primer sequences (Table 1) were selected

manually from the conserved regions of all five legumes,

and the oligonucleotide properties were analyzed by using

oligoanalyzer 3.1 software (http://www.idtdna.com/analy

zer/Applications/OligoAnalyzer/). GO cDNA was cloned

into pGEM-T Easy vector (Promega) and sequenced from

both the genotypes. Sequences were submitted to NCBI

(Accession No. JN009800 and JN009801). Based on these

sequences, gene specific primers were designed for qRT-

PCR analysis (Table 1). Nucleotide sequences of Chickpea

for rubisco (rbcL and rbcS) were downloaded from NCBI

and real-timePCR analysis was performed to investigate

the expression pattern of go and rubisco (rbcLand rbcS)

mRNA transcripts at flowering and podding stages under

elevated CO2 (eCO2). Total RNA was extracted from leaf

samples using the RNeasy Plant mini kit (Qiagen, Ger-

many). First-strand cDNA synthesis was performed using

2 lg RNA with Maxima� First Strand cDNA Synthesis Kit

for Q-PCR (Fermentas). qRT-PCR was performed using

Mx3005PTM sequence detection system and software

(Stratagene, USA). Each RT-PCR reaction was set up in

25-ll total volumes, containing 12.5 ll SYBR Green

Master Mix (Fermentas), 10 pmol of primers and B500 ng

of cDNA sample. The RT-PCR reactions were carried out

with the following cycling parameters: 2 min at 50 �C,10 min at 95 �C, and 40 cycles of 15 s at 95 �C and 30 s at

55 �C and extension at 72 �C for 30 s. The relative mRNA

levels for each gene were computed with respect to the

internal standard, GAPDH (Glyceraldehyde-3-phosphate

dehydrogenase), to normalize for variance in the quality of

RNA and the amount of input cDNA. The DDCt method

was used for calculation of relative expression as described

by Yuan et al. (2006).

Statistical analysis

Experiment was conducted in completely randomized

design with three replicates each for aCO2 and eCO2. The

data were statistically verified with analysis of variation

(ANOVA) and the significance of differences between the

means was tested using Duncan’s post hoc test at the sig-

nificance level P B 0.05 using SPSS v.10 for Windows

(SPSS Inc., Chicago, USA).

Results and discussion

High atmospheric CO2 concentration can enhance rate of

photosynthesis (PN) and carbon supply in C3 plants and

increases their growth and productivity (Ainsworth et al.

2008; Rogers et al. 2009, Pal et al. 2012; Chen and Setter

2012). It can suppress PCO and saves carbon loss

(Aranjuelo et al. 2011). In the present study, two desi and

kabuli chickpea genotypes were exposed to elevated CO2

to study their photosynthetic responses. Both the geno-

types showed significantly enhanced rate of photosyn-

thesis (PN) and the response differed at flowering and

podding stages (Fig. 1). PN increased at both flowering

and podding stages and the enhancement was more in

desi chickpea (56 % at flowering and 39 % at podding)

compared to kabuli (33 % at flowering and 28 % at

podding). Such an increase in PN during flowering and

podding stages shows availability of potential sink in both

chickpea genotypes. Similar increase in PN due to eCO2

treatment has been reported in wheat (Tausz-Posch et al.

2013; Biswas et al. 2013), soybean (Locke et al. 2013;

Hao et al. 2012), barley (Wang et al. 2013), oat (Bhatt

et al. 2010) and rice (Pal et al. 2012).

Table 1 Primer sequences for cloning and Real time PCR expression analysis of glycolate oxidase and rubisco

Gene Primer sequence (50–30) Amplicon size (bp)

Primer to clone glycolate oxidase

Glycolate oxidase gox-F: GAGGATCAGTGGACTCTGCAAGA

gox-R: CACCTAGTGCCAATGCCTTGAAGA

815

qRT-PCR primers

Glycolate oxidase gox-F: 50 GGACCAAGCTAATGACTCTGGACT-30

gox-R: 50-GACACCCTTGACAAGAATTGGCAG-30124

Rubisco-1,5-bis phosphate carboxylase/oxygenase-large sub unit rbcL-F: 50-CCAATTCGGTGGAGGAACTTTAGG-30

rbcL-R: 50-CAAGATCACGTCCCTCATTACGAG-30113

Rubisco-1,5-bis phosphate carboxylase/oxygenase-small sub unit rbcS F: 50-TACCTTCCACCATTGACTGAAGAG-30

rbcS R: 50-TGAGTTGTTGTGCTCACGGTACAC-30126

Ind J Plant Physiol.

123

Author's personal copy

Fig. 1 Effect of elevated CO2

exposure on photosynthetic rate

(lmol CO2 m-2 s-1) in

chickpea genotypes at flowering

and podding stages. Data shown

are mean ± SE. Values that do

not share common letters are

significantly different by

Duncan’s post hoc test at

P B 0.05

Fig. 2 Effect of elevated CO2 exposure on total sugars (A) and starch concentration (B) of chickpea genotypes at flowering and podding stages.

Data shown are mean ± SE. Values that do not share common letters are significantly different by Duncan’s post hoc test at P B 0.05

Ind J Plant Physiol.

123

Author's personal copy

Our finding showed that higher rate of photosynthesis

was accompanied by increase in sugar and starch content

(Fig. 2) in both the genotypes. Increase in PN under eCO2

resulted in increase in carbohydrates in the leaves to sup-

port the growth of chickpea. Between two genotypes, desi

type showed 42 % increase in concentration of total sugars

under eCO2 over aCO2, while in kabuli the increase was

32 % (over aCO2) at flowering stage. On the other hand, at

podding stage, the increase in concentration of total sugars

under eCO2 was 22 and 26 % over aCO2 in kabuli and desi

types, respectively (Fig. 2A). Similarly, starch concentra-

tion increased significantly under eCO2 treatment in both

the genotypes at above growth stages (Fig. 2B). The

increase in starch concentration was more in Pusa 1103

(30 % at flowering and 24 % at podding) compared to Pusa

1105 (26 % at flowering and 23 % at podding). In

comparison to starch, increase in sugar concentration was

more at both the stages. Similar changes in carbohydrates

concentration under eCO2 has been reported in chickpea

(Pal et al. 2008) and mungbean (Pandurangam et al. 2006).

Accumulation of more sugars compared to starch in the

leaves under eCO2 may result in down regulation of PN(Pandurangam et al. 2006); however, in this study con-

centration of both carbohydrates was similar.

The process of photosynthesis and photorespiration are

mediated through rubisco in C3 plants, and high atmospheric

CO2 promote photosynthetic carbon reduction over PCO

(Long 1994). Elevated CO2 exposure enhanced rubisco

activity in both the genotypes and the enhancement was

greater in desi chickpea (17 %over aCO2) at flowering stage,

while there was 8 % increase in rubisco activity of kabuli

chickpea at flowering in eCO2 exposed plants. However, at

Fig. 3 Effect of elevated CO2 exposure on rubsico (A) and glycolate

oxidase (B) activity in the leaf tissues of chickpea genotypes at

flowering and podding stages. Data shown are mean ± SE. Values

that do not share common letters are significantly different by

Duncan’s post hoc test at P B 0.05

Ind J Plant Physiol.

123

Author's personal copy

podding stage, there were non-significant changes in rubsico

activity in both the genotypes under eCO2 exposure

(Fig. 3A). Similar enhancement in rubisco activity has been

reported inwheat cultivars in response to eCO2 (Biswas et al.

2013). Elevated CO2 resulted in reduced GO activity in both

the genotypes at flowering and podding stages. Between the

two genotypes the reduction in GO activity in desi type was

greater at both the stages (33 and 25 % at flowering and

podding stages, respectively), while in kabuli, the reduction

was lower than desi type and the magnitude of reduction was

almost similar at both the stages (15–16 % over aCO2)

(Fig. 3B). Activity of GO, which is involved in oxidation of

glycolate in peroxisome, reflects changes in photorespiration

(PCO) (Ogren 1984). In this study, we observed reduction in

GO activity in both the chickpea genotypes grown under

eCO2 environment, confirming suppression of the process of

photorespiration due to high CO2/O2 ratio at the site of

rubisco. Booker et al. (1997) have reported reduction in GO

activity under eCO2 in soybean as a measure of suppressed

photorespiration.

Expression level of large (rbcL) and small subunits

(rbcS) of rubisco was more at flowering stage in both

chickpea genotypes under eCO2. rbcL transcript levels

increased by[1.5-fold in desi and B1.5 in kabuli type at

flowering stage under eCO2 (Fig. 4). At podding stage

there was a significant increase in the rbcS transcript level,

while rbcL transcript level showed non-significant changes

in both the genotypes (Fig. 4). go transcript level changed

significantly under eCO2 in both the genotypes during

flowering and podding stages, however the increase was

more in desi compared to kabuli type during flowering

stage (Fig. 4). Repression of photosynthetic genes has been

reported in eCO2 grown plants, which vary between intra

and inter species (Moore et al. 1998). Similar increase in

transcript level of rbcS and rbcL has also been reported in

cucumber under eCO2 (Jiang et al. 2012). Many studies

have suggested reduction in expression level and rubisco

protein content due to feed back inhibition or photosyn-

thetic acclimation and sugars accumulation (Ghildiyal et al.

2001; Pandurangam et al. 2006). Cheng et al. (1998) have

suggested that plant growth under eCO2 can result in a

differential repression of rubisco genes in a species. In our

study, there was correlation in enhancement of photosyn-

thesis and rubisco activity with expression of rbcS and

rbcL under eCO2 during flowering stage, and it was greater

for desi chickpea genotype (Pusa 1103). Similar response

between PN and rubisco or rbcS and rbcL expression under

eCO2 in different crop species has been reported by Kant

et al. (2012) and Seneweera et al. (2011).

Both the genotypes showed positive relationship

between photosynthesis, seed yield and shoot biomass

under eCO2. However, the relationship of photosynthesis

with grain yield was stronger for desi (Pusa 1103)

(r2 = 0.84) compared to kabuli type (Pusa 1105)

(r2 = 0.59) (Fig. 5A), while the relationship of photosyn-

thesis with shoot biomass was stronger for Pusa 1105

(r2 = 0.74) compared to Pusa 1103 (r2 = 0.63) (Fig. 5B),

which suggests that kabuli type (Pusa 1105) responded

better in terms of vegetative growth and produced more

shoot dry weight but desi type (Pusa 1103) showed better

Fig. 4 Effect of elevated CO2 exposure on relative transcript level of glycolate oxidase (go), and large (rbcL) and small (rbcS) sub-units of

rubisco in leaf tissues of chickpea genotypes at flowering and podding stages. Data shown are fold changes under eCO2 over aCO2

Ind J Plant Physiol.

123

Author's personal copy

translocation to sink, resulting in increase in seed yield

under eCO2 environment. Similar growth and yield

responses to eCO2 have also been shown in other crop

species (Wang et al. 2013).

The findings of this study conclude that elevated CO2

can improve growth and seed yield in chickpea crop

through increased rate of photosynthesis and suppression of

photo-respiratory carbon-losses. Between the two types of

chickpea, desi can perform better owing to its high sink

potential in terms of production of more number of pods

than kabuli type.

Acknowledgments The authors acknowledge Indian Council of

Agricultural Research (ICAR) for providing financial grant under

National Initiative on Climate Resilient Agriculture (NICRA) project.

References

Ainsworth, E. A., Davey, P. A., & Bernacchi, C. J. (2002). A meta

analysis of elevated (CO2) effects on soybean (Glycine max)

physiology, growth and yield. Global Change Biology, 8,

695–709.

Ainsworth, E. A., Leakey, A. D. B., Ort, D. R., & Long, S. P. (2008).

FACE-ing the facts: inconsistencies and interdependence among

field, chamber and modeling studies of elevated [CO2] impacts

on crop yield and food supply. New Phytologist, 179, 5–9.

Aranjuelo, I., Cabrera-Bosquet, L., Morcuende, R., Avice, J. C.,

Nogues, S., Araus, J. L., et al. (2011). Does ear C sink strength

contribute to overcoming photosynthetic acclimation of wheat

plants exposed to elevated CO2? Journal of Experimental

Botany, 62, 3957–3969.

Aranjuelo, I., Sanz-Saez, A., Jauregui, I., Irigoyen, J. J., Araus, J. L.,

Sanchez-Dıaz, M., & Erice, G. (2013). Harvest index, a

Fig. 5 Relationship of leaf photosynthesis with seed weight (A) and shoot biomass (B) of chickpea genotypes Pusa 1103 and Pusa 1105 exposedto elevated CO2. Solid symbols are values from plants grown at aCO2 and open symbols are values from plants grown at eCO2

Ind J Plant Physiol.

123

Author's personal copy

parameter conditioning responsiveness of wheat plants to

elevated CO2. Journal of Experimental Botany, 64, 1879–1892.

Bhatt, R. K., Baig, M. J., & Tiwari, H. S. (2010). Elevated CO2

influences photosynthetic characteristics of Avena sativa L.

cultivars. Journal of Environmental Biology, 31, 813–818.

Biswas, D. K., Xu, H., Li, Y. G., Ma, B. L., & Jiang, G. M. (2013).

Modification of photosynthesis and growth responses to elevated

CO2 by ozone in two cultivars of winter wheat with different years

of release. Journal of Experimental Botany, 64, 1485–1496.

Booker, F. L., Reid, C. D., Harti-Brunschon, S., Fiscus, E. L., &

Miller, J. E. (1997). Photosynthesis and photorespiration in

soybean [Glycine max (L.) Merr.] chronically exposed to

elevated carbon dioxide and ozone. Journal of Experimental

Botany, 48, 1843–1852.

Chen, C., & Setter, T. L. (2012). Response of potato dry matter

assimilation and partitioning to elevated CO2 at various stages of

tuber initiation and growth. Environmental Experimental Botany,

80, 27–34.

Cheng, S. H., Moore, B., & Seemann, J. R. (1998). Effects of short-

and long-term elevated CO2 on the expression of ribulose-1,5-

bisphosphate carboxylase/oxygenase genes and carbohydrate

accumulation in leaves of Arabidopsis thaliana (L.) Heynh.

Plant Physiology, 116, 715–723.

Food and Agricultural Organization of the United Nations. (2007).

FAO Statistical Yearbook (Vol. 1 and 2). http://www.fao.org/

statistics/yearbook/vol_1_1/index.asp

Ghildiyal, M. C., Rafique, S., & Sharma-Natu, P. (2001). Photosynthetic

acclimation to elevated CO2 in relation to leaf saccharide

constituents in wheat and sunflower.Photosynthetica, 39, 447–452.

Hao, X. Y., Han, X., Lam, S. K., Wheeler, T., Ju, H., Wang, H. R.,

et al. (2012). Effects of fully open-air [CO2] elevation on leaf

ultrastructure, photosynthesis, and yield of two soybean culti-

vars. Photosynthetica, 50, 362–370.

Hodge, J. E., & Hofreiter, B. T. (1962). Analysis and preparation of

sugars. In: Whistler, R.L., & Miller, J.N.B. (Eds.), Methods in

carbohydrate chemistry (6th ed., pp. 356–378). New York:

Academic Press.

IPCC. (2014). Summary for Policymakers. In C. B. Field, V.

R. Barros, D. J. Dokken, K. J. Mach, M. D. Mastrandrea, T.

E. Bilir, M. Chatterjee, K. L. Ebi, Y. O. Estrada, R. C. Genova,

B. Girma, E. S. Kissel, A. N. Levy, S. MacCracken, P.

R. Mastrandrea & L. L. White (Eds.) Climate change 2014:

Impacts, adaptation, and vulnerability. Part A: Global and

sectoral aspects. Contribution of Working Group II to the fifth

assessment report of the intergovernmental panel on climate

change (pp. 1–32). Cambridge: Cambridge University Press.

Jaggard, K. W., Qi, A., & Ober, E. S. (2010). Possible changes to

arable crop yields by 2050. Philadelphia Transaction of Royal

Society B, 365, 2835–2851.

Jiang, Yu-Ping, Cheng, F., Zhou, Yan-Hong, Xiao-Jian, Xia, Shi, K.,

& Yu, J. Q. (2012). Interactive effects of CO2 enrichment and

brassinosteroid on CO2 assimilation and photosynthetic electron

transport in Cucumis sativus. Environmental Experimental

Botany, 75, 98–106.

Kant, S., Seneweera, S., Rodin, J.,Materne,M., Burch, D., Rothstein, S.

J., & Spangenberg, G. (2012). Improving yield potential in crops

under elevated CO2: Integrating the photosynthetic and nitrogen

utilization efficiencies. Frontiers in Plant Science, 3, 1–9.

Kumar, P., Rai, P., Chaturvedi, A. K., Khetarpal, S., & Pal, M. (2012).

High atmospheric CO2 delays leaf senescence and crop maturity

in chickpea (Cicer arietinum L.). Indian Journal of Plant

Physiology, 17, 254–258.

Locke, A. M., Sack, L., Bernacchi, C. J., & Ort, D. R. (2013).

Soybean leaf hydraulic conductance does not acclimate to

growth at elevated [CO2] or temperature in growth chambers or

in the field. Annals of Botany, 112, 911–918.

Long, S. P. (1994). The potential effects of concurrent increases in

temperature, CO2 and O3 on net photosynthesis, as mediated by

Rubisco. In R. G. Alscher & A. R. Wellburn (Eds.), Plant

response to the gaseous environment (pp. 21–38). London:

Chapman and Hall.

Moore, B. D., Cheng, S. H., Rice, J., & Seemann, J. R. (1998).

Sucrose cycling, Rubisco expression, and prediction of photo-

synthetic acclimation to elevated atmospheric CO2. Plant Cell

Environment, 21, 905–915.

Nelson, N. (1944). A photometric adaptation of the Somogyi method

for the determination of glucose. The Journal of Biological

Chemistry, 153, 375–380.

Ogren, W. L. (1984). Photorespiration: Pathways, regulation, and

modification. Annual Review of Plant Biology, 35, 415–442.

Pal, M., Jagadish, S. V. K., Craufard, P. Q., Fitzgerald, M., Lafarge,

T., & Wheeler, T. R. (2012). Effect of elevated CO2 and high

temperature on seed set and grain quality of rice. Journal of

Experimental Botany, 63, 3843–3852.

Pal, M., Pandian, V. K., Jain, V., Srivastava, A. C., Raj, A., &

Sengupta, U. K. (2004). Biomass production and nutritional

levels of berseem (Trifolium alexandrium) grown under elevated

CO2. Agriculture, Ecosystem & Environment, 101, 31–38.

Pal, M., Talwar, S., Deshmukh, P. S., Vishwanathan, C., Khetarpal,

S., Kumar, P., & Lutheria, D. (2008). Growth and yield of

chickpea genotypes under elevated carbon dioxide concentra-

tion. Indian Journal of Plant Physiology, 13, 367–374.

Pandurangam, V., Sharama-Natu, P., Sreekanth, B., & Ghildiyal, M.

C. (2006). Photosynthetic acclimation to elevated CO2 in

relation to Rubisco gene expression in three C3 species. Journal

of Experimental Biology, 44, 408–415.

Rogers, A., Ainsworth, E. A., & Leakey, A. D. B. (2009). Will

elevated carbon dioxide concentration amplify the benefits of

nitrogen fixation in legumes? Plant Physiology, 151, 1009–1016.

Saha, S., Chakraborty, D., Pal, M., & Nagrajan, S. (2011).

Impact of elevated CO2 on utilization of soil moisture and

associated soil biophysical parameters in pigeon pea (Cajanus-

cajan L.). Agriculture, Ecosystem & Environment, 142,

213–221.

Seneweera, S., Makino, A., Hirotsu, N., & Norton, S. Y. (2011). New

insight into photosynthetic acclimation to elevated CO2: The role

of leaf nitrogen and ribulose-1,5-bisphosphate carboxylase/oxy-

genase content in rice Leaves. Environmental Experimental

Botany, 71, 128–136.

Servaites, J. C., & Torisky, R. S. (1984). Activation state of ribulose

bisphosphate carboxylase in soybean leaves. Plant Physiology,

74, 681–686.

Sharkey, T. D. (1988). Estimating the rate of photorespiration in

leaves. Physiologia Plantarum, 73, 147–152.

Somogyi, M. (1952). Notes on sugar determination. The Journal of

Biological Chemistry, 195, 19–23.

Tausz-Posch, S., Borowiak, K., Dempsey, R. W., Norton, R. M.,

Seneweera, S., Fitzgeral, G. J., & Tausz, M. (2013). The effect of

elevatedCO2onphotochemistry and antioxidative defence capacity

in wheat depends on environmental growing conditions—A FACE

study. Environmental Experimental Botany, 88, 81–92.

Wang, L., Pedas, P., Eriksson, D., & Schjoerring, J. K. (2013).

Elevated atmospheric CO2 decreases the ammonia compensation

point of barley plants. Journal of Experimental Botany, 64,

2713–2724.

Yuan, J. S., Reed, A., Chen, F., & Stewart Jr, C.N. (2006). Statistical

analysis of real-time PCR data. BMC Bioinformatics, 7, 85.

Zelitch, I., Neil, P., Richard, B. S., Brown, P. P., & Brutnell, T. P.

(2009). High glycolate oxidase activity is required for survival of

maize in normal air. Plant Physiology, 149, 195–204.

Ind J Plant Physiol.

123

Author's personal copy