cassie, abbie, marie. $1,000 a medical career that is involved with scd would be: a. cardiologist...

WHO WANTS TO BE A MILLIONAIRE:

SICKLE CELL DISEASE

Cassie, Abbie, Marie

$1,000

A medical career that is involved with SCD would be:

A. Cardiologist

B. Blood Spatter Analyst

C. Hematologist

D. DNA Analyst

$2,000

If you were to fall down and scrape your hands, what would stop the bleeding?

A. White Blood Cells

B. Plasma

C. Red Blood Cells

D. Platelets

$4,000

Another Name for Red Blood Cells is:

A. Erythrocytes

B. Leukocytes

C. Thrombocytes

D. Anemia

$6,000

How does the shape of the sickle cells affect its movement?

A. Makes it harder to move through vessels

B. Slows down blood flow

C. Stops blood flow

D. All of the above

$8,000

A hematocrit tests what percentage of whole blood is made up of:

A. Oxygen

B. White Blood Cells

C. Red Blood Cells

D. Plasma

$10,000

Symptoms of SCD may include:

A. Severe infection

B. Longer life expectancy

C. Bloating

D. Both A and C

$20,000

Treatment for SCD may include:

A. Antibiotics

B. Chronic Transfusion Therapy

C. Bone Marrow Transplant

D. All of the above

$30,000

What is the function of hemoglobin?

A. Carries Oxygen to body and CO₂ to the lungs

B. Carries Red Blood Cells to the bodyC. Carries White Blood Cells to

enemiesD. None of the above

$40,000

SCD:

A. Is an infectious disease

B. Can be inherited by one parent

C. Must be inherited by two parents

D. Both B and C

$50,000

How is the RNA molecule a “script” for protein production?

A. mRNA is read by tRNA

B. tRNA brings amino acids

C. Amino acids match with 3 mRNA sequences at a time, creating a protein

D. All of the above

$60,000

Change this DNA sequence into mRN

TACCATTGAAAGCATATCGAATGATGG

A. AUGACCCCCGUACAAACUACGUUCCGA

B. AUGGUAACUUUCGUAUAGCUUACUACC

C. AUGCGGCUUAUCUUUCUAUAUCUUCAG

D. AUGGUAACUUUCGUGUAGCUUACUUAC

$70,000

What amino acid must all protein sequences start with?

A. Thr

B. Pro

C. Val

D. Met

$80,000

Valine is:

A. Hydrophobic

B. Hydrophilic

C. Positive

D. Both A and C

$90,000

What type of mutation is responsible for SCD?

A. Point Mutation

B. Frameshift Mutation

C. SCD Mutation

D. Hemoglobin Mutation

$100,000

The replacement of glutamic acid with valine causes proteins be shaped in a way that causes them to:

A. Not move

B. Stick together

C. Run away from each other

D. Cry

$200,000

SCD is:

A. Always fatal

B. Dominate

C. Always homozygous

D. Recessive

$300,000

Clint is heterozygous with SCD, so is his wife. What is the percentage their child will have SCD and/or be a carrier?

A. 25%

B. 50%

C. 75%

D. 100%

$400,000

A woman is a homozygous SCD carrier and her husband is not a carrier. What is not the genotypic ratio their child will have SCD?

A. 1:2:1

B. 1:1

C. 2:2

D. 1

$500,000

Proteins:

A. Are based on A, T, C, U

B. Produce all genetic traits

C. Responsible for half our body functions

D. Dictate our life expectancy

$600,000

Change this DNA sequence into mRNA:

AACGATACCAACGATACC

A. UUGCUAUGGUUGCUAUGA

B. UUCCUAUUGUUGCUAUGG

C. UUGCUAUUGCUGGCUAUG

D. UUGCUAUGGUUGCUAUGG

$800,000

What does not determine the shape of a protein?

A. Amino Acids present

B. Number of Amino Acids

C. Order of Amino Acids

D. Surrounding Environment

$1,000,000

Which is not a step of protein synthesis?

A. Info on DNA is copied to mRNA

B. mRNA enters the nucleus

C. Ribosome attaches to mRNA and tRNA brings amino acids

D. Amino acids match w/ 3 at a time and ribosomes assemble amino acids into specific protein originally coded for by the gene on the DNA