achieve improved variant detection in single cell sequencing infographic
Post on 14-Jan-2017
1.402 Views
Preview:
TRANSCRIPT
Achieve improved variant detectionin single cell sequencing
Sample to Insight
Trademarks: QIAGEN®, Sample to Insight®, REPLI-g® (QIAGEN Group). For up-to-date licensing information and product-specific disclaimers, see the respective kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at www.qiagen.com or can be requested from QIAGEN Technical Services or your local distributor.© 2016 QIAGEN, all rights reserved. PROM-9403-001
1101136
¹ Zhang, C.-Z. et al. (2015) Calibrating genomic and allelic coverage bias in single-cell sequencing, Nat. Comm. 6, 6822.
“ For clinical samples with a limited number of cells, such as fine-needle aspirates or circulating tumour cells, the most interesting genetic variants are shared among the cells, … it is most efficient to perform ‘census-based variant detection’ from multiplexed sequencing of independently amplified single-cell DNA libraries, each sequenced to modest depths (~1x ).“1
No need for you to sequence at high depth as required in bulk sample variant detection
Why is single cell variant detection in cancer important?
• Facilitates your identification of tumor subpopulation and founder mutations
• Enables you to analyze circulating cells for non-invasive monitoring and early detection
• Simplifies your understanding of tumor phylogenetic trees and cell lineages
Census-based variant detection: increase variant detection power and reduce false
positives from library preparation¹
Pool single cell librariesSequence at modest depth (~1x per cell)
Uniform genome coverage during whole genome amplification is required
Prepare single cell libraries from multiple single cells
AGTCAGTCCCTTAAGGCCTTAGTTTTAA >30x
AGTCAGTCCCTTAAGGCCTTAGTTTTAA ~1x
Library # 1
Library # 2
Library # 3
Accept (variant allele detected in ≥2 libraries)Reject (variant allele detected in 1 library only)
Accurate variant detection in rare cells – feasible and affordable
SpotlightWith REPLI-g® Single Cell Kits,you can achieve highly uniformand comprehensive coverage
with superior accuracy
top related