alleletyper software user guide (pub. no - life technologies

USER GUIDE

AlleleTyper™ SoftwareCatalog Number 4486060Publication Part Number 4486002Revision A

For Research Use Only. Not for diagnostic procedures.

For Research Use Only. Not for use in diagnostic procedures.

The information in this guide is subject to change without notice.

DISCLAIMER: LIFE TECHNOLOGIES CORPORATION AND/OR ITS AFFILIATE(S) DISCLAIM ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, OR NON-INFRINGEMENT. TO THE EXTENT ALLOWED BY LAW, IN NO EVENT SHALL LIFE TECHNOLOGIES AND/OR ITS AFFILIATE(S) BE LIABLE, WHETHER IN CONTRACT, TORT, WARRANTY, OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL, INCIDENTAL, INDIRECT, PUNITIVE, MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT, INCLUDING BUT NOT LIMITED TO THE USE THEREOF.

NOTICE TO PURCHASER: DISCLAIMER OF LICENSE

Purchase of this software product alone does not imply any license under any process, instrument or other apparatus, system, composition, reagent or kit rights under patent claims owned or otherwise controlled by Life Technologies Corporation, either expressly, or by estoppel

TRADEMARKSThe trademarks mentioned herein are the property of Life Technologies Corporation and/or its affiliate(s) or their respective owners. TaqMan is a registered trademark of Roche Molecular Systems, Inc., used under permission and license. Google is a registered trademark and Chrome is a trademark of Google, Inc. Adobe, Acrobat, and Reader are trademarks of Adobe Systems, Inc. Excel, Microsoft, and Windows are registered trademarks of Microsoft Corporation.

© 2013 Life Technologies Corporation. All rights reserved.Part Number 4486002December 2013 (Rev. A)

Contents

3AlleleTyper™ Software User Guide

About This Guide . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

Purpose of this guide . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

Prerequisites . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

User attention words . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

CHAPTER 1 Product Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

Purpose of the software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

Prerequisites . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10

Workflow . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11

CHAPTER 2 Produce SNP genetic patterns . . . . . . . . . . . . . . . . . . . . . 13

Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

Produce SNP genetic patterns . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

Examine the data in TaqMan® Genotyper™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14

Export results file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14

CHAPTER 3 Produce copy numbers . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15

Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15

Produce copy numbers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15

Examine the data in CopyCaller® software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16

Export results file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16

CHAPTER 4 Create a translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17

Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17

Translation table templates and examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18

Create a monoallelic translation table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18

Create translation table file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19Create header section . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19Report headers and footers (Optional) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

Create translator table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20

4 AlleleTyper™ Software User Guide

Contents

Convert monoallelic translation table to a biallelic translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22(Optional) Export the biallelic conversion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23(Optional) Edit the biallelic translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23

Create a biallelic translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24

Multi-gene translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25

Import the biallelic translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

Manage translators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

CHAPTER 5 Translate genetic patterns . . . . . . . . . . . . . . . . . . . . . . . . . 27

Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27

Access AlleleTyper™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28

AlleleTyper™ Project List page . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29View Existing Project Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29Open an existing project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29Delete an existing project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30Export or Import projects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30

Create a new project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31User Settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31Enter project information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31

Load translator specification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

Import sample data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34

View results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35Summary Reports . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35Detailed Reports . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36

(Optional) Export Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38

APPENDIX A Example Translators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39

Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39

Monoallelic translation table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39

Biallelic translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40

Multi-gene translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

Specialty biallelic translators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42Common nomenclature genotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42Translator for triallelic SNP TaqMan® assay results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42Translator for adjacent SNP TaqMan® assay results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44

Converting monoallelic translation tables to biallelic translators . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45

APPENDIX B Canonical translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47

Canonical models for translator and report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47Canonical translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48Canonical report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49


Contents

APPENDIX C Blood Group Translator . . . . . . . . . . . . . . . . . . . . . . . . . . . 51

Translation table for Blood Group Genotyping . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51

Blood group determination requiring more than one SNP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52

APPENDIX D Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53

Glossary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55

Documentation and Support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

Related documentation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

Obtaining support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

Limited Product Warranty . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58


Contents


About This Guide

Purpose of this guide

The AlleleTyper™ Software User Guide provides reference information for the use of AlleleTyper™ Software and describes how to prepare translation tables containing genetic pattern information and how to use these translation tables to map TaqMan® SNP Genotyping Assay and/or TaqMan® Copy Number Assay results to any desired nomenclature used by a laboratory or research group.

Prerequisites

This guide uses conventions and terminology that assume a working knowledge of the Microsoft® Windows® operating system, the Internet, and Internet‐based browsers.

User attention words

User attention words may appear in this document. Each word implies a particular level of observation or action as described below:

Note: Provides information that may be of interest or help but is not critical to the use of the product.

IMPORTANT! Provides information that is necessary for proper translator development or data analysis.


About This GuideUser attention words

1


Product Information

Purpose of the software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

Prerequisites . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10

Workflow . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11

Purpose of the software

Life Technologies AlleleTyper™ Software is an automated data analysis application that translates genetic pattern information (constructed from TaqMan® SNP Genotyping Assay and/or TaqMan® Copy Number Assay results) to a particular user‐defined nomenclature.

Use AlleleTyper™ Software to:

• import TaqMan® SNP Genotyping Assay and/or TaqMan® Copy Number Assay results

• convert monoallelic translation tables to biallelic translators

• export translation tables for editing

• translate genetic patterns into nomenclature appropriate for your work

• view and export detailed reports

Prerequisites

Proper use of the AlleleTyper™ Software requires the following:

• Computer with internet access, supported web browser, and Microsoft® Excel® Software.

• An understanding of the assays required for genotyping the gene variants of interest in the project.

• A prepared translator table, see Chapter 4, “Create a translator” on page 17.

• Exported data file(s) from TaqMan® Genotyper™ Software and/or CopyCaller® analysis software. See Chapter 2, “Produce SNP genetic patterns”and Chapter 3, “Produce copy numbers” for information on required formatting of exported files.

• These data files contain assay genotype results for a particular set of samples, initially run on an Applied Biosystems® PCR system.


Product InformationOverview1

Overview

AlleleTyper™ Software is a flexible tool used for conversion of sample genotype information for single or multiple genes or loci to the desired nomenclature used by a laboratory or research group. For example, the Pharmacogenomics (PGx) community uses the star (*) allele nomenclature to describe gene‐level haplotypes that have been associated with drug metabolizing enzyme (DME) phenotypes (e.g., functional or nonfunctional variants). Polymorphisms within a star allele can include SNPs, insertion/deletion (InDels), and copy number variants (CNVs). For another example, the blood genotyping community requires translation of genetic information from multiple genes to standard blood group nomenclature. The AlleleTyper™ Software can also be used to translate the genotype results for special cases such as when a triallelic SNP is interrogated using two TaqMan® SNP assays, as well as used to simply provide a name for a particular genetic outcome for a given SNP or copy number assay.

The basic functionality of the AlleleTyper™ Software is graphically outlined in the following figure.

This AlleleTyper™ Software User Guide covers how to create and use translation tables and describes the input data files required. Before creating a translation table, or translator, consider all TaqMan® SNP Genotyping Assays (including TaqMan® DME Assays) and TaqMan® Copy Number Assays that will be used in your project, and which of these you will want to include in a translation table for reporting sample genotype results with specific nomenclature. SNP assay and copy number assay experiment data generated on an Applied Biosystems® real‐time PCR system must be analyzed by TaqMan® Genotyper™ Software and CopyCaller® Software, respectively, as results files exported from these software are input files for AlleleTyper™ Software.

AlleleTyper™ Software aids creation of translation tables by automatically converting monoallelic translation tables into biallelic translators. After examining biallelic translators for completeness and accuracy, they are imported into AlleleTyper™ Software along with TaqMan® Genotyper™ data files and/or CopyCaller® data files. AlleleTyper™ Software then matches the sample genetic pattern data to patterns in the biallelic translator and reports back the designated nomenclature for each matching pattern (on a gene‐by‐gene basis when a multi‐gene translator is used).

Exported Data(Genotyper™/CopyCaller®)Translator file

AlleleTyper™

Software

Results(View/Export)


Chapter 1Workflow 1

Workflow

Produce genotype information

Produce SNP genetic patterns

Examine the data in TaqMan® Genotyper™ Software

Export results file

Produce copy numbers

Examine the data in CopyCaller® software

Export results file

Create a translator

Create translation table file

Create a monoallelic translation table

Convert monoallelic translation table to a biallelic translator

(Optional) Edit the biallelic translator

Create a new project

Access AlleleTyper™ Software


Load translator specification

Translate genetic patterns

Import sample data

View results

(Optional) Export Results


Product InformationWorkflow1


2 Produce SNP genetic patterns

This chapter covers:

Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

Produce SNP genetic patterns . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

Examine the data in TaqMan® Genotyper™ Software . . . . . . . . . . . . . . . . . . . . . . 14

Export results file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14

Overview

TaqMan® Genotyper™ Software is a standalone software application designed to analyze raw data from TaqMan® SNP Genotyping Assay and TaqMan® Drug Metabolism Genotyping Assay experiments that were run on an Applied Biosystems® real‐time PCR system. Use TaqMan® Genotyper™ Software to generate SNP genotyping data files that you can import into AlleleTyper™ Software for translation.

Input data can be from any Applied Biosystems® instrument (e.g., a 7500/7500 Fast System, ViiA™ 7 Real‐Time PCR System, or QuantStudio™ Real‐Time PCR System) or consumable format (e.g., a 96‐well, 384‐well, or OpenArray® plate) that is supported by the TaqMan® Genotyper™ Software.

For instructions on how to use TaqMan® Genotyper™ Software, refer to the TaqMan® Genotyper™ Software Getting Started Guide (Pub. no. 4448637). If you do not have TaqMan® Genotyper™ Software, you can download a free copy from www.lifetechnologies.com.

Produce SNP genetic patterns

SNP assay data generated on an Applied Biosystems® real‐time PCR system must first be analyzed by TaqMan® Genotyper™ Software before it can be translated by AlleleTyper™ Software. Run TaqMan® Genotyper™ Software to analyze the real‐time PCR data, and export Analysis Results (SNP genotyping results) data files. The TaqMan® Genotyper™ Software can be used to collate the results of multiple SNP assays for all samples in a study into one or more (.txt) results file(s) for import into AlleleTyper™ Software and downstream translation. AlleleTyper™ Software requires the following information be included in the exported TaqMan® Genotyper™ Software results file:

The following fields are required in the main table:

• Assay ID

• NCBI SNP Reference

• Sample ID


Produce SNP genetic patternsExamine the data in TaqMan® Genotyper™ Software2

• Call

• Manual

• Task

• Well

• Experiment

Examine the data in TaqMan® Genotyper™ Software

Prior to exporting the SNP genetic pattern results, use TaqMan® Genotyper™ Software to verify that the following values are correct:

• Study information, which includes general information about the study. For example, the date/time the study was exported and the user who created the study.

• Sample or well information, which includes detailed information about each sample in the study, for example, the Assay ID, Sample ID, and genotype call.

• Assay information, which includes the SNP allele bases. This is provided to Genotyper™ for predesigned SNP and DME assays by importing the Assay Information File (AIF) found on your order CD. Allele bases are extracted from the assay context sequences (provided for the (+) strand of the reference genome); the allele order indicates the association with probe dyes as: [VIC®/FAM™]. For Custom assays, context sequences are currently not provided in AIFs; these can be manually created and added to an AIF. It is recommended that the plus (+) reference genome strand is used for consistency with predesigned assays in your project.

IMPORTANT! Accurate genetic pattern results and correct syntax usage is essential as AlleleTyper™ Software looks for exact pattern matches in order to make the correct call. Review the calls made by TaqMan® Genotyper™ Software and edit them as needed before exporting the results for use in translation analysis.

Export results file

After you generate analysis data, export the data using the Analysis Results−Advanced option. To export the TaqMan® Genotyper™ data file, select ExportAnalysis DataAnalysis ResultsAdvanced, then select (.txt) and click Export.

IMPORTANT! Data files exported from TaqMan® Genotyper™ will not be compatible with AlleleTyper™ Software unless they are exported from the TaqMan® Genotyper™ software using the ʹAdvancedʹ option. Ensure that the aforementioned required fields are selected for export.


3 Produce copy numbers


Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15

Produce copy numbers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15

Examine the data in CopyCaller® software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16

Export results file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16

Overview

CopyCaller® Software performs relative quantitation analysis of genomic DNA targets using the real‐time PCR data from TaqMan® Copy Number Assay experiments. The software and associated copy number assays can be used to detect and measure copy number variation of specific genomic sequences. Use CopyCaller® Software to analyze the real‐time PCR data and export copy number data files. Files can then be imported into AlleleTyper™ Software for translation.

Input data can be from any Applied Biosystems® instrument (e.g., a 7500/7500 Fast System, ViiA™ 7 Real‐Time PCR System, or QuantStudio™ Real‐Time PCR System) or consumable format (e.g., a 96‐well, 384‐well, or OpenArray® plate) that is supported by the CopyCaller® Software.

For instructions on how to use CopyCaller® Software, refer to the CopyCaller® Software User Guide (Pub. no. 4400042). If you do not have CopyCaller® Software, you can download a free copy from www.lifetechnologies.com.

Produce copy numbers

Run CopyCaller® Software to analyze the real‐time PCR data and to export copy number analysis results from one or more experiments into a single CopyCaller® Analysis data file for downstream import into and translation by AlleleTyper™ Software. AlleleTyper™ Software requires the following information be included in the exported CopyCaller® file:

The following fields are required in the main table:

• Sample Name

• Target (Typically the assay ID. If a user‐defined target name is used, the suffix ʹ_cnʹ must be appended to the name)

• CN Predicted (predicted copy number)


Produce copy numbersExamine the data in CopyCaller® software3

Examine the data in CopyCaller® software

After completing the CopyCaller® Software copy number analysis, verify that copy number values are of high quality. Calculated copy numbers should be close to whole number integer values; intermediate copy number values (e.g., 1.5) can indicate that the calibrator or calibrator copy number was specified incorrectly or that a potential problem exists with that sample or the calibrator sample. Predicted copy number values should have high confidence values (i.e., >95%). Note that the copy number analysis binning function can be used to specify that a sample has one or more duplication events by using a bin value of ≥3. When the data review is complete, export the results for use in AlleleTyper™ Software.

IMPORTANT! Accurate gene copy number results and correct syntax usage is essential as AlleleTyper™ Software looks for exact pattern matches in order to make the correct call. Ensure that the predicted copy numbers are unambiguous and correct before exporting results for use in translation analysis.

Export results file

To export the CopyCaller® data file select FileExport, then check Copy Number Results and select tab‐delimited text file (.txt) from the Export Results in drop‐down list, then click Export.

4


Create a translator


Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17

Translation table templates and examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18

Create a monoallelic translation table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18

Create translation table file . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19

Create translator table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20

Convert monoallelic translation table to a biallelic translator . . . . . . . . . . . . . . . . 22

Create a biallelic translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24

Import the biallelic translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

Manage translators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

Overview

This chapter describes how to create a translation table (or “translator”) containing genetic patterns associated with the desired nomenclature. Before creating a translator, consider all TaqMan® SNP Genotyping Assays (including TaqMan® DME Assays) and TaqMan® Copy Number Assays that will be used in your project, and which of these you will want to include in a translator for reporting sample genotype results with specific nomenclature.

You can create two types of translation tables: monoallelic and biallelic.

Monoallelic translation tables contain haplotype information and must be converted to biallelic translators containing diplotype information. The AlleleTyper™ Software will assist in making this conversion. Only biallelic translators are used for sample translation analysis. For studies that involve many gene variants, it is easiest to first prepare a monoallelic translation table and use AlleleTyper™ Software to convert this to a biallelic translation table containing all possible diplotype combinations. The biallelic translator can then be edited, if desired, by exporting the table and using a spreadsheet application such as Microsoft® Excel® to make any adjustments to it. For studies involving small numbers of variants or for special case assays such as for triallelic SNPs, it may be straightforward to directly prepare a biallelic table. For studies involving more than one gene, it is generally recommended that single gene translators are first prepared and tested, and then manually merged into a multi‐gene biallelic translator.

This chapter describes how to make basic translation tables. For information on how to create translators for specialized situations (e.g., inclusion of triallelic SNP assay information) see Appendix A.


Create a translatorTranslation table templates and examples4

Translation table templates and examples

Life Technologies provides example AlleleTyper™ translation table template files and translation tables (including monoallelic and biallelic tables; single gene and multi‐gene translators) for commonly tested drug metabolism gene variants as well as for blood group genotyping. These can be downloaded from the AlleleTyper™ web page and used as templates for creating translators specific for your TaqMan® Assays panel. Figures exemplifying different types of translators can also be found in Appendix A.

For PGx community researchers, the PharmGKB website (www.pharmgkb.org) provides comprehensive haplotype translation tables for CYP gene variants found in the Human Cytochrome P450 (CYP) Allele Nomenclature Database (www.cypalleles.ki.se) as well as for other drug metabolism gene variants. These can be used as reference tables for creating AlleleTyper™ translation tables.

The translation tables provided by both Life Technologies and PharmGKB use the convention whereby the variant alleles are provided in the (+) strand orientation of the reference genome. Likewise, TaqMan® SNP and DME Genotyping Assays context sequences are provided in the (+) genome strand orientation. In contrast, the star allele nomenclature for many PGx genes does not follow this convention: the variant alleles may map to the (–) strand of the reference genome and thus are given in the reverse complement orientation (e.g., CYP2D6, which maps to the (–) genome strand).

Create a monoallelic translation table

Translation tables can be prepared in monoallelic format or biallelic format as described in the following sections. We recommend creating single gene monoallelic tables and using the AlleleTyper™ Software to convert into biallelic format. See “Specialty biallelic translators” on page 42 for more information about special situations which may necessitate manually creating biallelic translators.

To create a monoallelic translation table:

Note: Refer to Appendix A on page 39 for an example monoallelic translation table or Appendix B on page 47 to see a model canonical translation table.

1. Create a new translation table Excel® file and create the header section.

2. Create translation specification table content by adding assay, group (if applicable), and haplotype information.

3. Populate the table with genetic pattern information under each Assay ID (column) for each haplotype (row).

4. Confirm the genetic pattern information is correct (i.e., ensure that the alleles used match the alleles found in the TaqMan® Genotyper™ results files).

Note: Accurate genetic pattern entry and correct syntax usage is essential as AlleleTyper™ Software looks for exact pattern matches in order to make the correct call.

5. Save the file as a Comma Separated Value (.csv) file.

https://www.lifetechnologies.com/us/en/home/clinical/clinical-translational-research/pharmacogenomics/alleletyper-software.html

http://www.cypalleles.ki.se/

http://www.cypalleles.ki.se


http://www.pharmgkb.org

http://www.cypalleles.ki.se/


Chapter 4Create translation table file 4

Create translation table file

To prepare a translator specifications table, create a Microsoft® Excel® spreadsheet that consist of two main parts: the header and the translation specification table.

1. Open a new spreadsheet or existing translation table template in Excel.

2. Click Save or Save As to save the new spreadsheet. Navigate to your preferred location to save the workbook. Enter the file name, select comma separated value (.csv) in the Save as type drop‐down list, then click Save.

Create header section

The purpose of the header section is to list information relevant to the translator that will be displayed in the software and in exported report files (i.e., translation results files). Header field names are assigned in column A, the corresponding attribute value is entered into the adjacent cells in column B.

1. Designate the header field names in column A. Enter three asterisks followed by the attribute field name (e.g., ***Version, see example). There is no limit to the number of rows of header information that can be displayed by the AlleleTyper™ Software.

2. Enter attribute values specific to the project for each header field into the adjacent cells of column B. AlleleTyper™ Software will display this information exactly as entered on the right hand side of the Setup page.

Note: Commas (,) may be used in the header field names and attribute fields without breaking the contained information across multiple cells in exported report files.

Report headers and footers (Optional)

Report headers and footers will not be displayed in the software but will appear at the top and bottom of exported report files. Enter information to appear in the exported report header and footer between the translator header and the translation specification table.

1. For each report header, enter three asterisks, followed by ‘HD’ without an intervening space (***HD) as the header field name into column A.

2. For each report footer, enter three asterisks, followed by ‘FT’ without an intervening space (***FT) as the footer field into column A.

1 2


Create a translatorCreate translator table4

3. Enter header and footer specific information into the adjacent cells in column B.

Note: Commas (,) may be used in the header and footer attribute fields to format information in the results files (i.e., separate blocks of information into individual cells) for ease of reading. Information entered into cells to the right of column B will not appear in the report.

Create translator table

Create the translator table by adding allele information for each assay to the worksheet below the header section. The following example shows a monoallelic translation table.

1. Below the header information, designate a landmark cell by entering four hashmarks (####) into an empty cell in column A. The AlleleTyper™ Software looks for this landmark cell to use as a reference from which to find the pertinent genetic pattern information it requires to make a sample translation “call”.

• Annotations entered to the right of the ‘####’ landmark cell represent assay information relevant to the user. Annotations entered into this row (Row 13 above example) will appear in the AlleleTyper™ Software and are exported into reports but are not interpreted by the software. Annotations can include allele nomenclature, gene names, rs SNP IDs, or assay names.

Note: Assays with the same name in this row will be grouped together under a merged cell header in the AlleleTyper™ Setup and Results tables. If this row is left blank (except for the ʹ####ʹ landmark cell) or if annotations in this row are unique, all assays are assumed to be in the same group and they will appear in the same order in the setup and results tables as in the translation table.

• (Optional) Additional user annotations entered into cells in the row above the ‘####’ landmark cell (Row 12, above example) are only for the user’s own reference; they will only appear in the translation table and not in AlleleTyper™ Software windows or in exported reports.


Chapter 4Create translator table 4

2. Enter TaqMan® Assay ID’s in the row immediately below the ‘####’ landmark cell (Row 14, above example). The assay IDs entered must be unique and identical to the assay IDs present in TaqMan® Genotyper™ Software or CopyCaller® Software results files that contain the sample data to be translated by AlleleTyper™ Software.

Note: Translation tables can contain a maximum of 160 assays.

IMPORTANT! If the assay IDs are not identical between the translation table and the TaqMan assay results files, the AlleleTyper™ Software will not be able to match assay genotypes and provide a translation result.

IMPORTANT! A translation table should not contain TaqMan® Assays that are not found in the TaqMan® Genotyper™ Software or CopyCaller® Software files. This results in AlleleTyper™ calls of ‘UND’ (undetermined) for all outcomes that depend upon that assay. The converse, having assays in the data files that are not in the translation table, will not interfere with translation.

Add haplotype information to the worksheet below the header section.

3. In the cell two rows below the ‘####’ landmark cell (Cell A15 in this example), enter the gene name or group name(s) if desired. If a multi‐gene translator is being prepared, the gene names used in this column will show up as column headers for gene‐specific translations in the Results report. If the cells below the ‘####’ landmark are left blank, then all haplotypes are assumed to be part of the same gene or assay group (i.e., for a single gene translator the value entered in the cell immediately to the right will be used as the header for the genotype results column).

4. Enter the specific haplotype names into column B. For a single gene translator, put the gene name at the top of this column (i.e., CYP2D6 in cell B14 in this example) for it to show up in the translation results report.

Add genetic pattern information to the worksheet to create the translation specification.

5. To the right of each haplotype and underneath the proper assay ID, enter the expected allele for the assay target.

Note: For monoallelic translation tables, only one allele value is allowed per cell. As SNP assays probe two alleles, a column in the table can contain only two unique alleles other than NOAMP. A cell in the table can be left blank which means the outcome for that assay has no influence on the genetic pattern. Syntax for correctly entering information into the worksheet for each genetic pattern is listed in the following table.


Create a translatorConvert monoallelic translation table to a biallelic translator4

6. Confirm the genetic pattern information is correct (i.e., ensure that the alleles used match the alleles found in the TaqMan® Genotyper™ results files).

IMPORTANT! Accurate genetic pattern entry and correct syntax usage is essential as AlleleTyper™ Software looks for exact pattern matches in order to make the correct call. The same SNP alleles that are used in the TaqMan® Genotyper™ Software export files must be used in the translation table.

7. Save the file as a Comma Separated Value (.csv) file.

Convert monoallelic translation table to a biallelic translator

AlleleTyper™ Software aids creation of translation tables by automatically converting monoallelic translation tables containing haplotype patterns to biallelic translators containing all possible diplotype or genotype patterns (e.g., *1 and *2 haplotypes to *1/*1, *1/*2 and *2/*2 diplotypes). See “Converting monoallelic translation tables to biallelic translators” on page 45 for a full description of the logic used in converting translators. We recommend that the user export the newly created biallelic translator and review for accuracy, test the translator with a test set of sample data, and make corrections where necessary before using it in a large project.

Note: The diplotype names used in a biallelic translator will appear as the diplotype ‘call’ in the translation results (e.g., *1/*2). Default diplotype names can be edited if desired, see [(Optional) Edit the biallelic translator (page 23)].

Table Syntax Comment Genotype examples

A, C, G, or T SNP base. Can be paired with a base, base string, or –.

A/G, C/TG, A/-

– Represents that a deletion or insertion is not present at this site. Can be paired with a base, base string, ins or del.

-/A, -/AGA, -/ins, -/del

Base string A sequence of 2 or more bases. Can be paired with a -, base, or base string.

AGTC/-, TG/A, CCC/GGG

ins Represents a sequence insertion. Must be paired with a –.

ins/–

del Represents a sequence deletion. Must be paired with a –.

del/–

noamp No amplification expected (for SNP assay).

noamp (e.g., gene is deleted)

No entry (blank cell)

Value not required by translator. Any of the possible calls for the assay (e.g. if A and G alleles: A/A; A/G; G/G)

Copy number Must be a single integer (0 to 20 inclusive) <, >, <=, or >= can prepended the integer value

0, 1, 2, 3, <2, >2, <=4, >=3


Chapter 4Convert monoallelic translation table to a biallelic translator 4

To convert a monoallelic translation table to a biallelic translator:

1. Log in to the AlleleTyper™ Software and create a new project or open an existing project, see “Create a new project” on page 31.

2. Click the Setup menu button to view the translation table import screen.

3. Click on the Import button on the Translator Specifications bar.

4. Navigate to the folder where you saved the monoallelic translation table (.csv) file, select the file and click Open. The translation table will automatically be imported in monoallelic format.

5. Click the BiAllelic button on the Translator Specifications bar, the translation table will be automatically shown in biallelic format: AlleleTyper™ Software creates a table of all possible diplotype combinations of the haplotypes found in the monoallelic table. Toggle between mono‐ and biallelic formats by using the MonoAllelic and BiAllelic buttons; only the biallelic translator information is used for sample genotype translation analysis.

Note: Data errors in the translation table will be identified by the software. Erroneous data will appear in red font and an error message will be displayed at the bottom of the Translation Specification page. Any errors must be fixed before the software can convert a monoallelic table to a biallelic translator. Refer to Appendix D, “Troubleshooting” on page 53 for a list of error messages.

(Optional) Export the biallelic conversion

To export the biallelic conversion:

1. Click the Export button in the Translator Specifications bar.

2. Navigate to the destination folder, enter the file name, select Comma Separated Value (.csv) in the Save as type drop‐down list, then click Save.

(Optional) Edit the biallelic translator

It may be necessary to edit the biallelic translator to:

• rename diplotype names, or other information as desired

• remove redundant diplotypes

• edit genotype specifications as needed (e.g., triallelic SNP assays, see Appendix A, “Example Translators” on page 39)

To edit the biallelic translator:

1. Open the newly converted biallelic translator in Excel® software.


Create a translatorCreate a biallelic translator4

2. Make desired edits to the biallelic translator table.

• Right click the cell you want to edit, select Clear Contents, then enter new information into the cell.

3. Add/Delete rows of information as needed.

• Right‐click the row number to highlight the row immediately below desired insertion row, select Insert to add a row.

• Right‐click the row number to highlight the row to be deleted, select Delete to remove the row.

4. Confirm the genetic pattern information is correct, then click Save. Use Save As to save the edited version of the biallelic translator as a .csv file with a new filename.

Note: We recommend testing the biallelic translator for errors with a test set of sample data. Troubleshoot (see Appendix D, “Troubleshooting” on page 53) any translator errors and edit as required to correct the translator.

Create a biallelic translator

Prepare biallelic translator specifications as for monoallelic translation tables.

Note: It is unnecessary to create a biallelic translator de novo if a monoallelic table has already been created. However, it may be straightforward to directly make a biallelic translation table when creating a specialty translator, or one with only a limited number of diplotypes.

Note: Refer to Appendix A for example translation tables.

1. Open a new Excel® spreadsheet or existing translation table template and create the header section.

2. Add assay, gene or group, and diplotype information.

3. Populate the translator with genetic pattern information under each Assay ID (column) for each diplotype (row).

Note: Syntax used for assay outcomes in biallelic translators is the same as that used for monoallelic translation tables except that a forward slash “/” is used to separate the two alleles for a diplotype (e.g., ‘G/G’ or ’− /TCT’). When more than one genotype is allowed, genotypes must be separated by a semi‐colon (e.g., A/A; A/G). Copy number cells must have a single value.

4. Confirm the genetic pattern information is correct.

Note: Accurate genetic pattern entry and correct syntax usage is essential as AlleleTyper™ Software looks for exact pattern matches in order to make the correct call.

5. Save the translator file as a Comma Separated Value (.csv) file.


Chapter 4Multi-gene translator 4

Multi-gene translator

Translation tables containing multiple genes can be built two ways:

Note: Refer to “Multi‐gene translator” on page 41 to see an example of a multi‐gene translator.

1. First create a multi‐gene monoallelic translation table followed by automated conversion to a biallelic translator in AlleleTyper™ .

a. Follow the general directions in “Create a monoallelic translation table” on page 18.

b. For each gene of the multi‐gene translator, add the gene name to each cell of the column beneath the ‘####’ landmark cell for which there is an associated haplotype name and genetic pattern information in the adjacent columns. It is acceptable to use identical haplotype names as long as gene names are unique.

Note: This will serve to functionally group all haplotype names and genetic pattern information for the gene.

c. Follow the instructions in “Convert monoallelic translation table to a biallelic translator” on page 22.

Note: AlleleTyper™ Software will build a multi‐gene biallelic translator from a multi‐gene monoallelic translation table on a gene‐by‐gene basis.

2. First create single‐gene biallelic translators in AlleleTyper™ followed by manual assembly into a multi‐gene translator.

a. Create individual gene‐specific biallelic translators. Follow the general directions in “Create a monoallelic translation table” through “(Optional) Edit the biallelic translator” sections for each gene of interest.

b. Create a new translation table file with header section in Microsoft® Excel®.

c. Copy and paste the biallelic translation information from the first gene‐specific biallelic translator into this new file.

d. Enter the gene name into each cell of the column beneath the ‘####’ landmark cell for which there is an associated diplotype name and genetic pattern information in the adjacent columns.

e. Copy and paste the assay ID information for the second gene in the next available columns to the right of the last assay from the first gene.

f. Copy and paste the diplotype name information for the second gene immediately below the diplotype name information of the first gene.

g. Enter the second gene name into each cell, below the first gene name, for which there is an associated diplotype name in the adjacent column.

h. Copy and paste the genetic pattern information of the second gene into the table under the appropriate assay ID headers and to the right of the appropriate gene and diplotype names.

i. Repeat steps e–h for all genes of interest. Click Save when done.


Create a translatorImport the biallelic translator4

Option 2 may be preferable when assays for several genes are included in the translator as it may be simpler to test, edit and troubleshoot individual gene biallelic translators before assembly into a multi‐allelic gene translator.

Note: Translation tables can contain a maximum of 160 assays.

IMPORTANT! When using multi‐gene translators, the gene names provided in the column under the ‘####’ landmark cell will become column headers for gene‐specific sample calls in the Results report. Similarly for single gene translators, if a gene name is entered in the ‘####’ column, this gene name will also appear as the Results sample call column header. If no gene name is entered in the ‘####’ column, the header used for the diplotype name column will be used.

Import the biallelic translator

To import the biallelic translator:

1. Log in to the AlleleTyper™ Software and create a new project or open an existing project (page 31).

2. Click Setup (step 2 in the main toolbar), then click Import in the Translator Specifications toolbar.

3. Navigate to the destination folder, select the edited translator, then click Open. The translation table will be imported in biallelic format.

IMPORTANT! If translator information was already imported into the project, it will be over‐written.

Manage translators

It is the users responsibility to manage translators and review them for accuracy of allele patterns. Follow good file management practices. This includes:

• Proper labeling of translator files, including version

• Validating translator integrity

• Restricting access to translators

• Replacing outdated translators

AlleleTyper™ Software provides translator version tracking. All export files will record the version of the translator used to create the exported results. Verify that the correct version of a translator is loaded for a given project.


5 Translate genetic patterns


Access AlleleTyper™ Software . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28

AlleleTyper™ Project List page . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29

Create a new project . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31

Load translator specification. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

Import sample data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34

View results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

(Optional) Export Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38

Overview

AlleleTyper™ Software compares input sample data files (SNP genetic patterns produced and exported from TaqMan® Genotyper™ Software and/or the copy number calls produced and exported from CopyCaller® Software) with a user defined biallelic translator, see Chapter 4. AlleleTyper™ Software searches for matches between a sample’s SNP allele and/or copy number (genetic pattern) and those genetic patterns listed in the translator to determine the sample diplotype and provide results for export.

Input data can be from any Applied Biosystems® real‐time instrument platform (e.g., a 7500/7500 Fast System, ViiA™ 7 Real‐Time PCR System, or QuantStudio™ Real‐Time PCR System) that is supported by the TaqMan® Genotyper™ or CopyCaller® software.


Translate genetic patternsAccess AlleleTyper™ Software5

Access AlleleTyper™ Software

When deployed in cloud configuration, the AlleleTyper™ Software is accessed as an internet application that is optimized for use with the Microsoft® Windows® operating system running the Google® Chrome™ web browser v4.0 or later.

1. Confirm that your computer has an internet connection.

2. Open a browser window and navigate to the AlleleTyper™ Software registration page at: apps.lifetechnologies.com/alleletyper

Note: Using your browser settings, confirm that cookies and JavaScript are turned on for the website to function correctly. If you cannot access the website, contact Life Technologies Customer Support.

3. You will be prompted to sign in using your Life Technologies account username and password. If you do not have an account, follow the instructions to create a new user account, then click the Continue button. If you are already signed in with your account, the software will open automatically.

Note: If you cannot sign in to the software, contact Life Technologies Customer Support.

4. The AlleleTyper™ Project List page will open.




https://apps.lifetechnologies.com/alleletyper



Chapter 5AlleleTyper™ Project List page

5

AlleleTyper™ Project List page

After signing in to the AlleleTyper™ Software the AlleleTyper™ Project List page will be displayed. This is the home screen that displays existing projects. From the Project List page you can create a new project, open an existing project, or manage an existing project. Projects can be complete (with full results content) or partially complete (in progress).

From the AlleleTyper™ Project List page the user can:

• View existing project information

• Open existing projects

• Delete existing projects

• Export or import projects

• Create new projects

To return to the AlleleTyper™ Project List page at any time click on the software name at the top of the page.

View Existing Project Information

Project information can be viewed without opening the project by clicking on the icon to the left of the project name. Clicking the icon will display a pop‐up window displaying the project information.

Open an existing project

To open an existing project:

• Click on the existing Project Name.

or

• Click on the icon to the left of the project name, then click Open.


Translate genetic patternsAlleleTyper™ Project List page5

Delete an existing project

To delete an existing project:

1. Click the icon at the right side of the AlleleTyper™ Project List page. The Confirmation Dialog box will be displayed.

2. Click Yes to delete the project, click No to return to the project information screen.

Export or Import projects

To Export a project:

1. Select the project to export by clicking within the project row.

2. Click Transfer a project out, the following dialog will be displayed.

3. Select Save File, then click OK. Navigate to the location where the file is to be saved, enter a new file name if desired, then click Save.

To Import a project:

1. Click Transfer a project in, to open the Import a project dialog.

2. Navigate to the location where the file is saved, select the project (.las file) to import, then click Open.


Chapter 5Create a new project

5


To create a new project click on the Create a Project button. Creating a new project or opening an existing project displays the Project Information screen.

Note: Once a new project is initiated the project will be visible in the Project List page of the user account until deleted by the user.

User Settings Click user settings to manage default settings for:

• date and time format

• export file format

• CSV (comma delimited)

• Text (tab delimited)

• maximum alternative translations reported

1. Click on the icon to access the user settings.

2. Select your preferred default settings from the drop down lists to change the maximum number of possible translations to report. See “Detailed Reports” on page 36 for more information.

3. Click Yes to accept the new settings. Click No or the icon to close the pop‐up window without making any changes.

Enter project information

In the Project Information screen details of the project can be entered or edited. Information entered is automatically saved to the project.

Note: To return to the Project List page at any time click on the software name at the top of the page.

1. Accept the default project name or enter a new project name. This filename can be changed at any time by opening the project and entering a new name in the Project Name field.


Translate genetic patternsLoad translator specification5

2. Optional: Enter additional information relating to the project in the Description and Notes panes if desired.

3. Enter any comments specific to the project into the Project Comments pane, then click the Post Comment button to add the comment. Comments will appear in the Comments History section immediately below.

Note: Comments are only visible in the Project Information screen and are not exported in the final results files.

4. Click Setup (step 2) in the progression bar to open the Translator Specifications page. The project name and any description or comments will automatically be saved.

Load translator specification

You can have only one translator specification per project. The translator specifies the TaqMan® assay data that AlleleTyper™ Software needs to collect for samples from the Genotyper™ Software or CopyCaller® Software input files. See, “Create translation table file” on page 19 for details on how to create a mono‐ or biallelic translation table. Once loaded, a monoallelic translation table can be converted to a biallelic translator using the AlleleTyper™ Software. The software shows the conversion and enables you to export it for editing, see “Convert monoallelic translation table to a biallelic translator” on page 22. Only a biallelic translator can used for translation of sample genotype results.

For more information about translators, see Appendix A, “Example Translators” on page 39.

To load a translator specification:

1. Click Import in the Translator Specifications pane.

2. Navigate to the location on your computer where the translator (.csv) file (created in Chapter 4, “Create a translator” on page 17) is saved, select the file to import, then click Open. If translator information was previously imported for this project, it will be overwritten.

Note: Translator specification file can be either mono‐ or biallelic format. A monoallelic translation table will be automatically converted to a biallelic translator which is required for sample genotype translation analysis.


Chapter 5Load translator specification

5

Note: (Optional) The Clear button can be used to remove translator information from the project. It is not necessary to clear previous translator information before importing a new table.

3. The contents of the translation table will appear in the Translator Specifications pane. Translator header information will be displayed in the window to the right (report header/footer information will only appear in exported translator files). If the imported translator is monoallelic, two buttons “Bi‐Allelic” and “Mono‐Allelic” will appear in the translator specifications pane header.

Note: These buttons do not appear when the imported translator is biallelic.

4. Click the Bi‐Allelic button to view the imported translation table in biallelic format. Depending on the size of the translator table this may take several seconds to complete. The translator table will now appear in biallelic format. View either the mono‐ or biallelic translation table by clicking the appropriate button.

See “Convert monoallelic translation table to a biallelic translator” on page 22 for additional information on converting translators.

5. Export the biallelic translator to review, edit if needed and import back into AlleleTyper™ Software.

a. Click Export and save the file as (.csv) or (.txt) in your preferred location when prompted by the web browser.

b. Open the newly converted biallelic translator in Excel® and edit as necessary to:

• rename diplotype names, or other information as desired

• remove redundant diplotypes, see “Biallelic translator” on page 40.

• edit genotype specifications as needed (e.g., triallelic SNP assays, see Appendix A, “Example Translators” on page 39)

c. Confirm the genetic pattern information is correct. Click Save to replace the original file with the edited version or use Save As to save the edited version of the biallelic translator as a .csv file with a new filename.

Note: Steps to export and save files may vary depending on internet browser and browser settings being used. Refer to your internet browserʹs help guide if needed.


Translate genetic patternsImport sample data5

6. (Optional) Import the edited biallelic translator specification table.

• Click Setup to return to the Translator Specifications page.

• Click Import, select the edited biallelic translation table, then click Open to load the edited biallelic translator.

Note: This will replace the biallelic translator currently loaded in the software.

7. Click Data to import TaqMan® Genotyper™ files and/or CopyCaller® files. The imported translator will automatically be saved to the project and the Sample Data screen will open.

Import sample data

Import TaqMan® Genotyper™ Software and/or CopyCaller® Software sample genotyping results (.txt) files into the AlleleTyper™ project.

• Imported data for each sample will be compared against the translator specification patterns to determine the resulting diplotype for each sample. Analysis data needs to contain information for the assays listed in the translator table.

• TaqMan® Genotyper™ Software results files contain information from TaqMan® SNP Genotyping Assay experiments. To generate and export Genotyper™ data, refer to Chapter 2, “Produce SNP genetic patterns” on page 13.

• CopyCaller® Software results files contain information from TaqMan® Copy Number Assay experiments. To generate and export CopyCaller® data, refer to Chapter 3, “Produce copy numbers” on page 15.

To import files:

1. Click the Import button to open the File Upload window.

2. Select the appropriate TaqMan® Genotyper™ or CopyCaller® data .txt file, then click Open.

Note: Multiple Genotyper™ (.txt) files, or multiple CopyCaller® (.txt) files, can be imported one at a time by clicking ʹImportʹ and choosing additional TaqMan® Genotyper™ or CopyCaller® .txt files.


Chapter 5View results

5

3. Imported data will appear in the pane on the right. Source file information (including filename) for the corresponding data will appear, in the TaqMan® Genotyper™ files pane or CopyCaller® files pane respectively, on the left.

4. Remove unnecessary data analysis files.

a. Click on the icon to the left of the filename.

b. Click Yes when prompted to confirm removal of the data.

Note: This will only remove the data from the AlleleTyper™ Software. The original (.txt) data file will not be deleted.

5. Optional: To remove all data analysis information, click the Clear button on the right side of the Sample Data bar.

6. Click Results (step 4) in the progression bar to open the Results page. The project will automatically be saved.

View results

AlleleTyper™ Software automatically translates the genotyping data for each sample in the input files and generates a Summary Report that is displayed in the Results page.

Summary Reports The Summary Report generated lists all the diplotype translations that match each Sample ID.

• Sample names, taken from the TaqMan® Genotyper™ and/or CopyCaller® data, are listed in the Sample ID column.

• Diplotype results (‘calls’) are listed under the user‐assigned gene or group name to the right of the sample IDs.

Note: The gene or group name will match the name that was provided in Chapter 4, “Create a translator”. (CYP2D6 in the following example).


Translate genetic patternsView results5

• The sample’s genetic pattern is reported in the right hand columns.

• Undetermined calls are designated as ʹUNDʹ.

Note: If replicates of a given sample/assay combination were run and had inconsistent results, the genotype is reported as UND for that combination.

• Click on the Detailed Report button for possible explanations of undetermined (UND) results calls.

Detailed Reports Detailed reports display additional information not found in the summary report, including:

• Possible translations: if a sample contains missing data or undetermined genotyping calls for a given assay within a gene or group, the sample gets an UND call in the Summary Report, but the software will determine possible translations for the sample that are consistent with the available information and report these in the Detailed Report.

– If a single translation result is consistent with the available data, this is displayed as the result in the Detailed Report.

– If more than one translation is possible, the alternative translations are displayed in italics wrapped in curly brackets { }. The maximum number of alternative diplotypes that AlleleTyper™ Software reports can be set in the User Settings (page 31).

• Comments on samples for which there are special circumstances; such as missing or undetermined values, or where results were based on one or more manual genotype calls.

Note: If a sample returns a ʹnoampʹ genotyping result for a given assay, the software treats it as an undetermined call unless ‘noamp’ appears explicitly in the translator. In the latter case, the software looks for an exact match. However, if, for a given assay, noamp is listed as an explicit call in the translator but, as a result of trying to match it exactly, no translations are found, the software treats the noamp in the sample as UND and tries to find a translation that is consistent with the rest of the available genotype information.


Chapter 5View results

5

To view the detailed report:

1. Click the Detailed Report button to view the complete results call information for each sample.

2. Scroll up or down to find the Sample ID of interest.

• Translation possibilities for undetermined calls appear faded in curly brackets.

• Information related to each sampleʹs result call is listed in the Notes column. Refer to the following table for explanations of messages displayed in the Notes column.

Note: When more than one gene or group name has been entered in the translator, the resulting set of diplotype translations for each gene/group will be displayed separately in its own column.

Message Displayed Explanation

there are undetermined values for these assays

The genotyping result is 'UND' for the indicated assays, or the result is 'noamp' and a 'noamp' call does not appear explicitly in the translator.

manual calls involved One or more calls in the genetic pattern were manually adjusted in TaqMan® Genotyper™ Software.

no translation is available The genetic pattern for the sample is not found in the translator.

no available data No data is available for the sample.

inconsistent replicates for these assays.

Replicates of the indicated sample/assay combinations gave inconsistent results. UND is assigned to those combinations.

missing data for these assays Data is missing for the indicated assay(s).


Translate genetic patterns(Optional) Export Results5

(Optional) Export Results

Exported results files will contain report header and footer information if it was entered into the translation table.

To export results files:

1. Select the report to export by clicking on the Summary Report or Detailed Report button in the Results page menu bar.

2. Click on the Export button in the Results page menu bar. The Export Settings window will be displayed. A default filename and file type (.csv) are pre‐populated.

3. Enter an Export File Name (recommended), then select the Export File Type from the drop down menu.

Note: The default Export File Type can be set as a preference in User Settings by clicking on the icon in the project header at the top of the page.

4. Click Export, navigate to the destination folder, then click Save.

Note: Some browsers or browser settings may save the file automatically in a ‘download’ folder.


A Example Translators


Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39

Monoallelic translation table. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39

Biallelic translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40

Multi‐gene translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

Specialty biallelic translators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42

Converting monoallelic translation tables to biallelic translators . . . . . . . . . . . . . 45

Overview

This appendix covers examples of different types of translators and how to modify a biallelic translator for use in specific situations not previously covered in Chapter 4, “Create a translator” on page 17.

Note: Life Technologies also provides example AlleleTyper™ translation table template files and translation tables (including monoallelic and biallelic tables; single gene and multi‐gene translators) for commonly tested drug metabolism gene variants as well as for blood group genotyping. These are available for download through the AlleleTyper™ Software information page accessed from www.lifetechnologies.com/pgx and may be used as templates for creating translators specific for your TaqMan® Assays panel.

Monoallelic translation table

The following is an example of a monoallelic translation table for a subset of important CYP2D6 SNP and Copy Number Variants.

https://www.lifetechnologies.com/pgx.html

https://www.lifetechnologies.com/pgx.html




Biallelic translatorA

Biallelic translator

The following is an unedited example of a biallelic translator, converted by the AlleleTyper™ Software from the above monoallelic translation table. This table represents a subset of important CYP2D6 SNP and Copy Number Variants. AlleleTyper™ builds all possible diplotypes from the monoallelic haplotypes. Due to the presence of copy number variant alleles, the resultant biallelic translator contains redundant diplotypes that fall into two categories:

1. Containing 2 CYP2D6 gene copies:

*1/*1 and *1x2/*5, *4/*4 and *4x2/*5, and *10/*10 and *5/*10x2. Each pair of diplotypes represents having a CYP2D6 gene on each chromosome or having two copies of CYP2D6 on one chromosome (a duplicated allele) and no gene on the other chromosome (the *5 null deletion allele). This structural difference cannot be determined by qPCR and the phenotypic outcome is the same. The diplotypes containing *5 can be removed from the translator.

2. Containing 3 CYP2D6 gene copies:

*1/*4x2 and *1x2/*4, *1/*10x2 and *1x2/*10, and *4/*10x2 and *4x2/*10. Each pair of diplotypes represents the situation where both alleles of a given variant are present and run as heterozygotes in SNP genotyping experiments; the SNP allele that is duplicated cannot be distinguished. Either the redundant diplotypes can be kept in the translator and both options can be reported, or one instance can be deleted and the genotype renamed, e.g., to *1/*4 dupe.


Multi-gene translator A

Multi-gene translator

The following is an example of a monoallelic mutli‐gene translation table for three genes.

The following is the corresponding example biallelic mutli‐gene translator for three genes.


Specialty biallelic translatorsA

Specialty biallelic translators

Common nomenclature genotypes

The following is an example of a biallelic translator using common nomenclature for specific genotypes. By entering gene/group names into column A the Summary and Detailed results tables will include the headers: Factor V Leiden, Factor II 20210G>A, MTHFR A222V and MTHFR E429A and the sample genotype result will be reported as WT, HET, or MUT.

Translator for triallelic SNP TaqMan® assay results

Triallelic SNP targets can be interrogated using a pair of TaqMan® SNP Genotyping assays. Each assay contains one probe for the major SNP allele, which is labeled with the same reporter dye in both assays (e.g., VIC® dye), and one probe for one of the minor alleles, which is labeled with the second reporter dye (e.g., FAM™ dye). To generate accurate sample genotypes, the two assays must be run independently on the same panel of samples and the resulting allelic discrimination plots must be analyzed in concert, comparing the expected cluster positions from both assays to a map of the true sample genotypes. AlleleTyper™ Software can be used to translate the results.

After running paired assays for triallelic SNPs in separate reactions on the same genomic DNA samples, examine the cluster plots in TaqMan® Genotyper™ Software. Sample calls my need to be adjusted, as noted below:

• Heterozygotes.

Any sample called as a heterozygote is a true heterozygote for the reported alleles in a given assay.

• Homozygotes.

Samples running in or near a FAM™ or VIC® homozygous cluster can be either a true homozygote for the reported allele, or can be a heterozygote for the FAM™ or VIC® reported allele and for the unreported SNP allele in a given assay. Samples carrying just one reported allele may or may not run together with those carrying two reported alleles; i.e., cluster splitting may or may not be notable. If samples close to a homozygote cluster are called as undetermined, manually call these as homozygotes.

• Noamp. Weak or No amplification.

Samples that are homozygous for the unreported allele can exhibit weak amplification, relative to other samples carrying reported alleles, due to nonspecific activity of the assay probes. If a weakly amplifying sample has been called as undetermined, manually adjust the call to ʹnoampʹ so that sample genotype data can be translated properly by the AlleleTyper™ Software.


Specialty biallelic translators A

The TaqMan® Genotyper™ Software results can be exported and files imported into AlleleTyper for translation using a biallelic translation table specific for the triallelic SNP assay pair. The following example translation table is for the ABCB1 c.3095G>T/A triallelic SNP rs2032582 assays. Results will be reported in the Summary and Detailed results tables with the header: ABCB1 c.3095G>T/A and the appropriate genotype result, as noted.

Note: The SNP alleles reported by the assays and the cDNA alleles are the reverse complement of one another, since assay context sequences are provided in the genome plus strand orientation whereas the ABCB1 gene maps to the minus strand.


Specialty biallelic translatorsA

Translator for adjacent SNP TaqMan® assay results

For certain highly studied DME targets, two SNPs are located adjacent to one another, which complicates the genetic analysis of these SNPs. If two adjacent SNPs occur in only 3 haplotypes, however, the SNPs can be interrogated similarly to triallelic SNPs using two assays (see “Translator for triallelic SNP TaqMan® assay results” on page 42). For example, only 3 haplotypes have been observed for the CYP2C19 *2 and *10 SNPs (www.cypalleles.ki.se/cyp2c19.htm): the rare *10 c.680T allele and the *2 c.681A do not occur together on the same chromosome and only 6 diplotypes are possible (similar to triallelic SNPs). The genotype results from both a *2 SNP assay and a *10 SNP assay must be compared to determine the genotypes of each SNP. This is because when a *2 assay is run on a sample containing a *10 allele, the probes will fail to amplify the *10‐containing allele; the converse is true when the *10 assay is run on a sample containing a *2 allele. Context sequences for each assay and a biallelic translator table that contains the 6 possible diplotype patterns are shown below.

Assay context sequences for CYP2C19*2 and *10 SNPs:

• CYP2C19.2, c.681G>A, C—25986767–70

TTCCCACTATCATTGATTATTTCCc[A/G]GGAACCCATAACAAATTACTTAAAA

• CYP2C19.10, c.680C>T (assay commercialization in process)

TTTCCCACTATCATTGATTATTTCC[C/T]gGGAACCCATAACAAATTACTTAAA

• *10 *2

TTTTCCCACTATCATTGATTATTTCC[C/T][G/A]GGAACCCATAACAAATTACTTAAA

Note: Commercialization of the CYP2C19*10 assay is in progress. Contact your Sales Representative for early access to this assay.

Haplotype/Haplotype†

† Note: This table contains an extra column displaying the SNP alleles in each diplotype to help clarify the genetic patterns. As the *2 and *10 alleles have not been observed to occur on the same chromosome, diplotypes including the A-T haplotypes are not included. The placement of this column to the left of the #### landmark means that this information will not be used by AlleleTyper™ Software.

#### Diplotypes

CYP2C19*2 assay CYP2C19*10 assay

681 G/A – 680C 681G – 680 C/T

CYP2C19 C—25986767–70 *10 Assay ID

G–C/G–C *1/*1 G/G C/C

G–C/G–T *1/*10 G/G C/T

G–C/A–C *1/*2 G/A C/C

G–T/G–T *10/*10 noamp T/T

G–T/A–C *2/*10 A/A T/T

A–C/A–C *2/*2 A/A noamp

http://www.cypalleles.ki.se/cyp2c19.htm

http://www.cypalleles.ki.se/cyp2c19.htm


Converting monoallelic translation tables to biallelic translators A

Converting monoallelic translation tables to biallelic translators

The following section demonstrates the logic used by the AlleleTyper™ Software when converting monoallelic translation tables to biallelic translators when blank cells (1) or cells containing the value ‘noampʹ (2) are present in the monoallelic translation table.

1. Blank cells in translation tables. Monoallelic translation tables can contain blank cells, indicating that a genetic pattern value is not required for a given assay to define a given haplotype. When a diplotype is composed of one haplotype with a blank well and one haplotype with a SNP allele value for a given assay, the biallelic translator will show the 2 possible genotypes.

2. NOAMP values in translation tables. In a monoallelic translation table, the value ʹnoampʹ indicates that the expected outcome for a sample is no amplification (e.g., the gene is deleted or the SNP assay does not contain a probe for an allele present in the haplotypes).

When a sample contains just one SNP allele that can be amplified by a SNP genotyping assay, the sample will cluster with samples that are homozygous for 2 alleles (as will samples containing 3 copies of the same SNP allele). The biallelic translator will show, for example, a genotype of G/noamp as G/G to match the SNP assay genotyping result. A copy number assay result is required to determine the copy number of genes in CNV regions.

Genotype Assay1 Assay2 Assay3–cn

Monoallelic translation table

allele1 c 1

allele2 t a 2

allele3 g 1

allele4 noamp noamp 0

First intermediate biallelic translator

allele1/allele1 c/c / 2

allele1/allele2 c/t /a 3

allele1/allele3 c/ /g 2

allele1/allele4 c/noamp /noamp 1

allele2/allele2 t/t a/a 4

allele2/allele3 t/ /g 3

allele2/allele4 t/noamp g/g 2

allele3/allele3 / g/g 2

allele3/allele4 /noamp g/noamp 1

allele4/allele4 noamp/noamp noamp/noamp 0


Converting monoallelic translation tables to biallelic translatorsA

Genotype Assay1 Assay2 Assay3–cn

Second intermediate biallelic translator

allele1/allele1 c/c 2

allele1/allele2 c/t a/a;g/a 3

allele1/allele3 c/c;c/t;c/noamp a/g;g/g 2

allele1/allele4 c/c a/a;g/g;noamp/noamp 1


allele2/allele3 t/t;t/c;noamp/noamp a/g 3


allele3/allele3 g/g 2

allele3/allele4 t/t;c/c;noamp/noamp g/g 1

allele4/allele4 noamp noamp 0

Final biallelic translator

allele1/allele1 c/c 2

allele1/allele2 c/t a/a;g/a 3

allele1/allele3 c/c;c/t a/g;g/g 2

allele1/allele4 c/c a/a;g/g 1


allele2/allele3 t/t;t/c a/g 3


allele3/allele3 g/g 2

allele3/allele4 t/t;c/c g/g 1

allele4/allele4 noamp noamp 0

B


Canonical translator

Canonical models for translator and report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47

Canonical translator . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

Canonical report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49

Canonical models for translator and report

The following model canonical translator, and canonical report, serve to illustrate the input requirements and export appearance in AlleleTyper™ Software by providing a model.

This information can be particularly useful to development teams that seek to automate translator setup and reporting (ex: LIMS development).

Requirements are presented, with instructional commentary enclosed in ʹ<<ʹ and ʹ>>ʹ brackets. For example:


Canonical translatorCanonical models for translator and reportB

Cano

nica

l tr

ansl

ator

The following can

onical translator model shows the input requirem

ents for a tran

slator to be supported by AlleleTyper

™

Software.


Appendix BCanonical models for translator and report B

Cano

nica

l rep

ort

The following can

onical rep

ort m

odel shows the resulting export of a summary rep

ort.


Canonical translatorCanonical models for translator and reportB

C


Blood Group Translator

Translation table for Blood Group Genotyping . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51

Blood group determination requiring more than one SNP . . . . . . . . . . . . . . . . . . 52

Translation table for Blood Group Genotyping

The translation table for Blood Group Genotyping provided by Life Technologies is available for download from the AlleleTyper™ web page, and needs no further editing. Details of the table with a subset of the markers in the panel are shown below.

If modification of the provided table is desired, follow the instructions to edit the biallelic translator on page 23.






Appendix CBlood group determination requiring more than one SNP C

Blo

od g

roup

det

erm

inat

ion

requ

irin

g m

ore

than

one

SN

P

For some blood groups, m

ore than one SNP is needed to determine the phenotype. In these instan

ces all known

combinations of individual genotypes are listed in a block (hap

lotype). A

n exam

ple is shown for the MNS group in the

overview below.


D Troubleshooting

AlleleTyper™ page Error message Recommended action

All (general error message) The file [filename] cannot be found. Check the filename and re-submit the operation.

Project The file format found in [file name] is not supported by the software.

The content of the file does not conform to the expected arrangement of information and/or there are invalid values in the content.

Check that the file contains the .las extension and change to <filename>.las if necessary. If file still is not importing, a new project file may need to be created.

Setup The software does not support importing files with the extension [extension name].

Be sure to save translator file as a .csv file. This can be done in Excel by choosing 'Save As' and choosing the comma separated value (.csv) file as the file type.

The file format found in [file name] is not supported by the software.

The content of the file does not conform to the expected arrangement of information and/or there are invalid values in the content.

Check that the file contains the .csv extension and the file is formatted as comma separated values.

The software failed to import the translator file.

Check that the translator file is set up properly and saved in correct format (.csv).

Check internet and computer cable connections and re-submit the operation.

The value [show the value] is invalid, [unsupported character] is not a valid character to use in a translator.

Check content under assay ID columns for unsupported characters (i.e., incorrect base letters, symbols, etc).

A copy number specification must be an integer within 0 to 20 (inclusive) possibly prepended by (<, >, <=, or >=).

Check translator content under assay ID columns for copy number assays and correct as needed.

Invalid set of genotypes: an assay is assumed to detect only two distinct alleles.

Check content under assay ID columns, only 2 alleles can be used for each assay (not including 'noamp' or empty values). If triallelic translation is desired, refer to Appendix A.

Warning: There is only one type of genotype call for this assay.

Check that the designated assay has 2 alleles specified in the translator.

All IDs identifying assays must be unique, no repeats.

Check translator for duplicate assay IDs and delete one of the duplicate assay columns.


TroubleshootingD

Setup, continued The genetic pattern must contain at least one assay.

Translator needs to be edited to include at least one column of assay information for haplotype/diplotype of interest.

The genetic pattern can contain up to 160 assays.

There are too many assays in the translator, reduce the number to 160 or below.

For multi-gene translators using independent sets of assays split them into single gene translators.

Data The software only imports .csv or .txt files.

Check that the data file was exported correctly and is in the correct format (.txt or .csv). Refer to chapters 2 and 3.

The file content appears to have a format that is not supported, please check the file.

Check that the data file was exported correctly and is in the correct format (.txt or .csv). Refer to chapters 2 and 3.

Sample ID must have a value. Check data file for missing Sample Name information.

Assay ID must have a value. Check data file for missing Assay ID information.

Target must have a value. Check data file for missing information.

Genotyping call column must have a value.

File exported improperly, check Genotyper™ file to ensure that values are 'A,C,G,T' not 'VIC®, FAM™' for example.

The value [the value] is not valid. Look for invalid calls in the TaqMan® Genotyper™ file or invalid copy numbers in the CopyCaller® file.

CN Predicted must have a value. In the CopyCaller® file there is a sample for which copy number was not assigned.

AlleleTyper™ page Error message Recommended action


Glossary

allele genotype The genotype at a specific genetic locus (e.g., A, C, G, T for SNP assays; 1, 2, 3 for Copy Number assays).

AlleleTyper™ file A file containing information for a given project. These files include study details, translator specifications, data analysis for a sample set, and final results.

biallelic refers to use of diplotypes in translation specification tables.

call Assigning a result to a sample (e.g., a sample could have a call of diplotype *1/*2).

*.csv Comma‐separated value file. An exported text file containing plate setup information.

diplotype the combination in one individual of two haplotypes.

*.eds Experiment document single file. A data file generated by the data collection software.

genetic pattern A combination of genotypes at one or more genetic loci and/or copy numbers at one or more genetic loci.

genotype The genetic makeup of an individual like the two alleles of a SNP or the copy number of a sequence at a particular location in the genome.

haplotype A specific combinations of SNPs all occurring on the same chromosome (inherited from Mom or Dad).

monoallelic refers to use of haplotypes in translation specification tables.

*.las AlleleTyper™ Software exports project files as (.las).

PDF Adobe® Acrobat® Portable Document Format file. In AlleleTyper™, formal reports generated from the software to report analysis results.

translator file (.csv) file consisting of header section (project information) and genetic pattern section (genotype information).

*.txt Text file containing experimental data (exported from Genotyper™ or CopyCaller® Software) or final diplotype results (exported from AlleleTyper™ Software).

star-allele haplotype nomenclature common in pharmacogenomics research.


Glossary


Documentation and Support

Related documentation

Portable document format (PDF) versions of the documents listed in this section are available from the Life Technologies website. For additional documentation, see “Obtaining support”.

Note: To open the PDF versions, use the Adobe® Acrobat® Reader® software available from www.adobe.com.

Obtaining support

For the latest services and support information for all locations, go to:

www.lifetechnologies.com/support

At the website, you can:

• Access worldwide telephone and fax numbers to contact Technical Support and Sales facilities

• Search through frequently asked questions (FAQs)

• Submit a question directly to Technical Support ([email protected])

• Search for user documents, SDSs, vector maps and sequences, application notes, formulations, handbooks, certificates of analysis, citations, and other product support documents

• Obtain information about customer training

• Download software updates and patches

Document Catalog No. Description

TaqMan® Genotyper™ Software Getting Started Guide 4448637 Provides reference information for TaqMan® Genotyper™ Software and describes how to analyze real-time PCR data from genotyping experiments.

CopyCaller® Software User Guide 4400042 Provides reference information for CopyCaller® Software and describes how to analyze the data from TaqMan® Copy Number Assays experiments.

http://www.adobe.com

http://www.lifetechnologies.com/support


mailto:[email protected]


Documentation and SupportLimited Product Warranty

Limited Product Warranty

Life Technologies Corporation and/or its affiliate(s) warrant their products as set forth in the Life Technologiesʹ General Terms and Conditions of Sale found on Life Technologies’ website at www.lifetechnologies.com/termsandconditions. If you have any questions, please contact Life Technologies at www.lifetechnologies.com/support.

goto:www.lifetechnologies.com/termsandconditions

goto:www.lifetechnologies.com/termsandconditions

http://www.lifetechnologies.com/termsandconditions







Headquarters5791 Van Allen Way | Carlsbad, CA 92008 USA | Phone +1 760 603 7200 | Toll Free in USA 800 955 6288For support visit www.lifetechnologies.com/support or email [email protected]

www.lifetechnologies.com

16Dec2013


http://www.lifetechnologies.com

alleletyper software user guide (pub. no - life technologies

Documents