abel gonzalez-perez research associate biomedical...

80
Abel Gonzalez-Perez Research Associate Biomedical Genomics Lab

Upload: others

Post on 30-Oct-2020

4 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Abel Gonzalez-PerezResearch Associate

Biomedical Genomics Lab

Page 2: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

0. A word about detection...

Page 3: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

0. A word about detection

1. Annotation of SNVs and small indels. Vocabularies and tools

2. Functional Impact of SNVs. Approaches and tools

3. Somatic mutations in cancer

Page 4: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

NGS technologies compared to Sanger sequencing

B&FG 3eTable 9-1Page 382

Page 5: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 6: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

FASTQ format

The FASTQ format stores DNA sequence data as well as associated Phred quality scores of each base.

DNA read

Base quality score

Page 7: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 8: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Next-generation sequence data: visualizing of short reads aligned to a reference genome

reference genome

reads

variant

Page 9: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

B&FG 3eFig.9-13Page 403

home/bioinformatics$ samtools view 030c_S7.bam | lessM01121:5:000000000-A2DTN:1:2111:20172:15571 163 chrM480 60 148M2S = 524 195 AATCTCATCAATACAACCCTCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAAGCAATAACCTGAAAATGTTTAGACGGG BBBBBFFB5@FFGGGFGEGGGEGAAACGHFHFEGGAGFFHAEFDGG?E?EGGGFGHFGHF?FFCHFH00E@EGFGGEEE1FFEEEHBGEFFFGGGG@</01BG212222>F21@F11FGFG1@1?GC<G11?1?FGDGGF=GHFFFHC.-RG:Z:Sample7 XC:i:148 XT:A:U NM:i:3 SM:i:37AM:i:37 X0:i:1 X1:i:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:19C109C0A17

(1)Thequerynameof theread isgiven(M01121…)

(2)Thef l agvalueis163(thisequals1+2+32+128)

(3)Thereferencesequencename,chrM,refersto themitochondrial genome

(4)Position480 istheleft-mostcoordinatepositionof thisread

(5)ThePhred-scaledmappingqualityis60(anerrorrateof1in10 )

(6)TheCIGARstring(148M2S)shows148matchesand2soft-clipped(unaligned)bases

(7)An=signshowsthatthematereferencematchesthereferencename

(8)The1-based leftposition is524

(9)Theinsert sizeis195 bases

(10)ThesequencebeginsAATCT andendsACGGG(itslength is150bases)

(11)Eachbaseisassignedaqualityscore(fromBBBBBendingFHC.-)

(12)Thisreadhasadditional,optionalf i el dst

h

ataccompanytheMiSeqanalysi

Anatomy of a Sequence Alignment/Map (SAM) file

Page 10: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 11: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

B&FG 3eTable 9.6Page 411

Variant Call Format (VCF) file summarizes variation

A VCF file includes the following information:

Page 12: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

B&FG 3eFig.9-17Page 412

Variant Call Format (VCF) file summarizes variation

SNP Insertion

Deletion Replacement

Alignment VCFrepresentation1234 POS REF ALTACGT 2 C TATGT

Alignment VCFrepresentation12345 POS REF ALTAC-GT 2 C CTACTGT

Alignment VCFrepresentation1234 POS REF ALTACGT 1 ACG AA--T

Alignment VCFrepresentation1234 POS REF ALTACGT 1 ACG ATA-TT

Page 13: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

1. Annotation of SNVs and small indels. Vocabularies and tools.

Page 14: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

1. Annotation of SNVs and small indels. Vocabularies and tools.

Genomic variant

Effect on transcript

Phenotypic effect

Page 15: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

1. Annotation of SNVs and small indels. Vocabularies and tools.

Genomic variant

Effect on transcript

Phenotypic effect

Functional Impact

Consequence type

Page 16: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

1. Annotation of SNVs and small indels. Vocabularies and tools.

Genomic variant

Effect on transcript

Phenotypic effect

Association studies

Page 17: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

1. Annotation of SNVs and small indels. Vocabularies and tools.

Genomic variant

Effect on transcript

Phenotypic effect

Functional Impact

Consequence type

Annotation

Assessment

Page 18: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

1. Annotation of SNVs and small indels. Vocabularies and tools.

Taken from Ensembl Variation Database

Page 19: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

1. Annotation of SNVs and small indels. Vocabularies and tools.

The Ensembl Variant Effect Predictor

Genomic coordinates/ change of the variant

Map to overlapping genomic features(transcripts, reg. regions, etc)

VEP standalone PERL script using Ensembl APIs

VEP web tool

Page 20: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

1. Annotation of SNVs and small indels. Vocabularies and tools.

The Ensembl Variant Effect Predictor

Page 21: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

1. Annotation of SNVs and small indels. Vocabularies and tools.

The Ensembl Variant Effect Predictor(Example)

Page 22: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

1. Annotation of SNVs and small indels. Vocabularies and tools.

The Ensembl Variant Effect Predictor(Example)

Page 23: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Page 24: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Page 25: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Page 26: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Predicting functional impact of nsSNVs

Page 27: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Predicting functional impact of nsSNVs:three exemplary tools

http://sift.jcvi.org/

SIFT

Page 28: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Predicting functional impact of nsSNVs:three exemplary tools

Query sequence + aminoacid change

Psi-Blast +Motif

Closely related sequences

MSA

Closely related sequences

PSSM

Ng and Henikoff, 2001. Genome Research

SIFT

Page 29: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Predicting functional impact of nsSNVs:three exemplary tools

http://genetics.bwh.harvard.edu/pph2/PolyPhen2

Page 30: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Predicting functional impact of nsSNVs:three exemplary tools

2. Functional Impact of SNVs. Approaches and tools

Predicting functional impact of nsSNVs:three exemplary tools

Adzhubei et al, 2010. Nature Methods

PolyPhen2

Page 31: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Predicting functional impact of nsSNVs:three exemplary tools

Adzhubei et al, 2010. Nature Methods

PolyPhen2

Page 32: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

SNVs catalogs

1000 Genomes Project:genetic variants with frequencies of at least 1% in the populations studied

~2,504 individuals so far

http://www.1000genomes.org/

Page 33: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

SNVs catalogs

1000 Genomes Project:genetic variants with frequencies of at least 1% in the populations studied

~2,504 individuals so far

http://www.1000genomes.org/

Page 34: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

SNVs catalogs

http://www.ncbi.nlm.nih.gov/projects/SNP/

dbSNPCentral repository of SNVs without allele frequency limitation

Page 35: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

SNVs catalogs

http://hapmap.ncbi.nlm.nih.gov/

HAPMAPProject to characterize haplotypes (close co-ocurring variants)

in human populations

Page 36: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

SNVs catalogs

https://www.gwascentral.org/

GWAS Centralcentralized compilation of summary level findings from genetic

association studies, both large and small

Page 37: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Navigating variants in Ensembl http://www.ensembl.org

SMARCA4: genomic region

SMARCA4: transcripts

Page 38: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Navigating variants in Ensembl

Page 39: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Navigating variants in Ensembl

Page 40: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

2. Functional Impact of SNVs. Approaches and tools

Navigating variants in Ensembl

Page 41: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

3. A word about somatic mutations in cancer

Page 42: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 43: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 44: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 45: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Mike Stratton. EMBO Molecular Medicine (2013)

Page 46: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Mutagenic processes

(internal and external)

Mechanisms of DNA repair

Mutational processes

Page 47: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 48: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Mutagenic processes

(internal and external)

Mechanisms of DNA repair

This interaction affects he genome at different levels of resolution

Mutational processes

Page 49: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Mutational processes

UV light signature

Tobacco smoke

Mutation burden and mutationsignature affecting the whole

genome

Page 50: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Mutational processes

Sabarinathan et al. Nature. 2016

More mutations in transcription factor binding sites of melanocytes

Schuster-Böckler and Lehner et al. Nature 2012

More mutations in closed chromatin regions

More mutations in regions lowly expressed genes

Lawrence et al. Nature. 2013

Fewer mutations in exons than expectedin POLE-mutant tumorsFrigola, Sabarinathan et al. Nature Genetics. 2017

Page 51: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

3. Interpreting somatic mutations in cancer

Page 52: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Understand the genomic mechanisms that fuel the tumor phenotypes

Drivers of cancer

Hanahan and Weinberg. Cell 2011

Driver versus passenger events

Needle in a haystack

Page 53: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 54: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 55: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 56: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 57: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 58: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Which mutations in driver genes are drivers?

Page 59: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

How deleterious are cancer driver mutations?

Page 60: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

How deleterious are cancer driver mutations?

Page 61: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

How deleterious are cancer driver mutations?

Deleteriousness

Driv

erne

ss

Yes

No

Yes No

● Highly deleterious mutations affecting cancer genes

● Highly deleterious mutations affecting non-cancer genes

● Lowly deleterious mutations that contribute to tumor phenotype?

● Lowly deleterious mutations affecting non-cancer genes

Pas

seng

er

Page 62: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

How deleterious are cancer driver mutations?

Page 63: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Carter et al., 2009. Cancer Research

Page 64: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

How deleterious are cancer driver mutations?

It depends on the mode of action of the gene!!

Page 65: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

OncodriveFM

OncodriveCLUST

MuSiC-SMG

F

C

RUsing complementary signals help obtaining a more comprehensive list of cancer drivers

Tamborero et al., Scientific Reports 2013

Page 66: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 67: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 68: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 69: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 70: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

How about other types of variants?

Page 71: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Copy Number Alterations

Page 72: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Other genomic rearrangements

Page 73: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Other genomic rearrangements

Page 74: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

Repositories of known oncogenic variants

Page 75: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 76: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 77: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 78: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT

PTEN*

Temsirolimus

Vemurafenib(V600E) (R130G)

PI3K

AKT

mTOR

BRAF*

(R175H)

TP53*

rAd-p53

Strategies to target cancer drivers

IndirectGene Therapy

Direct

Page 79: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT
Page 80: Abel Gonzalez-Perez Research Associate Biomedical ...bbglab.irbbarcelona.org/courses/bco/documents/Funct...ACGT 2 C T ATGT Alignment VCFrepresentation 12345 POS REF ALT AC-GT 2 C CT