Effects of ascorbic acid and ascorbic acid 2-phosphate, along-acting vitamin C derivative, on the proliferation and

differentiation of human osteoblast-like cells

Shinji Takamizawaa,b, Yojiro Maehataa, Katsuyuki Imaic, Haruki Senooc,Sadao Satob,d, Ryu-Ichiro Hataa,d*

aDepartment of Biochemistry and Molecular Biology, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka 238-8580, JapanbDepartment of Craniofacial Growth and Development Dentistry, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka 238-8580, Japan

cDepartment of Cell Biology and Histology, Akita University School of Medicine, Hondo, Akita 010-8543, JapandResearch Center of Advanced Technology for Craniomandibular Function, Kanagawa Dental College, 82 Inaoka-cho, Yokosuka 238-8580, Japan

Received 3 July 2003; revised 30 October 2003; accepted 10 January 2004

Abstract

In order to investigate the effect of ascorbic acid (AsA) and ascorbic acid 2-phosphate (Asc 2-P), a long-acting vitamin Cderivative, on the growth and differentiation of human osteoblast-like cells, we supplemented the culture medium of MG-63 cellswith various concentrations (0.25 to 1 mM) of these factors. Asc 2-P significantly stimulated nascent cell growth at all concentrationsin the presence of fetal bovine serum (FBS). On the other hand, AsA showed a growth repressive effect depending on itsconcentration, and that of FBS. Asc 2-P also increased expression of osteoblast differentiation markers, such as collagen synthesisand alkaline phosphatase (ALP) activity. These stimulative activities of Asc 2-P were attenuated by inhibitors of collagen synthesis,indicating that these effects were dependent on collagen synthesis. Electron micrographs of the cells showed the formation of athree-dimensional tissue-like structure endowed with a mature extracellular matrix in the presence of Asc 2-P.! 2004 Elsevier Ltd. All rights reserved.

Keywords: Ascorbic acid 2-phosphate; Ascorbic acid; Long-acting vitamin C; Human osteoblasts; Osteoblast differentiation

1. Introduction

Multifarious activities of -ascorbic acid (vitamin C,AsA) have been demonstrated in many biological sys-tems and in various scientific fields (Burns et al., 1987;Hata, 1996). One of the essential functions of AsA maybe its role as a cofactor for the hydroxylation of prolineand lysine residues in collagen, which is the most abun-dant protein in the body (Kielty et al., 1993; Prockopand Kivirikko, 1995). It is also an essential supplementfor the differentiation of various kinds of cells in culture(Franceschi, 1992). One difficulty with the handling ofAsA is its instability in solution, especially under the

normal culture conditions of neutral pH and 37 (C.Previously, we reported that a phosphate derivativeof AsA, ascorbic acid 2-phosphate (Asc 2-P), had acofactor activity for collagen biosynthesis by humanfibroblasts in culture, as did AsA. Asc 2-P was alsofound to be very stable under culture conditions (Hataand Senoo, 1989). Asc 2-P has since been used as asupplement, instead of AsA, in a variety of cultures,including that of osteoblastic cells (Fermor et al., 1998;Gallagher et al., 1996; Gundle and Beresford, 1995;references in Hata, 1996; Hitomi et al., 1992; Mizutaniet al., 2001; Senoo et al., 1989; Torii et al., 1994).

Both AsA and Asc 2-P have been shown to stimulatedifferentiation of various kinds of cells, but there is littleinformation about any direct comparison of their effects.Over a decade ago, we reported the stimulation ofgrowth and differentiation of human dermal fibroblastsby both Asc 2-P and AsA (Hata et al., 1988; Hata and

* Corresponding author. Tel.: +81-46-822-8840;fax: +81-46-822-8839

E-mail address: ryuhata@kdcnet.ac.jp (R. Hata).Abbreviations: Asc 2-P, ascorbic acid 2-phosphate; AsA, ascorbic

acid.

Cell Biology International 28 (2004) 255265

CellBiologyInternational

www.elsevier.com/locate/cellbi

1065-6995/$ - see front matter ! 2004 Elsevier Ltd. All rights reserved.doi:10.1016/j.cellbi.2004.01.010

Senoo, 1989). Both of them are frequently used incultures of osteoblastic cells derived from variouskinds of animal species, but there are no comparativereports about the effects of both factors on the growthand differentiation of these cells. Here, we reportour results on such a comparison using MG-63 cells,which are a widely used cell line of human osteoblast-like cells.

2. Materials and methods

2.1. Cell culture

MG-63 human osteoblast-like cells were obtainedfrom American Type Culture Collection (Rockville,MD, USA). The cells were divided into ampoules andstored in liquid nitrogen. Cells from one ampoule weregrown and used for a series of experiments. The cellsresponded to active vitamin D3 by expressing alkalinephosphatase (ALP) activity, an early osteoblast differ-entiation marker, and osteocalcin, a marker of termi-nally differentiated osteoblasts (Franceschi and Young,1990; Hata et al., 2002; Lian et al., 1999; Maehata et al.,2002). The cells were plated at 2"105 per 100 mmculture dishes and cultured in DMEM-10, which isDulbeccos modified Eagles medium (DMEM) (NissuiPharmaceutical, Tokyo, Japan) supplemented with anantibiotic (gentamycin sulfate, 50 mg/l), an anti-fungalreagent (Fungizone, 0.25 mg/l), buffered with N-2-hydroxyethylpiperazine-N#-2-ethansulfonic acid (3 g/l,DMEM-0), and containing 10% heat-inactivated fetalbovine serum (FBS; Trance Scientific, Melbourne,Australia). Cells were passaged once a week after disper-sion with 0.1% trypsin (Wako Pure Chemical Industries,Ltd, Osaka, Japan) in Dulbeccos Mg2+-/Ca2+-free phos-phate buffered saline (DPBS [#]; TaKaRa, Tokyo,Japan) for 15 min at 37 (C. Cells were counted using aCoulter Z1 Counter (Coulter Electronics Ltd, England)after dispersion of the cells with 0.1% trypsin solution inDPBS (#).

2.2. Determination of growth rate

MG-63 cells were plated at 1"105 per 35 mm dish(FALCON 3046, Becton Dickinson and Co., NJ, USA)and cultured in DMEM-0, supplemented or not with thesodium salt of -ascorbic acid (AsA, 0.251 mM; WakoPure Chemical Industries, Ltd, Osaka, Japan) or-ascorbic acid 2-phosphate magnesium salt (Asc 2-P,0.251 mM; Wako Pure Chemical Industries, Ltd) in theabsence or presence of 1% or 10% FBS. Phase-contrastphotomicrographs were taken with a DIAPHOT-TMD(Nikon, Tokyo, Japan). DNA content was determinedby a modification of the fluorometric method describedpreviously (Hata et al., 1984).

2.3. Determination of alkaline phosphatase activity

After selected periods of culture, the medium wasremoved, and the cell layer was rinsed twice with DPBS(#) and then lysed with cell lysis buffer consisting of 10mM TrisHCl, pH 7.5, containing 0.4% Nonidet P-40(Iwaki Kagaku Co., Tokyo, Japan). Phenylmethylsul-fonyl fluoride (Wako Pure Chemical Industries, Ltd)was added to a final concentration of 4 mM (Franceschiand Young, 1990). One half of the lysate was usedfor determination of the DNA content as describedabove and the remaining half for measurement ofALP activity, using phosphophenol as the substrate(Alkaline Phospha K, Wako Pure Chemical Industries,Ltd).

2.4. Reverse transcriptasepolymerase chain reaction(RTPCR)

Total RNA was isolated from the cells with TRIzol(Invitrogen, Tokyo). Complementary DNAs were syn-thesized using the Superscript First Strand SynthesisSystem (Invitrogen, Tokyo), following the manufactur-ers protocol. Aliquots (5%) of the total cDNA wereamplified in each PCR in a 20 l reaction mixture thatcontained 5 pmol of 5# and 3# primers, 1"PCR buffer,2.0 mMMgCl2, 0.2 mM of each deoxytrinucleotide, and0.5 U of Ex Taq polymerase (TaKaRa, Tokyo). EachcDNA sample was run in duplicate for every PCR.Amplification was performed using a Mastercyclergradient (Eppendorf-Netheler-Hinz GmbH, Hamburg).

The first denaturation step at 94 (C for 2 min wasfollowed by 15, 20 and 25 cycles of PCR for !-actin,each consisting of denaturation at 94 (C for 30 s,annealing at 60 (C for 2 min and extension at 72 (C for2 min; and by 20, 25 and 30 cycles for bone/liver/kidneyALP, each consisting of denaturation at 94 (C for 30 s,annealing at 57 (C for 2 min, and extension at 72 (C for2 min. In all cases, a final extension at 72 (C for 10 minwas performed before storing the samples. Specificprimers used were: for human !-actin, AGCCATGTACGTTGCTA (sense), and AGTCCGCCTAGAAGCA(antisense), for amplification of 800 base pairs (bps); andfor ALP, ACGTGGCTAAGAATGTCATC (sense),and CTGGTAGGCGATGTCCTTA (antisense) foramplification of 475 bps (Rickard et al., 1996). PCRproducts were separated by 2% agarose (NuSieve3:1 agarose, BioWhittaker Molecular Applications,Rockland, ME, USA) at least twice.

The separated DNA fragments were visualized byethidium bromide staining and quantified with aFluorImager 595 (Amersham Phamacia Biotech, Tokyo)using excitation at 514 nm, emission at 610 nm andImage Quant for calculations. Twenty cycle-amplified!-actin and 25 cycle-amplified ALP PCR products werewithin the linear range of the amplification curves andthus used for semi-quantitative analysis. Differences in

S. Takamizawa et al. / Cell Biology International 28 (2004) 255265256

the quantitative determinations between ALP PCRproduct bands were calculated after normalizing thevalues to the corresponding 20 cycle-amplified !-actinPCR product band. Measurements were repeated atleast three times.

2.5. Metabolic labeling and collagen assay

The cells were incubated in 1 ml of fresh DMEM-10containing [3H]proline (370 kbq/ml, -[2,3-3H]proline,37 MBq/ml in ethanol:water [2:98] from PerkinElmer,Boston, USA) and 0.25 mM Asc 2-P for the last 24 h inthe presence or absence of azetidine 2-carboxylic acid(Az-C, 0.5 and 1.0 mM; Sigma-Aldrich Japan, Tokyo)or ethyl-dihydroxybenzoate (EDHBA, 0.2 and 0.4 mM;Sigma-Aldrich). The combined cell layer and mediumwas processed for the determination of collagen andnoncollagenous protein synthesis using nonspecificprotease-free collagenases, as described previously (Hataet al., 1980). The relative rate of collagen synthesis wascalculated assuming that collagen has an amino acidcontent 5.4 times higher than that of other proteins(Peterkofsky and Diegelmann, 1971).

2.6. Electron microscopy

The cells were fixed, processed and observed asdescribed previously (Hata and Senoo, 1989), exceptthat ultra thin sections were cut with an ultramicrotome2088-V (LKB, Bromma, Sweden) and examined undera transmission electron microscope (JEOL-1200EX,Tokyo) at an acceleration voltage of 80 kV.

2.7. Statistical analysis

Data were expressed as mean$S.D. Significance ofdifferences was determined using Students t-test.

3. Results

3.1. Effect of AsA and Asc 2-P on the growth of MG-63cells

Asc 2-P is stable under culture conditions andliberates AsA by the action of ALP on the plasmamembrane of various kinds of cells. AsA thus producedis then incorporated into the cells (Fig. 1).

In order to evaluate the effects of AsA and Asc 2-P onthe growth of cells, we first plated MG-63 cells inDMEM-10 and cultured them for 24 h. During thisperiod, the cells adhered well to the culture dish surface.Then the culture medium was changed to DMEMcontaining various concentrations of FBS, AsA or Asc2-P. The cells grew for 3 days in DMEM containing 1%FBS (Fig. 2B) or 10% FBS (Fig. 2C), becoming threetimes and eight times more numerous, respectively,compared to day 0, as determined by the increase inDNA content (Fig. 3A). The cell number did notincrease during this period in the absence of serum(Fig. 2A and Fig. 3A).

When the medium was supplemented with AsA, nosignificant growth stimulation was observed (Fig. 2E, F,H, and I). Instead, disintegrated cells were observed inthe presence of AsA under serum-free culture conditions(Fig. 2D, G, and J) or in the presence of 1.0 mM AsA

Fig. 1. Schematic representation of metabolism of -ascorbic acid 2-Phosphate (Asc 2-P) and -ascorbic acid (AsA). Bold arrows indicate rapidreactions.

S. Takamizawa et al. / Cell Biology International 28 (2004) 255265 257

and 1% FBS (Fig. 2K). In fact, dose-dependent inhibi-tion of cell growth was indicated by the decrease inDNA content, when the medium was supplemented withAsA under serum-free culture conditions (Fig. 3B).Similar apparent growth inhibition was observed bysupplementation of the culture medium with 1.0 mMAsA and 1% FBS (Fig. 2K, Fig. 3B). On the other hand,no apparent growth inhibition was observed when Asc2-P was the supplement, whether FBS was present or not(Fig. 2d to i). Instead, significant growth stimulation wasobserved by supplementation with 1.0 mM Asc 2-P,irrespective of the FBS concentration (Fig. 3C). Growthstimulative effects of Asc 2-P were also observed atlower concentrations, when FBS was present in theculture medium (Fig. 3C).

3.2. Effects of AsA and Asc 2-P on ALP activity andmRNA levels of MG-63 cells

AsA at 0.25 mM, the concentration normally used forculture, significantly stimulated ALP activity in MG-63

cells. Asc 2-P also increased the enzyme activity, givinga value much higher than that obtained with AsA(Fig. 4B). Cell growth was also stimulated in culturescontaining Asc 2-P, but not in those supplemented withAsA (Fig. 4 A). The effect of these factors on the level ofALP mRNA was examined by RTPCR. After gelelectrophoresis and staining, we detected a band thatmoved a little bit faster than the 500 bps marker band;and it corresponded with the size (475 bps) of theRTPCR product expected for human bone/liver/kidneytype ALP. We confirmed the DNA sequences of RTPCR products after cloning (data not shown). Thebands of ALP-specific PCR products were denser whenmRNAs were obtained from cultures having AsA orAsc 2-P, than in those from the control. The differenceswere observed regardless of the cycle number of PCR(Fig. 5A). Semi-quantitative determination of thedensity of the amplified bands indicated a significantincrease in ALP PCR products when the cells werecultured for 7 days with 0.25 mM AsA or Asc 2-P(Fig. 5B).

Fig. 2. Effect of various concentrations of serum, AsA and Asc 2-P on the morphology of MG-63 cells. The cells were plated (1"105/35 mm dish)and cultured in DMEM-10 for 24 h. Then the culture medium was changed to fresh DMEM containing various concentrations of FBS (0, 1, 10%)in the absence (control, A, B, C) or presence of AsA (+AsA: 0.25 [D, E, F], 0.5 [G, H, I], or 1.0 mM [J, K, L]), or Asc 2-P (+Asc 2-P; 0.25 [d, e,f], 0.5 [g, h, I], or 1.0 mM [j, k, l]). Phase-contrast photomicrographs were taken 3 days after the addition of AsA or Asc 2-P. Magnification"200.

S. Takamizawa et al. / Cell Biology International 28 (2004) 255265258

3.3. Collagen is essential for stimulation of cell growthand ALP activity by Asc 2-P

When 0.25 mM Asc 2-P was present in the cultures,collagen synthesis, as well as total protein synthesis,increased (data not shown). The relative rate of collagen

synthesis to total protein synthesis also increased from1.4% to 2.3% in the presence of Asc 2-P (Fig. 6A); andthe Asc 2-P-induced increase in cell growth, as seen fromDNA content and ALP activity (Figs. 3 and 4), wasconfirmed (Fig. 6B, C, and D). Various concentrationsof inhibitors of collagen synthesis, such as Az-C and

Fig. 3. Effect of various concentrations of serum, AsA and Asc 2-P on the growth of MG-63 cells. The cells were plated (1"105/35 mm dish) andcultured in DMEM-10 for 24 h. Then the medium was exchanged for fresh medium containing FBS at 0%, 1%, and 10% without (A, control) or withAsA (B, +AsA: 0.25, 0.5, 1.0 mM) or Asc 2-P (C, +Asc 2-P: 0.25, 0.5, 1.0 mM). Values are the means of quadruplicate assays$S.D. Significantlydifferent from respective controls: *P

EDHBA, were added together with Asc 2-P, in order tosee the relationship between collagen synthesis, cellgrowth and ALP activity. The presence of collagensynthesis inhibitors suppressed collagen synthesis in thecells in a dose dependent manner (Fig. 6A). In addition,cell growth (DNA content) and ALP activity wererepressed by the presence of either inhibitor. Theseresults indicate that stimulation of collagen synthesisis essential for stimulation of both growth and ALPactivity in the cells by Asc 2-P.

3.4. Formation of ECM rich tissue-like substance byMG-63 cells

Electron microscopy revealed multi-layered cells, andwell-developed rough endoplasmic reticulum (rER) andGolgi apparatus (Fig. 7B, D) in cultures in the presenceof Asc 2-P (+Asc 2-P, Fig. 7B and 7D), whereas in its

absence, multi-layering and these organelles were lesspronounced (Control, Fig. 7A, C). Cells surroundedby striated fibers typical of fibrous collagen wereprominent in Asc 2-P supplemented cultures (Fig. 7B,insert), but not evident in the control cultures (Fig. 7A,insert). These data indicate Asc 2-P-stimulated matrixmaturation and formation of a tissue-like substance byMG-63 cells.

4. Discussion

It has been reported that AsA is essential forthe differentiation of osteoblastic cells in culture(Franceschi, 1999; Franceschi and Young, 1990; Owenet al., 1990). In their pioneering work using MG-63 cellsto study the regulation of osteoblast differentiation,Franceschi and Young (1990) reported that AsA

Fig. 4. Effects of AsA and Asc 2-P on the growth and ALP activity of MG-63 cells. The cells were plated (1"105/35 mm dish) and cultured inDMEM-10 in the absence (Control) or presence of AsA (0.25 mM) or Asc 2-P (0.25 mM) for 6 days. The medium was changed 3 days after seeding.A: DNA content per 35 mm dish. B: ALP activity shown as femtomoles of phenol released per minute per g DNA. Values are the means ofquadruplicate assays $S.D. Significant differences are indicated by brackets: *P

repressed the cell growth and stimulated the differ-entiation of these human osteoblast-like cells. We areinterested in this work, because these cells respond toactive vitamin D3 by expressing ALP, an early osteo-blast differentiation marker, and osteocalcin, a markerof terminally differentiated osteoblasts (Franceschi andYoung, 1990; Hata et al., 2002; Lian et al., 1999;Maehata et al., 2002). When we used Asc 2-P, a long-acting ascorbic acid derivative, as a supplement in theculture medium of MG-63 cells, it stimulated the nascent

growth of the cells, irrespective of the concentrationused (Figs. 2 and 3).

On the other hand, the growth of the cells was eitherrepressed or unaffected, depending on the concentrationof AsA and FBS (Figs. 2 and 3). The effect also varieddepending on the freshness of the medium, DMEM-10and cell density (data not shown). These variations inthe effect on cell growth have also been seen in otherculture systems (Clement et al., 2001; Makino et al.,1999). Such variations may be due to opposing effects of

Fig. 5. RTPCR analysis of ALP mRNA levels of MG-63 cells cultured in the absence or presence of 0.25 mM AsA or Asc 2-P for 7 days. The cellswere plated (1"105/35 mm dish) and cultured in DMEM-10 in the absence (Control) or presence of AsA (0.25 mM) or Asc 2-P (0.25 mM) for7 days. Total RNAs were prepared and used for RTPCR as described in the text. A: Aliquots of RTPCR product were separated by 2% agarosegel electrophoresis and visualized by staining with ethidium bromide. B: Relative amounts of ALP mRNA expression were determined using a FluorImager. Values are means$S.D. of triplicate determinations using two different preparations of total RNAs. Significant differences are indicated bybrackets: *P

AsA, i.e. its stimulatory effect on growth, and its inhibi-tory side effects under in vitro culture conditions, wherethere is an excess of O2 (Makino et al., 1999; Oda et al.,2001).

Ascorbyl radicals produced from AsA and H2O2 aregenerated by self-reduction of oxidized AsA, due to anexcessive amount of it in the presence of excess O2. Infact, 10 mM AsA and 0.25 mM H2O2 killed nearly 100%of MG-63 cells (data not shown). Asc 2-P is resistant tooxidation by O2 and releases free AsA by the action ofALP in the cell membranes of most animal cells, includ-ing osteoblasts. There was no inhibitory effect on growthby Asc 2-P up to 10 mM (Figs. 2 and 3, and data notshown), suggesting that free AsA is formed from Asc 2-Ponly at the cell surface and the AsA thus formed isimmediately incorporated by the cells. These data indi-cate that Asc 2-P is superior to AsA as a supplementfor in vitro cultures, so we used only the former insubsequent experiments.

Asc 2-P also stimulated collagen synthesis and ALPactivity. In addition, specific inhibition of collagensynthesis due to the presence of both Asc 2-P and theproline analogue Az-C, which is incorporated insteadof proline into proto-procollagen polypeptides andinhibits the maturation of collagen chains, attenuatedthe stimulatory effects on growth and expression ofALP activity (Fig. 6). This attenuation by Az-C maynot reflect an inhibitory effect on general proteinsynthesis, because only Asc 2-P-stimulated ALPactivity, in addition to collagen synthesis, was inhibitedby it. Further evidence was obtained by the inhi-bition of collagen synthesis via a different molecularmechanism.

The presence of Asc 2-P together with EDHBA, aspecific inhibitor of prolyl hydroxylase (Sasaki et al.,1987) that is essential for the maturation of proto-procollagen chains, also showed a similar attenuativeeffect on growth and ALP activity. These data indicate

Fig. 6. Effects of Asc 2-P and inhibitors of collagen synthesis on collagen synthesis, cell proliferation and ALP activity of MG-63 cells. The cells wereinoculated (1"105/35 mm dish) and cultured in DMEM-10 in the absence (Control, open bars) or presence of 0.25 mM Asc 2-P. Azetizine2-carboxylic acid (Az-C, 0.5 or 1.0 mM) or ethyl-3,4-dihydroxybenzoate (EDHBA, 0.2 or 0.4 mM), inhibitors of collagen synthesis were added tosome of the Asc 2-P-containing cultures, and the cells were cultured for a further 7 days. A: Relative rate of collagen synthesis was determined bya method using purified bacterial collagenases. B: DNA content was determined by fluorometric assay. C: ALP activity indicated as picomoles ofphenol released per minute per dish. D: ALP activity expressed as femtomoles of phenol released per minute per g DNA. Significantly differentfrom control values: *P

that specific stimulation of collagen synthesis by Asc 2-Pmay be essential for growth stimulation of the cellsand expression of ALP activity, the latter being a markerfor early osteoblast differentiation. Asc 2-P-inducedincreases in the nascent growth rate, collagen synthesis

and ALP activity were also observed in normal osteo-blastic cell cultures, even though their relationship wasnot examined (Owen et al., 1990).

We have previously observed that Asc 2-P stimulatesthe synthesis and maturation of collagen molecules

Fig. 7. Effect of Asc2-P on the ultrastructure of MG-63 cells in culture. The cells were cultured in the absence (A and C) or presence (B and D) of0.25 mM Asc2-P for 6 weeks. For electron microscopy, the dishes were processed as described in the text. The electron photomicrographs are ofcultures sectioned perpendicular to the dish surface. G, Golgi apparatus; M, mitochondrion; rER, rough endoplasmic reticulum. Bars indicate 1 m(A and B), 200 nm (inserts of A and B), and 500 nm (C and D), respectively.

S. Takamizawa et al. / Cell Biology International 28 (2004) 255265 263

(Hata and Senoo, 1989; Kurata and Hata, 1991; Kurataet al., 1993). We also observed the formation of3-dimensional tissue-like material by human dermalfibroblasts, when cultured for long periods of time in thepresence of Asc 2-P (Hata and Senoo, 1989).

When MG-63 cells were cultured for 6 weeks in thepresence of Asc 2-P, the prominence of striated collagenfibers was indicated by electron microscopic observationof the cell layer, suggesting Asc 2-P-stimulated collagenaccumulation, as well as collagen synthesis. Thus, Asc2-P supplementation of the culture medium facilitatedthe formation of a 3-dimensional tissue-like material byMG-63 cells.

The Asc 2-P-supplemented culture system describedhere may be useful for analyzing the process of osteo-blast differentiation, and for investigating the effectsof various hormones and other factors on thedifferentiation and metabolism of osteoblastic cells.

Acknowledgements

We thank Drs Kazuhito Izukuri and Yasumasa Katofor their helpful discussions. A part of this work wassupported by grants from the following: GroundResearch Announcement for Space Utilization pro-moted by the Japan Space Forum (R.H.); BioventureResearch (S.S. and R.H.) and Scientific Research onPriority Area (A; R.H.), from the Ministry ofEducation, Culture, Sports, Science and Technology ofJapan and Scientific Research (B; R.H.) from the JapanSociety for Promotion of Science.

References

Burns JJ, Rivers JM, Machlin LJ, editors. Third conference on vitaminC. Annal New York Acad Sci 1987;498.

Clement MV, Ramalingam J, Long LH, Halliwell B. The in vitrocytotoxicity of ascorbate depends on the culture medium used toperform the assay and involves hydrogen peroxide. AntioxidRedox Signal 2001;3:15763.

Fermor B, Gundle R, Evans M, Emerton M, Pocock A, Murray D.Primary human osteoblasts proliferation and prostaglandin E2release in response to mechanical strain in vitro. Bone 1998;22:63743.

Franceschi RT. The role of ascorbic acid in mesenchymaldifferentiation. Nutr Rev 1992;50:6570.

Franceschi RT. The developmental control of osteoblast-specific geneexpression: Role of specific transcription factors and the extracel-lular matrix environment. Crit Rev Oral Biol Med 1999;10:4057.

Franceschi RT, Young J. Regulation of alkaline phosphatase by1,25-dihydroxyvitamin D3 and ascorbic acid in bone-derived cells.J Bone Miner Res 1990;5:115767.

Gallagher JA, Gundle R, Beresford JN. Isolation and culture ofbone-forming cells (osteoblasts) from human bone. In: Jones GE,editor. Methods in molecular biology: human cell cultureprotocols: Human Press Inc, 1996;23362.

Gundle R, Beresford JN. The isolation and culture of cellsfrom explants of human trabecular bone. Calcif Tissue Int 1995;56(Suppl 1):S810.

Hata R. Regulation of gene expression and cell differentiation byascorbic acid (vitamin C). In: Muramatsu T, editor. Gene expres-sion and nutrition. Research Signpost, Trivandrum, 1996, p. 123.

Hata R, Hori H, Nagai Y, Tanaka S, Kondo M, Hiramatsu M et al.Selective inhibition of type I collagen synthesis in osteoblastic cellsby epidermal growth factor. Endocrinology 1984;115:86776.

Hata R, Ninomiya Y, Nagai Y, Tsukada Y. Biosynthesis of interstitialtypes of collagen by albumin-producing rat liver parenchymal cell(hepatocyte) clones in culture. Biochemistry 1980;19:16976.

Hata R, Senoo H. L-Ascorbic acid 2-phosphate stimulates collagenaccumulation, cell proliferation, and formation of a three-dimensional tissue like substance by skin fibroblasts. J Cell Physiol1989;138:816.

Hata R, Sunada H, Arai K, Sato T, Ninomiya Y, Nagai Y et al.Regulation of collagen metabolism and cell growth by epidermalgrowth factor and ascorbate in cultured human skin fibroblasts.Eur J Biochem 1988;173:2617.

Hata R, Takamizawa S, Maehata Y, Izukuri K, Kato Y, Imai K et al.Collagen synthesis is essential for osteoblast differentiation inthe presence and absence of vitamin D. Differentiation 2002;70:334.

Hitomi K, Torii Y, Tsukagoshi N. Increase in the activity of alkalinephosphatase by L-ascorbic acid 2-phosphate in a human osteo-blast cell line, HuO-3N1. J Nutr Sci Vitaminol (Tokyo) 1992;38:53544.

Kielty CM, Hopkinson I, Grant ME. Collagen: the collagen family:structure, assembly, and organization in the extracellular matrix.In: Royce PM, Steinmann B., editors. Connective tissue and itsheritable disorders. Molecular, genetic, and medical aspects:Wiley-Liss, 1993;10347.

Kurata S, Hata R. Epidermal growth factor inhibits transcription oftype I collagen genes and production of type I collagen in culturedhuman skin fibroblasts in the presence and absence of L-ascorbicacid 2-phosphate, a long-acting vitamin C derivative. J Biol Chem1991;266:999710003.

Kurata S, Senoo H, Hata R. Transcriptional activation of type Icollagen genes by ascorbic acid 2-phosphate in human skin fibro-blasts and its failure in cells from a patient with "2(I)-chain-defective Ehlers-Danlos syndrome. Exp Cell Res 1993;206:6371.

Lian JB, Stein GS, Canalis E, Robey PG, Boskey AL. Bone formation:osteoblast lineage cells, growth factors, matrix proteins, and themineralization process. In: Favus MJ, editor. Primers on themetabolic bone diseases and disorders of mineral metabolism,4th ed New York: Lippincott Williams and Wilkins, 1999;1429.

Maehata Y, Takamizawa S, Ozawa S, Izukuri K, Kato Y, Imai Ket al. Interaction of vitamin D signal with vitamin C signal on thedifferentiation of human osteoblast-like cells. Mol Biol Cell 2002;13:364a.

Makino Y, Sakagami H, Takeda M. Induction of cell death byascorbic acid derivatives in human renal carcinoma and glio-blastoma cell lines. Anticancer Res 1999;19:312532.

Mizutani A, Sugiyama I, Kuno E, Matsunaga S, Tsukagoshi N.Expression of matrix metalloproteinases during ascorbate-induceddifferentiation of osteoblastic MC3T3-E1 cells. J Bone Miner Res2001;16:20439.

Oda D, Nguyen MP, Royack GA, Tong DC. H2O2 oxidative damagein cultured oral epithelial cells: The effect of short-term vitamin Cexposure. Anticancer Res 2001;21:271924.

Owen TA, AronowM, Shalhoub V, Barone LM, Wilming L, TassinariMS et al. Progressive development of the rat osteoblast phenotypein vitro: Reciprocal relationships in expression of genes associatedwith osteoblast proliferation and differentiation during formationof the bone extracellular matrix. J Cell Physiol 1990;143:42030.

Peterkofsky B, Diegelmann R. Use of a mixture of proteinase-freecollagenases for the specific assay of radioactive collagen in thepresence of other proteins. Biochemistry 1971;10:98894.

S. Takamizawa et al. / Cell Biology International 28 (2004) 255265264

Prockop DJ, Kivirikko KK. Collagens: Molecular biology, diseases,and potential for therapy. Annu Rev Biochem 1995;64:40334.

Rickard DJ, Kassem M, Hefferan TE, Sarkar G, Spelsberg TC, RiggsBL. Isolation and characterization of osteoblast precursorcells from human bone marrow. J Bone Miner Res 1996;11:31224.

Sasaki T, Majamaa K, Uitto J. Reduction of collagen production inkeloid fibroblast cultures by ethy1-3,4-dihydroxybenzoate. J BiolChem 1987;262:9397403.

Senoo H, Tsukada Y, Sato T, Hata R. Co-culture of fibroblasts andhepatic parenchymal cells induces metabolic changes and for-mation of a three-dimensional structure. Cell Biol Int Rep 1989;13:197206.

Torii Y, Hitomi K, Tsukagoshi N. L-Ascorbic acid 2-phosphatepromotes osteoblastic differentiation of MC3T3-E1 mediated byaccumulation of type I collagen. J Nutr Sci Vitaminol (Tokyo)1994;40:22938.

S. Takamizawa et al. / Cell Biology International 28 (2004) 255265 265

Effects of ascorbic acid and ascorbic acid 2-phosphate, a long-acting vitamin C derivative, on the proliferation and differentiation of human osteoblast-like cellsIntroductionMaterials and methodsCell cultureDetermination of growth rateDetermination of alkaline phosphatase activityReverse transcriptasepolymerase chain reaction (RTPCR)Metabolic labeling and collagen assayElectron microscopyStatistical analysis

ResultsEffect of AsA and Asc 2-P on the growth of MG-63 cellsEffects of AsA and Asc 2-P on ALP activity and mRNA levels of MG-63 cellsCollagen is essential for stimulation of cell growth and ALP activity by Asc 2-PFormation of ECM rich tissue-like substance by MG-63 cells

DiscussionAcknowledgementsReferences