[Journal of Nucleic Acids Investigation 2011; 2:e7] [page 39]

GyrB versus 16s rRnasequencing for the identification of Campylobacter jejuni,Campylobacter coli, and Campylobacter lariNereus William Gunther IV,1

Jonnee Almond,1 Xianghe Yan,1

David S. Needleman2

1Molecular Characterization of FoodbornePathogens Research Unit, U.S.Department of Agriculture, AgriculturalResearch Service, Eastern RegionalResearch Center, Wyndmoor, PA, USA;2Integrated Biomolecular Resource CoreFacility, U.S. Department of Agriculture,Agricultural Research Service, EasternRegional Research Center, Wyndmoor,PA, USA

Abstract

Species of the genus Campylobacter areresponsible for the largest number of bacterialfood-borne illness cases occurring yearly in thedeveloped world. The majority of disease iscaused by three of the thermotolerantCampylobacter species: Campylobacter jejuni,Campylobacter coli, and Campylobacter lari.An inability to differentiate these three speciesusing the commonly employed 16S rRNAsequencing procedure has led to the develop-ment of alternative methods to identify thesebacteria. Some of these methods include theutilization of the gyrB gene. A reliable methodwas developed for the differentiation of C. jeju-ni, C. coli, and C. lari employing the gyrB gene.It involves amplification and sequencing of aspecies-variable region of the gene with a sin-gle pair of DNA primers. The method workswell for the separation and organization of thethree Campylobacter strains as well as satisfy-ing the suggested guidelines for sequencebased identification for most strains investi-gated.

Introduction

Campylobacter species are the majorcausative agent of food-borne gastrointestinalbacterial infections in the developed world.1-3

The genus Campylobacter is comprised of 16different species.4 Campylobacter jejuniaccounts for the majority of the diseaseattributable to Campylobacter with C. coli and

C. lari responsible for most of the remain-der.5,6 Additionally, these three species com-prise three of the four known thermotolerantspecies of Campylobacter. A commonly usedmethod for the differentiation of bacterialspecies is 16S rRNA sequencing.7 However, inthe case of C. jejuni, C. coli and C. lari differ-entiation by the 16S rRNA method is not suf-ficiently discriminating given the high degreeof similarity found between the 16S rRNAgene sequences for these three species.8 Toaddress this issue other researchers have uti-lized the gyrB gene, which encodes the β sub-unit of DNA gyrase, to more fully differentiatebacterial species where the 16S rRNAsequences are too well conserved.9 Previousresearch in other laboratories used multipleprimer pair PCR-based amplification andrestriction fragment length polymorphismanalysis (RFLP) of the gyrB gene to differen-tiate Campylobacter species.10 Using gyrB wehave developed a method capable of reliablydifferentiating the three main human diseasecausing Campylobacter species, C. jejuni, C.coli and C. lari while supplying additionalsequence data with potential use in taxonom-ic studies. This method utilizes a single pairof degenerate DNA primers for both theamplification and subsequent sequencing ofan 811-bp fragment of the gyrB gene from thebacterial strains to be identified. This methodwas found to provide excellent discriminationbetween strains of C. jejuni, C. coli, and C.lari. The advantage of this method withregards to species identification and differen-tiation is readily apparent when compared toresults derived from the 16S rRNA method.

Materials and Methods

Bacterial strainsIn total, 25 different reference strains of

Campylobacter species were used in this study.The Campylobacter strains chosen for thiswork were well characterized having beenidentified to the species level by multiplemethods. Additionally, the C. jejuni, C. coli,and C. lari strains utilized were isolated fromboth human and animal sources and minimal-ly passaged. C. coli: RM1403, RM4796,RM1529, RM4803, RM4780, RM3232, RM1840,RM2221, RM1182, RM1182; C. lari: RM2820,RM3600, RM4110, RM2099, RM2100, and C.jejuni: RM5032, RM1188, RM1449, RM1464,RM3194, RM1247, RM3405, RM1221, RM1246strains were kindly provided by Dr. RobertMandrell (USDA, Agricultural ResearchService, Western Regional Research Center,Albany, CA, USA). C. coli strain ATCC33559and C. lari strain ATCC35221 were purchasedfrom ATCC (Manassas, VA, USA). Strains were

cultured from frozen stocks (-80ºC) directlyonto Brucella (Becton Dickinson, Sparks, MD,USA) agar plates (1.5% agarose) and incubat-ed in a microaerobic chamber (MACS-VA, DonWhitley, UK) (5% O2, 10% CO2, 85% N2) at 42ºCfor 24 h. Additionally, four Escherichia colistrains, four Salmonella strains and aCampylobacter showae and concisus were cho-sen randomly from our lab’s collections andutilized to test the specificity of the primersused in the gyrB based identification method.

DNA extractionBacterial DNA was extracted from a single

Campylobacter colony using 25 μL of nuclease-free water and 25 μL of PrepMan Ultra reagent(Applied Biosystems, Foster City CA, USA)placed in a 1.5 mL micro centrifuge tube. Thesamples were heated in boiling water for 15minutes, allowed to cool to room temperatureand centrifuged at 16000 X g for 2 min. Thesupernatant (containing the DNA) was trans-ferred to a clean 1.5 ml microcentrifuge tube.

16S rRNA and gyrB amplificationPCR amplification of a 1540-bp fragment of

the 16S rRNA gene used primer pair EubA-(AAGGAGGTGATCCANCCRCA) and EubB-(AGAGTTTGATCMTGGCTCAG)11 (IntegratedDNA Technologies, Coralville, IA) and amplifi-cation of a 811-bp fragment of the gyrB gene

Journal of Nucleic Acids Investigation 2010; volume 2:e7

Correspondence: Eastern Regional ResearchCenter, Molecular Characterization of FoodbornePathogens Research Unit, 600 E. Mermaid Lane,Wyndmoor, PA 19038, USA. Tel. +1.215.233.6503 - Fax. +1.215.233.6581. E-mail: jack.gunther@ars.usda.gov

Key words: campylobacter, sequencing, gyrB, 16SrRNA, identification.

Acknowledgements: we would like to thank theEastern Regional Research Center’s IntegratedBiomolecular Resources core facility for theirsequencing work and Dr. Pina Fratamico forreviewing this manuscript.

Mention of trade names or commercial productsin this article is solely for the purpose of provid-ing specific information and does not imply rec-ommendation or endorsement by the U.S.Department of Agriculture.

Received for publication: 24 January 2011.Accepted for publication: 13 April 2011.

This work is licensed under a Creative CommonsAttribution 3.0 License (by-nc 3.0).

©Copyright N.W. Gunther IV et al., 2011Licensee PAGEPress, ItalyJournal of Nucleic Acids Investigation 2011; 2:e7doi:10.4081/jnai.2011.e7

Non-co

mmercial

use o

nly

[page 40] [Journal of Nucleic Acids Investigation 2011; 2:e7]

used primer pair JCL forward(GHCAA-GAATTTTCAGAAGGWAAAGT) and JCL reverse-(GGATCTTTACTTTGACAATCAGCTA).

Primers JCL forward and reverse weredesigned by aligning multiple C. jejuni, C.coli, and C. lari gyrB sequences collectedfrom sequences deposited in GenBank(NCBI, Bethesda, MD, USA). Areas of con-served sequences surrounding areas ofspecies variable sequences were identified.Sequence areas that would produce PCRproducts between 600-1000 bp in length wereselected and from these two promisingsequences that could be amplified by primerpairs with similar characteristics were usedto design two sets of primers. The primerswere tested through PCR amplification andone primer pair was judged to be the mostpromising labeled JCL forward and reverse.PCR amplification was performed using aPCR kit (Invitrogen, Carlsbad, CA, USA) in atotal volume of 50 μL containing 5 μL of 10xreaction buffer, 1 μL of dNTPs, 5 μL of eachprimers (10 µM), 1μL of template DNA, 0.25μL of Taq DNA (5 u/µL) and 32.75 μL of PCRwater to make up the final volume.Amplification was performed using an iCyclerthermocycler (BioRad, Hercules, CA, USA).Thermal cycling conditions for 16S rRNA wasas follows: Initial denaturation at 95°C for 90s, followed by 30 cycles of 95°C for 30 s, 55°Cfor 45 s, and 72°C for 60 s with a final exten-sion at 72°C for 5 min. Thermal cycling con-ditions for gyrB gene were as follows: initialdenaturation at 95°C for 90 s, followed by 30cycles of 95°C for 30 s, 50°C for 45 s, and72°C for 60 s with a final extension at 72°Cfor 5 min. Eight microliters of PCR productwere used for electrophoresis in a 1.0%agarose gel at 120 V for 30-45 min.

DNA SequencingSequencing of the 16S rRNA PCR fragment

utilized the amplification primers EubA andEubB and the nested primers 519F-(CAGCMGCCGCGGTAATWC) and 519R-(GWATTACCGCGGCKGCTG) in order to com-pletely sequence the 1540 bp PCR fragment.To sequence of the 811-bp gyrB PCR fragmentwe were able to use the same primers, JCL for-ward and JCL reverse, that we used for ampli-fication of the fragment. The sequencing reac-tion included the following components: 7 μLof 2.5x buffer, 1 μL of primers (3.2 μM), 1 μLof ABI’s Big Dye Terminator (Foster City, CA,USA), 1.2 μL of cleaned PCR product andddH2O to make up the final volume. Cyclesequencing was performed using 30 cycles of95°C for 10 s, 55°C for 5 s and 60°C for 4 min.After a purification step the sequencing reac-tion products were analyzed using an AppliedBiosystem (Foster City) 3730 DNA sequencer.

Sequence analysis, alignment, andconstruction of phylogenetic treefor gyrB and 16S rRNA data

After sequence trimming, the sequence datawere then combined and assembled to formcontiguous stretches of sequence contigs withthe Sequencher program, V. 4.9 (Gene CodesCorp, Ann Arbor, MI, USA). The Sequenchersoftware was also used for gel trace analysis,contig assembly verification, contig sequencecomparisons, and Phred quality analysis. Thealignments of all obtained nucleotidesequences of gyrB and 16S rRNA were generat-ed by using the multiple sequence alignmentprogram, CLUSTALX version 1.8312 with thedefault parameters and adjusted manually.Phylogram trees were generated from the clus-ter analysis using the Bootstrap NeighborJoining method with 1000 random samplingsand a seed number of 111. The resulting phylo-gram trees were displayed using the TreeViewX program.13 The sequence similarity anddivergence for individual tested strains were

calculated by MegAlign of the DNASTAR pro-gram (DNASTAR Inc., Madison, WI, USA).

Results

16S rRNA sequencesSequencing of the 1540-bp 16S rRNA PCR

fragments generated 1418 bp of sequence withan average Phred score of ≥20 (≥99% accu-rate) for each of the 25 Campylobacter strains.When these sequences were aligned and dis-played as a phylogenetic tree, they formed anindistinct heterogeneous tree with no prefer-ential grouping by species for the three sepa-rate Campylobacter species investigated(Figure 1).

The sequences of all of the 25 Campy -lobacter strains regardless of the originatingspecies differed from one another by no morethen 2.9%. Additionally, the 16S rRNAsequences of the majority of the C. jejuni and

Article

Figure 1. Phylogram tree of 16S rRNA sequences of 25 Campylobacter strains of thespecies C. jejuni, C. coli, and C. lari. Bootstrap values are included for the main branch-es of the tree.

Non-co

mmercial

use o

nly

[Journal of Nucleic Acids Investigation 2011; 2:e7] [page 41]

C. coli strains differed from one another byless then 1% with some differing by only 0.1%.

gyrB sequencesSequencing of the 811-bp gyrB PCR frag-

ment generated 703 bp of sequence with anaverage Phred score of ≥20 (≥99% accurate)for each of the 25 Campylobacter strains. Thesequences were aligned and displayed in treeform resulting in the strains organizing intothree distinct groups (Figure 2).

Group A was comprised exclusively of all tenC. coli strains sequenced for this study.Similarly, group B contained only the six C. laristrains utilized in the study. Finally, group Cwas restricted to only the nine C. jejuni strainsthat had been selected for this research. Therewere only slight differences observed betweenthe C. coli strains comprising group A with nomore than 2% differences between the C. coligyrB sequences. Similarly, in group C therewas no more than a 2% difference between theC. jejuni gyrB sequences produced. However,the C. lari strains’ gyrB sequences thataccount for group B showed a higher level ofstrain to strain sequence variations with per-cent differences in sequences of about 9.5%.This is similar to the differences in sequencesobserved between the C. coli gyrB sequencesin group A and the C. jejuni gyrB sequences ingroup C which range from 9-11.2%. Thesequence differences between the C. jejunigyrB sequences of group C and the C. lari gyrBsequences of group B ranged from 11.5-14.4%.Finally the sequence differences between theC. lari gyrB sequences of group B and the C.coli gyrB sequences of group A ranged from13.2-15.8%.

BLAST results from 16S rRNA andgyrB sequences

When the individual sequences derivedfrom the 16S rRNA or gyrB genes of theCampylobacter strains were queried againstNCBI’s bacterial sequence databases using theBLAST (blastn) web-based analysis tool, thegyrB sequences produced superior specificitywith regards to the species identities of thehomologous sequences derived from the data-base searches.14 All ten of the C. coli straingyrB sequences when compared against thebacterial sequence database produced a collec-tion of C. coli sequences that matched thequery sequence with identity scores of 99-97%.The first match from the database that was nota C. coli sequence only had a maximum iden-tity of 91% (data not shown). Conversely, forthe 16S rRNA sequences, the C. coli sequencequeries returned a list of matching sequencesthat were a mixture of C. jejuni and C. colisequences all possessing identity scores of 99-98%. The nine C. jejuni strain gyrB querysequences produced a list of C. jejuni strain

sequences from the database with 99-98%matching identities. The first non C. jejunisequence match returned from the databasecomparison had identity scores of no morethen 90% (data not shown). Again the resultsof the database searches of the 16S rRNA C.jejuni sequences were much less specific andreturned a mixture of C. jejuni, C. coli, and C.lari sequences with identity scores in the 99-97% range. Finally, the six C. lari gyrBsequences queried against the bacterial data-base returned a list of C. lari sequences withidentities to the query sequences of between99-90%. The first non- C. lari sequences fromthe lists resulting from the database compar-isons had percent identity scores of no greaterthan 88% to the query sequences (data not

shown). The BLAST results from a comparisonof the 16S rRNA C. lari sequences comparedagainst the bacterial database returned a mix-ture of C. lari and non-C. lari strains, with per-centage identity scores of 99-97% to the querysequences.

Comparing the gyrB sequences produced bythis research against NCBI’s bacterial sequencedatabase allowed for the successful identifica-tion of twenty-five different C. jejuni, C. coli andC. lari strains with zero resulting misidentifica-tions or false-positives. Additio nally, ten otherbacterial strains were included in the gyrBsequencing assay to address concerns about thepotential for non-specific cross reactions occur-ring in this method. A collection of E. coli,Salmonella and non-jejuni, coli and lari

Article

Figure 2. Phylogram tree of gyrB sequences of 25 Campylobacter strains of the species C.jejuni, C. coli, and C. lari. Bootstrap values are included for the main branches of the tree.

Non-co

mmercial

use o

nly

[page 42] [Journal of Nucleic Acids Investigation 2011; 2:e7]

Campylobacter strains were evaluated with nofalse positives being produced by the assay.

Discussion

We have described a method for the PCRamplification and sequencing of a fragment ofthe gyrB gene capable of reliably identifyingand differentiating the three main human dis-ease causing Campylobacter strains: C. jejuni,C. coli, and C. lari. This method has the advan-tage of being able to use the same primers forboth the amplification and sequencing of thegyrB fragment. An 811-bp fragment of the gyrBgene was selected for this assay since itallowed for a single sequencing run coveringthe entire length of the resulting gene frag-ment. Therefore, the two sequencing primerswould be sufficient to produce overlappingsequences the entire length of the gyrB frag-ment resulting in confirmatory data toincrease the overall confidence in the reportedsequence. The resulting 703 bp of high qualitysequence proved sufficient to separate the col-lection of Campylobacter strains into three dis-tinct groups which correlated perfectly withtheir species identities. Additionally BLASTbased comparisons to NCBI’s bacterialsequence database for many of the individualsequences produced sequence matches with≥99% sequence homology to bacterialsequences from the same species. Suggestedguidelines in the literature describing the cut-off levels for sequence homology (percentidentity) for proper identification of bacterialspecies ranging from ≥97% to ≥99%.15,16 The C.jejuni and C. coli strain gyrB sequences inves-tigated in this manuscript satisfy these guide-lines. However, it should be noted that some ofthe C. lari strains failed to meet this standard.Based on the phylogenetic tree results thereappears to be a large amount of C. lari strain tostrain variation with regards to the gyrBsequence. This leads to a less tight grouping ofthe C. lari strains in the phylogenetic tree butdoes not affect the overall separation of the C.lari strains from the more tightly grouped C.jejuni or C. coli strains. Therefore, thesequence of the gyrB gene remains a good toolfor separating strains of C. coli, C. jejuni, andC. lari from one another at the species level. Itis also a good tool for identification of C. coliand C. jejuni strains through BLAST compar-isons to sequence databases. However, thevariations in the gyrB sequences betweenstrains of C. lari make it difficult to use thosesequences alone for the identification of C.lari strains based on the currently acceptedidentity guidelines.

This problem with C. lari may be compound-ed by the fact that there are considerably fewergyrB sequences in the nucleotide database for

C. lari as compared to C. coli and C. jejuni. C.lari has been shown to be a genetically diversespecies, and the C. lari strains used in ourstudy may be members of different sub-groups.17,18 By increasing the number of C. larigyrB genes sequenced and available in bacter-ial sequence databases it maybe possible thatdistinct gyrB subgroups of C. lari will emergeand allow for superior sequence based identifi-cation of C. lari strains.

The sequence data produced by this methodprovides for the possibility of additional taxo-nomic studies similar to the one just mentionedregarding determining if there might be sub-groupings of C. lari strains. This is an advan-tage that a sequence based identification sys-tem has over multiplex PCR identification tech-niques that are generally quicker and simpler toperform. Additionally, the gyrB gene is not theonly target gene with the power to identify path-ogenic Campylobacter species. Other researchhas shown that the lpxA and GTPase genes canalso clearly identify and separate many of theCampylobacter species.19,20 Therefore, it may beadvantageous to also utilize these gene targetsin addition to this gyrB-based method in anyfuture taxonomic studies focusing on identify-ing Campylobacter sub-groups.

References

1. CDC. Preliminary FoodNet data on the inci-dence of infection with pathogens transmit-ted commonly through food--10 States,United States, 2005. MMWR Morb MortalWkly Rep 2006;55:392-5.

2. Fields PI, Swerdlow DL. Campylobacter jeju-ni. Clin Lab Med 1999;19:489-504.

3. Park SF. The physiology of Campylobacterspecies and its relevance to their role asfoodborne pathogens. Int J Food Microbiol2002;74:177-88.

4. Mandrell RE, Harden LA, Bates A, et al.Speciation of Campylobacter coli, C. jejuni,C. helveticus, C. lari, C. sputorum, and C.upsaliensis by matrix-assisted laser desorp-tion ionization-time of flight mass spec-trometry. Appl Environ Microbiol 2005;71:6292-307.

5. Moore JE, Corcoran D, Dooley JS, et al.Campylobacter. Vet Res 2005;36:351-82.

6. Tam CC, O'Brien SJ, Adak GK, et al.Campylobacter coli - an important food-borne pathogen. J Infect 2003;47:28-32.

7. Fox GE, Stackebrandt E, Hespell RB, et al.The phylogeny of prokaryotes. Science1980;209:457-63.

8. Gorkiewicz G, Feierl G, Schober C, et al.Species-specific identification of campy-lobacters by partial 16S rRNA genesequencing. J Clin Microbiol 2003;41: 2537-46.

9. Yamamoto S, Harayama S. PCRAmplification and Direct Sequencing ofgyrB Genes with Universal Primers andTheir Application to the Detection andTaxonomic Analysis of Pseudomonas putidaStrains. Appl Environ Microbiol 1995;61:1104-9.

10. Kawasaki S, Fratamico PM, Wesley IV,Kawamoto S. Species-specific identifica-tion of Campylobacters by PCR-restrictionfragment length polymorphism and PCRtargeting of the gyrase B gene. Appl EnvironMicrobiol 2008;74:2529-33.

11. Cottrell MT, Kirchman DL. Community com-position of marine bacterioplankton deter-mined by 16S rRNA gene clone libraries andfluorescence in situ hybridization. ApplEnviron Microbiol 2000;66:5116-22.

12. Thompson JD, Gibson TJ, Plewniak F, et al.The CLUSTAL_X windows interface: flexi-ble strategies for multiple sequence align-ment aided by quality analysis tools.Nucleic Acids Res 1997;25:4876-82.

13. Page RD. TreeView: an application to dis-play phylogenetic trees on personal comput-ers. Comput Appl Biosci 1996;12:357-8.

14. Altschul SF, Gish W, Miller W, et al. Basiclocal alignment search tool. J Mol Biol 1990;215:403-10.

15. Drancourt M, Bollet C, Carlioz A, et al. 16Sribosomal DNA sequence analysis of a largecollection of environmental and clinicalunidentifiable bacterial isolates. J ClinMicrobiol 2000;38:3623-30.

16. Stackebrandt E, Goebel BM. TaxonomicNote: A Place for DNA-DNA Reassociationand 16S rRNA Sequence Analysis in thePresent Species Definition in Bacteriology.J Syst Bacteriol 1994;44:846-9.

17. Van Doorn LJ , Verschuuren-Van HaperenA, Van Belkum A, et al. Rapid identificationof diverse Campylobacter lari strains isolat-ed from mussels and oysters using areverse hybridization line probe assay. JAppl Microbiol 1998;84:545-50.

18. Duim B, Wagenaar J. Amplified fragment-length polymorphism and protein profilingfor identification of Campylobacter lari sub-groups. Methods Mol Biol 2006;345: 119-30.

19. Van Doorn LJ, Verschuuren-van Haperen A,Burnens A, et al. Rapid identification ofthermotolerant Campylobacter jejuni,Campylobacter coli, Campylobacter lari, andCampylobacter upsaliensis from variousgeographic locations by a GTPase-basedPCR-reverse hybridization assay. J ClinMicrobiol 1999;37:1790-6.

20. Klena JD, Parker CT, Knibb K, et al.Differentiation of Campylobacter coli,Campylobacter jejuni, Campylobacter lari,and Campylobacter upsaliensis by a multi-plex PCR developed from the nucleotidesequence of the lipid A gene lpxA. J ClinMicrobiol 2004;42:5549-57.

Article

Non-co

mmercial

use o

nly