3005HSC

2000MSC Molecular Genetics

Lecture Notes2015

Undergraduate Course, School of Medical Science, Griffith University, Gold Coast campus, Queensland, Australia.Topic 1 Mendelian Genetics

1.0 Introduction Genetics is the study of heredity. Three main branches:1. Transmission genetics: the study of transmission of traits from generation to generation. Pioneered by Gregor Mendel in 1865

2. Molecular Genetics: the study of the composition and role of genetic material based on the central dogma that DNA is the template for RNA which encodes proteins. This explains the transmission of traits first described by Mendel.

3. Population Genetics: the study of variation and evolution in populations. We know that DNA accumulates changes (mutations) which result in phenotypic variation between individuals in a population. Natural selection can then act on that variation and the population will change over time, ie the population will evolve.

We should always keep in mind the relationship between the three branches1.1 Mendels Experiments

(Refer text chapter 3, pages 43-55) Mendel 1856

Crossed pea plants easy to grow, crossbred artificially, grows to maturity in one season Used 7 visible features (traits), each with 2 visible alternate forms (phenotypes), used pure-breeding strains

[Please revise how chromosomes move in meiosis to produce gametes: try youtube.com/watch?v=_IzfJSxa-uA]1.1.1 Mendels Observations of Plants with One Trait

The Monohybrid Cross

Crossing two pure-breeding plants resulted in one phenotype in the F1 progeny

Eg. plant heighttall x short

tall

Inbreeding F1 progeny (self fertilisation) resulted in two phenotypes in the F2 generation

The phenotype seen in the F1 progeny was 3 times more common in the F2 progeny than the other phenotype

3:1 phenotypic ratio; 1:2:1 genotypic ratio

This led to Mendels first 3 postulates

1.1.2 Mendels First 3 Postulates

1. Unit factors exist in pairs (unit factors control genetic characters/traits)

Prior to this, thought that one per trait with parental traits blending in offspring

Factors separate into germ cells (observed traits of seeds; round/wrinkled, green/yellow etc)

Fertilisation results in individuals with one factor from each parent

2. Dominance/Recessiveness

In the pair of unit factors for a single trait in an individual, if each is unlike the other, one unit factor is dominant and the other is recessive3. Law of Segregation:

In the formation of gametes, the two factors for any trait separate (segregate) randomly, so that each ends up in a different gamete.

Separation of factors gives gametes with equal chance of each factor due to random union of gametes

1.1.3 Mendels Observations of Plants with Two Traits

The Dihybrid Cross To see if the law of segregation applied to more than one trait, Mendel crossed plants that were purebreeding (dominant and recessive) for two traits eg. Seed colour and shape

He found:

F1 one phenotype of each separate trait

F2 9:3:3:1 phenotypic ratio

F2 ratio due to combination of two independent 3:1 ratios

This may be done with a Punnett square to allow the genotypes and phenotypes from a cross to be visualised easily (Reg. Punnett Cambridge, founded Journal of Genetics 1910, developed Punnet swquare 1905, discovered linkage 1906).

9 different genotypes, 4 phenotypes in a 9:3:3:1 ratio This led to Mendels second law: The Law of Independent Assortment

meio1.1.4 Law of Independent Assortment

Segregation of two factors for a trait are independent of the segregation of other factor pairs in the formation of gametes

Individual members of pairs of alleles segregate independently of one another during gamete formation

Eg.

AaBb

Where A and a alleles separate independently

of B and b alleles

ABAbaBab

This gives 4 possible types of gametes, therefore if you cross 4 gametes with another 4 gametes you get 16 possible combinations

Conclusions

Mendel determined laws that demonstrate inheritance of traits

Law of segregation: two factors per cell for a particular trait separate independently into gametes

Law of independent assortment: separation of pairs of alleles are independent of each other

Mendel had no knowledge of chromosomes or genes

Used maths and probabilities to determine laws

Also persistence, repetition to verify results and logic to reach conclusions

We can correlate Mendel's Postulates with the behaviour of chromosomes during meiosis

Were his results too good?

Luck did not use linked genes or incomplete dominance

1936 Fisher evaluated Mendels data to determine if Mendel was neutral or objective in his studies or had his conclusions in mind

Found that results were closer to expected frequencies than should have been

Looking at whole series of experiments, there was a 1/14000 chance of getting results as Mendel had claimed

However, others repeated, giving ratios similar if not better than Mendels

Unconscious bias? Experience modifying expectations? Some subjective interpretation? Fisher was incorrect? Medels paper abbreviated? 1.2 TerminologyTerminology I

Genes: Mendels hereditary factors; segment of DNA specifying RNA or polypeptide

Alleles: alternate forms of a gene, normal = wild-type

NB: Alleles are not restricted to two, there may be many alleles for a gene

Genotype: genetic constitution

Phenotype: characteristics that result from genotype and environment

Identical twins: same genes, therefore different phenotype from environment

Locus: position of gene on chromosome

Diploid: two copies of a gene (two sets of chromosomes)

Haploid: one copy of a gene (one set of chromosomes)

Homologous chromosomes: same genes, may be different alleles

Homozygote: genotype with same allele (eg. AA)

Heterozygote: genotype with different alleles (eg. Aa)

Terminology II Pure-breeding: parent that produces only one progeny like themselves

F1: first filial generation

F2: formed by crossing with F1 Testcross: cross of hybrid F1 with homozygous recessive to determine unknown genotype

Backcross: cross of hybrid F1 with parent

NB: testcross is a type of backcross

Monohybrid: an organism who is heterozygous at one gene locus Aa

Dihybrid: an organism who is heterozygous at two gene loci AaBb

Conventions Genes on different chromosomes: AaBbCcDd

Linked genes: ABCD

abcd

Indicating haplotypes or arrangement of linked alleles

Capital letter for dominant genes

Small letter for recessive genes

1.3 Testcrosses

A testcross may be used to detect the genotype of an individual who expresses a dominant trait. Eg. How would you determine if a tall plant is DD or Dd?

For a testcross, cross with homozygous recessive to discover genotype of unknown

1.3.1 Testcross With One Trait

Results give unknown genotype

1.3.2 Testcross With Two Traits

In this case, it may be used to detect the genotype of an individual who expresses two dominant traits

AABB

x aabb

(AB)

(ab) gametes

AaBb

x

aabb

(AB)(Ab)(aB)(ab)

(ab)gametes

AaBb Aabb aaBb aabb

1 : 1 : 1 : 1

4 phenotypes, 4 genotypes, in equal ratios when the unknown is a dyhybrid ie AaBb

If unknown is AABB, then 1 phenotype and 1 geneotype ie AaBb[Do the Punnet square]1.4 The Forked-line method for F1 x F1 Crosses

Consider that each gene pair moves separately during gamete formation

In Aa x Aa cross (F1 generation) we know that will have yellow and will have green seeds and in Bb x Bb cross we know that will have smooth and will have wrinkled seeds

The product law is applied ie. when 2 independent events occur simultaneously, the probability of the two outcomes occurring in combination is equal to the product of their individual probabilities of occurrence

The forked line method can also be used for a trihybrid crosses. Study text figure 3.91.5 Extensions of Mendelism

(Refer text chapter 4, pages 74-86) Extensions of Mendelian analysis include:

that a gene can exist in many different allelic states

that a particular gene can affect several different traits

that a particular trait can be affected by several different genes

genetic and environmental factors influence phenotypic variation

Complete Dominance

Phenotype of homozygote same as that of a heterozygote

Eg. PKU (Phenylketonuria)

overproduction of phenylpyruvic acid (in PKU patients) due to inactive phenylalanine hydroxylase

Build up of phenylalanine leads to mental retardation

Due to alleles of enzyme phenylalanine hydroxylase

Homozygote dominant: Phy Phy (PP) unaffected

Heterozygote: Phy phy (Pp) unaffected

Homozygote recessive: phy phy (pp) - affected

Partial (Incomplete) Dominance

Heterozygote shows intermediate phenotype

Eg. Snapdragons

New phenotype seen in heterozygote

Not seen in Mendels results

Co-Dominance

Both phenotypes in heterozygote

Eg. ABO human blood groups

Due to enzyme that adds sugar to blood group antigens on RBC

A N-acetyl sugar

B Unacetylated sugar

O No sugar

Alleles: IA, IB, i

Blood groups: A, B, AB, O

Genotypes: IAIA, IAi; IBIB, IBi ; IAIB, ii

IAIB AB individuals produce A and B antigens

Epistasis

Gene interactions

Phenotype of one gene influenced by genotype of one or more other genes

Results in variations from simple Mendelian ratios

May be dominant or recessive epistasis, different ratios for each

Interaction of genes changes simple Mendelian ratios

Eg.Pigment in violets, eg of recessive epistasis where dd is epistatic to G and g

Pink D active enzyme

g

d inactive enzyme

Red

D enzyme g pink

G

D enzyme G white

White

DDGGxddgg

DdGg xDdGg

D_G_ : D_gg : dd_ _

9 : 3 : 4

Penetrance

Incomplete penetrance: some individuals with a particular genotype do not always express the associated phenotype

Complete penetrance: genotype always expressed in associated phenotype = 100% penetrance, incomplete penetrance is when the genotype is expressed in the associated phenotype Haploid ----------> Diploid

meiosis

fertilisation

Ploidy = number of chromosome sets

Interphase = phase between cycles (cells most active time)

Mitosis can occur in cells of any ploidy

Meiosis can only occur in even ploidy cells

Meiosis needs homologous chromosomes

Meiosis results in VARIATION of offspring

Meiosis I = homologous chromosomes separate

Meiosis II = chromatids separate2.1.3 Consequences Sexual ReproductionMeiosis

Halves ploidy

Independently assorts chromosomes

Allows recombination between linked genes

Fertilisation

Random union of gametes from parents

Variation in chromosome combinations & gene combinations on chromosomes in the offspring

Mendels' Laws

1. Segregation - one allele in any gamete

2. Independent Assortment - segregation of alleles, independent of allele segregation for other genes

2.2 Genes On Different Chromosomes

Show independent assortment, segregation

Providing the following

1. Not linked

2. Complete dominance

3. No lethal genes

4. No epistasis

Testcross F1

AaBb x

aabb

(AB)(Ab)(aB)(ab)

(ab)

AaBb : Aabb : aaBb :aabb

1 : 1 : 1 : 1

Dihybrid Cross of F1

F1*F1

AaBb x AaBb

A_B_: A_bb : aaB_ : aabb

9 : 3 : 3 : 1

2.3 Linked Genes(Refer text page 106-9)

Linkage

Linkage: variation in gametes due to different combinations of linked genes

Crossing over occurs when homologous chromosomes align during Prophase I, pieces of chromosomes may be exchanged

Proposed by Thomas Morgan: fruit flies, 1908 Columbia University, New York, found genetic crossing over Chiasmata discovered in 1909 by Jansessns, Jesuit priest and Professor, a physical explanation for crossing over

Chiasmata are points of overlap on homologous chromosomes during Prophase I

Linked genes are genes on the same chromosome

Do NOT show independent assortment of alleles

Tend to be inherited together

Genes very close - little crossing-over

Genes further apart - more crossing-over

1% crossing-over = 1cM (centimorgan)

1cM = chromosome map unit

Crossing-over = recombination

Maximum Detectable = 50%

2.3.1 Detection Of LinkageDetected by deviation from expected ratios

ie. Variation from1:1:1:1 testcross & 9:3:3:1 dihybrid F2

Eg.

TESTCROSS

ABx ab

AB

ab

F1 ABxab

ab

ab

AB ab Ab aBab ab ab ab

[------------] = crossing over (non-parentals)

If genes are 20cM apart, then:recombinants = 20%

parentals = 80%

Recombination due to crossing-over

Phenotypes different to original parents, therefore sometimes called non-parentals

Non-Recombinants = no crossing-over

Phenotypes same as original parents, are called parentals

Eg. If genes 10cM apart

= 10% recombinants (5% for each type)

& 90% non-recombinants (45% for each type)

Proportions Testcross

% recom. Parental

Non-Parental10cM

0.45

0.45

0.05

0.05

20cM

0.40

0.40

0.10

0.10

50cM

0.25

0.25

0.25

0.25

Not Linked1.00

1.00

1.00

1.00

2.3.2 Determining Distance

Use testcross to determine distance between linked genes

BD *bd

BD

bd

(BD)

(bd)gametesF1

BD

*

bd

bd

bd

(BD)(Bd)(bD)(bd)

(bd) gametes

BD bd Bd bDbd bd bd bd

Nos 176 190 16 18

% recombination= 16+18total

= 8.5cM

2.3.3 Linkage Maps Amount of crossing-over used to determine distances between genes

Termed Linkage Maps

Distance is additive

4cM

5cM

A---------------------B-------------------------------C

add distance A - C = 9cM

Genome Maps in various organisms use linkage data

& somatic cell hybridization & in-situ hybridization

Data to combine results to give maps of various chromosomes

2.4 Gene MappingThree Methods

i) Somatic Cell Hybridization

Follows segregation of gene product with a particular chromosome. Text P 123

ii) In-Situ Hybridization

Bind cloned gene probe to chromosome directly

iii) Linkage Studies Probability that particular pedigree/s with 2 traits reflects linkage between them.

Can be detected on autosomes and sex chromosomes

Calculate probability that 2 traits independently assort according to non-linkage.

Then calculate probability that same data results from linked genes.

Calculate ratio of these probabilities and convert to logarithm

This generates LOD scores (LOD = Log of the odds for linkage)

LOD Scores Linkage between markers detected by computer analysis of gene ratios

IF:

Lod score of 3 = 1000:1 odds for linkage

Lod score of -2 = 100:1 odds against linkage

Lod scores can be added over families

2.5 Sex-Linked Inheritance

(Refer text chapter 4 pages 88-91) Sex can be used as a marker for a disorder

Genes located on the sex chromosomes show sex-linked inheritance

Refers to genes in the differential segment of X or Y

Genes on X are called - X-linked

Genes on Y are called - Y-linked (holandric)

Mostly X-Linked

Mode of inheritance will indicate X-chromosomal localisation of the gene in question

ie. No male to male transmission in X-linked & obligate male to female transmission in X-linked

Since X-chromosome is much larger & therefore has much larger differential segment, there are many more X-linked disorders (X-linked disorders almost always recessive)

First documented by Thomas Morgan 1910

Males hemizygous for for X-linked genes2.5.1 X-linked Recessive Tends to skip generations

More affected males than females (affected female requires mother & father affected which is rare)

Half sons of carrier females are affected

Lethal only in males

Examples:

Haemophilia A & B

Duchenne Muscular Dystrophy

Red-Green Colour Blindness

2.5.2 x-linked Dominant At least one parent affected

Affects males and females equally

Affected female transmits to half sons

Affected male transmits to none of his sons but ALL daughters

In general, males have more severe & less variable forms of the disease

Examples:

Vitamin-D resistant rickets

Goltz's syndrome, usually lethal in males, multiple abnormalities

2.5.3 Sex-limited and Sex-influenced Inheritance Genes not on sex chromosome

Sex plays a role in expression of a phenotype

Sex-Limited Characteristics In Sex-limited inheritance, expression limited to one sex eg. Plumage in domestic fowl, milk production in female dairy cattle

Sex Influenced Characteristics

In sex-influenced inheritance, sex influences expression

May be hormonal influence

Eg. Pattern baldness in humans (also called premature sterile male with breast development

Broad pelvis, breast enlargement

Generally reduced intelligence but not always

Triple X Female (XXX)

Normal female phenotype, including fertility, maybe taller, majority never detected, 1/1000 births.Non-Dysjunction can also Occur in Males

Non-dysjunction at Anaphase I can lead to

44 + XXYor44 + XO

(Klinefelters)

(Turners)

Non-dysjunction at Anaphase II can lead to

22XX or 22YY

+ normal 22A + X

44 + XXX or 44 + XYY

(Triple X) (XYY male)

XYY Male Male phenotype, normal IQ Tall due to increase SHOX genes, 7cm on average, may be fertile

A fascinating example of bad data and instant social stigmatization based on genetic testing. So called XYY super male criminal now considered false.2.6.5 Sex Determination in Mammals sex is determined by the dominant effect of the Y chromosome

presence of Y = male; absence of Y = female

Maleness is a result of:` Y chromosome loci that cause differentiation of embryonic gonads to form testis

TDF (Testis Determining Factor) is a gene on the Y chromosome in a regions called SRY (Sex-determining Region-Y) which is just outside the pseudo-autosomal region

SRY was found by studying individuals whose sex was inconsistent with their chromosome constitution eg XX males and XY females.

XX males carry a small piece of the Y chromosome in one to their X chromosomes

XY females have a small region of their Y chromosome deleted

Y chromosome has a small pseudoautosomal region that has genes found on X2.6.6 Androgen Insensitivity Syndrome Aka. testicular feminisation synfrome

46, XY - normal karyotype but sterile female phenotype

Normal male hormone (testosterone) levels, but testes develop internally

Male sex characteristics do not develop

Due to defective X chromosome gene for androgen receptor protein which is activated by testosterone to develop male phenotype, therefore testosterone fails to act & female sex characteristics develop

Androgen receptor protein

Coded for by AR gene on X, defective gene Tfm (testicular feminisation mutant)

Therefore XY females can respond to testosterone if the hormone is administered, resulting in male characteristics

2.6.7The Sex RatioMale

XY

FemaleXXXXY

XXXXY

Expect 1:1 male:female

ActuallyMale

Female conception disorders during lifetime

9% - malformations such as cleft lip, palate & polygenic disorders eg diabetes, ulcer etc developmental disorders 1.5% - Mendelian disorders & chromosomal abnormalities

Infants and Infant Deaths (Parents would be candidates for a genetic referral):

3-5% of all births result in congenital malformations 0.5% of all newborns have a chromosomal abnormality

7% of all stillborns have a chromosomal abnormality 20-30% of all infant deaths are due to genetic disorders 30-50% of post-neonatal deaths are due to congenital malformations Single Gene Disorders

1986 - McKusick, V: Mendelian Inheritance In Man; contained 4000 Mendelian traits, most associated with disease

Autosomal Dominant: 50%

Autosomal Recessive: 43%

X-Linked

: 7%

Examples

Cystic Fibrosis

AR1/2500

PKU

AR1/10000

Glu-6P-DHase

XL1/1000

Familial

AD1/500

Hypercholesteremia

Thalassaemia

AR1/16000

Haemophilia

XL1/8000

Often frequency hard to determine due to:

Penetrance

Variable expressivity

Heterogeneity many syndromes with similar symptoms; different mutations same disorder

Also, treatment & early intervention can affect frequency, eg. PKU: early intervention (diet) allows individuals who are affected to live & reproduce

Others have frequency changes due to pressure (selection) against reproduction or reduced fertility

Multigene Disorders

Some genetic disorders due to several genes interacting = polygenic

Some complex - polygenic plus environmental factors

Eg. Hypertension, diabetes

Some disorders show familial aggregation, indicating a genetic involvement

Eg. Spina bifida - risk increases with previous child affected child or parent (to 1/20) also for anencephaly, with a previous affected child increases risk to 1/20

Spontaneous Miscarriages

1st Trimester

50% chromosomal abnormalities

XO (Turner), 20% of miscarriages total (95% Turners miscarried)

Autosomal trisomies = 50% abnormal chromosome conceptions

Many never seen liveborn

Prevalence Of Genetic Conditions

20-30% of all infant deaths are due to genetic disorders 30-50% of post-neonatal deaths are due to congenital malformations

0.5% of all newborns have a chromosomal abnormality

7% of all stillborns have a chromosomal abnormality

11.1% of paediatric hospital admissions are for children with genetic disorders

50% of individuals found to have mental retardation have a genetic basis for their disability

12% of adult hospital admissions are for genetic causes 10% of the chronic diseases (heart, diabetes arthritis) which occur in the adult populations have a significant genetic component Robinson A. and Linden MG. 1993. Clinical Genetic Handbook, Boston, Blackwell Scientific Publications.

Weatherall DJ. 1985. The New Genetics and Clinical Practice, Second Edition. Oxford: Oxford University Press.

4.5 Genetic Diagnosis Symptoms, family history

Determination of mode of inheritance

Determination of risk to preclinical, prenatal situations

Therefore Risk Assessment

Genetic counselling involved

4.5.1 PreImplantation Testing

For IVF

In recurrent miscarriages, maternal age, prior chromosomally abnormal child or fetus, heritable medical condition, gender selection

4.5.2 Prenatal Testing

UltrasoundCan detect developmental defects eg.

Head -

anencephaly

Spine -

spina bifida

Abdomen -polycystic kidneys

Heart -

congenital heart disease

Limb -

deformities, shortening

Prevention of disorders by

Intrauterine treatment in some cases

Eg. Surgical treatment of urinary tract obstruction or chemical treatment such as vitamin therapy

Or terminationScreening For Chromosomal Abnormalities1) nuchal Transluceny Test

~ 12 weeks Measures thickness of fluid layer at level of foetal neck by ultrasound

Increase risk of chromosomal abnormalities or heart defects with increased thickness

+ blood test for maternal free HCG and PAPP-A (pregnancy-associated plasma protein-A) or other markers in second trimester HCG higher and PAPP-A lower in trisomies Risk calculated for chromosomal abnormality in foetus, not diagnostic If greater than 1/300 and/or patient older than 35YO, diagnostic tests recommended -chorionic villus sampling or amniocentesis 2) Chorionic Villus Biopsy

~12 wks

Sample taken trans-abdomen under US guidance

But 1/100 risk of miscarriage

Also chance of sampling maternal cells and not detecting abnormality

Cells separated & used for testing, FISH for trisomies and X Y, karyotyping, biochemical testing

3) Amniocentesis

14-17 wks

Sample of amniotic fluid containing foetal cells through abdomen

Foetal cells must be cultured for cytochemical tests or used for biochemical or DNA testing

Results take longer

1/200 risk of miscarriage

More accurate as only foetal cells sampled

3) Cell Free Foetal DNA

Non-invasive

From plasma of pregnant women

Not as accurate

Tests Performed on Foetal Cells

a) Fish

Cytochemical testing

Fluorescently labelled probe hybridises to fetal chromosomes

Can pick up trisomies, Turners monosomy

B) Karyotype Analysis

Cytochemical testing

Culture fetal cells, arrest in metaphase on slides, stain, observe microscopically for abnormalities

C) Biochemical Testing

Better to use amniocentesis & analyse fluid for:

Inborn errors of metabolism eg PKU

Structural protein disorders eg osteogenesis imperfecta (fragile bone disorder)

Neural tube defects eg spina bifida by chemical monitoring

D) DNA Testing

By direct mutation analysis of genes, eg. Thalassaemia

By analysis of linkage markers eg Huntington's

Therefore defect known or linked (defect close to marker)

Detect DNA sequence changes by Southern Blot or PCR

RFLPs Restriction Fragment Length Polymorphisms

DNA sequence changes in restriction enzyme sites

Stable, Mendelian inheritance

Can occur within genes or within non-coding regions

Useful DNA markers

Alleles can be tested for linkage or association

Detect by Southern Blotting

Or PCR (useful for RFLPs involving insertions or deletions)

RFLP may cause defect such that individuals inheriting one allele will get disease, eg sickle-cell anaemia

Or RFLP linked to disease ie DNA containing RFLP on same chromosome eg X-linked muscular dystrophy

3.5.3 Neonatal Testing

Guthrie Test

Heel prick blood test

Test for PKU (Bacterial inhibition assay), CF (PCR and mutation analysis) and other

disorders

Early detection useful for prevention of eg mental retardation and genetic counselling

3.6 Treatment1. Dietary Exclusion

Eg. Phenylalanine in PKU

2. Dietary Addition

Eg. Uridine supplement in orotic-aciduria (abnormal pyrimidine metabolism)

3. Drug Avoidance

Eg. Glu-6P-DHase - antimalarial drugs & fava bean cause RBC haemolysis

4. Body Elimination

Eg. Haemochromatosis, iron accumulation --> heart, liver, pancreas disorders

Remove iron by venesection

5. Cofactor Supplementation

Eg. Enzyme error, increase cofactor eg B12, B6 cause enzyme to act normally

6. Enzyme Repression or Inhibition

Eg. Supply substrate stopping overproduction of metabolite by feedback inhibition

7. Replacement Therapy

Eg. Blood in Thalassaemia

Factor VIII in haemophilia, missing enzymes, hormones

8. Organ Transplantation

Eg. Cystic disease, kidney transplantation

9. Preventative Surgery

Eg. Removal of colon in hereditary colon cancer (during early stages)

10. Preventative Therapy

Eg. Anti-Rh antibody injection into Rh- mother after birth of 1st Rh+ child

Kills Rh+ blood cells before immune system is stimulated (injection decays before next pregnancy

Topic 4 DNA Technology

3.1 Recombinant Dna Technology Recombinant DNA refers to the joining of DNA molecules, usually from different biological sources, that are not found together in nature Recombinant DNA technology is used to isolate, replicate, and analyze genes The introduction of recombinant DNA technology has allowed genetic engineering

Basis is technology of making recombinant molecules

Inserting DNA into vector & making multiple copies, ie. Cloning

3.1.1 Cloning Steps1. Cut donor DNA

2. Cut vector DNA

3. Join fragments

4. Introduce into host

5. Screen for desired gene

3.2 Tools

3.2.1 Restriction Enzymes

Most useful enzyme for DNA work are Restriction Enzymes (RE)

also called restriction endonucleases

These are enzymes that cut DNA at specific nucleotide sequences

Act as means of removing foreign DNA in bacterial cells

Bacteria have a modification system that methylates own chromosomal DNA to stop RE digestion

3.2.2 Recognition sites Most recognition sequences exhibit a form of symmetry described as a palindrome, and restriction enzymes cut the DNA in a characteristic cleavage pattern.

palindromes, eg|

GAATTC

CTTAAG

| Mostly four to six nucleotides long

Some contain eight or more nucleotides Cut to give blunt or sticky ends

3.2.3 Other Enzymes1. DNA Ligase

Joins DNA molecules

2. Alkaline Phosphatase

Removes 5`-P, stops re-ligation

Useful after RE digestion to stop self-ligation

3. DNA Polymerase

Copies SS DNA to give DS DNA

4. Reverse Transcriptase

Makes DNA from RNA template

Useful for cDNA library construction

5. Terminal Transferase

Useful for 'tailing' DNA fragments ie attaching bases at 3`end to create sticky ends

3.3 Vectors Vectors are carrier DNA molecules that can replicate cloned DNA fragments in a host cell Wide variety generally derived from plasmids, phage

Many new artificial constructs

3.3.1 Desired Characteristics Capable of autonomous replication in host cell

Small size (usually 3-7kb) generally

Normally capable of amplifying cloned sequence

At least one unique RE site for insertion

Markers for easy identification & selection (Antibiotic resistance, colour, fluorescence)

Appropriate signals of expression desired (Colour, fluorescence, linked gene metabolism)

Vectors: Many Types Include:

1. Plasmids

2. Lambda Phage

3. Expression Vectors

4. Cosmids

5. Shuttle

6. YAC

Choice of vector depends on:

Type of experiment

Size of insert

Available RE sites

3.3.2 Plasmids

Small, circular, self-replicating

Extra chromosomal

1-many copies/cell (amplification)

Other genes for drug resistance = genetic markers

Most widely used are pBR322 & derivatives

An artificial construct

Inserts: up to 15kb (5-10kb stable inserts)

Select recombinants by insertion into antibiotic resistance gene

Eg. Cutting with PvuI or PstI, then will be tetracycline resistant but ampicillin sensitive

3.3.3 Bacteriophage Lambda ( )

E.coli virus

49 kb circular structure

Single RE insertion sites or double sites for replacement DNA

Most commonly used types are

gt10- all purpose vector

- if form plaques, recombinant

gt11 - expression system

- if insert --> hybrid gene, select by antibiotics

Inserts : 10-20 kb (50kb

2 origins of replication

ori - bacterial origin

ars - autonomous replicating sequence (yeast)

Other structural features

CEN - centromere sequences, attachment sites for spindle

TEL - telomere sequences for integrity of chromosome ends

Selectable markers

ampr (plasmid)

TRP1 URA3 [grow in TRP- (tryptophan) URA- (uracil) yeast host cell]

3.3.6 Expression Vectors

These contain promoters that allow expression of gene productsThese contain origins of replication, for replication in E. coli.Usually contain selectable markers to select transformants in bacteria (E.coli) (eg AmpR) and eukaryotic cells (G418/Neomycin).

Contain a multiple cloning site (MCS) downstream of the promoter to insert DNA to be expressed.3.4 Host Cells for Cloning

Bacterial cells

Yeast cells; grow like bacterial cells but eukaryote; can modify protein; genetics well known; safe for production of vaccines etc.

Plants

Insects

Human cell lines

3.5 Recombinant DNA Libraries Collection of cloned DNA sequences from a single source eg. Cell type, tissue type, individual

3.5.1 Library Construction

1. Cut source DNA

2. Select & cut vector

3. Ligate desired DNA into vector

4. Select recombinants

5. Screen for desired clone eg. probes

3.5.2Genomic vs cDNA Libraries Genomic - all DNA sequences from source, coding & non-coding

cDNA - only sequences used in making mRNA transcripts, therefore only coding DNA from source

For genomic libraries, tend to use partial digests to get overlapping fragments to get intact gene in at least some fragments

Also allows 'walking' to get to desired gene

To represent library fully better to insert into vector that can take bigger DNA fragments, that way less clones to screen for desired gene Eg. phage or cosmid rather than plasmid

3.5.3cDNA Library ConstructionIsolate mRNA

3.5.4Library Screening

Identify recombinant containing desired insert by hybridization to labelled SS probe

Probe may be partial sequence oligonucleotide or related sequence from similar species or related gene (eg pseudogene)

3.6 Molecular Genetic Techniques3.6.1PCR Polymerase Chain Reaction

Process for producing large amounts of a specific DNA fragments in vitro, enabling use of this DNA sequence for variety of experiments

Developed in 1983 by K.Mullins & F.Faloona - started use 1985-86

Requires

Template - DS DNA or RNA

2 oligoprimers (not complementary)

dNTPs, buffer, Mg2+ Taq Polymerase

NEED:

Sequence known at ends of region to be amplified

Sequence for amplification

PCR Method

----------------------

---------------------- DS DNA

denature, anneal oligoprimers

-----------------------

|||

|||

-----------------------

Taq Polymerase

-----------------------

|||

~~~~~~~~~~~~~~

|||

-----------------------

denature, anneal, Taq...

-----------------------

~~~~~~~~~~~~

-----------------------

4 DS DNA

-----------------------

~~~~~~~~~~~~~

-----------------------

... and so on (up to 30 cycles ~ 230)

PCR Points

Taq Polymerase

DNA Polymerase isolated from Thermus aquacticus Not denatured by heating to 90-95C

Optimum temperature 75C

Amplification Plateau

30-35 cycles

= 230-235 copies DNA sequence

No further amplification

Cycle - 3 steps

(i) Denaturing

DS DNA ---> SS DNA

95C, 30 secs

(ii) Annealing

Anneal primers to SS DNA

1 minute 37-65C

(iii) Extension

SS --> DS DNA

1 min; 60-72C

Taq Polymerase - allowed automation

Enzyme can be cooled repeatedly heated & cooled

High temperature optimum --> high stringency

Primers - not complementary

If were could hybridise to each other

PCR can be used to amplify genes or non-coding fragments

Eg. Detect insertion/deletion/mutation by PCR

Extract DNA, PCR

Run DNA on gel

Observe bands

Larger or smaller bands depending on size of DNA between primers

3.6.1Real-time PCR Allows quantification of gene expression

Several different types eg. RT-PCR or quantitative real-time PCR

In quantitative real-time PCR mRNA is converted to cDNA

Fluorescent dyes and probes are used which bind to the DNA between the primers; extension causes emission of light which is detected by a laser

Greater fluorescence = higher gene expression

3.6.2Electrophoresis of Nucleic Acids Gel electrophoresis is transfer through a porous gel or membrane under charge.

Submarine gel electrophoresis is conducted in a submerged gel (under buffer).

Capillary gel electrophoresis is conducted in a capillary

Separation of molecules based on size & charge (eg protein gel electrophoresis can also be performed)

Smallest fragments move farthest in the gel Fragments can be visualized when stained with ethidium bromide and illuminated by UV light Standard markers are used to determine size of unknown product.3.6.3Southern blotting

Named after Edward M. Southern Used to identify which clones in a library contain a given DNA sequence and to characterize the size of the fragments from restriction digest Transfer of DNA from gel to membrane (usually nylon and usually positively charged) Transfer occurs via i) electro-blotting; ii) vacuum and; iii) capillary RNA and protein can also be transferred from gel to membrane: referred to as Northern and Western Blotting respectively.3.6.4Microarrays

Function using the same systems as Southern Blot (Probe annealing) Chips or slides covered in fixed DNA/RNA probes Allows detection of concentration as well as presence of specific sequences. Recent advances in technology allow multiple millions of probes on a single chip.3.6.5FISH

Fluorescent in situ hybridization (FISH) involves hybridizing a probe directly to a chromosome or RNA without blotting FISH can be carried out with isolated chromosomes on a slide or in situ in tissue sections or entire organisms3.6.6DNA sequencing

DNA - obtain by cloning or PCR

NB: PCR more prone to error (4X more), therefore do not use PCR derived clone. Use direct PCR product to give mixture of errors

Sanger-(Dideoxy) Sequencing

SS DNA Pol I template

DNA Pol I to extend P32 primer

dNTPs plus ddNTPs

DideoxyNTPs do not form phosphodiester bonds, therefore stop chain

----> fragments of different lengths 4 reactions, 4 different ddNTPs

----> gel (polyacrylamide) + autoradiography

MOST COMMON

Animation at http://www.dnalc.org/resources/animations/sangerseq.html

Next Generation Sequencing

Often referred to as 454 Sequencing, or Ionic Sequencing

Relies on binding of PCR product/DNA fragment to a bead which can be isolated in a specific chamber.

Bound DNA to be sequenced is rendered single stranded prior to sequencing

Sample is then sequenced by sequentially adding one base and a DNA polymerase and detecting addition (or not) of specific bases.

Detection can be indirect, by detection of liberated ATP as in pyrosequencing, or direct, as in detection of H+ released by base addition, as in ionic sequencing.

Offers advantages in terms of throughput and ability to determine complex genotypes. Not currently common, but has potential to overtake Sanger Sequencing.

Topic 5 DNA Mutation

5.1 DNA Mutation

(Refer text chapter 15)

A mutation is an alteration in a DNA sequence.

Induced mutations result from the influence of an unrelated factor or agent, either natural or artificial.

Spontaneous mutations happen naturally and randomly, arising from replication errors and base modifications

Mutations can occur in any cell: various changes in phenotype ranging from minor to major changes

5.1.2 Spontaneous Mutations Mutations occur randomly but with characteristic rate depending on:

Gene

Organism

Mutations are not adaptive

Eg. Grow bacteria that are sensitive to antibiotic in antibiotic resistant bacteria

BUT replica plating showed that mutations already in these cells, ie. mutations random: Lederberg experiments Luria-Delbrck fluctuation test also showed that mutations are spontaneous Other examples: Insecticide resistance, antibiotic resistant bacteria, fungus resistant plants

5.1.3 Classifying Mutations Various ways to classify

By location

i) Germinal gametes, inherited

ii) Somatic other cells, not generally inherited

iii) Autosomal within genes on autosomes

iv) X-linked within genes on X chromosome

By molecular change

Frameshift mutation

Point mutation: nucleotide substitution

By phenotypic effects

Lethal mutations

Conditional mutations - phenotype changes, dependent on environment

eg temperature sensitive Siamese cats fur colouring

5.1.3.1 Point Mutations

Aka. Base substitutions Eg. An A substituted by a C

MAY be non-coding or coding, which may result in change in codon which may change an amino acid (missense mutation) or may not (silent mutation), OR lead to chain termination (nonsense mutation), if altered to UAA, UAG or UGA

Usually no physiological effect, but occasionally there may be

Eg 1. Haemoglobin Variants

DNA

GGACTCCTC

HbamRNA

CCUGAGGAG

- normal

Protein

ProGluGlu

DNA

GGA CACCTC

HbsmRNA

CCUGUGGAG

- has sickle-cell anaemia

Protein

ProValGlu

Eg 2. FOP Fibrodysplasia Ossificans ProgressivaTwo types of point mutations

(i) Transition

Pyrimidine pyrimidine

T C C T

Purine purine

G A A G

(ii) Transversion

Pyrimidine purine or vice versa

8 variations

Spontaneous mutations of this sort biased to transition because of 'wobble' ie 3rd nucleotide of codon can vary giving same amino acid & often transition mutation gives same amino acid = Silent Substitution5.1.3.2 Frame-Shift Mutation

Insertion or deletion of a nucleotide can major aa change

Through alteration of the reading frame

Eg. Deletion

she ca(n) scr eam lou dly she cas cre aml oud ly. Also possible, new aa is STOP codon short protein

Eg. Duchenne muscular dystrophy, ABO blood system

5.1.3.3 Mutation Types1. Silent - no change to aa sequence

2. Missense - substitution changed aa sequence eg. Achondroplasia

3. Nonsense - substitution Stop codon eg. Marfan syndrome

4. Addition/Deletion - add or remove one or more bases

Often occurs with short tandem repeats or runs of particular nucleotides eg. Cystic fibrosis

5. Frameshift - addition/deletion can change reading frame

6. Transposon Mutations - inserts into gene

7. Expansion of repeat sequences eg. Fragile X, Huntington Disease

Some diseases can arise from a large number of mutations

Eg. Beta thalassemia5.1.3.4 Bombay Phenotype

Affects inheritance of the ABO blood type A rare recessive mutation in the FUT1 (fucosyl transferase) gene, involved in synthesizing the H substance, prevents the addition of the terminal sugars of the A and B alleles Individuals are functionally and phenotypically Type O although genotype may be A/B 5.2 Processes DNA replication errors

Base mispairing Tautomeric shifts in nucleotides Depurination, deamination

Oxidative damage

Integration of transposons

5.2.1 TransPosable Elements Found in prokaryotes and eukaryotes

Jumping genes

Can create mutations or silence genes by insertion into functional genes or alter expression

Can trigger duplications, deletions or translocations

May be germ-line

Involved in human disease

5.3 Induced Mutations1) Base Analogs

Compounds similar to bases

Cause mutations because prone to mispairing

Eg. 5-bromouracil - T analog but can change to enol form & pair with G (instead of A) during replication

Next Replication GC formation

2) Alkylating Agents Add chemical groups to bases different pairing or base distortion Eg. Nitrosamines, nitrogen mustard, ethylmethane sulfonate (EMS)

3) Intercalating Agents

Ethidium bromide, Chemotherapeutic agents

Insert between adjacent bps

Misaligned template/daughter stands replicated DNA

Addition/deletion in daughter strands

3) Adduct forming agents

mutation-causing chemicals, bind to DNA and alter its conformation, thereby interfering with replication and repair

Acetaldehyde

Component of cigarette smoke

Heterocyclic amines (HCAs)

Cancer-causing chemicals created during cooking of meats (beef, chicken, and fish)

17 different HCAs linked to cancers of stomach, colon, and breast

4) UV (Ultra Violet)

UV dimer formation

Transcription + replication blocks

5.3.1 Radiation X-Rays - dental, medical

Alpha, beta, gamma rays - radioisotopes, fallout,

UV - lower energy, Sun

Ionizing Radiation

DNA Damage

SS break, sugar-P-backbone

DS break

Base alteration

Last two - most damaging

Also chromosome breaks in eukaryotes translocations, inversions, duplications, deletions

Amount of damage depends on:

i) Total Dose

Mutation rate directly proportional to dose received in DrosophilaR = Roentgen = units for exposure dose

ii) Dose-Rate

Same rate dose given quickly is more damaging than given slowly

Eg. Mice 90R/min - 4X more mutations as 90R/week for same total dose

Suggests some repair mechanisms

But no safe level, ie. threshold dose below which all damage repaired

Doubling Dose

Humans, 45R X-rays; doubles the mutation rate

1960 - chest X-ray : 0.1R

1980 - chest X-ray : 0.01R)

Tumour Therapy Rationale

Interphase cells less susceptible to chromosome break

Therefore cancer cells more mitosis

Therefore more lethal chromosome breakage induced by radiation5.3.2 DNA Polymorphisms

Normal variations in the genome

Defined as occurring in >1% of population

Arise point mutation

RFLPs : RE site

5.4 DNA Repair

DNA repair systems maintain the integrity of genetic material susceptible to spontaneous and induced damage, protecting against disease and cancer

5.4.1 Types of DNA Repair Systems

Different enzyme systems available for repair of specific errors. Not all available in humans.

Mismatch Repair

System for detecting & correcting after proofreading

Uses excision & resynthesis

Mismatched base detected

One strand cut

Region around mismatch excised

DNA Polymerase fills gap (uncut strand template)

DNA Ligase seals gap

In prokaryotes, when detect mismatch, enzymes preferentially cut undermethylated (=daughter) strand to remove error, therefore sometimes called methyl-directed mismatch repair (methylation slower than replication)

Error Rates Average

Replication-mismatch: 1 in 10E-5

ie. Mismatched base for each round of replication

Chance 1 in 10E-5 wrong

Proofreading - chance of not correcting: 1 in 10E-2

99% wrong corrected

Mismatch Repair - chance of not correcting: 1 in 10E-3

99.9% those remaining corrected

10E-5 * 10E-2 * 10E-3 = 10E-10 (chance that base not correct)

Post-Replication Repair

Responds after damaged DNA has escaped repair and failed to be completely replicated Recombinational Repair

Break in DS DNA

Rec A protein binds, initiates strand exchange with homologous DNA double recombination joint

DNA Pol I fills gaps

Recombination joints resolved

Recombination is so that each have one good strand

SOS Repair

Last resort

Extreme DNA damage gaps in DS DNA in both daughter strands

ie. Homologous chromosome damaged

Therefore no recombination repair SOS Repair

~ 20 SOS genes which insert bases into gaps without template therefore 3 out of 4 bases wrong

Extensive mutagenesis

Photoreactivation Repair

Light dependent Removes thymine dimers caused by UV light. The process depends on the activity of the photoreactivation enzyme called Photolyase

Photolyase captures energy from light and breaks covalent bonds between thymine dimers

Humans and other organisms lack photoreactivation repair

Excision Repair

Light independent

Exists in all prokaryotes and eukaryotes Damaged region cut out by nuclease, gap filled by DNA Pol & sealed by ligase

Base excision repair removes bases

Nucleotide excision repair (NER) removed bulky lesions

Human auto-recessive diseases that occur due to failure of NER pathway

1. Xeroderma pigmentosa

Lost ability to undergo NER

Affected individuals exhibit severe skin abnormalities, skin cancers, and a wide range of other symptoms, including developmental and neurological defects

2. Cockayne syndrome (CS)

Developmental and neurological defects, sunlight sensitivity, but no increase in cancers

Premature aging and death by age 20

3. Trichothiodystrophy (TTD)

Dwarfism, retardation, brittle hair and skin, facial deformities

Sensitivity to sunlight but no increase in cancers

Median life span of six years

Double Stranded Break Repair

Homologous recombinational repair

Occurs during the late S or early G2 phase of the cell cycle Exchange of chromosome parts due to breakage & reunion of intact double helices

Therefore 4 strands involved in cross-over with chiasma (cross-over points) visible before Metaphase I

Nonhomologous end joining is activated in G1

5.2 Mitochondrial DNA Mutation For a human disorder to be attributed to mitochondrial DNA,

the inheritance must exhibit a maternal inheritance pattern

the disorder must reflect a deficiency in the bioenergetic function of the organelle

there must be a specific mutation in a mitochondrial gene

Human mtDNA contains 16,569 base pairs coding for 13 of over 70 proteins required for aerobic cellular respiration

mtDNA is very susceptible to mutations

Doesn't have histones to protect from mutations

Mitochondria have high concentrations of reactive oxygen species (ROS) generated by cell respiration

ROS damages organelle contents (proteins, lipids, mtDNA) A zygote receives a large number of organelles through the egg; a mutation in one or a few will be diluted out by many mitochondria that lack the mutation and function normally

Heteroplasmy is the condition in which adult cells have a variable mixture of normal and abnormal organelles Two disorders arising from mtDNA are

Myoclonic epilepsy and ragged red fiber disease (MERRF) in which individuals express ataxia, deafness, dementia and seizures Leber's hereditary optic neuropathy (LHON) which is characterized by blindness Defective mtDNA is implicated in the aging process

5.5 Use of Mutation

5.5.1 Mutation Reversal

Wild mutant = forward mutation

Mutant wild = reversion

Basis of Ames Test to test mutagenicity of compounds

uses any of a dozen (mutated) strains of Salmonella typhimurium selected for their increased sensitivity to mutagens Therefore more lethal chromosome breakage induced by radiation

5.5.2 Forward Genetics

Mutants used to determine gene function

Mutagenise organism by mutagen such as chemical or transposon

Isolate mutant

Map loci

Eg. Use complementation analysis to determine if two mutations causing similar phenotype are in same geneTopic 6 Population Genetics

6.1 What is Population Genetics?

-Population genetics the study of genetic variation in groups of organisms

-Builds on Mendels findings of inheritance of traits in groups of pea plants due to genetic elements

-Involves study of genetic variation within and between groups to explain evolutionary forces eg. mutation, selection, migration, mixing

-Population genetics can help understand human disease patterns genetic epidemiology

6.2 Human Genetic Variation (the spice of life)

-Genetic variation is important to survival of species because it allows a population to respond to environmental change. Eg. Antibiotic and vaccine resistance

-Is the basis of Darwins theory of natural selection.

-Nb. Change in genetic variation over time is slow relative to social change and fast relative to geographic change

6.2.1 Genomic Variation Among Individuals

-Genomics is the study of an organisms entire hereditary information (DNA makeup)

-No 2 humans have exactly the same genomic makeup (except identical twins).

-On average the sequences of all human genomes are 99.9% the same

-This leaves only 0.1% of the genome for sequence variation among humans.

-0.1% of the genome = 3 million sites (loci).

-The variation at these 3 million loci contributes to variation in human traits (eg. appearance, disease susceptibility).

6.2.2 Relevance of Genomic Variation

-Understanding genomic variation in humans is important for researchers because;

-DNA variants form the direct basis of heritable traits.

-DNA variants can be used as informative markers in:

-Health and medicine

-Mapping genes for complex disease

-Predicting a patients response to medication

-Forensics science

-Individual identification

-Genetic Anthropology

-Human migration and evolution

6.2.3 Types of Genomic Variants

There are two main types:

1. Single base change events

-Mutations

-Single nucleotide polymorphisms (SNPs)

2. Insertion/deletion of segment of DNA

-Variable number tandem repeats (VNTR)

-Minisatellites (repeat units of 10 500 base pairs)

-Microsatellites (repeat units of 2 6 base pairs)

-Copy Number Variants (CNV)

-copies or deletions of large DNA fragments (>1000bp)6.2.3.1 DNA Sequence Variants (aka Polymorphisms)

-There are different categories of DNA sequence variations:

-Single nucleotide polymorphisms (SNPs)

agcttctatct

agcttctctct

-Short Tandom Repeat polymorphisms (STRs)

agtctctctctctctctctctctctatacg (CT)11

agtctctctctctctctctatacg (CT)8

-Copy Number Variants (CNVs)

cattcaaaggagaaaggagaggtctc

cattcaaaggagaggtctc

>Single Nucleotide Polymorphisms (SNiPs)

-Usually defined as having a minor allele frequency > 0.01 (1%) in a population

-Most common DNA variants by far!

-Over 2 million have been identified to date.

-In the human genome there is on average 1 SNP every 100 - 300 bp

-Useful for disease gene mapping in human populations.

>Types of SNPs

-Anonymous SNPs SNPs that have no known effect on gene function. These are valuable as markers only.

-Coding SNPs (cSNPs) SNPs present in the gene coding region of the chromosome.

-These may represent disease causing variants.

Non-synonymous SNPs SNP results in a different amino acid (most likely to be functional)

Synonymous SNPs SNP does not result in an amino acid change.

-SNPs are preferred for population genetic analysis over other types of markers because:

-SNPs are most abundant genetic marker (polymorphism) in the human genome and provide the best genome coverage-Modern SNP chip technology allows rapid and inexpensive genotyping

-Most SNPs are biallelic which makes statistical analysis more tractable

>Short Tandem Repeats (Microsatellites)

-Hypervariable = highly polymorphic due to high mutation rate.

-Up to 40 repeat variations for one locus!

-Spaced approx. 1 every Mb (1,000,000 bases) in the genome

>Copy Number Variants (CNVs)

-Gains or losses (insertions or deletions) of large segments of DNA 1000bp 5million bps

-Can include whole genes and therefore can cause pathology and human disease

-About 2000 CNVs currently known and may be 100s more!

6.4 Genetic Marker Maps

-Useful for mapping position of genes.

-Useful for disease gene mapping.

-Three main types

i) Cytogenetic Maps (Chromosomal position indicated by cell staining bands)

ii) Genetic Map (Distance in Centimorgans)

ii) Physical Map (Distance in base pairs)

Rule of thumb 1cM ~ 1Mb

6.4.1 Genome Map of CNVs

-Genomic Variation Databases

-Mutation (Disease) Databases

OMIM www.ncbi.nlm.nih.gov/Omim/

HGMD www.hgmd.org

HUGO www.genomic.unimelb.edu.au/mdi

-SNP Databases

dbSNP www.ncbi.nlm.nih.gov/SNP

TSC www.snp.cshl.org

-CNV Database

TCAG http://projects.tcag.ca/variation/

-Microsatellite Databases

GDB www.gdb.org

Marshfield maps www.reseach.marshfieldclinic.org

6.5 Genotype and Allele Frequency Analysis

-Understanding human genomic variation relies on genotype and allele frequency analysis of polymorphisms.

-Allele = different versions of a genetic locus or DNA sequence variant (A or a)

-Diploid individuals (humans) have 2 possible alleles

homozygotes = same 2 alleles (AA or aa)

heterozygotes = 2 different alleles (Aa)

-Genotype frequencies = proportion of individuals in the population having a particular genotype

-Allele frequencies = proportion of alleles in the population

6.6 Probability and Genetics

-Analysis of allele and genotype frequencies relies on probability laws

-Probability is the chance of an event occurring and values range from 0 1

-Probability of first child being a boy is 0.5

-Prob of 2 boys is 0.5 * 0.5 = 0.25 (events are independent product law)

-Prob of 2 boys or 2 girls is 0.25 + 0.25 = 0.5 (events mutually exclusive sum law)

6.6.1 Probability and Alleles

-In terms of allele frequencies probability that siblings will inherit identical alleles from parents is independent, therefore multiply probabilities.

-Probability of one child inheriting a disease allele is 0.5 or 50% chance.

-Probability of 3 children inheriting same disease allele is;

(0.5)3 = 0.125 (or 12.5% chance)

-Probability of 4 children inheriting same disease allele is;

(0.5)4 = 0.0625 (or 6.25% chance)

6.6.2 Calculating Genotype and Allele Frequencies

6.7 Allele Frequencies Vary Among Populations-In population genetics a population is a group of individuals defined by some characteristic.

-Group thought to share a common set of genes (alleles)

-Allele frequencies vary in space and time because of evolutionary forces;

-a new mutation arises spontaneously

-selection occurs when one allele is advantaged (or disadvantaged) in particular ironment

-migration among individuals occurs through separation and mixing of individuals

-new populations grow out of a small number of founders (genetic drift)

-Analysis of allele frequencies helps understand these evolutionary forces and population histories.

6.8 Relationship between allele and genotype frequencies -Theoretical relationship between the proportion of alleles and frequency of genotypes was described in 1900s by Hardy and Weinberg.

-Hardy-Weinberg Law is a mathematical equation for predicting genotype frequencies from allele frequencies in an ideal population.

-infinitely large

-not subject to evolutionary forces

-random mating6.8.1 What is Hardy-Weinberg Law?-Based on probability and binomial expansion rules (see chapter 3)

-For a polymorphism with 2 alleles (A and a)

-Frequency of allele A or f(A) = p

-Frequency of allele a or f(a) = q

p + q = 1 (p+q)2=1-Hardy-Weinberg Law = p2 + 2pq + q26.8.2 Hardy-Weinberg Equilibrium (HWE)-Hardy-Weinberg Equilibrium: p2 + 2pq + q2 = 1

-HWE exists when allele frequencies remain constant from generation to generation but only under ideal circumstances

-no mutation, selection, migration and large random mating population

-In reality no population meets the HWE assumptions perfectly but most human populations do not deviate significantly from the model6.8.3 Use of Hardy-Weinberg Law

Eg. Albinism is a recessive disorder affecting 1/20000 individuals. What is the frequency of carriers?

-Hardy-Weinberg Equilibrium: p2 + 2pq + q2 = 1where,

p2 = normal genotype (AA)

2pq = carrier genotype (Aa)

q2 = albino genotype (aa) = 1/20000 = 0.00005

-If q2 = 0.00005 then q = 0.007

-If q = 0.007 then p = 1 0.007 = 0.993

-Therefore carrier frequency = 2(0.993*0.007) = 0.014

-Therefore 1.5% of population are carriers (~1/70 people)6.9 Haplotypes analysis is also important in population genetics-A haplotype is a sequence of SNP alleles stretching along an extended segment of DNA essentially a super allele!

-Haplotypes are usually inherited as a single unit from parents ie. same as alleles!

Of course recombination can happen. Haplotype distribution represents the final product of natural selection. 6.9.1 Association Among Adjacent SNPs in a Population-If SNPs are close together in the genome alleles will tend to be inherited together as haplotypes more often then for SNPs that are further apart.

-Why? less chance that recombination will separate the alleles of SNPs that are close together ie. break up haplotypes!

-Association of SNPs that are physically close together (ie. alleles on same haplotype) is called linkage disequilibrium (LD)

Some Practice Questions-Why study the genetics of populations? give some reasons

-Why is genomic variation important in nature?

-What is the most common type of DNA sequence variant?

-Why do geneticists favour SNPs over STRs? 2 main reasons

-Name and describe a type of genetic marker map

-What is the general purpose of a genetic marker map?

-What is the probability that a couple will have 2 boys and a girl?

-What is a CNV?

-Name 3 evolutionary forces that can cause allele frequencies in a population to change

-What is the Hardy-Weinberg Law (understand concept, equation and application)

-What part of the law corresponds to the frequency of heterozygotes in a population?

-HWE is based on binomial expansion rules (T/F)

-Try doing Problems in the text book

-Define haplotype and linkage disequilibrium

Topic 7 Genetic Epidemiology and Multifactorial Traits

Genetic epidemiology7.1 What is Genetic Epidemiology?

-Epidemiology

-the study of the distribution and determinants of disease in populations.

-Genetic Epidemiology

-The epidemiology of diseases with an inherited (genetic) component.

-Involves surveying the genome!

7.2 DNA Sequence Variations

-There are different categories of DNA sequence variations;

-Single nucleotide polymorphisms (SNiPs)

agcttctatct

agcttctctct

-Simple Tandom Repeat Polymorphisms (STRs)

agtctctctctctctctctctctctatacg (CT)11

agtctctctctctctctctatacg (CT)8

-Insertions/Deletions (indels)

cattcaaaggagaggtctc

cattcaggtctc

7.3 Disease Complexity

-Simple Disorders

-exhibit predictable inheritance patterns Mendelian!

-Usually due to single gene mutations

-rare eg. Cystic fibrosis, sickle cell anemia

-Complex disease

-disease does not exhibit classical Mendelian patterns of inheritance.

-ie. genotype/phenotype correspondence breaks down

-Due to multiple factors (genetic and environmental)

-ie. multifactorial traits

7.4 Factors Complicating Disease Inheritance in Humans

-Incomplete penetrance individual inherits disease gene but does not develop disease

-Phenocopy individual has disease but does not have disease gene (environmental factors)

-Genetic heterogeneity different genes (or alleles) influence same disease trait

-Genetic Interaction multiple genes join forces to influence the disease (epistasis)

-Other transmission mechanisms mitochondrial inheritance and genetic imprinting

7.5 Types of Complex traits

-Continuous Traits eg. measurements such as height, BMI, bp

-follow a distribution with statistical mean and variance parameters

-Discrete Traits

-categorical (meristic) eg. mole count

- threshold eg. Obesity

7.6 How do we know a disease has a genetic component?

-Observation - the disease tends to run in families ie. familial clustering!

-However, this alone is not enough to conclude that genetic factors are involved!

7.6.1 Scientific ways of Determining Genetic Involvement in Disease

-Calculating risk to relatives

-Twin/adoption studies

-Calculating Heritability

7.6.1.1 Relative Risk ()

-The magnitude of = degree of familial clustering of disease indicating genetic component

-Identifying genetic components of disease is much easier for traits with high values of .7.6.1.2 Heritability

-How can we quantify the relative contributions of genetics and environment for a complex disease?

-Use a measurement called heritability (H)

-H estimates the % of the phenotypic variation for a trait that is due to genes

-Calculating heritability relies on genetic model

7.6.1.3 Phenotypic Variance and the Genetic Model

-Mathematical model describing the relationship among factors that explain variation in the phenotype ie. variance components

-VPhenotype = VGenotype + VEnvironment + VG*E

-Heritability relates to quantifying V of genetic factors

-2 types of heritability

-Broad Sense (H2)

-Narrow Sense (H)

-Broad Sense Heritability (H2)

-measures contribution of genetic variance (factors) to phenotypic (trait) variance

H2 = VG/VP

-Narrow Sense Heritability (H)

-more specifically measures contribution of additive action of different alleles (additive variance - VA)

-VA - thought to be largest main source of genetic variance; others are dominance variance (VD) and interactive variance (VI)

-VG = VA + VD + VI

-So Narrow Sense heritability, H = VA/VP

7.6.1.4 Twin/Adoption Studies

-Measurements of heritability rely on studies of families, especially twins

-Can discriminate between genetic or environmental influences on disease traits

-Adoption studies have shown that the risk of an adoptee having a disease depends more on biological parents

-Twin studies comparing MZ and DZ twins may show increased similarity rates of disease (concordance) in MZ over DZ twins indicating genetic involvement.

Twin Studies (see page 678)

-Monozygotic (MZ) twins derive from single egg and have identical genotypic make up. ie share 100% of genome

-Dizygotic (DZ) twins have separate eggs and share about 50% of genome

-The differences in disease concordance values between MZ and DZ twins can be used to estimate heritability and whether or not a disease has a strong genetic component.

7.7 Genetic Epidemiology

- The epidemiology of diseases with an inherited (genetic) component.

-Involves surveying the genome!

7.7.1 Research Approaches in Genetic Epidemiology

1. Candidate gene targeting

-Involves targeting specific DNA variants within genes of suspected physiological importance

-Requires knowledge of disease pathophysiology!

2. Genome Scanning or Mapping

-Utilises adjacent DNA markers in the genome to indicate a region harboring a disease gene

-Does not require knowledge of disease pathophysiology! A nave/unsupervised approach!

7.7.2 Study Designs in Genetic Epidemiology

1 Association Studies Tests for associations between DNA markers and disease traits in unrelated population groups..

2. Linkage Studies tests for co-inheritance of DNA markers and disease traits in affected pedigrees7.7.2.1 Association Studies

-Disease-marker association exists when alleles at the marker locus occur with different relative frequencies in affected and unaffected (control) patient groups:

-nb see lecture notes for more detail about study design as well as examples

What about gene-gene interactions

-Typically genetic association studies have focused on only one gene (variant) at a time.

-For complex diseases any single gene (variant) is only likely to confer a relatively small effect on the trait ie. has minor clinical importance

-The combined effect of multiple genes is more likely to be more important medically.

-Therefore, strategies are required that consider gene-gene interactions

Genome-Wide Association Scans

-Useful when;

-family (inheritance) information is not available eg. DNA banks, adult onset disorders (usually more common)

-Focuses on unrelated population groups not pedigrees!

-Useful for finding multiple genes each having a small impact on disease (low penetrance!)

-Eg. diseases include type 2 diabetes, Crohns Disease, schizophrenia, breast cancer, migraine

-Most popular approach these days because of SNP genotyping technology

GWAS are based on DNA markers called Single Nucleotide Polymorphisms (SNPs)

7.7.2.2 Genetic Association Study Design

-To perform GWAS it is estimated that ~500,000 DNA markers (SNPs) spanning the genome require genotyping.

-1000 cases and 1000 controls may be needed to find low penetrance genes in GWAS

1 billion genotypes!

-Cost of Genome-wide Association studies?

7.7.2.3 What do we do when we find the genes?

1. Understand the genetic mechanisms that cause the disease pathology.

2. Determine the strength of disease gene association ie. How well does genotype predict disease phenotype?

3. Determine how the disease gene association is modified by non-genetic (environmental) factors (ie. gene-by-environment interaction).

Some Practice Questions

-Definitions of epidemiology

-Compare and contrast simple vs complex disease

-Know the factors that complicate disease inheritance

-Understand section on heritability

-What are the 2 main approaches to mapping genes and what is the difference?

-What is the definition of association in genetic epidemiology?

-Understand case-control analysis strategy including testing for genotype/phenotype association using chi-squared test.

-What has happened to facilitate the whole genome association scanning approach?

-What do we do when we find disease genes?Topic 8 Epigenetics

8.1Definitions Epigenetics is the study of gene expression changes that do not involve changes to the DNA sequence

Epigenetic traits are stably inherited phenotypes that are transmitted via mitosis and meiosis The epigenome is the cell specific epigenetic state of a cell which can be modified throughout an organisms lifetime

8.1.1Epigenetic Pathways Three categories of pathways that establish and maintain epigenetic state1. Epigenators: environmental signals that stimulate an intracellular pathway 2. Epigenetic initiators: produce the response to the epiginator signals and define the location - include DNA binding proteins, non-coding RNAs and protein-protein signal transduction pathways3. Maintainers: maintain the response once the modifications have occurred include DNA methylases, histone acetylases and deacetylases

8.2Epigenetic Mechanisms8.2.1Methylation The reversible modification of DNA by the addition or removal of methyl groups

In mammals, methylation of DNA takes place after replication and during differentiation of adult cells

Methylation involves the addition of a methyl group catalysed by methyltransferase enzymes

This occurs on cytosine bases adjacent to guanine called CpG dinucleotides, which are clustered in regions called CpG islands

CpG islands are located in and near promoter sequences adjacent to genes Unmethylated CpG islands adjacent to essential genes (housekeeping genes) and cell-specific genes are available for transcription Other genes with adjacent methylated CpG islands are transcriptionally silenced The bulk of methylated CpG dinucleotides are found in repetitive DNA sequences located in heterochromatic regions of the genome including the centromere

Heterochromatic methylation also maintains chromosome stability by preventing translocation and other chromosomal abnormalities8.2.2X Inactivation One of the X chromosomes in each somatic cell of mammalian females is inactivated by converting them into heterochromatin with altered patterns of methylation This provides dosage compensation for X chromosome genes

Dr Mary Lyon proposed X-inactivation ie. Lyonization in the 1960s

An essential element of Lyon's hypothesis was the random nature of the inactivation process Signal from X inactivation centre (XIC) at Xq13 causes inactivation Gene called XIST within XIC coats inactive X8.2.3Histone modificat ion Chromatin is composed of DNA wound around an octamer of histone proteins to form nucleosomes

Amino acids in the N-terminal region of the histones can be covalently modified by acetylation, methylation, and phosphorylation Modifications occurs at conserved amino acid sequences in the N-terminal histone tails, which protrude from the nucleosome

Chemical modification of histones alters the structure of chromatin, making genes accessible or inaccessible for transcription Acetylation by histone acetyltransferase (HAT) opens up the chromatin structure, making genes available for transcription

Removal of the acetyl groups by histone deacetylase (HDAC) closes the configuration, silencing genes by making them unavailable

The sum of the complex patterns and interactions of histone modifications that change chromatin organization and gene expression is called the histone code

8.2.4Small non-coding RNAs (siRNAs) siRNAs also participate in epigenetic regulation of gene expression

After transcription, siRNAs associate with protein complexes to form RNA-induced silencing complexes (RISCs) siRNAs can silence genes by interfering with transcription initiation

siRNAs complementary to promoter regions bind to a promoter that blocks the assembly of preinitiation complex by preventing the binding of transcription factor TFIIB and RNA polymerase

Short RNA molecules can also associate with protein complexes to form RNA-induced transcriptional silencing (RITS) complexes

RITS complexes initiate formation of facultative heterochromatin that silences genes located within these newly created heterochromatic regions

This is reversible and can be converted to euchromatin, which is accessible for transcription.

8.3Epigenetics and Imprinting Genomic imprinting in mammals results in the expression of the alleles of a given gene being dependent on their parental origin ie. some genes are turned on (active) only on the copy that is inherited from a person's father while others are active only on the copy from the persons mother. This parent-specific gene activation is caused by a phenomenon called genomic imprinting. DNA methylation is a key mechanism of imprinting

Imprinted genes play major roles in controlling growth during embryonic and prenatal development IGF2 gene encoding the insulin-like growth factor-2 is an example of an imprinted gene In humans (and other mammals like mice and pigs) the IGF2 allele inherited from the father (paternal) is expressed; the allele inherited from the mother is not.

If both alleles should begin to be expressed in a cell, that cell may develop into a cancerous cell. Most human disorders associated with imprinting have their origins during foetal growth and development eg.

Prader-Willi syndrome occurs due to loss of function of genes in a particular region of chromosome 15, which are expressed only in the paternal allele. Common characteristics include abnormal growth and body composition (small stature, very low lean body mass, and early-onset childhood obesity), hypotonia (weak muscles) at birth, insatiable hunger, extreme obesity, and intellectual disability. Angelmans syndrome occurs due to loss of function of genes in a particular region of chromosome 15, which are expressed only in the maternal allele. It is characterized by developmental disabilities, seizures, speech deficits, and motor oddities.

Beckwith-Weidmann syndrome is caused by altered methylation of the regulatory regions of genes involved in abnormal growth such as IGF2. Common characteristics include enlargement of some organs and tissues, large prominent eyes, large tongue, seizures. External or internal factors that disturb the epigenetic pattern of imprinting or the expression of imprinted genes can have serious phenotypic consequences

In vitro fertilization (IVF) in humans can cause problems with imprinted genes.

Children born after IVF and other ART procedures are at risk of have very low birth weight and have an increased risk of Angelmans syndrome and Beckwith-Weidmann syndrome8.3.1 Uniparental Disomy Uniparental disomy (UPD) occurs when an individual receives both copies of a chromosome from one parent only

Problems occur when the chromosome involved in the UPD is imprinted8.4Epigenetics and Cancer Hypomethylation is a property of all cancers examined to date

For some complex diseases, there are strong links to some environmental factors, such as smoking and lung cancer

In the 1980s Feinberg and Vogelstein observed that colon cancer cells had much lower levels of methylation than normal cells derived from the same tissue

The epigenetic states of normal cells are greatly altered in cancer cells, and other epigenetic changes, including selective hypermethylation and gene silencing, are also present in cancer cells

Cancer is now viewed as a disease that involves both epigenetic and genetic changes that lead to alterations in gene expression DNA hypomethylation reverses the inactivation of genes, leading to unrestricted transcription of many gene sets including oncogenes

While hypomethylation is a hallmark of cancer cells, hypermethylation at CpG islands and inactivation of certain genes, including tumour-suppressor genes are also found in many cancers

BRCA 1 is hypermethylated and inactivated in breast cancer and ovarian cancer

The combination of mutation and hypermethylation occurs in familial forms of cancer eg. CDKN2A mutation in bladder cancer Cancer cells also show disrupted histone modification profiles

Mutations in genes encoding members of the histone-modifying proteins histone acetyltransferase (HAT) and histone deacetylase (HDAC) are linked to the development of cancer eg. Rubenstein-Taybi syndrome8.4.1Stem Cells in cancer Since methylation patterns occur very early in the transformation process, it was proposed that initiating epigenetic changes leading to cancer may occur in stem cells residing in normal tissue

Three lines of evidence support stem cell involvement in epigenetic changes

1st: Epigenetic changes can replace mutation in silencing individual tumour suppressor genes or activating oncogenes.

2nd: Global hypomethylation may cause genome instability and the large-scale changes characteristic of cancer.

3rd: Epigenetic modifications are more effective than mutations in transforming normal cells into malignant cells

The focus of epigenetic therapy is the reactivation of genes that have been silenced by methylation or histone modification

The FDA in the USA has approved a drug (decitabine, marketed as Vidaza) for treatment of acute myeloid leukemia and myelodysplastic syndrome, a precursor to leukemia. It is a hypomethylating drug.8.5Epigenetics and Behaviour Epigenetic changes, including alterations of methylation patterns, and histone modification may be important components of behavioural phenotypes

In mice, two regions of the brain show preferential expression of parental genes

Parent-of-origin effects have been shown in more than 800 genes, supporting the idea that imprinting in different regions of the brain may represent a major form of epigenetic regulation

In humans, epigenetic changes have been documented in the progression of neurodegenerative disorders and neuropsychiatric diseases with altered behavioural phenotypes eg. Alzheimer disease, Parkinson's disease, Huntington Disease, schizophrenia, and bipolar disorder

A controversial theory related to epigenomics concerns the idea that epigenetic alterations linked to environmental signals during development or early in life influence behaviour (and physical health) later in adult life

Several experiments showed that behavioural changes were mediated by epigenetic methylation of DNA and modification of histones that alter chromatin configuration leading to altered levels of gene expression

Environments experienced by pregnant animals or newborns affected the behaviour and health of the offspring as adults.

8.6 Epigenetics and the Environment Environmental agents including nutrition, chemicals, and physical factors such as temperature can alter gene expression by affecting the epigenetic state of the genome

The clearest evidence for the role of environmental factors comes from studies in experimental animals8.6.1Diet

A reduced protein diet fed to rats during pregnancy results in permanent changes in the expression of several genes in the F1 and F2 offspring eg Agouti In rodents, unmethylated agouti gene = yellow coat colour, obese and prone to diabetes and cancer, methylated agouti = brown coat and low disease risk

Obese yellow mice and normal brown mice are genetically identical but the yellow mice have an epigenetic "mutation. ie. epimutation Rodents studies show that exposure to chemicals such as BPA can also hypomethylate the agouti gene and cause the yellow obese phenotype

These finding have applications to epigenetic diseases in humans

Risk of colorectal cancer is linked directly to folate dietary deficiency and activity differences in enzymes leading to the synthesis of methyl donors Women pregnant during the 19441945 Dutch Hunger Winter famine in the Netherlands had children with increased risk of obesity, diabetes, and coronary heart disease Hypomethylation of the imprinted IGF2 gene was seen in children exposed in utero during the Dutch Hunger Winter compared with unexposed same-sex siblings. The researchers also found that IGF2 was hypomethylated in individuals whose mothers were periconceptually exposed to famine, whereas other genes including leptin were hypermethylated. The F2 generation also had abnormal patterns of weight gain and growth Paternal diet can also cause an effect. Study on an isolated Swedish community from 1799 onwards based on annual harvests showed that food abundance during SGP (slow growth period prior to puberty) was associated with a shortened lifespan while scarcity of food was associated with an extended survival of grandchildren

In animal studies epigenetic regulation has been shown to be induced by both maternal under- and over-nutrition within genes that control lipid and carbohydrate metabolism and within genes involved in the central appetiteenergy balance neural network. In many cases, the epigenetic status of the same genes is altered both by maternal under- and over-nutrition, although the direction of the epigenetic change is different. Several projects are now focussing on how epigenetic mechanisms can impact health and control disease processes. Eg. The NIH Roadmap Epigenomics ProjectTopic 9 Biotechnology

9.1Biotechnology Using living organisms to create products to enhance quality of life

Relies on genetic engineering ie. recombinant DNA technology, cloning, genomics techniques

Has potential to address global problems ie. health issues, food shortage BUT

Raises ethical, social, economic questions

9.1.1Recombinant DNA Technology

Creates artificial DNA molecules from different sources

May be from different species

Several techniques used to introduce foreign DNA into host genomes

1. Drosophila

Mobile transposon termed the P element,

P element transposons

Central region coding for transposase with flanking 31bp IR

Transposase section deleted, DNA fragment of interest inserted & injected into germ cells, along with intact P element (making transposase) as helper 2. Mammals

Usually use retroviral vectors

Inject vector DNA into fertilized egg

Transfer egg to mother for development

Retroviral vector

RNA code for reverse transcriptase that converts to DS DNA & inserts into host genome Transgenic animals

BUT disadvantages.

Random insertion

Can inactivation of genes

Need inducible promoter to switch on

Prone to rearrangement & deletions

May infect other cells

Other individuals not in need of therapy Alternatively, alter embryonic stem cells (cells in blastocyst) in culture by mutating or introduce vector, microinject, into blastocyst involved in germ line

3. Plant Transformation

Plasmid - large Ti (200kb)

Contains a transposable element

T DNA element (30kb)

Flanked by 25bp IRs

Plasmid found in soil bacteria: Agrobacterium tumefaciens Infects susceptible plants (most common flowering plants 160,000 species)

Tumours at entry site (usually a wound)

T DNA - codes for protein, stimulating division of infected cells tumours

Transposase function in plasmid DNA (not T DNA directly). Plasmid transposase inserts T DNA into plant genome

Can modify to remove tumour genes and add other genes eg. herbicide resistance

4. Site-Directed Eukaryotic Transformation

Early site-directed systems used mutating chemicals favouring rough areas of DNA

Were random, but useful when specific results not required

More modern system uses zinc finger nucleases (ZFNs)

Zinc finger nucleases are themselves recombinant proteins made up of:

Zinc-finger domains (specific sequence recognition)

Restriction domain (e.g. FokI)

ZFNs are used in pairs to improve specificity

May be directly inserted into target cell or transiently expressed via plasmid

When bound to target sequence, restriction domain causes a double strand break

Cell activates recombination based repair to replace damaged region with alternative copy

Addition of desired alternative sequence in high concentration facilitates production of specific alteration.

Can include significant insertion of sequence to make fusion genes, as well as to delete genes or effect single nucleotide changes in a permanent manner.

Therefore has utility in a broad range of genetic engineering applications Overcomes many of the problems associated with viral vectors. BUT -

May also result in non-homologous end-join repair

Gene deletion

Oncogenic (cancer causing) fusion genes

May cause apoptosis

Needs selection to identify properly modified cells

Delivery to host cells in vivo difficult

Currently still quite expensive9.1.2Genetic Engineering: Applications Research

Isolate gene

Study gene regulation, development, function

Eg. HPRT deficient mice model for Lesch-Nyhan,

Also mouse models for cystic fibrosis, Duchene Muscular Dystrophy

Gene knockouts: yeast, drosophila, mice

Knockout gene in mouse cells, insert into blastocyst with different coat colour, mate to establish homozygous knockout

Production

Of particular proteins

Biochemicals, enzymes, drugs,