MITOCHONDRIAL OXIDATIVE METABOLISM IN NONALCOHOLIC FATTY LIVER DISEASE (NAFLD)

By

KAITLYN ABDO

A THESIS PRESENTED TO THE GRADUATE SCHOOL

OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2017

© 2017 Kaitlyn Abdo

To my mother, for always standing by me through the good times and the bad, and to my brother, for rolling with the punches

4

ACKNOWLEDGMENTS

I thank my family for their support, and my amazing coworkers and mentor. For

without them, I would not have accomplished this great feat. My father was my greatest

inspiration, and my mother my strongest level of support. Support for this work was

provided by Dr. Cusi’s ongoing Endocrine, Diabetes and Metabolism research program.

I would like to thank Dr. Sunny for experimental design and implementation of the

jugular catheters. Srilaxmi Kalavalapalli was instrumental in conducting and analyzing

the insulin assay. Furthermore, I would like to acknowledge Gabriel Fernandez from Dr.

Clayton Matthew’s lab for his expertise in mitochondrial respiration and ROS assays,

and Dr. Matthew Merritt for utilization of the Oroboros O2K system. I would also like to

acknowledge the University of Florida Molecular Pathology Core for work done on

histology.

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS .................................................................................................. 4

LIST OF FIGURES .......................................................................................................... 8

LIST OF ABBREVIATIONS ........................................................................................... 10

ABSTRACT ................................................................................................................... 12

CHAPTER

1 GENERAL OVERVIEW OF NONALCOHOLIC FATTY LIVER DISEASE ............... 14

Why Study NAFLD: Biological and Clinical Relevance of Studying NAFLD............ 14 Progression of NAFLD to NASH ............................................................................. 15

The Pathophysiology of NAFLD .............................................................................. 15 Hepatic Insulin Resistance in NAFLD ..................................................................... 16 Mitochondrial Dysfunction and Inflexibility .............................................................. 18

Overall Hypothesis .................................................................................................. 19

2 ESTABLISHMENT OF AN IN VITRO MODEL SYSTEM TO PROBE MITOCHONDRIAL ALTERATIONS IN EARLY STAGES OF NAFLD..................... 24

Materials and Methods............................................................................................ 24

Chemicals ......................................................................................................... 24 Animal Studies ................................................................................................. 24

Primary Hepatocyte Isolation ............................................................................ 24 Mitochondrial Respiration ................................................................................. 25 Mitochondrial ROS Production ......................................................................... 26

Histology ........................................................................................................... 26 Western Blotting for Protein Expression ........................................................... 27 Gene Expression Analysis ................................................................................ 27

Biochemical Measurements ............................................................................. 27 Targeted Metabolomics .................................................................................... 28 Statistics ........................................................................................................... 28

Results .................................................................................................................... 28 Hepatocytes of Mice Fed a High Fructose Diet Develop NAFLD at 4 Weeks .. 28

Protein and Gene Expression Show Insulin Resistance and Increased Mitochondrial Function at 4 Weeks of Feeding ............................................. 29

Mitochondrial Respiration and ROS Production is Elevated in TFD Mice at 4 Weeks ........................................................................................................... 31

3 INTRALIPID CHALLENGE SHOWS COMPLETE MITOCHONDRIAL DYSFUNCTION IN MOUSE MODEL OF NASH ..................................................... 39

6

Materials and Methods............................................................................................ 39

Chemicals ......................................................................................................... 39

Animal Studies ................................................................................................. 39 Histology ........................................................................................................... 39 Jugular Vein Catherization ............................................................................... 40 Intralipid Infusion .............................................................................................. 40 Preliminary Data for Intralipid Infusion Rate ..................................................... 41

Intralipid Infusion Analysis ................................................................................ 41 Western Blotting for Protein Expression ........................................................... 41 Gene Expression Analysis ................................................................................ 41 Biochemical Measurements ............................................................................. 42 Targeted Metabolomics .................................................................................... 42

Statistics ........................................................................................................... 42

Results .................................................................................................................... 43 C57BL/6J Mice Develop NASH at 24 Weeks of High Fructose High trans-

Fat Feeding ................................................................................................... 43

Mitochondria are Dysfunctional in Mouse Model of NASH ............................... 43 NASH Mice Exhibit Severe Insulin Resistance ................................................. 44

4 DISCUSSION ......................................................................................................... 53

APPENDIX: SUPPLEMENTARY FIGURES .................................................................. 58

LIST OF REFERENCES ............................................................................................... 64

BIOGRAPHICAL SKETCH ............................................................................................ 69

7

LIST OF TABLES

Table page 2-1 Expression of genes related to mitochondrial metabolism and inflammation

markers in primary isolated hepatocytes of C57BL/6J mice fed on a control diet or a high fructose high trans-fat diet (TFD) for 4 weeks.. ............................. 35

3-1 Clinical and metabolic parameters from biological samples of C57BL/6J control and TFD fed mice when challenged with a five-hour glycerol or Intralipid infusion.. ............................................................................................... 47

3-2 Expression of genes related to mitochondrial metabolism and inflammation markers in liver homogenates of C57BL/6J mice fed on a control diet or a high fructose, high trans-fat diet (TFD) for 24 weeks.. ........................................ 50

A-1 Primer sequences for genes analyzed with qPCR for isolated hepatocytes and liver homogenates. ...................................................................................... 59

8

LIST OF FIGURES

Figure page 1-1 Fatty liver disease progresses to steatohepatitis.. .............................................. 21

1-2 Fat accumulation occurs in insulin resistant liver with NAFLD. ........................... 22

1-3 Hepatic insulin resistance and dyslipidemia in NAFLD. ...................................... 23

2-1 Histology of C57BL/6J mice fed on a control or TFD diet for 4 weeks.. .............. 32

2-2 Metabolic changes in C57BL/6J primary hepatocytes following a custom media incubation.. .............................................................................................. 33

2-3 Insulin signaling was blunted in NAFLD-modeled hepatocytes.. ........................ 34

2-4 Genes involved in fat oxidation and ketogenesis were upregulated in TFD mice at 4 weeks.. ................................................................................................ 36

2-5 Hepatocytes isolated at 4 weeks of TFD exhibited elevated fibrotic and inflammatory markers.. ....................................................................................... 37

2-6 Primary hepatocytes from 4-wk TFD mice showed elevated oxygen consumption rate (OCR) and ROS production with NAFLD.. ............................. 38

3-1 Histology of C57BL/6J mice fed a control or TFD diet for 24 weeks.. ................. 46

3-2 Basal parameters of control and TFD fed mice.. ................................................ 48

3-3 TFD raises fasting plasma insulin and Intralipid increases insulin and glucose levels.. ................................................................................................................ 48

3-4 C57BL/6J mice following a 5-hr Intralipid infusion exhibited mitochondrial dysfunction and inflexibility.. ............................................................................... 49

3-5 Basal insulin signaling is upregulated in insulin resistant C57BL/6J TFD mice.. .................................................................................................................. 49

3-6 Gene expression of C57BL/6J mice at 24 weeks of feeding.. ............................ 51

3-7 Inflammation and fibrosis is present in NASH mouse models.. .......................... 52

A-1 Concentration of FFAs (mmol/L) over a period of 5 hours, including baseline (0 hours).. ........................................................................................................... 58

A-2 Quantification of western blot from hepatocytes on 4-week diet.. ....................... 60

A-3 Plasma blood glucose levels in 24-week fed mice.. ............................................ 61

9

A-4 Plasma urea concentrations in mice on 24-weeks of control or TFD diet.. ......... 62

A-5 Quantification of western blot from liver homogenates on 24-week diet.. ........... 63

10

LIST OF ABBREVIATIONS

Acc1 Acetyl-coA carboxylase 1

ADP Adenosine diphosphate

ATP Adenosine triphosphate

BGL Blood glucose levels measured in mg/dL

BSA Bovine serum albumin

Chrebp Carbohydrate-responsive element-binding protein

Cpt1a Carnitine palmitoyltransferase 1a

CytC Cytochrome C

DMF Dimethylformamide

DPBS Dulbecco’s phosphate buffered saline

Fas Fatty acid synthase

FBS Fetal bovine serum

FFA Free fatty acids

Fgf21 Fibroblast growth factor 21

Hmgcs2 3-Hydroxy-3-methylglutaryl-coA synthase 2

Il6 Interleukin 6

IR Insulin resistance

Lcad Long chain acyl-coA dehydrogenase

Mmp13 Matrix metallopeptidase 13

MTBSTFA N-tert-Butyldimethylsilyl-N-methyltrifluoroacetamide

NAFLD Nonalcoholic fatty liver disease is defined by the accumulation of fat in the liver

NASH Nonalcoholic steatohepatitis is characterized as the end-stages of NAFLD, with hepatocyte injury and inflammation

OCR Oxygen consumption rate

11

Ppara Peroxisome proliferator-activated nuclear receptor alpha variant

Pc1 Pro-collagenase 1

ROS Reactive oxygen species

T2DM Type II diabetes mellitus

TCA cycle Tricarboxylic acid cycle

TG Triglycerides

Ucp2 Uncoupling protein 2

12

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science

MITOCHONDRIAL OXIDATIVE METABOLISM IN NONALCOHOLIC FATTY LIVER

DISEASE (NAFLD)

By

Kaitlyn Abdo

August 2017

Chair: Kenneth Cusi Major: Medical Sciences

Dysfunctional mitochondrial energetics and hepatic insulin resistance are central

features of nonalcoholic fatty liver disease (NAFLD). Mitochondrial pathways

(tricarboxylic acid (TCA) cycle, ketogenesis, respiration and ATP synthesis) remodel

with progressed severity of hepatic insulin resistance and fatty liver disease. While the

activity of several of these pathways are induced during early stages of insulin

resistance, mitochondrial respiration and ATP synthesis have been shown to be

impaired during more severe states, including nonalcoholic steatohepatitis (NASH) and

type 2 diabetes mellitus (T2DM). Understanding the metabolic events during the

remodeling of oxidative metabolism and its interaction with reactive oxygen species

generation through the electron transport chain is of significant interest for developing

therapeutic strategies. We hypothesize that chronic free fatty acid (FFA) overload will

result in hepatic insulin resistance and further disturb the mitochondria’s flexibility to

compensate and adapt to nutrient and hormonal stimuli. In in vitro studies, primary

hepatocytes isolated from mice (C57BL/6J) challenged with a high fructose, high trans-

fat (TFD) diet or a control diet for 4-wks, were treated with low (0.2 mM) vs. high (0.8

mM) FFA. In vivo studies were conducted on mice with NASH, following 24-wks of TFD

13

feeding. These mice were infused with Intralipid for 5-hrs to elevate FFA levels by 2-3

fold. Measures of ketone production, insulin signaling by western blot analysis, gene

expression patterns, and analysis of circulating biomarkers were conducted to test our

hypothesis. Primary hepatocytes isolated from 4-wk TFD fed mice had impaired insulin

signaling and higher hepatocyte triglyceride content (Control: 0.25±0.12 vs. TFD:

1.15±0.03 mg/mL; p < 0.05). In spite of insulin resistance, ketogenesis (Control:

766±115 vs. TFD: 1242±105 µM; p < 0.05) was upregulated in extracted primary

hepatocytes. However, when mice with NASH were challenged by Intralipid infusion, the

mice clearly illustrated an inability to induce ketogenesis (C-Glycerol: 213±35.2, C-

Intralipid: 513±169, TFD-Glycerol: 654±213, TFD-Intralipid: 615±99.9 µM) indicating

blunted compensatory mechanisms to FFA overload. Early induction of ketogenesis

despite hepatic insulin resistance in primary hepatocytes and the blunted response of

ketogenesis to Intralipid challenge in mice with NASH, demonstrates mitochondrial

inflexibility. Blunted compensatory mechanisms within hepatic mitochondria during

hepatic insulin resistance can result in sustained induction of oxidative flux, hastening

oxidative stress and inflammation.

14

CHAPTER 1 GENERAL OVERVIEW OF NONALCOHOLIC FATTY LIVER DISEASE

Nonalcoholic fatty liver disease (NAFLD) is a prevalent metabolic disorder that is

due to the accumulation of fat in the liver and is associated with metabolic dysfunction

and insulin resistance [1], [2], [3]. Excess adiposity and insulin resistance are two major

risk factors of NAFLD [4]. Fatty liver disease is a common comorbidity of type 2

diabetes mellitus (T2DM) as well as obesity [5]. NAFLD can progress further to

nonalcoholic steatohepatitis (NASH), with inflammation and fibrosis [6].

Why Study NAFLD: Biological and Clinical Relevance of Studying NAFLD

NAFLD is defined as the accumulation of fat in the liver more than 5% by

histology and absence of other liver conditions and alcohol consumption [5].

Consequence of chronic fatty liver disease include cirrhosis, hepatocellular carcinoma,

and also increased risk of cardiovascular disease [6]. Approximately 34% of the people

in the United States have been diagnosed with NAFLD, and this disease stands to be

the leading cause of liver transplants in the near future [7], [8]. Furthermore, NAFLD has

become common in pediatrics, with up to 50% of obese children [9]. Despite the

prevalence of this disease, patients with NAFLD are underdiagnosed and undertreated

in the clinical setting. Many of the limitations in clinical practice are secondary to our

poor understanding of the pathogenesis of the disease. It is currently unclear the factors

involved in the development and progression of the disease [7]. Currently there are no

exclusive therapeutic options that specifically target the disease, and the current

diagnosis requires a liver biopsy, due to lack of good plasma biomarkers [5], [10]. A

better understanding of the underlying mechanisms involved in the development and

15

progression of NAFLD is essential, if we want to overcome the current clinical

limitations.

Progression of NAFLD to NASH

It has been suggested that this “two-hit” hypothesis is outdated and that multiple

parallel hits simultaneously lead to the progression of NAFLD [11]. The first “hit” in the

progression of NAFLD is associated with accumulation of fat in the liver and the second

characterized by signs of fibrosis and inflammation [12], [11]. Large clinical studies have

identified an excessive FFA supply, hyperinsulinemia, and hyperglycemia as key factors

in the progression of NAFLD to NASH [13], [14], [15]. Seventy percent of T2DM patients

have isolated steatosis [5], [16]. Isolated steatosis (IS) gradually transitions to NASH,

with inflammation and fibrosis [17] (Figure 1-1).

The mitochondria in the liver attempt to adapt to the chronic influx of free fatty

acids (FFA), and once maximal capacity is met, inflammatory and apoptotic pathways

are initiated [13]. The maladaptation of the hepatic mitochondria is associated with the

progression to nonalcoholic steatohepatitis (NASH) [6]. NASH can progress to cirrhosis

of the liver and hepatocellular carcinoma [18], [19]. NASH is projected to be the leading

cause of liver transplants [20], [21], [22]. Thus, studying NAFLD and the mechanisms by

which the build-up of fat in the liver transitions to inflammatory responses is of

biomedical and clinical importance [23].

The Pathophysiology of NAFLD

Obesity leads to increased adiposity, and eventually, insulin resistance in the

adipose tissue [4]. Insulin resistance in adipose tissue in conjunction with elevated free

fatty acids from a chronic supply of nutrients leads to the continual accumulation of

triglycerides (TGs) in the liver [7], [13]. In obese and T2DM patients, approximately 70%

16

of the lipolysis of adipose tissue into free fatty acids is used for fat synthesis in the liver

[13], [24]. Fatty liver disease is characterized by peripheral insulin resistance and

accumulation of lipid droplets in the liver (Figure 1-2).

NAFLD is a multifactorial metabolic disorder that is strongly associated with the

onset of hepatic insulin resistance (IR) from a chronic overload of metabolic substrates

(free fatty acids) [1]. Hepatic IR is present from the liver’s insensitivity to raised blood

glucose levels (BGLs) and increased gluconeogenic pathways (either due to T2DM or

obesity) [1]. A mouse model is necessary to target the mechanism by which NAFLD

progresses to end-stage nonalcoholic steatohepatitis (NASH).

Dysfunctional mitochondrial fat oxidation precedes lipotoxic byproducts (i.e.

DAGs and ceramides) that further progress the disease due to inflammatory and

cytokine responses [1]. Fat accumulation, resulting in hepatocellular injury, is commonly

accompanied by inflammation [18]. Excessive accumulation in the hepatocytes of an

insulin resistant liver ultimately leads to mitochondrial stress and increased cytokine and

overproduction of reactive oxidative species (ROS) [26]. The continual fueling of these

inflammatory and fibrotic pathways leads to hepatocyte apoptosis and cirrhosis of the

liver [27]. The accumulation of lipids in the muscle has been previously studied, and

now our lab is studying the same effect in the liver of mice due to the prevalence of

NAFLD and the clinical relevance to studying the disease [7].

Hepatic Insulin Resistance in NAFLD

Insulin is a hormone produced by the pancreas that partakes in many signaling

transduction pathways, with the main role being the maintenance of physiologic blood

glucose levels. Glucose transport is the primary defect in insulin-mediated glucose

metabolism in patients with T2DM [5]. Adiposity is elevated in obese and T2DM

17

patients, which leads to further lipolysis of fat entering the hepatic mitochondria [23].

The hepatic mitochondria is involved in the storing or oxidizing of fat (from diet or

adipose tissue) and this remains in homeostatic balance, unless insulin resistance

occurs [23].

In NAFLD, there is mitochondrial dysfunction from fat overload that results in

hepatic insulin resistance and lipotoxic byproducts [25]. Free fatty acids are the most

abundant energy source circulating in the body under fasting conditions [28]. During

hepatic insulin resistance, fatty acids are taken up by the liver for immediate energy,

stored in the liver as triglycerides if energy demand is low, or excreted into the plasma

as very low-density lipoproteins (VLDLs). Carnitine palmitoyltransferase I (CPT1)

transports long-chain free fatty acids into the mitochondria to either be broken down

through beta oxidation (β-oxidation) or to enter the tricarboxylic acid (TCA) cycle for

immediate energy [23]. Upregulated fat oxidation results in the esterification of

triglycerides and increased gluconeogenic pathways [23]. The liver, which is the location

of the main source of glucose production, continues producing glucose, consequently

causing hyperglycemia and hyperinsulemia [1].

In an insulin-resistant state, gluconeogenesis remains high and thus, more fats

brought into the liver are stored and esterified as triglycerides. Mitochondrial activity is

impaired to compensate for increased fat in IR patients. The TCA cycle is thus

upregulated with IR from increased FFA, leading to further progression of the disease.

The metabolic effects that occur in NAFLD from insulin resistance and unregulated

uptake of FFA is shown in Figure 1-3 [29].

18

Mitochondrial Dysfunction and Inflexibility

The liver plays a major role in lipid metabolism [28]. TCA cycle flux increases in

diet-induced mice with NASH [25]. Diacylglycerides (DAGs) and ceramides increase

concurrently, regardless of increased TCA cycle activity to compensate for the influx of

fat into the mitochondria [25]. This suggests incomplete fat oxidation and storage due to

mitochondrial dysfunction [25]. Studies in mice fed on a trans-fat high fat diet (TFD)

have shown the inability of the hepatic mitochondria to regulate ketone turnover. The

mitochondria were unable to adapt to severe insulin resistance [30]. Chronic

mitochondrial dysfunction triggers inflammatory pathways, with hepatocellular death,

ballooning, and fibrosis.

As a compensatory mechanism, mitochondrial respiration initially increases in

response to an excessive FFA supply, but progression of the disease leads to

diminished mitochondrial function [31]. Uncoupled mitochondrial respiration and

elevated oxidative metabolism through the TCA cycle may increase reactive oxygen

species (ROS) in patients with a fatty liver [32]. ROS production is recognized as the

main contributor to hepatocellular death in the progression of NAFLD to NASH [33].

High concentrations of ROS have been attributed to the development of NASH [28],

[34]. Reactive oxygen species is a natural product of mitochondrial metabolism;

however, dysfunction from severe insulin resistance and chronic nutrient supply cause

an overproduction of ROS, activating proinflammatory responses [28]. For example, it

has been well studied that long-chain fatty acids activate toll-like receptor 4 (TLR4), and

that diet-induced mice have shown to have increased hepatic inflammation through the

TLR4 pathway [35, 36].

19

Overall Hypothesis

Previous investigators have set the groundwork for the emerging field in

metabolic disorders. A study conducted in 2012 showed severely insulin resistant mice

had impaired ketogenesis [30]. The inflexibility of ketone turnover supported the idea of

mitochondrial metabolism remodeling during hepatic insulin resistance. Furthermore,

researchers have suggested rates of hepatic mitochondrial oxidation, or flux through the

TCA cycle, may play a key role in the progression of NAFLD. A prominent investigator

in the field, Gary Shulman, showed that TCA cycle flux is not altered in NAFLD [38],

which brings to attention the need to further study this disease. The Shulman lab

measured hepatic fluxes in humans using an experimental method with labeled acetate

and lactate. The data from Shulman’s lab suggested flux through the TCA cycle is not a

key player in the pathogenesis of NAFLD. Contrary to Shulman, our lab published last

year that flux through the TCA cycle increases in diet-induced mice with NASH [25].

Concurrently, we also showed lipotoxicity in steatohepatitis occurs despite an increase

in TCA activity. An increase in DAGs and ceramides suggest incomplete fat oxidation

and storage mechanisms. Furthermore, an increase in TCA cycle was shown in rats

when given an acute lipid load, or Intralipid challenge [37]. Likewise, oxidative stress

and inflammation occurred in response to higher flux through the TCA cycle. Together,

the idea that mitochondrial metabolism mediates oxidative stress and inflammation in

fatty liver is new novel observation, and our lab is currently working on this emerging

idea in more detail.

Our main hypothesis is that hepatic mitochondria are unable to adapt to the influx

of fat in mice with hepatic insulin resistance and fatty liver. Both in vivo and in vitro

experiments will be conducted to support the stated hypothesis. In this study, we

20

present two studies, which together, capture the beginning and end-stages of fatty liver

disease. Our first aim will be to develop a cell system to model NAFLD. In vitro studies

will be used to see changes early on in an in vitro model of NAFLD, using low and high

concentrations of palmitate. In our second aim, in vivo studies will be used to assess the

acute and chronic adaptations of liver mitochondria during FFA overflow. These effects

will support the idea of mitochondrial dysfunction and impartial fat oxidation.

Mitochondrial oxidative flux is upregulated in NASH, and the current study is

meant to tease out the mechanisms by which NAFLD is associated with fat oxidation.

Intralipid infusion will be used to perturb mitochondrial oxidative function and detect

metabolic alterations. Mitochondria are mechanistically dysfunctional during hepatic

insulin resistance. Observing the effects of mitochondrial oxidative metabolism will

reveal the alterations involved in NAFLD and aid in the discovery for drug therapeutics

for the disease.

21

Figure 1-1. Fatty liver disease progresses to steatohepatitis. NAFLD is characterized by

an infiltration of fat in the liver. This disease is extremely prevalent in patients with diabetes as well as obesity. Approximately 70% of T2DM patients will have a fatty liver and 30-40% of those patients will progress to NASH with fibrosis and inflammation within the liver, defined as NASH. Progression of NASH involves chronic inflammation and continual hepatocellular injury, leading to cirrhosis of the liver and high risk of cardiovascular disease [12].

22

Figure 1-2. Fat accumulation occurs in insulin resistant liver with NAFLD. This human

model demonstrates fat build-up in the liver compared to a healthy liver [7]. Chronic fat accumulation is associated with an insulin resistant state of the liver, connected with obesity and insulin resistant adipose tissue [25].

23

Figure 1-3. Hepatic insulin resistance and dyslipidemia in NAFLD. Fat oxidation resulting from increased adiposity in combination with nutrient overload, leads to raised triglyceride levels and gluconeogenic pathways, along with increased ketone bodies and TCA cycle flux.

24

CHAPTER 2 ESTABLISHMENT OF AN IN VITRO MODEL SYSTEM TO PROBE MITOCHONDRIAL

ALTERATIONS IN EARLY STAGES OF NAFLD

In the current application, we developed an in vitro model system to study fatty

liver disease. We created a cell system that exhibited similar physiological changes

observed in a clinical setting in NAFLD. We designed the experiment to observe

alterations in mitochondrial function early-on in the disease. The rationale behind this

study was that teasing out mechanisms in isolated hepatocytes would provide further

insight into the metabolic feature of NAFLD.

Materials and Methods

Chemicals

Sodium D-3-hydroxybutyrate-2,4-13C2 was purchased from Sigma Aldrich. Urea

(13C, 99%; 15N2, 98%) was purchased from Cambridge Isotope Laboratories, Inc. All

other chemicals came from Fisher Scientific.

Animal Studies

Animal studies were approved by the Institutional Animal Care and Use

Committee (IACUC) at the University of Florida (UF) using protocol number 201507337.

Male mice (C57BL/6J) were ordered from Jackson Laboratory at 10 to 12 weeks of age

for animal diet feeding studies. C57BL/6J mice were fed a synthetic control diet (C; 10%

fat calories, no. D09100304; Research Diets) by Animal Care Services (ACS) or a high

trans-fat diet (TFD; 40% fat calories, no. D09100301) for 4-5 weeks for in vitro studies.

Primary Hepatocyte Isolation

Primary hepatocytes were isolated by collagenase perfusion from C57BL/6J mice

fed on either a control or TFD diet for 4 weeks. After several centrifugation steps, 1

million hepatocytes were seeded onto collagen-coated plates in customized Waymouth

25

media. Custom Waymouth media contained 10% of FBS, insulin (100nM),

dexamethasone (100 nM), and penicillin-streptomycin. Following a 4 hour incubation

period, primary hepatocytes were incubated overnight in low or high fat custom-made

media- 0.2 mM FFA or 0.8 mM FFA. Custom-made media contained L-carnitine (1 mM),

BCAA (0.2 mM), insulin (1 nM), glucose (5 mM), and glycerol (0.3 mM) in a solution

containing 2% BSA in DPBS. Media was collected in hourly increments for ketone

production measurements. For protein expression of insulin resistance, media was

given an insulin bolus (50 nM) for 15 minutes and then the hepatocytes were collected.

Cells were collected the next day for triglyceride content, as well as protein and gene

expression analysis.

Mitochondrial Respiration

Intact mitochondria were isolated from fresh liver tissue using differential

centrifugation. Mitochondrial oxygen consumption was measured using the Oroboros

O2K system in mice fed four weeks on control or TFD diet. The chamber volume was 2

mL for each measurement. A total of 0.4 mg of mitochondrial protein was added to

respiration incubation media at 37°C containing Complex I respiratory substrates,

glutamate (2 M) and malate (0.8 M) to assess State 3 and 4 respiration. State 4, or non-

phosphorylating oxygen consumption, was obtained as endogenous ATP is depleted

from the addition of mitochondria. State 3, also known as ADP stimulated respiration,

was induced with the addition of adenosine diphosphate in excess (ADP, 1 mM). All

rates were recorded for at least 2 minutes. The assay was repeated in duplicate, with

the rate of change between State 3 and 4 calculated for comparison.

26

Mitochondrial ROS Production

Liver mitochondrial reactive oxygen species (ROS) production was done with

constant stirring at 37 °C using 150 μg of mitochondrial protein in 500 μL of incubation

media. ROS production was assessed in the presence of Complex I substrates,

glutamate/malate, and in the presence of Complex I and Complex III electron transport

chain inhibitors to determine sources of ROS. This was done using an AmplexRed (AR)

and horseradish peroxidase reaction, which measures the amount of hydrogen peroxide

(H2O2) produced on a spectrofluorometer (Shimadzu RF5301PC). To determine the

optimal inhibitor concentration, titration curves were performed for each inhibitor at

concentrations of 0, 0.1, 1, 5, 10, and 20 μM in liver mitochondria utilizing either

glutamate and malate or succinate to support ROS production, with the final

concentration used as 10 μM for each inhibitor. Basal ROS production was assessed

first for two minutes, Antimycin A added after the initial two minutes, and Rotenone

added subsequently two minutes later. Each sample was analyzed for ROS production

twice, with average concentrations of H2O2 reported.

Histology

Tissue (liver) from mice fed on diet for four weeks was placed in formalin for

histology. Liver from mice fed on diet for 4 weeks were fixed in 10% neutral buffered

formalin for 20–24 hours, washed and stored in 70% ethanol before embedding in

paraffin at the Molecular Pathology Core at University of Florida. The liver sections from

the control mice and mice with NAFLD were then stained with Masson’s Trichrome to

visualize collagen fibers. The liver slides were blinded and scored by a veterinary

pathologist using a previously published and validated scoring system of liver biopsies

[39].

27

Western Blotting for Protein Expression

Primary hepatocytes were lysed in buffer containing protease and phosphatase

inhibitors (Sigma-Aldrich, St. Louis, MO). Following SDS-PAGE, proteins were

transferred to a nitrocellulose membrane (Protran; Whatman/GE Healthcare,

Piscataway, NJ) and incubated overnight with the desired primary antibody (Cell

Signaling Technology, Danvers, MA). Membranes were incubated in the IgG rabbit

secondary antibody the next morning and developed using BioRad ChemiDoc System

with ECL or lumigen imaging. Protein expression was quantified using Image J

Software.

Gene Expression Analysis

Primary hepatocytes mRNA were extracted by using Trizol. The extracted mRNA

was converted into cDNA using the iScript cDNA Synthesis Kit from (BioRad, Inc.).

Quantitative real-time polymerase chain reaction (qPCR) was performed on the desired

genes. The qPCR mix contained 25 ng cDNA, 150 nmol/L of each primer and 5 µl

SYBR Green PCR master mix (BioRad Inc.). Samples were run in triplicate on a CFX

Real Time system (Bio Rad, C1000 Touch Thermal Cycler). The comparative threshold

method was used to determine relative mRNA levels with cyclophilin as the internal

control. Primers used for qPCR are listed in Table A-1.

Biochemical Measurements

Hepatocyte triglycerides were resuspended in 2:1 chloroform: methanol and the

supernatant was taken for measurement. Concentrations were determined using Serum

Triglyceride Determination kit from Sigma Aldrich.

28

Targeted Metabolomics

Analysis of plasma urea and ketones was done by gas chromatography-mass

spectrometry (GC-MS). To 50 µL media, a known concentration of their respective

internal standards was added. The samples were deproteinized with 500 µL acetone

and supernatant was dried under nitrogen. Dried sample was converted to a derivative

by 50% MTBSTFA + 50% DMF before separation on a HP-5MS column (30m x 0.25

mm x 0.25 μm; Agilent) under electron impact ionization (HP 5973N Mass Selective

Detector, Agilent).

Statistics

All continuous variables were represented as means ± SEM. A Student’s t-test

was used for comparison among two groups, with significance determined as p<0.05.

Results

Hepatocytes of Mice Fed a High Fructose Diet Develop NAFLD at 4 Weeks

An in vitro model system was created to perturb the mechanisms involved in the

progression of NAFLD. Hepatocytes were isolated from the liver of mice fed either a

semisynthetic control diet or a high fructose, high trans-fat diet.

Histology at 4 weeks further validates this model with presence of lipid droplets in

mice fed a high fructose high trans-fat diet. Hematoxylin and eosin (H&E) staining

showed increased lipid droplets in TFD mice versus control (Figure 2-1A and 2-1B).

Trichrome staining showed no fibrosis among both groups (Figure 2-1C and 2-1D).

Mice fed on a high fructose, high trans-fat diet experienced adaptive

mitochondrial oxidative metabolism and increased storage mechanisms (Figure 2-2).

Challenging isolated hepatocytes from a four-week control-fed mouse with high FFA

29

(0.8 mM) led to increased triglyceride (TG) storage (Figure 2-2A). In media with

physiological FFA, hepatocytes isolated from mice on a TFD diet had significantly

higher TG content than their control counterparts. Furthermore, ketone production was

elevated at each time interval in TFD-fed mice versus control-fed mice (Figure 2-2B).

Protein and Gene Expression Show Insulin Resistance and Increased Mitochondrial Function at 4 Weeks of Feeding

Insulin signaling was initially upregulated with elevated concentrations of free

fatty acids in primary isolated hepatocytes. Antibodies involved in the downstream

signaling of insulin (Akt Ser473) were probed to test insulin sensitivity. Protein

expression was high due to increased nutrient supply at 4 weeks of feeding. Insulin

sensitivity was tested by administering a bolus of insulin for 15 minutes (Figure 2-3).

Control-fed mice had increased expression of Akt-P(Ser473) when stimulated

with insulin. The phosphorylated form of Akt, downstream from the insulin receptor (Irs-

2), was used as a measure of insulin sensitivity. Western blots conducted using isolated

hepatocytes showed increased expression in control-fed mice when given an insulin

bolus. The expression of Akt-P(Ser473) was more prevalent when challenged with 0.8

mM FFA. Protein expression by western blotting showed elevated basal insulin

signaling in TFD mice. The TFD mice at 4 weeks experienced a blunted response to an

insulin stimuli, which is clearly shown with isolated hepatocytes in high FFA media.

Protein expression was lower in TFD mice when challenged with high FFA, and did not

increase significantly when stimulated by insulin. Fatty acid synthase (Fas) displayed

higher expression in TFD mouse, but did not vary when challenged with insulin or high

FFA.

30

Isolated hepatocytes fed for four weeks displayed alterations shown by qPCR.

Genes involved in fat oxidation and ketogenic pathways were upregulated. Upregulation

of FAO and ketogenesis were diet-induced. Pgc1a is a coactivator of Ppara, which is

involved in fat oxidation as well as mitochondrial biogenesis and gluconeogenesis [31],

[40], [41]. Cpt1a is the key enzyme in carnitine-dependent transport across the

mitochondrial inner membrane [42]. We also analyzed the gene responsible for the

uncoupling protein within the mitochondria, Ucp2, which separates oxidative

phosphorylation from ATP synthesis and is used to control ROS production [43]. Genes

involved in lipogenesis were also regulated differently in mice fed a TFD diet. The gene

involved with fatty acid metabolism and is the rate-limiting step in fatty acid synthesis

Acc1 [44], trended higher in mice on a TFD diet. Fatty acid synthase, Fas, involved with

the synthesis of palmitate [45] trended lower with mice fed a high fructose, high trans-fat

diet. Fibrotic and inflammatory markers were also upregulated in TFD mice (Table 2-1).

Hepatic mitochondrial function was elevated at four weeks of high trans-fat

feeding. A precursor for fat oxidation and involved in mitochondria biogenesis, Pgc1a,

was upregulated in TFD mice compared to control (Figure 2-4A). The gene involved in

bringing FFA into the mitochondria for oxidative metabolism, Cpt1a, was also

upregulated in TFD mice. Higher nutrient supply (0.8 mM FFA) increased expression of

Cpt1a (Figure 2-4B). Long chain acyl-coA dehydrogenase, Lcad, is the first enzyme

involved in free fatty acid metabolism, and was upregulated in TFD mice (Figure 2-4C).

3-Hydroxy-3-methylglutaryl-coA synthase 2, Hmgcs2, the first enzyme involved in

ketogenesis [46], exhibited increased expression in TFD hepatocytes compared to their

control counterparts (Figure 2-4D).

31

Genes involved with collagen synthesis and breakdown, Pc1 and Mmp13, were

upregulated in the hepatocytes of mice on a TFD diet [47]. Also involved in fibrosis, Pc1

and Mmp13, were upregulated in mice fed on a high fructose, high trans-fat diet for 4

weeks (Figure 2-5A and 2-5B). Interleukin 6, Il6, is a pro-inflammatory cytokine that acts

to increase the breakdown of fats and to improve insulin resistance [48]. Il6 was

significantly increased in TFD mice, and high FFA in the media of TFD hepatocytes

further upregulated expression of Il6 (Figure 2-5C).

Mitochondrial Respiration and ROS Production is Elevated in TFD Mice at 4 Weeks

Oxygen consumption rates were higher in mice fed a TFD using glutamate and

malate as substrates (Figure 2-6A). Isolated mitochondria at 4 weeks on a TFD

displayed increased mitochondrial respiration at State 4 and State 3 respiration.

Furthermore, ROS production was also increased at 4 weeks in TFD mice (Figure 2-

6B).

32

Figure 2-1. Histology of C57BL/6J mice fed on a control or TFD diet for 4 weeks. A)

Hematoxylin and eosin staining showed no lipid droplets in control mice. B) H&E staining showed drastically increased lipid droplets in mice fed a high fructose, high trans-fat diet for 4 weeks. Trichrome staining showed no fibrosis in C) control or D) TFD hepatocytes.

33

All data are represented as mean ± SEM; n=3-4. (

#p<0.05 among 0.2 mM FFA vs. 0.8 mM FFA;

**p<0.05

versus respective control group)

Figure 2-2. Metabolic changes in C57BL/6J primary hepatocytes following a custom media incubation. A) Primary hepatocytes isolated from 4-wk TFD fed mice had a higher triglyceride content versus control-fed mice. B) Ketone production was elevated for each time increment in mice fed a high trans-fat diet for 4 weeks compared to a control diet in 0.2 mM FFA custom media.

34

Figure 2-3. Insulin signaling was blunted in NAFLD-modeled hepatocytes. Akt-

P(Ser473) insulin signaling expression was highly expressed from an insulin bolus in control-fed mice. In TFD hepatocytes with an acute insulin bolus, a blunted insulin signaling response was present. Quantification of the western blot is shown in Figure A-2.

Akt-P (Ser473)

Gapdh

Akt-T

Fas

0.2 mM Palmitate

0.8 mM Palmitate

+ins -ins +ins -ins +ins -ins +ins -ins

TFD diet Control TFD diet Control

35

Table 2-1. Expression of genes related to mitochondrial metabolism and inflammation markers in primary isolated hepatocytes of C57BL/6J mice fed on a control diet or a high fructose high trans-fat diet (TFD) for 4 weeks. Mice fed on a TFD for 4 weeks had elevated fat oxidation and ketogenic pathways. Mitochondrial respiration was also upregulated, in conjunction with lipogenesis. Mice fed at TFD had an upregulation in fibrosis and inflammatory genes.

Control diet TFD diet

0.2 mM FFA 0.8 mM FFA 0.2 mM FFA 0.8 mM FFA

Fat oxidation and Ketogenesis

Pgc1a/Ppargc1a 1.00 ± 0.29 1.39 ± 0.42 2.20 ± 0.33* 1.78 ± 0.28

Ppara 1.00 ± 0.31 0.91 ± 0.18 1.07 ± 0.12 1.18 ± 0.14

Cpt1a 1.00 ± 0.14 1.45 ± 0.12 2.64 ± 0.27* 3.45 ± 0.74*

Lcad/Acadl 1.00 ± 0.21 0.66 ± 0.07 1.43 ± 0.19 1.48 ± 0.17*

Hmgcs2 1.00 ± 0.14 1.01 ± 0.21 2.82 ± 0.50* 2.78 ± 0.48*

Mitochondrial Respiration

Ucp2 1.00 ± 0.45 1.35 ± 0.46 2.17 ± 0.82 2.19 ± 0.38

Lipogenesis

Acc1 1.00 ± 0.14 1.07 ± 0.15 1.57 ± 0.36 1.45 ± 0.11

Fas 1.00 ± 0.11 0.86 ± 0.09 0.78 ± 0.05 0.64 ± 0.06

Fibrosis and Inflammation

Pc1 1.00 ± 0.12 1.27 ± 0.28 2.67 ± 0.29* 2.46 ± 0.74

Mmp13 1.00 ± 0.17 0.92 ± 0.16 4.58 ± 1.01 3.26 ± 0.62

Il6 1.00 ± 0.22 0.86 ± 0.28 9.68 ± 0.53* 29.08 ±3.78*#

Values are mean ± SEM; n=3-5 per group. (*p ≤ 0.05 versus respective control groups; #p ≤ 0.05 between 0.2 mM and 0.8 mM FFA groups).

36

All data are represented as mean ± SEM; n=3-4. (

#p<0.05 among 0.2 mM FFA vs. 0.8 mM FFA;

*p<0.05

versus respective control group)

Figure 2-4. Genes involved in fat oxidation and ketogenesis were upregulated in TFD mice at 4 weeks. A) Pgc1a, an activator of Ppara, was significantly upregulated in a diet-induced model of NAFLD. B) The gene involved in bringing fat into the mitochondria for oxidation, Cpt1a, was also increased, and further increased with a high FFA challenge. C)The first step in the fatty acid oxidation, Lcad, was upregulated in TFD versus control. D) The first step in ketogenesis, Hmgcs2, was also elevated in TFD mice compared to the controls.

37

All data are represented as mean ± SEM; n=3-4. (

#p<0.05 among 0.2 mM FFA vs. 0.8 mM FFA;

*p<0.05

versus respective control group)

Figure 2-5. Hepatocytes isolated at 4 weeks of TFD exhibited elevated fibrotic and

inflammatory markers. A) A promoter of collagen synthesis, Pc1, was significantly higher in mice fed a high fructose, high trans-fat diet. B) Another gene involved with fibrosis, Mmp13, showed an increasing trend in TFD compared to controls. C) A proinflammatory cytokine, Il6, was also higher due to diet, as well as a high FFA challenge.

38

Figure 2-6. Primary hepatocytes from 4-wk TFD mice showed elevated oxygen

consumption rate (OCR) and ROS production with NAFLD. A) TFD isolated hepatocytes showed an increased OCR compared to control when given Complex I substrates during State 4 and State 3 respiration. B) At each mitochondrial complex inhibitor (Antimycin A for Complex III and Rotenone for Complex I), TFD isolated hepatocytes demonstrated increased ROS production compared to control-fed mice.

39

CHAPTER 3 INTRALIPID CHALLENGE SHOWS COMPLETE MITOCHONDRIAL DYSFUNCTION

IN MOUSE MODEL OF NASH

Our second aim of the study was to demonstrate mitochondrial dysfunction in a

mouse model of NASH. This was done by feeding mice with a high fructose, high trans-

fat diet for 24 weeks to induce steatohepatitis [49, 50]. To assess steatohepatitis, we

used a nutrient-induced insulin resistant mouse model and administered an acute

Intralipid infusion challenge.

Materials and Methods

Chemicals

Intralipid (20% fat emulsion) was purchased from Fresenius Kabi. Heparin (1,000

units/mL) was purchased from Sagent Pharmaceuticals. All other chemicals came from

Fisher Scientific.

Animal Studies

Animal studies were approved by the Institutional Animal Care and Use

Committee (IACUC) at the University of Florida (UF) under protocol number 201507337.

Male mice (C57BL/6J) were ordered from Jackson Laboratory at 10 to 12 weeks of age

for animal diet feeding studies. C57BL/6J mice were fed a synthetic control diet (C; 10%

fat calories, no. D09100304; Research Diets) by Animal Care Services (ACS) or a high

trans-fat diet (TFD; 40% fat calories, no. D09100301) for 24 weeks for in vivo studies.

Histology

Tissue (liver) from mice fed on diet for twenty-four weeks was placed in formalin

for histology. Liver from mice fed on diet for 24 weeks were fixed in 10% neutral

buffered formalin for 20–24 hours, washed and stored in 70% ethanol before

embedding in paraffin at the Molecular Pathology Core at University of Florida. The liver

40

sections from the control mice and mice with NAFLD were then stained with Masson’s

Trichrome to visualize collagen fibers. The liver slides were blinded and scored by a

veterinary pathologist using a previously published and validated scoring system of liver

biopsies [39].

Jugular Vein Catherization

Jugular vein catheters were implanted in mice fed with control and TFD diet (n=5-

9) for stable isotope infusions. Mice were given 100 µL buprenex under anesthesia the

day of surgery and the day after surgery. Weight was monitored for 5 days to ensure

viable mice.

Intralipid Infusion

Body weight (g) and fasting blood glucose levels (mg/dL) were recorded from

each mouse before start of infusion. Mice were fasted one hour prior to the start of

infusions. Control and TFD mice were randomized to receive either an Intralipid or a

glycerol infusion over a 5 hour period. There were four treatment groups: control

animals infused with glycerol (C + glycerol), control animals infused with Intralipid (C +

Intralipid), TFD animals infused with glycerol (TFD + glycerol), and TFD animals infused

with Intralipid (TFD + Intralipid). A group of control mice (n=11) were infused with only

glycerol (n=5) or Intralipid (n=6). A group of TFD mice (n=17) were infused with only

glycerol (n=8) or Intralipid (n=9). The Intralipid solution (20% fat emulsion) contained

2.25% glycerol, and thus the infusion of glycerol alone was 2.25%. Emulsion of 20%

Intralipid was introduced through the mouse jugular vein catheter at a rate of 0.075

mL/hour. Heparin was added (20 µL/ 1 mL Intralipid) to the infusion mixture to facilitate

the lipolysis of Intralipid in vivo.

41

Preliminary Data for Intralipid Infusion Rate

Two test animals were used to validate the dose of Intralipid infused. Mice were

fasted an hour before infusion, and their blood (50 µL) were collected from the mouse

tail vein in every hour interval for a total of five hours. Plasma was collected by spinning

down the blood for 10 min, at 9000 rpm 4oC. This was to test if desired level of free fatty

acids (FFA, mmol/L) increased at least two-fold than normal to represent an elevated

physiological level of free fatty acids (Figure A-1).

Intralipid Infusion Analysis

Following 5-hour infusion of either Intralipid or glycerol, mice were anesthetized

and whole blood was collected from the descending aorta. Livers were flash frozen in

liquid nitrogen and later stored at -80°C until further analysis.

Western Blotting for Protein Expression

Approximately 30 mg aliquots of frozen livers were used to analyze protein

expression. Liver proteins were lysed in buffer containing protease and phosphatase

inhibitors (Sigma-Aldrich, St. Louis, MO). Following SDS-PAGE, proteins were

transferred to a nitrocellulose membrane (Protran; Whatman/GE Healthcare,

Piscataway, NJ) and incubated overnight with the desired primary antibody (Cell

Signaling Technology, Danvers, MA). Membranes were incubated in the IgG rabbit

secondary antibody the next morning and developed using BioRad ChemiDoc System

with ECL or lumigen imaging. Protein expression was quantified using Image J

Software.

Gene Expression Analysis

Liver mRNA was extracted by using Trizol. The extracted mRNA was converted

into cDNA using the iScript cDNA Synthesis Kit from (BioRad, Inc.). Quantitative real-

42

time polymerase chain reaction (qPCR) was performed on the desired genes. The

qPCR mix contained 25 ng cDNA, 150 nmol/L of each primer and 5 µl SYBR Green

PCR master mix (BioRad Inc.). Samples were run in triplicate on a CFX Real Time

system (Bio Rad, C1000 Touch Thermal Cycler). The comparative threshold method

was used to determine relative mRNA levels with cyclophilin as the internal control.

Biochemical Measurements

Plasma free fatty acid concentrations were determined using the HR Series

NEFA kit, purchased from Wako Pure Chemical Industries, Ltd. Plasma and liver

triglyceride concentrations were determined using Serum Triglyceride Determination kit

from Sigma Aldrich. Triglyceride processing followed the method as described in the

methods of Chapter 2. Plasma insulin was measured by a mouse insulin ELISA kit from

Crystal Chem, Inc.

Targeted Metabolomics

Fasting plasma urea and ketones concentrations were analyzed by stable

isotope dilution with GC-MS. To 10 µL plasma, a known concentration of their

respective internal standards was added. Processing followed the method as described

in the methods of Chapter 2.

Statistics

All continuous variables were represented as means ± SEM. A Student’s t-test

was used for comparison among two groups, with significance determined as p<0.05.

43

Results

C57BL/6J Mice Develop NASH at 24 Weeks of High Fructose High trans-Fat Feeding

At 24 weeks of a high fructose high trans-fat diet, C57BL/6J mice develop

nonalcoholic steatohepatitis. In a previous NASH study our lab conducted, liver

histology with H&E staining showed large amounts of lipid droplets and fibrosis in mice

fed a TFD diet versus a control diet (Figure 3-1A and 3-1B) [25]. Furthermore, fibrosis

and inflammation was even more prevalent in mice on a TFD for 24 weeks than the

controls (Figure 3-1C and 3-1D).

Mitochondria are Dysfunctional in Mouse Model of NASH

Mice with NASH at 24 weeks exhibited many metabolic alterations. Hepatic

mitochondria were deemed dysfunctional from a high fructose high trans-fat diet based

on measured metabolic parameters. This is further supported by an administered

Intralipid challenge. Clinical and metabolic parameters of both control and TFD mice fed

for 24 weeks are shown in Table 3-1.

A high fructose high trans-fat diet generated weight gain compared to mice on a

control diet (Figure 3-2A). An acute infusion of Intralipid gradually increased the overall

weight of the mice. Liver weight was significantly different in TFD mice compared to

their respective controls (Figure 3-2B). Liver triglyceride content also amounted to more

in the presence of high nutrient supply, with an Intralipid challenge aiding in triglyceride

storage (Figure 3-2C).

An acute 5-hour infusion with Intralipid showed an increasing trend in raising

plasma blood glucose levels (Figure A-3). A high fructose high trans-fat diet had no

44

significant effect on blood glucose. Insulin levels after a 1 hour fast were also raised in

accordance to an Intralipid challenge and high nutrient supply (Figure 3-3).

Triglycerides in the plasma were elevated when mice were given a 5-hour

Intralipid infusion (Figure 3-4A). An acute Intralipid infusion for 5 hours elevated FFA

levels two-fold (Figure A-1). Free fatty acids were elevated significantly when

challenged with an acute Intralipid infusion in both control and TFD mice (Figure 3-4B).

TFD mice initially had a higher level of FFAs compared to that of control. Ketogenesis

was also elevated in TFD mice compared to the controls (Figure 3-4C). Ketone

production in control mice increased significantly when supplemented with Intralipid, but

this response was blunted in the TFD mice. There were no significant changes in urea

production among all four groups (Figure 3-4D).

NASH Mice Exhibit Severe Insulin Resistance

Western blots conducted on liver homogenates show with Irs-2 severe insulin

resistance in TFD mice at 24 weeks of feeding (Figure 3-5). Downstream signaling with

Akt-P(Ser473) and Akt-P(T hr308) further demonstrate the inability of NASH mice to

effectively respond to an influx of fat. Basal insulin signaling is upregulated in NASH

mice infused with glycerol, and this response is blunted when challenged with Intralipid.

Gene expression showed that oxidative metabolism, mitochondrial respiration,

and lipogenesis in NASH mice were upregulated. Cytochrome C, CytC, which binds to

cardiolipin and may result in ROS production remained unchanged [51]. Chrebp, a

central regulator of de novo lipogenesis also remained unchanged in the TFD mice

compared to the control-fed mice [52]. Inflammation and fibrosis were also higher in

mice with steatohepatitis. Fgf21, involved in fatty acid oxidation and glucose uptake in

fat was upregulated in control-fed mice from an acute Intralipid infusion [53]. Expression

45

of Fgf21 was slightly higher in TFD-fed mice versus the control, with no significant

change in expression when challenged with Intralipid. All genes observed for NASH

mice are displayed in Table 3-2.

Hepatic mitochondrial signaling is upregulated in TFD mice compared to controls,

but exhibit an inability to respond when given Intralipid. Fat oxidation was upregulated in

control-fed mice with an Intralipid challenge, but TFD mice experienced a blunted

response to increase fat oxidation when given Intralipid (Figure 3-6A). Mitochondrial

respiration was significantly altered in TFD mice (Figure 3-6B). Srebp1c is a major

regulator of fatty acid synthesis [54]. Lipogenesis, shown by Srebp1c, was also

increased in TFD mice compared to the controls (Figure 3-6C).

Fibrosis and inflammatory signaling, Mmp13, Tnfa, and Tlr4, were upregulated in

TFD mice versus controls (Figure 3-7). Mmp13, a gene that encodes for collagenase 3

and is involved in fibrosis [47], was significantly high in TFD mice (Figure 3-7A).

Involved in systemic inflammation and cell death, Tnfa, an inducer of cell death and

systemic inflammation [55], was also higher due to TFD (Figure 3-7B). Tlr4, an activator

of the innate immune system [56], was upregulated in TFD mice compared to respective

controls (Figure 3-7C).

46

Figure 3-1. Histology of C57BL/6J mice fed a control or TFD diet for 24 weeks. A) H&E

staining for control mice showed no lipid droplets whereas B) TFD mice exhibited accumulation of lipids. C) Trichrome staining in control-fed mice showed no fibrosis. D) Trichrome staining showed severe fibrosis and hepatocyte cellular death in TFD-fed mice with NASH.

Control diet TFD diet

47

Table 3-1. Clinical and metabolic parameters from biological samples of C57BL/6J control and TFD fed mice when challenged with a five-hour glycerol or Intralipid infusion. NASH mice had higher body and liver weight than the controls. Intralipid further emphasized this effect. Ketogenesis and triglyceride storage mechanisms were higher in TFD mice compared to the controls.

All data are represented as mean ± SEM; n=4-9. (*p<0.05 versus respective control groups; #p<0.05 between glycerol and Intralipid infusion groups).

Control diet TFD diet

Glycerol Intralipid Glycerol Intralipid

Body Weight (g) 32.50 ± 0.99 31.25 ± 0.84 36.22 ± 1.53* 38.22 ± 0.83*

Liver Weight (g) 1.21 ± 0.06 1.11 ± 0.04 3.08 ± 0.24* 3.47 ± 0.23*

Plasma Glucose (mg/dL)

150.00±8.42 172.71 ± 8.97 153.56±13.03 169.56±12.28

Plasma Insulin (ng/mL) 0.43 ± 0.08 0.33 ± 0.02 0.42 ± 0.06 0.45 ± 0.03*

Plasma Ketones (µmoles/L)

235.4 ± 36.6 840.0 ± 95.1# 708.1 ±138.9* 902.5 ± 257.4

Plasma Urea (µmoles/L)

4886 ± 451 5229 ± 269 4745 ± 397 4762 ± 323

NEFA (mmoles/L) 0.24 ± 0.04 0.83 ± 0.03# 0.35 ± 0.04* 0.62 ± 0.07*#

Plasma Triglycerides (mmoles/L)

0.85 ± 0.03 1.38 ± 0.05# 0.83 ± 0.04 1.12 ± 0.06*#

Liver Triglycerides (mg/g liver)

9.76 ± 2.12 15.68 ± 2.01 92.49±10.94* 99.27 ± 5.77*

48

2 0

3 0

4 0

5 0

Bo

dy

We

igh

t

(g)

*

C o n tro l T F D

*

0

1

2

3

4

Liv

er W

eig

ht

(g)

*

C o n tro l T F D

*

0

5 0

1 0 0

Liv

er T

rig

lyc

erid

es

(mg

g l

ive

r-1

)

* *

C o n tro l T F D

A ) B ) C )

All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05 bet ween glycerol and Intralipid infusion groups)

Figure 3-2. Basal parameters of control and TFD fed mice. A) Mice weighed more when fed on a high trans-fat diet. B) Liver weight was significantly higher on a TFD diet, even more so in TFD mice challenged with Intralipid. C) Liver triglycerides were higher in TFD mice compared to their respective controls.

All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05 between glycerol and Intralipid infusion groups)

Figure 3-3. TFD raises fasting plasma insulin and Intralipid increases insulin and

glucose levels. A) An acute infusion with Intralipid raised glucose levels in both control and TFD mice. B) Intralipid raised insulin levels in control and TFD mice. A high fructose high trans-fat diet also elevated insulin levels.

49

All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05 between glycerol and Intralipid infusion groups)

Figure 3-4. C57BL/6J mice following a 5-hr Intralipid infusion exhibited mitochondrial

dysfunction and inflexibility. A) High influx of FFA lead to elevated TGs in the plasma in TFD-fed mice infused with Intralipid. B) A 5-hr Intralipid infusion showed significant increase in FFA production in TFD-fed mice and a further elevated response when challenged with Intralipid. C) Ketone production was increased in TFD-fed mice at 24 weeks of feeding, and remained similar when challenged with Intralipid. Urea production is shown in Figure A-4.

Figure 3-5. Basal insulin signaling is upregulated in insulin resistant C57BL/6J TFD

mice. TFD mice had upregulated insulin signaling when infused with glycerol. Further challenge of Intralipid demonstrates the severe insulin resistance in mouse models of NASH. Quantification of the western blot is shown in Figure A-5.

50

Table 3-2. Expression of genes related to mitochondrial metabolism and inflammation markers in liver homogenates of C57BL/6J mice fed on a control diet or a high fructose, high trans-fat diet (TFD) for 24 weeks. Genes related to fat oxidation and ketogenic pathways were upregulated in TFD mice. Mitochondrial respiration was also increased due to diet. Fibrosis and inflammation was significantly increased in NASH mice.

Control diet TFD diet Glycerol Intralipid Glycerol Intralipid

Fat oxidation and Ketogenesis

Pgc1a/Ppargc1a 1.00 ± 0.27 0.82 ± 0.23 0.39 ± 0.04 0.44 ± 0.06

Ppara 1.00 ± 0.09 1.63 ± 0.21# 2.21 ± 0.25* 1.98 ± 0.57

Cpt1a 1.00 ± 0.26 0.95 ± 0.06 0.66 ± 0.10 0.69 ± 0.14

Lcad/Acadl 1.00 ± 0.06 1.26 ± 0.10 1.34 ± 0.09* 1.43 ± 0.04

Hmgcs2 1.00 ± 0.10 1.40 ± 0.04# 1.36 ± 0.12 1.44 ± 0.13

Mitochondrial Respiration

Ucp2 1.00 ± 0.16 0.91 ± 0.14 2.54 ± 0.15* 2.09 ± 0.53

Cytc 1.00 ± 0.04 1.17 ± 0.16 0.93 ± 0.04 1.01 ± 0.05

Lipogenesis

Acc1 1.00 ± 0.42 0.61 ± 0.08 0.83 ± 0.11 0.91 ± 0.14

Fas 1.00 ± 0.67 0.51 ± 0.10 0.81 ± 0.16 1.05 ± 0.19

Srebp1c 1.00 ± 0.10 0.83 ± 0.25 1.77 ± 0.24* 1.74 ± 0.22*

Chrebp 1.00 ± 0.13 0.93 ± 0.09 1.00 ± 0.06 1.11 ± 0.09

Fibrosis and Inflammation

Pc1 1.00 ± 0.19 1.00 ± 0.16 44.05 ±11.87 30.67 ±12.17

Fgf21 1.00 ± 0.29 2.76 ± 0.52# 1.51 ± 0.13 1.83 ± 0.15

Tnfa 1.00 ± 0.11 1.44 ± 0.47 2.83 ± 0.60* 2.71 ± 0.22

Mmp13 1.00 ± 0.38 0.94 ± 0.29 25.87 ± 2.02* 16.73 ± 5.55

Il6 1.00 ± 0.43 1.87 ± 0.59 0.48 ± 0.14 0.68 ± 0.26

Tlr4 1.00 ± 0.16 1.03 ± 0.25 2.54 ± 0.30* 2.71 ± 0.45*

Values are mean ± SEM; n=3-4 per group. (*p ≤ 0.05 versus respective control groups; #p ≤ 0.05 between glycerol and Intralipid infusion groups).

51

All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05

between glycerol and Intralipid infusion groups)

Figure 3-6. Gene expression of C57BL/6J mice at 24 weeks of feeding. NASH mice exhibited elevated A) fat oxidation, B) mitochondrial respiration, and C) lipogenic signaling pathways. The gene involved in mitochondrial fat oxidation, Ppara, was upregulated in TFD mice versus control. Intralipid increased oxidation in control mice, but this response was blunted in TFD mice. Mitochondrial respiration, observed with Ucp2, was increased due to high nutrient supply. Lipogenesis (Srebp1c) was increased in TFD mice compared to their respective controls.

52

All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05 between glycerol and Intralipid infusion groups)

Figure 3-7. Inflammation and fibrosis is present in NASH mouse models. Gene expression at 24 weeks of high trans-fat feeding showed elevated inflammatory signaling. A) Mmp13, a gene involved in fibrosis, was upregulated due to TFD. B) Proinflammatory genes, Tnfa and Tlr4, were upregulated in mice on a TFD versus control. C) TFD mice infused with Intralipid had a significantly higher expression than their respective controls.

Mm

p13

0

10

20

30

Rela

tive m

RN

A e

xp

ressio

n

*

*

CICG TG TI

Mmp13

Tnfa

0

1

2

3

4

Rela

tive m

RN

A e

xp

ressio

n

*

*

CICG TG TI

Tnfa

Tlr4

0

1

2

3

4

Rela

tive m

RN

A e

xp

ressio

n *

*

Tlr4

CICG TG TI

*

A) B) C)

53

CHAPTER 4 DISCUSSION

It is well established that NAFLD is a chronic metabolic disorder [1]. Our study

explored mitochondrial oxidative metabolism within the liver in insulin resistant mice.

Mitochondrial metabolism was altered due to high nutrient supply with a TFD, as well

with a further insult of FFA (0.8 mM FFA or Intralipid). We showed mitochondrial

dysfunction despite insulin resistance, in both an in vitro cell model of NAFLD and an in

vivo mouse model of NASH.

Developing an in vitro model system to study NAFLD was a necessary

innovation. The cell system model was validated through a variety of assays, allowing

us to conduct experiments studying the mechanisms and progression of the disease.

Histology further validate the cell system model, showing high accumulation of lipid

droplets without fibrosis in TFD mice at 4 weeks of feeding. The accumulation of

triglycerides from the influx of fat caused a switching of storage mechanisms to

oxidation of fat. An overnight incubation with excess FFA (0.8 mM) demonstrated the

ability of the mitochondria to adapt to external stimuli in the hepatocytes of control-fed

mice. The ability for the mitochondria to compensate for a high supply of FFA was

blunted in mice fed a TFD diet. Ketogenesis was elevated in TFD mice at each time

interval, validating the in vitro model system. Isolated hepatocytes were shown to have

upregulated basal insulin signaling, but displayed insulin resistance when TFD

hepatocytes were challenged with a bolus of insulin. Isolated hepatocytes were showing

elevated fat oxidation and ketogenesis in early stages of NAFLD. A promoter of fat

oxidation, Pgc1a, was elevated in diet-induced mice. The gene involved in bringing fat

into the mitochondria for oxidation, Cpt1a, also showed an increased trend with a high

54

FFA challenge as well as high nutrient supply from the diet. This is further supported

with the first step in fatty acid oxidation, Lcad, which was upregulated in TFD mice.

Ketogenesis was also upregulated in mice on a 4-week TFD, which supports previous

data (Figure 2-4). Furthermore, fibrotic (Pc1 and Mmp13) and inflammatory (Il6) genes

were upregulated in the isolated hepatocytes of TFD mice. Interleukin 6 has been

associated with pro-inflammatory cytokines, which acts to increase fat metabolism to

improve insulin resistance [48]. The 4-week in vitro study also showed elevated

mitochondrial respiration and ROS production in the TFD mice. Together, this model

system demonstrated the beginning stages of NAFLD with insulin resistance and

mitochondrial dysfunction fueling inflammatory pathways.

Our secondary aim probed the effect of a further insult to an already insulin

resistant mouse model of NASH. A previous study by our lab showed mice fed on a

TFD for 24 weeks develop steatohepatitis [25]. Body weight and liver weight increased

as expected given a high nutrient supply. Weight of the liver as well as triglyceride

content within the liver were affected only by diet and not by an acute infusion of

Intralipid. Glucose levels were elevated by a high lipid load. After a one hour fast,

plasma insulin levels showed an increasing trend in raised insulin due to Intralipid and

TFD. Elevated insulin levels were not significant enough to suppress and oxidative

metabolism within the liver. Hyperinsulinemia in NASH mice lowered glucose to the

same levels as seen in the control-fed mice. An acute Intralipid challenge caused higher

hepatocyte triglyceride secretion. The basal concentration of free fatty acids available

for energy consumption was higher in TFD versus controls. This trend was even more

apparent when the mice were given an insult of Intralipid. As the hepatocyte’s storage

55

mechanisms in the form of esterified triglycerides meet a threshold, metabolism turns to

fat oxidation and secretion of triglycerides from the liver in the form of very low-density

lipoproteins. Ketogenesis was elevated in the control-fed mice due to Intralipid. At

baseline, basal ketone production is raised in TFD mice due to the high fructose high

trans-fat diet. The mitochondria were unable to adapt to a further influx of fat when

challenged with Intralipid. The inability to respond to a high FFA stimuli demonstrates

the severe insulin resistance and mitochondrial inflexibility in these NASH mice. Urea

production was not altered from diet nor lipid load. Protein expression further supported

mitochondrial dysfunction in NASH mice. Probing downstream pathways involved in

insulin signaling showed the mitochondria’s inability to upregulate insulin signaling when

challenged with an insult such as Intralipid. Gene analysis supported a new steady state

by showing upregulated genes involved in fatty acid oxidation, mitochondrial respiration,

and lipogenesis. Fat oxidation was higher in control mice when infused with Intralipid,

showing the hepatic mitochondria’s ability to adapt to a high influx of fat. NASH mice

displayed upregulated fat oxidation, but this response was blunted when challenged

with Intralipid. This is explained by the elevated increase in plasma triglycerides, as both

storage and oxidative machinery thresholds were met in these severely insulin resistant

mice. Impaired mitochondrial respiration was shown with the uncoupling protein gene

(Ucp2), where the NASH mice are unable to efficiently oxidize the high supply of FFA

from the diet. Mitochondrial stress leads to the uncoupling of oxidative phosphorylation

from energy synthesis to control ROS production [43, 57], a main contributor to the

progression of NAFLD to steatohepatitis. Lipogenesis correlation was also increased in

NASH mice, as shown by Srebp1c. In conjunction with upregulated and dysfunctional

56

mitochondrial machinery, hepatocellular injury occurred in NASH mice likely from

lipotoxicity. Gene promoters of fibrosis, such as Mmp13, were upregulated from a 24-

week high fructose high trans-fat diet. Pro-inflammatory cytokines, like Tnfa and Tlr4,

were also upregulated in NASH mice. It is important to note Intralipid had an effect only

on fat oxidation (Ppara) compared to its respective control. These metabolic infusion

studies showed NASH mice had blunted compensatory mechanisms to FFA overload

and this lead to elevated inflammatory signaling.

An in vitro model system of NAFLD displayed early onset of insulin resistance

and inflammation. The design of a cellular system to study the disease will allow our lab

to tease out metabolic alterations that occur early-on in fatty liver disease. From our first

aim, we were able to show how mice on a high fructose high trans-fat diet already

showed signs of mitochondrial inflexibility. An acute 5-hour Intralipid infusion

demonstrated severe insulin resistance and mitochondrial dysfunction in a mouse

model of NASH. In spite of insulin resistance, ketogenesis managed to be upregulated

in response to greater nutrient supply, but mice with NASH had an inability to further

increase ketogenesis when challenged by an Intralipid infusion, clearly indicating a

blunted and maladaptive compensatory response to lipid overload.

Early induction of ketogenesis, despite hepatic insulin resistance in primary

hepatocytes and the blunted response of ketogenesis to Intralipid challenge in mice with

NASH, demonstrates mitochondrial inflexibility. Future studies will include measuring

flux through the TCA cycle in mice with fatty liver as well as steatohepatitis. We aim to

show an increase in TCA flux in NASH mice, contrary to Shulman’s hypothesis, along

with lipotoxic byproducts. Based on the in vitro data focusing on the electron transport

57

chain, we aim to take a closer look at respiration and ROS production in mice with end-

stage liver disease. We speculate that this mitochondrial inflexibility may be an early key

defect that fosters oxidative stress, chronic inflammation, and hepatocyte injury in

NASH.

58

APPENDIX SUPPLEMENTARY FIGURES

Figure A-1. Concentration of FFAs (mmol/L) over a period of 5 hours, including baseline

(0 hours). Free fatty acid levels increased by two-fold by end of infusion experiment, or to a normal physiological response to Intralipid.

59

Table A-1. Primer sequences for genes analyzed with qPCR for isolated hepatocytes and liver homogenates.

Gene Name Primer Sequence (forward) Primer Sequence (reverse)

Ppib/Cyclophilin b GGAGATGGCACAGGAGGAA

GCCCGTAGTGCTTCAGCTT

Pgc1a AGACAAATGTGCTTCCAAAAAGAA GAAGAGATAAAGTTGTTGGTTTGGC

Ppara ACAAGGCCTCAGGGTACCA

GCCGAAAGAAGCCCTTACAG

Cpt1a CAAAGATCAATCGGACCCTAGAC

CGCCACTCACGATGTTCTTC

Lcad TCAATGGAAGCAAGGTGTTCA

GCCACGACGATCACGAGAT

Hmgcs2 GACTTCCTGTCATCCAGC

GGTGTAGGTTTCTTCCAGC

Ucp2 GCTTCTGCACCACCGTCAT

GCCCAAGGCAGAGTTCATGT

Cytc GAAAAGGGAGGCAAGCATAAG

TGTCTTCCGCCCGAACA

Acc1 GGACAGACTGATCGCAGAGAAAG

TGGAGAGCCCCACACACA

Fas GCTGCGGAAACTTCAGGAAAT

AGAGACGTGTCACTCCTGGACTT

Srebp1c GGAGCCATGGATTGCACATT

GGCCCGGGAAGTCACTGT

Chrebp GAAACCTGAGGCTGTCATCCT

CGTGGTATTCGCGCATCA

Pc1 ACCTGTGTGTTCCCTACTCA

GACTGTTGCCTTCGCCTCTG

Fgf21 CCTCTAGGTTTCTTTGCCAACAG

AAGCTGCAGGCCTCAGGAT

Tnfa CTGAGGTCAATCTGCCCAAGTAC

CTTCACAGAGCAATGACTCCAAAG

Mmp13 CCTTCTGGTCTTCTGGCACAC

GGCTGGGTCACACTTCTCTGG

Il6 TCGTGGAAATGAGAAAAGAGTTG

AGTGCATCATCGTTGTTCATACA

Tlr4 CACTGTTCTTCTCCTGCCTGAC CCTGGGGAAAAACTCTGGATAG

60

Figure A-2. Quantification of western blot from hepatocytes on 4-week diet. Isolated

hepatocytes (N=1) were incubated overnight with low (0.2 mM) or high (0.8 mM) FFA in media. A 50 nM insulin bolus was given for 15 minutes. Insulin sensitivity was measured (p-Akt) and showed insulin resistance in mice on a TFD diet.

61

Figure A-3. Plasma blood glucose levels in 24-week fed mice. Mice maintained same

glucose levels regardless of increased nutrients. An Intralipid challenge slightly raised glucose levels in the the plasma in both control and NASH mice.

62

Figure A-4. Plasma urea concentrations in mice on 24-weeks of control or TFD diet. Urea production was not changed by diet nor Intralipid challenge.

63

Figure A-5. Quantification of western blot from liver homogenates on 24-week diet. Insulin sensitivity was measured by probing Irs-2 and p-Akt in NASH mice when challenged with Intralipid. Mice with NASH showed severe insulin resistance when given an acute lipid load.

64

LIST OF REFERENCES

1. Cusi, K., Role of obesity and lipotoxicity in the development of nonalcoholic steatohepatitis: pathophysiology and clinical implications. Gastroenterology, 2012. 142(4): p. 711-725.e6.

2. Adams, L.A., et al., The natural history of nonalcoholic fatty liver disease: a

population-based cohort study. Gastroenterology, 2005. 129(1): p. 113-21. 3. Lee, J., et al., Epigenetics in non-alcoholic fatty liver disease. Mol Aspects Med,

2017. 54: p. 78-88. 4. Poggiogalle, E., et al., Non-alcoholic fatty liver disease connections with fat-free

tissues: A focus on bone and skeletal muscle. World J Gastroenterol, 2017. 23(10): p. 1747-1757.

5. Bril, F. and K. Cusi, Management of Nonalcoholic Fatty Liver Disease in Patients

With Type 2 Diabetes: A Call to Action. Diabetes Care, 2017. 40(3): p. 419-430.9 6. Sunny, N.E., F. Bril, and K. Cusi, Mitochondrial Adaptation in Nonalcoholic Fatty

Liver Disease: Novel Mechanisms and Treatment Strategies. Trends Endocrinol Metab, 2017. 28(4): p. 250-260.

7. Galgani, J.E., C. Moro, and E. Ravussin, Metabolic flexibility and insulin

resistance. Am J Physiol Endocrinol Metab, 2008. 295(5): p. E1009-17. 8. Browning, J.D., Statins and hepatic steatosis: perspectives from the Dallas Heart

Study. Hepatology, 2006. 44(2): p. 466-71. 9. Papandreou, D., I. Rousso, and I. Mavromichalis, Update on non-alcoholic fatty

liver disease in children. Clin Nutr, 2007. 26(4): p. 409-15. 10. European Association for the Study of the Liver European Association for the

Study of Diabetes European Association for the Study of, O. 11. Podrini, C., et al., Redox homeostasis and epigenetics in non-alcoholic fatty liver

disease (NAFLD). Curr Pharm Des, 2013. 19(15): p. 2737-46. 12. Day, C.P. and O.F. James, Steatohepatitis: a tale of two "hits"?

Gastroenterology, 1998. 114(4): p. 842-5. 13. Ali, R. and K. Cusi, New diagnostic and treatment approaches in non-alcoholic

fatty liver disease (NAFLD). Ann Med, 2009. 41(4): p. 265-78. 14. Marceau, P., et al., Liver pathology and the metabolic syndrome X in severe

obesity. J Clin Endocrinol Metab, 1999. 84(5): p. 1513-7.

65

15. Luyckx, F.H., et al., Liver abnormalities in severely obese subjects: effect of drastic weight loss after gastroplasty. Int J Obes Relat Metab Disord, 1998. 22(3): p. 222-6.

16. Harada, S., et al., Influence of hyperglycemia on liver inflammatory conditions in

the early phase of non-alcoholic fatty liver disease in mice. J Pharm Pharmacol, 2017.

17. Pais, R., et al., A systematic review of follow-up biopsies reveals disease

progression in patients with non-alcoholic fatty liver. J Hepatol, 2013. 59(3): p. 550-6.

18. Sun, C., J.G. Fan, and L. Qiao, Potential epigenetic mechanism in non-alcoholic

Fatty liver disease. Int J Mol Sci, 2015. 16(3): p. 5161-79. 19. Reeves, H.L., M.Y. Zaki, and C.P. Day, Hepatocellular Carcinoma in Obesity,

Type 2 Diabetes, and NAFLD. Dig Dis Sci, 2016. 61(5): p. 1234-45. 20. Charlton, M.R., et al., Frequency and outcomes of liver transplantation for

nonalcoholic steatohepatitis in the United States. Gastroenterology, 2011. 141(4): p. 1249-53.

21. Anstee, Q.M., G. Targher, and C.P. Day, Progression of NAFLD to diabetes

mellitus, cardiovascular disease or cirrhosis. Nat Rev Gastroenterol Hepatol, 2013. 10(6): p. 330-44.

22. Wong, R.J., et al., Nonalcoholic steatohepatitis is the second leading etiology of

liver disease among adults awaiting liver transplantation in the United States. Gastroenterology, 2015. 148(3): p. 547-55.

23. Sunny, N.E., et al., Excessive hepatic mitochondrial TCA cycle and

gluconeogenesis in humans with nonalcoholic fatty liver disease. Cell Metab, 2011. 14(6): p. 804-10.

24. Donnelly, K.L., et al., Sources of fatty acids stored in liver and secreted via

lipoproteins in patients with nonalcoholic fatty liver disease. J Clin Invest, 2005. 115(5): p. 1343-51.

25. Patterson, R.E., et al., Lipotoxicity in steatohepatitis occurs despite an increase

in tricarboxylic acid cycle activity. Am J Physiol Endocrinol Metab, 2016. 310(7): p. E484-94.

26. Gallego-Durán, R. and M. Romero-Gómez, Epigenetic mechanisms in non-

alcoholic fatty liver disease: An emerging field. World J Hepatol, 2015. 7(24): p. 2497-502.

66

27. Wei, Y., et al., Nonalcoholic fatty liver disease and mitochondrial dysfunction. World J Gastroenterol, 2008. 14(2): p. 193-9.

28. Bellanti, F., et al., Lipid oxidation products in the pathogenesis of non-alcoholic

steatohepatitis. Free Radic Biol Med, 2017. 29. Gaggini, M., et al., Non-alcoholic fatty liver disease (NAFLD) and its connection

with insulin resistance, dyslipidemia, atherosclerosis and coronary heart disease. Nutrients, 2013. 5(5): p. 1544-60.

30. Satapati, S., et al., Elevated TCA cycle function in the pathology of diet-induced

hepatic insulin resistance and fatty liver. J Lipid Res, 2012. 53(6): p. 1080-92. 31. Finck, B.N. and D.P. Kelly, PGC-1 coactivators: inducible regulators of energy

metabolism in health and disease. J Clin Invest, 2006. 116(3): p. 615-22. 32. Satapati, S., et al., Mitochondrial metabolism mediates oxidative stress and

inflammation in fatty liver. J Clin Invest, 2016. 126(4): p. 1605. 33. Roskams, T., et al., Oxidative stress and oval cell accumulation in mice and

humans with alcoholic and nonalcoholic fatty liver disease. Am J Pathol, 2003. 163(4): p. 1301-11.

34. Baskol, G., M. Baskol, and D. Kocer, Oxidative stress and antioxidant defenses

in serum of patients with non-alcoholic steatohepatitis. Clin Biochem, 2007. 40(11): p. 776-80.

35. Krakauer, T., Inflammasome, mTORC1 activation, and metabolic derangement

contribute to the susceptibility of diabetics to infections. Med Hypotheses, 2015. 85(6): p. 997-1001.

36. Sutter, A.G., et al., Dietary Saturated Fat Promotes Development of Hepatic

Inflammation Through Toll-Like Receptor 4 in Mice. J Cell Biochem, 2016. 117(7): p. 1613-21.

37. Satapati, S., et al., Mitochondrial metabolism mediates oxidative stress and

inflammation in fatty liver. J Clin Invest, 2015. 125(12): p. 4447-62. 38. Petersen, K.F., et al., Assessment of Hepatic Mitochondrial Oxidation and

Pyruvate Cycling in NAFLD by (13)C Magnetic Resonance Spectroscopy. Cell Metab, 2016. 24(1): p. 167-71.

39. Kleiner, D.E., et al., Design and validation of a histological scoring system for

nonalcoholic fatty liver disease. Hepatology, 2005. 41(6): p. 1313-21.

67

40. Puigserver, P. and B.M. Spiegelman, Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1 alpha): transcriptional coactivator and metabolic regulator. Endocr Rev, 2003. 24(1): p. 78-90.

41. Sajan, M.P., R.A. Ivey, and R.V. Farese, BMI-related progression of atypical

PKC-dependent aberrations in insulin signaling through IRS-1, Akt, FoxO1 and PGC-1α in livers of obese and type 2 diabetic humans. Metabolism, 2015. 64(11): p. 1454-65.

42. Prip-Buus, C., et al., Molecular and enzymatic characterization of a unique

carnitine palmitoyltransferase 1A mutation in the Hutterite community. Mol Genet Metab, 2001. 73(1): p. 46-54.

43. Macaluso, F.S., M. Maida, and S. Petta, Genetic background in nonalcoholic fatty

liver disease: A comprehensive review. World J Gastroenterol, 2015. 21(39): p. 11088-111.

44. Kawano, Y. and D.E. Cohen, Mechanisms of hepatic triglyceride accumulation in

non-alcoholic fatty liver disease. J Gastroenterol, 2013. 48(4): p. 434-41. 45. Hernandez-Rodas, M.C., R. Valenzuela, and L.A. Videla, Relevant Aspects of

Nutritional and Dietary Interventions in Non-Alcoholic Fatty Liver Disease. Int J Mol Sci, 2015. 16(10): p. 25168-98.

46. El Aidy, S., et al., Gut bacteria-host metabolic interplay during

conventionalisation of the mouse germfree colon. ISME J, 2013. 7(4): p. 743-55. 47. Palladini, G., et al., Role of matrix metalloproteinases in cholestasis and hepatic

ischemia/reperfusion injury: A review. World J Gastroenterol, 2015. 21(42): p. 12114-24.

48. Berlanga, A., et al., Molecular pathways in non-alcoholic fatty liver disease. Clin

Exp Gastroenterol, 2014. 7: p. 221-39. 49. Clapper, J.R., et al., Diet-induced mouse model of fatty liver disease and

nonalcoholic steatohepatitis reflecting clinical disease progression and methods of assessment. Am J Physiol Gastrointest Liver Physiol, 2013. 305(7): p. G483-95.

50. Trevaskis, J.L., et al., Glucagon-like peptide-1 receptor agonism improves

metabolic, biochemical, and histopathological indices of nonalcoholic steatohepatitis in mice. Am J Physiol Gastrointest Liver Physiol, 2012. 302(8): p. G762-72.

68

51. Akie, T.E., et al., OXPHOS-Mediated Induction of NAD+ Promotes Complete Oxidation of Fatty Acids and Interdicts Non-Alcoholic Fatty Liver Disease. PLoS One, 2015. 10(5): p. e0125617.

52. Filhoulaud, G., et al., Novel insights into ChREBP regulation and function. Trends

Endocrinol Metab, 2013. 24(5): p. 257-68. 53. Dushay, J., et al., Increased fibroblast growth factor 21 in obesity and

nonalcoholic fatty liver disease. Gastroenterology, 2010. 139(2): p. 456-63. 54. Kohjima, M., et al., SREBP-1c, regulated by the insulin and AMPK signaling

pathways, plays a role in nonalcoholic fatty liver disease. Int J Mol Med, 2008. 21(4): p. 507-11.

55. Temple, J.L., et al., A Guide to Non-Alcoholic Fatty Liver Disease in Childhood

and Adolescence. Int J Mol Sci, 2016. 17(6). 56. Soares, J.B., et al., The role of lipopolysaccharide/toll-like receptor 4 signaling in

chronic liver diseases. Hepatol Int, 2010. 4(4): p. 659-72. 57. Fares, R., et al., The UCP2 -866 G>A promoter region polymorphism is

associated with nonalcoholic steatohepatitis. Liver Int, 2015. 35(5): p. 1574-80.

69

BIOGRAPHICAL SKETCH

Kaitlyn Abdo was born in Coral Springs, Florida but raised in Charlotte, North

Carolina. She obtained bachelor’s degrees in biology as well as chemistry from the

University of North Carolina Wilmington, with honors in chemistry. Her undergraduate

research interests were in observing the helical structures of cytolytic and cell-

penetrating peptides. Her observations on the physical properties of these peptides

were published in Biophysical Journal on October 18, 2016. In the fall of 2015, she

started graduate research at the University of Florida under Dr. Kenneth Cusi studying

the effects of fat metabolism in NAFLD mouse models. Kaitlyn finished her master’s in

medical sciences with a minor in entrepreneurship in August 2017. She completed her

biotechnology internship in Israel the summer of 2017. Kaitlyn plans to gain more

experience in basic and clinical research before applying to medical school.