zyxin is a critical regulator of the apoptotic hipk2-p53 ... · suppressor in ewing sarcoma (32)...

Tumor and Stem Cell Biology

Zyxin Is a Critical Regulator of the Apoptotic HIPK2-p53Signaling Axis

Johanna Crone, Carolina Glas, Kathrin Schultheiss, Jutta Moehlenbrink, Eva Krieghoff-Henning, andThomas G. Hofmann

AbstractHIPK2 activates the apoptotic arm of the DNA damage response by phosphorylating tumor suppressor p53 at

serine 46. Unstressed cells keep HIPK2 levels low through targeted polyubiquitination and subsequentproteasomal degradation. Here we identify the LIM domain protein Zyxin as a novel regulator of theHIPK2-p53 signaling axis in response to DNA damage. Remarkably, depletion of endogenous Zyxin, whichcolocalizes with HIPK2 at the cytoskeleton and in the cell nucleus, stimulates proteasome-dependent HIPK2degradation. In contrast, ectopic expression of Zyxin stabilizes HIPK2, even upon enforced expression of itsubiquitin ligase Siah-1. Consistently, Zyxin physically interacts with Siah-1, and knock-down of Siah-1 rescuesHIPK2 expression in Zyxin-depleted cancer cells. Mechanistically, our data suggest that Zyxin regulates Siah-1activity through interference with Siah-1 dimerization. Furthermore, we show that endogenous Zyxin coaccu-mulates with HIPK2 in response to DNA damage in cancer cells, and that depletion of endogenous Zyxin resultsin reduced HIPK2 protein levels and compromises DNA damage-induced p53 Ser46 phosphorylation andcaspase activation. These findings suggest an unforeseen role for Zyxin in DNA damage-induced cell fate controlthrough modulating the HIPK2-p53 signaling axis. Cancer Res; 71(6); 2350–9. �2011 AACR.

Introduction

The cellular DNA damage response (DDR) network con-stitutes an important antitumor barrier that is inactivatedduring carcinogenesis (1). The DDR is a powerful cellularresponse counteracting genomic instability through inductionof cell-cycle arrest and DNA repair or cellular senescence andapoptosis (2, 3).

Homeodomain-interacting protein kinase 2 (HIPK2) is acritical regulator of cell fate decisions during development andin response to genomic damage (3–5). In unstressed cellsHIPK2 levels are kept low through proteasome-dependentdegradation which is facilitated by the ubiquitin ligasesSiah-1 and WSB1 (4, 6–8). In response to DNA damage, HIPK2is stabilized and activated through the ATM/ATR pathway,which involves disruption of the HIPK2–Siah-1 complexthrough ATM-mediated phosphorylation of Siah-1 (6, 9). Ifthe genome is severely damaged upon UV exposure, ionizingradiation, or chemotherapeutic drug treatment, HIPK2 formsa complex with the tumor suppressor p53 and phosphorylates

p53 at Ser46 and thereby stimulates expression of proapop-totic target genes (9–12). In response to UV damage, HIPK2 iscorecruited by the promyelocytic leukemia protein (PML)along with p53 to PML nuclear bodies (10, 11, 13), whichare nuclear multiprotein domains playing a critical role in theregulation of p53 activity and p53-mediated cell fate uponDNA damage (14–17).

The LIM (Lin-11, Isl-1 and Mec3) domain protein Zyxinlocalizes to focal adhesion sites and the actin cytoskeletonwhere it interacts with a number of cytoskeletal proteins andsignaling components, thereby regulating actin cytoskeletondynamics and cell motility and migration (18–20). Blockage ofCrm1-dependent nuclear export with leptomycin B (LMB)leads to nuclear accumulation of Zyxin (21, 22). Consistentwith these findings, Zyxin was found to shuttle between thecytoplasm and the cell nucleus and to play a role in mechan-otransduction and atrial natriuretic peptide signaling. Inter-estingly, Zyxin has also been implicated in cell death regulation(19, 23–26), but its role in apoptosis regulation is controversial.

Intriguingly, both HIPK2 and Zyxin have been reported toexert tumor suppressive functions: HIPK2 expression isreduced in breast and thyroid carcinoma (27, 28), it is inacti-vated through mislocalization by the protoprotein HMGA1(28) and is functionally compromised by mutation in acutemyeloid leukemia (AML) and myelodysplastic syndrome (29).Moreover, there is evidence that in mice, HIPK2 acts as haplo-insufficient tumor suppressor in the skin (30). For Zyxin,reduced expression has been associated with bladder cancerprogression (31), and Zyxin was shown to act as a tumorsuppressor in Ewing sarcoma (32) and in prostate cancer cells(33). Although these findings indicate a tumor suppressive

Authors' Affiliation: Cellular Senescence Group, Cell & Tumor BiologyProgram, Deutsches Krebsforschungszentrum (DKFZ), DKFZ-ZMBH Alli-ance, Heidelberg, Germany

J. Crone and C. Glas contributed equally to the study.

Corresponding Author: ThomasG. Hofmann, Cellular SenescenceGroupA210, German Cancer Research Center (DKFZ), ImNeuenheimer Feld 280,69120 Heidelberg, Germany. Phone: 0049-6221-424631; Fax: 0049-6221-424902. E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-10-3486

�2011 American Association for Cancer Research.

CancerResearch

Cancer Res; 71(6) March 15, 20112350

on March 28, 2021. © 2011 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst January 19, 2011; DOI: 10.1158/0008-5472.CAN-10-3486

http://cancerres.aacrjournals.org/

activity of Zyxin, the signaling routes and molecular mechan-isms linking Zyxin to tumor suppression remain largelyunclear.In this study, we have identified Zyxin as a critical regulator

for the p53 Ser46 kinase HIPK2, which induces apoptosis inresponse to DNA damage. We demonstrate that Zyxin expres-sion is important to maintain HIPK2 protein stability, as Zyxindepletion results in proteasome-dependent HIPK2 degrada-tion. HIPK2 expression in Zyxin-depleted cells is rescued byproteasome inhibition or by codepletion of the ubiquitin ligaseSiah-1. Furthermore, ectopically expressed Zyxin stabilizesHIPK2 and efficiently protects HIPK2 from Siah-1–mediateddegradation, presumably by interfering with Siah-1 homodi-merization. Depletion of endogenous Zyxin in human hepa-tocellular carcinoma cells inhibits DNA damage-induced p53Ser46 phosphorylation and caspase-dependent PARP clea-vage, a hallmark of apoptotic cell death. These results suggestZyxin as a critical regulator of DNA damage–induced celldeath induction through regulation of the HIPK2–p53 signal-ing axis, and thereby propose a potential molecular basis forthe tumor suppressive activity of Zyxin.

Materials and Methods

Cell culture and transfectionsU2OS, HepG2, MFC7, and 293T cells (all directly obtained

from ATCC) were maintained in DMEM/10% FCS/1% (w/v)penicillin/ streptomycin/ 20 mmol/L HEPES. Transient trans-fections were done using standard calcium phosphate pre-cipitation, Lipofectamine 2000 or HiPerFect (Qiagen).

Expression plasmids and antibodiesHIPK2 and Siah1 expression vectors and antibodies were

described previously (10, 34, 43). Zyxin expression vectorswere generated by standard PCR reactions and were allverified by DNA sequencing by the DKFZ core facility. Zyxindeletions contained the following regions: dLIM amino acids(a.a.) 1–380, LIM1/3 a.a. 380–572, LIM1/2 a.a 380–504, andLIM2/3 a.a 444–572. The rabbit zyxin antibodies were gener-ated by immunising rabbits with the following KLH-coupledpeptide: TLKEVEELEQLTQQLM (a.a 352–367 of humanZyxin). Antibodies were affinity purified against the peptideprior to use. Other antibodies used were flag M2 (Sigma), Myc9E10 (Santa Cruz), HA 3F10 (Roche), HA 12CA5 (Roche), PARP(Pharmingen), Ser46 (Cell Signaling), p53 DO-I (Santa Cruz),GAPDH V18 (Santa Cruz), EGFP mixture of clones 7.1 and 13.1(Roche), and actin C4 (MP Biomedical).

RT-PCR and oligosSemi-quantitative RT-PCR against HIPK2, Zyxin, and Siah

was performed using total RNA extracted with the RNAextraction kit from Qiagen and the following oligonucleotides:Siah1 RT For 50 cctgtaaatggcaaggctctc 30, Siah1 RT Rev 50

ctagtctttgacaccagcattg 30; HIPK2 RT For 50 ggcctcacatgtg-caagttttc 30, HIPK2 RT Rev 50 ttggtaggtatcaaggaggctc 30; ActinRT For 50 cctcgcctttgccgatcc 30, Actin RT Rev 50 ggatcttcat-gaggtagtcagtc 30; Zyxin RT For 50 gttccacatcgcctgcttc 30, ZyxinRT Rev 50 cagccattgtcatctgcctc 30.

DNA damage inductionFor UV irradiation, cell culture medium was removed and

cells were exposed to the indicated UV-C dosages using aStratalinker 1800 (Stratagene). After addition of fresh medium,cells were allowed to recover for the indicated time periods.For Adriamycin treatments, the cells were incubated withfresh culture medium supplemented with 1mg/mL Adriamycinfor the indicated time periods.

Immunofluorescence microscopyCells were washed in PBS. For endogenous protein stain-

ings, preextraction was performed by a 30-minute incubationin CSK buffer (100 mmol/L NaCl, 300 mmol/L sucrose, 3mmol/L MgCl2, and 10 mmol/L PIPES, pH 6.8), 2-minuteincubation in CSK/0.5% Triton-X-100 and a brief wash inCSK buffer. Cells were fixed with PBS/4% paraformaldehydefor 30 minutes at room temperature. Immunofluorescencestainings were performed as published previously (44). Thefollowing primary antibodies were used: mouse anti-Flag (M2;Sigma), rabbit anti-HIPK2 (10), goat anti-Zyxin (N-19; SantaCruz), mouse anti–c-Myc 9E10 (Santa Cruz), rat anti-HA(3F10; Roche). The secondary antibodies we used wereAlexa-488–coupled goat anti-mouse, Alexa-488–coupled goatanti-rabbit, Alexa-568–coupled donkey anti-goat, Alexa-594–coupled donkey anti-rat, and Alexa-594–coupled goat anti-rabbit (Molecular Probes). Cells were examined using a con-focal laser scanning microscope (FluoView1000; Olympus)with a 60� oil objective using the sequential scanning mode.All images were collected and processed using the FluoViewSoftware (Olympus) and sized in Adobe Photoshop 7.0.

RNA interferenceFor RNA interference the following targeting sequence was

inserted into the pSUPER vector to knock-down human Zyxin:50-GAAGGTGAGCAGTATTGAT-30, or the following dsRNAssynthesised by Dharmacon were used: 50-GTGTTACAAGTGT-GAGGAC-30 or 50-GCCCAAAGTGAATCCCTT-30. The follow-ing target sequences were also used: HIPK2 50-CAC CTA CGAGGT CTT AGA G-30 and Siah-1 50-GATAGGAACACGCAAG-CAA-30. For the control experiments the following sequencetargeting GL2 firefly luciferase 50-CGTACGCGGAA-TACTTCGA-30 was used (44) either as dsRNA oligo or inpSUPER. All siRNA sequences were verified to confirm theirspecificity to the respective target mRNA. Stable knock-downswere done by calcium phosphate precipitation of pSUPER-shGL2 and pSUPER-shZyxin along with pWZL-neo intoHepG2 cells and subsequent selection of G418-resistant cellpools.

Immunoprecipitation and immunoblottingFor coimmunoprecipitation experiments, cells were lysed in

buffer containing 150 mmol/L NaCl, 50 mmol/L HEPES, pH7.5, 5 mmol/L EDTA, 0.5% NP-40, and protease inhibitors(Complete without EDTA, Roche; Mg132, Biomol; and PMSF,Applichem) or 250 mmol/L NaCl, 20 mmol/L Tris-HCl, pH 7.4,5 mmol/L EDTA, 1% NP-40, 25 mmol/L NaF, 10% glycerol, andprotease inhibitors. For the HIPK2– Zyxin coimmunoprecipi-tation, cells were lysed in buffer containing 50 mmol/L Hepes,

Regulation of the HIPK2-p53 Signaling Axis by Zyxin

www.aacrjournals.org Cancer Res; 71(6) March 15, 2011 2351




pH 7.4, 150 mmol/L NaCl, 10% glycerol, 1% Triton X-100, 1.5mmol/L MgCl2, 1 mmol/L EGTA, and protease inhibitors.Mouse Flag (M2), mouse Myc or mouse HA antibodies wereused with protein-A/G–coupled sepharose beads (SantaCruz). After incubation at 4�C on a rotating wheel the beadswere washed 3 times in NP-40 buffer (150 mmol/L NaCl, 50mmol/L Hepes, pH 7.5, 5 mmol/L EDTA, 0.5%, NP40). Fortotal-cell lysates, cells were either lysed in buffer containing 20mmol/L Tris/HCl, pH7.4, 1% NP-40, 150 mmol/L NaCl, 5mmol/L EDTA, 10% glycerol, 25 mmol/L NaF, and 1% SDS,and DNA was sheared by sonication, or cells were lysed in thesame buffer containing only 0.1% SDS without sonication.Immunoblotting was done as described (10). Quantificationswere done using the ImageJ software.

GST protein purification, in vitro translations and GSTpulldowns

GST proteins were purified from E. coli BL21 by standardprotocols. For Siah and LIM constructs, bacteria were incu-bated in the presence of 0.5 mmol/L Zinc. HIPK2 and Zyxinwere in vitro translated using the TNT coupled ReticulocyteLysate System (Promega). Pulldowns were incubated for 4 to 6hours on a rotating wheel at 4�C in in vitro interaction buffer(0.05% NP-40, 1 mmol/L Na3VO4 and 1 mmol/L PMSF in PBS),washed 3 times for 10 minutes in the same buffer, denatured,resolved by SDS page, and gels were subsequently Coomassie-stained and dried, and the radioactive signal was detectedeither by autoradiography or by phosphoimager.

Results

Zyxin interacts with HIPK2Using the N-terminal part of HIPK2 (encoding amino acids

1–565) as bait in a yeast 2-hybrid screen (34) against a fetalhuman brain cDNA library, we identified 2 identical cDNAclones encoding the C-terminal region of Zyxin harboring itsLIM domains (Fig. 1A). This interaction was confirmed in vitroand further mapped to LIM domains 1 and 2 of Zyxin and theN-terminal 188 amino acids of HIPK2 (Fig. 1B and C). Theinteraction between Zyxin and HIPK2 could also be detectedin intact cells by coimmunoprecipitation experiments(Fig. 1D), which suggests that HIPK2 and Zyxin interact invivo. These data indicate interaction of HIPK2 and Zyxin invitro and in vivo (a schematic view is shown in Fig. 1E). Wefailed to demonstrate interaction of endogenous HIPK2 andZyxin proteins, which is likely due to complex formation ofboth factors at particular multiprotein domains, such ascytoskeletal structures and nuclear bodies which are veryhard to solubilize under conditions which preserve pro-tein–protein interactions. In fact, immunofluorescence stain-ings of endogenous HIPK2 and endogenous Zyxin showedcolocalization of both factors at cell edges (most likely repre-senting focal contacts) and in a subset of HIPK2-containingnuclear bodies (Fig. 1F).

Zyxin regulates HIPK2 protein levelsTherefore, we proceeded to analyze the functional interac-

tion between HIPK2 and Zyxin. Intriguingly, acute knock-

down of endogenous Zyxin in various cancer cell lines stronglyreduced HIPK2 steady-state protein levels in unstressed cells,whereas HIPK2 mRNA levels remained unchanged (Fig. 2Aand B). Stable Zyxin knockdown with a pSuper constructcontaining an independent Zyxin target sequence also showedstriking reduction of the HIPK2 levels (Fig. 2C). Using a gain offunction approach, we found that ectopic expression of Myc-tagged Zyxin leads to HIPK2 accumulation in a dose-depen-dent manner. Interestingly, a Zyxin protein that was predo-minantly targeted to the nucleus by addition of the SV40 NLSand point mutation of the internal NES sequence (Nuc-Zyxin)was even slightly more efficient in stabilizing ectopicallyexpressed HIPK2 than the wild-type form of Zyxin (Fig. 2Dand E), hinting at a role for nuclear Zyxin in this process.Taken together, these results indicate that Zyxin regulatesHIPK2 stability.

Zyxin inhibits HIPK2 degradation in a Siah-1–dependent fashion

We and others have recently shown that HIPK2 steady-statelevels are largely controlled by regulated proteasomal degra-dation (6–9). Therefore, we examined whether reduced HIPK2protein levels in Zyxin-depleted cells originate from enhancedHIPK2 protein destabilization. Effective proteasome inhibi-tion (as evident by accumulation of the proteasome targetp53) with the proteasome inhibitor MG-132 fully rescuedHIPK2 expression (Fig. 3A), indicating that Zyxin depletionindeed results in increased HIPK2 degradation.

One important mediator of HIPK2 breakdown is the E3ubiquitin ligase Siah-1 (6, 8, 35). Because Zyxin depletionresults in proteasome-dependent HIPK2 degradation, weinvestigated if Zyxin protects HIPK2 from degradation byantagonizing Siah-1 function. As expected, Siah-1 expressionresulted in efficient HIPK2 degradation (Fig. 3B). Remarkably,coexpression of Zyxin rescued HIPK2 levels even in presenceof its ubiquitin ligase (Fig. 3B). These findings indicate thatZyxin expression protects HIPK2 from Siah-1-mediated degra-dation.

Next we investigated whether knock-down of Zyxin maylead to Siah-1–dependent HIPK2 degradation. To this end, weknocked down Siah-1 by RNAi in shZyxin cells. Strikingly,knock-down of Siah-1 specifically rescued endogenous HIPK2expression in shZyxin cells (Fig. 3C). Taken together, thesefindings suggest that depletion of Zyxin results in Siah-1–dependent HIPK2 degradation.

Zyxin colocalizes and physically interacts with Siah-1Because of the functional interaction of Zyxin with Siah-1,

we next asked whether both molecules physically interact. Tothis end, we performed coimmunoprecipitation analyses fromcell lysates expressing Myc-Zyxin and HA-Siah-1. Interestingly,ligase-deficient Siah-1 (Siah-1C44S) was readily coimmunopre-cipitated with Zyxin, in contrast to wild-type Siah-1 (Fig. 4A).Nuc-Zyxin showed a slightly increased binding to Siah-1 incomparison to the wild-type form (Fig. 4B). Similar resultswere obtained by reciprocal immunoprecipitation analyses(Fig. 4C). Consistent with these findings, indirect immuno-fluorescence staining and confocal microscopy revealed that

Crone et al.

Cancer Res; 71(6) March 15, 2011 Cancer Research2352




ligase-deficient Siah-1 as well as wild-type Siah-1 readilycolocalized with Nuc-Zyxin (Fig. 4F and H). Siah-1C44S andwild-type Siah-1 showed a comparable subcellular distribu-tion (Fig. 4D). Furthermore, wild-type Zyxin and wild-typeSiah-1 colocalized in the cytoplasm (Fig. 4G), however, to alesser extent than wild-type Zyxin and Siah-1C44S (Fig. 4E).

Thus, these findings suggest that Siah-1 and Zyxin form aprotein complex, which may occur preferentially in the cellnucleus.

To examine whether Zyxin and Siah-1 may interact directly,we performed GST pulldown assays. In vitro translated 35S-labeled Zyxin was efficiently pulled down by GST-Siah1

Kinase domain 1,1911

Kinase domain 5651Bait:

HIPK2

Isolated clone

A

C D

-LI

M 2

/3

-LIM

1/2

Inpu

t

LIM1NE

S

Pro LIM2LIM3 2751

LIM1LIM2LIM3368 572

Zyxin

in Y2H screen-1

-188

-18

9-52

0

Inpu

t

B

WB: 250-

Flag-HIPK2 - +Myc-Zyxin + +

Autoradio-gram

Coomassiestaining

100 -

GS

T

GS

T

GS

T-

10%

HIPK2

GST

LIM1/2LIM2/3

40-

33-

24

55-

GS

T

GS

T-

GS

T-

10%

Zyxin

189-5201-188

72 -55 -40 -

72 -55 -40 -33 -

Flag

WB: Flag

WB: Myc

130

250

130lysate

IP: Flag

95

-

-

-

-

Zyxin

HIPK2

HIPK2

LIM1NE

S

Pro LIM2LIM3 Kinase domain2751 1,1911

EHIPK2 Zyxin

GST24-GST

24 -WB: Myc

95-Zyxin

F

Merge/DNAMergeHIPK2 Zyxin

DNAMergeHIPK2 Zyxin

Figure 1. Zyxin and HIPK2 interact and colocalize. A, schematic representation of the Zyxin fragment recovered in a Yeast 2 hybrid screen with theHIPK2 N-terminus as bait. B and C, GST pulldown assays with the indicated GST fusions (B, HIPK2 fragments; C, Zyxin fragments) and 35S-labeled,in vitro translated proteins as indicated. D, Western blot showing precipitated Flag-HIPK2 and coprecipitated Myc-tagged Zyxin. Expression levels in thelysates are shown below. E, schematic representation of the HIPK2/Zyxin interaction domains deduced from the pulldown assays. F, confocal images ofimmunofluorescence stainings of endogenous HIPK2 (green) and Zyxin (red) in preextracted U2OS cells. Colocalization is shown in yellow. DNA wascounterstained with Hoechst (last panels).






(Fig. 4I), suggesting that the interaction between both proteinsis indeed direct. Further mapping experiments indicated thatthe RING domain of Siah-1 (a.a. 1–80) mediates the interactionwith Zyxin (Fig. 4J). Taken together, these results indicate thatZyxin physically interacts with Siah-1.

Zyxin interferes with Siah-1 homodimerizationBecause Siah-1 forms dimers via its substrate binding

domain (36, 37), we next assessed whether Zyxin regulatesSiah-1 homodimerization. To this end we coexpressed wild-type, ligase-proficient HA-Siah-1 and Flag-Siah-1 proteins inpresence or absence of Myc- (Nuc-) Zyxin and investigatedSiah-1 homodimerization by coimmunoprecipitation ana-lyses. In the absence of Zyxin, HA-Siah-1 efficiently copreci-pitated with Flag-Siah-1 (Fig. 5A). In contrast, in presence of

Zyxin the homodimerization of Siah-1 was significantlyreduced (Fig. 5A), and again, Nuc-Zyxin showed a slightlystronger effect. A comparable interfering effect of Zyxin onSiah-1C44S homodimer formation was observed (Fig. 5B).Taken together, these data suggest that Zyxin may modulateHIPK2 stability through interference with the assembly offunctional active Siah-1 dimers.

Zyxin accumulates upon DNA damage induced by UVand adriamycin treatment

To get insight into the functional role of endogenouslyexpressed Zyxin in the DNA damage response, we examinedZyxin protein levels in response to DNA damage in humanHepG2 hepatoma cells. Interestingly, lethal UV damage(70 J/m2) (6) resulted in clear Zyxin accumulation

A B Csi

GL2

siZ

yx

siH

IPK

2HIPK2

Zyxin L2 yx PK

2

shG

L2

shZ

yx

HIPK2Zyxin

Actin

ZyxinActin

T-P

CR

HIPK2

Zyxin

Actin

siG

L

siZ

y

siH

IP

Zyxin

Actin

ZyxinActin

-PC

R

LIM1NE

S

Pro LIM2LIM3

-354-KEVEELEQLT-363

LIM1NE

SPro LIM2LIM3

-354-KEAEEAEQLT-363

NLS

U2OS

HIPK2

RT

D

MCF7

HepG2

HIPK2Actin

RT

nixyZ-cuN-cyMnixyZ-cyM Merge/DNA Merge/DNA

GE

Flag-HIPK2Myc-Zyxin

Myc-Nuc-Zyxin

+ - +- + +- - -

+ + +

-+++

++++- -

short exposure

long exposure

HIPK2

HIPK2

GFP

WB: Flag

WB: Flag

Zyxin

GFP

WB: Myc

GFP

Figure 2. Zyxin regulates HIPK2stability. A and B, Western blot ofU2OS (A) or MCF7 (B) cellstransfected with the indicatedsiRNA oligos, probed with theindicated antibodies. Actin servesa loading control. A, knockdownefficiency and HIPK2 mRNA levelsare controlled by RT-PCR(bottom). C, Western blot (top) ofHepG2 cell pools stablytransfected with the indicatedshRNA plasmids. Zyxin and HIPK2mRNA levels are controlled by RT-PCR (bottom). D, HT1080 cellsstained for exogenouslyexpressed, Myc-tagged wild-typeZyxin or nuclear-targeted (Nuc-)Zyxin. The cartoons show therespective constructs withmutated residues depicted in red.E, cotransfection of Flag-HIPK2and increasing amounts of wild-type or Nuc-Zyxin in 293T cells.GFP serves as transfectioncontrol.

Crone et al.





(Fig. 6A). In addition, Zyxin accumulation correlated withHIPK2 stabilization and p53 Ser46 phosphorylation (Fig. 6A).Sublethal UV damage (20 J/m2; ref. 6), however, resulted inweak and transient Zyxin accumulation (Fig. 6A). Further-more, cells treated with a lethal dose of the DNA-damagingchemotherapeutic drug adriamycin showed elevated Zyxinlevels (Fig. 6B), indicating that Zyxin accumulates inresponse to severe DNA damage, and that Zyxin accumula-tion correlates with HIPK2 stabilization and p53 Ser46phosphorylation.We also addressed the subcellular localization of endogen-

ous Zyxin in U2OS and HepG2 cells before and after UVtreatment, using indirect immunofluorescence staining andconfocal microscopy. Zyxin predominantly resided in thecytoplasm in unstressed cells. Most cells only showed weaknuclear staining of Zyxin, and no significant changes in thesubcellular distribution of Zyxin were detectable after DNAdamage (data not shown).

Zyxin depletion inhibits DNA damage–induced p53Ser46 phosphorylation and apoptotic caspaseactivationTo examine the functional relevance of Zyxin in DNA

damage–induced HIPK2 stabilization and p53 Ser46 phos-phorylation, we used HepG2 cells stably depleted of Zyxin(shZyxin) and control cells (shGL2). Cells were exposed to UVlight, a well-established HIPK2-activating stimulus (10, 11),and subsequently analyzed by immunoblotting. In accordancewith published data (6, 8), HIPK2 was stabilized upon UV anda robust p53 Ser46 phosphorylation was evident in the shGL2control cell pool (Fig. 6C). In contrast, Zyxin-depleted cells

showed a clear reduction in UV-induced HIPK2 stabilizationand p53 Ser46 phosphorylation (Fig. 6C). Zyxin-depleted cellsshowed no signs of caspase activation upon UV damage,whereas the control cell pool showed characteristic cas-pase-dependent cleavage of the caspase substrate proteinPARP (Fig. 6C). Taken together, these findings demonstratea role of Zyxin in the regulation of DNA damage–induced p53Ser46 phosphorylation and apoptotic caspase activation.

Discussion

The Ser/Thr protein kinase HIPK2 is an emerging regulatorof cell fate decisions in development, morphogenesis, andgenotoxic stress (3–5). To activate the cell death responseupon chromosomal damage, HIPK2 stimulates various down-stream signaling pathways most prominently the tumor sup-pressor p53. HIPK2-mediated phosphorylation of p53 at Ser46potentiates the activation of proapoptotic p53 target genes,which finally leads to cell death (10, 11). Activation of HIPK2 inresponse to genotoxic stress is facilitated through the check-point kinases ATM and ATR, which phosphorylation-depen-dently inhibit HIPK2 proteolysis by the ubiquitin ligase Siah-1through site-specific phosphorylation of Siah-1 (6).

Our findings here demonstrate that the LIM domain proteinand focal adhesion component Zyxin is essential for HIPK2stabilization, p53 Ser46 phosphorylation and caspase-activa-tion in response to DNA damage. In addition, our data indicatethat Zyxin is also essential to maintain the low level steady-state HIPK2 protein expression in unstressed cells, whichsuggests that HIPK2 may fulfil important, but so far onlylittle investigated functions in cells in the absence of genotoxic

y yy y

α-GFPα GFP

shZyxin

siLu

ci

siS

iah-

1CB

L2 xin

xin

+ M

G 1

32A+ + + + Flag-HIPK2

- + + + HA-Siah1

- - + - Myc-wt-Zyxin

HIPK2

actin

siG

siZ

siZ

Zyxin

Actin

p53

HIPK2

siLu

ci

siS

iah-

1

siLu

ci

siS

iah-

1

α-myc

WB:

α-HA

α-Flag

- - - + Myc-Nuc-Zyxin

RT

-PC

R

actin

Siah-1

shZyxin HepG2

U2OSH1299

Figure 3. Zyxin interferes with proteasome-dependent HIPK2 degradation. A, U2OS cells transfected with control or Zyxin siRNA and treated with theproteasome inhibitor MG132 (20 mmol/L) for 12 hours as indicated. p53 serves as positive control for proteasome inhibition, actin is used as loading control. B,Western blot of H1299 cells transiently transfected with the indicated constructs. C, Western blot (top) of stably Zyxin-depleted HepG2 cell pools additionallytransfected with control or Siah-1 siRNA. Actin serves as loading control. Siah-1 knockdown was determined by RT-PCR (bottom).






WB: Myc/HA IP HAWB M WB: Myc/HA IP HAWB M

IP: Myc

Nuc-ZyxinZyxin

HA-Siah-1C44SMyc-Zyxin

Myc-Nuc-Zyxin

+ + +- + -- - +

CB

IP: HA WB: Myc

Nuc-ZyxinZyxin

HA-Siah-1C44SMyc-Zyxin

Myc-Nuc-Zyxin

- + -+ + -- - +

+-+

IP: HA Zyxin

HA-Siah-1C44SHA-Siah-1Myc-Zyxin

- - +- + -+ + +

A

Nuc-ZyxinZyxin

lysateWB: Myc/HA

Siah-1n.s.

Siah-1

: WB: HA

lysateWB: HA

lysateWB: Myc

Nuc-ZyxinZyxin

Siah-1

Siah-1

: yc

IP: HA WB: HA

lysate:WB: Myc

Siah-1IgG

Zyxin

IgGratio Zyxin/Siah: 1 1.6

n.s.

Myc-Nuc-Zyxin HA-Siah-1C44S Merge Merge/DNA

Myc-Zyxin HA-Siah-1C44S Merge Merge/DNAHA-Siah-1

HA-Siah-1C44S

Siah-1/DNA

Siah-1C44S/DNA

D E

F

Myc-Zyxin HA-Siah-1 Merge Merge/DNAG

Myc-Nuc-Zyxin HA-Siah-1 Merge Merge/DNAH

I

35S-Zyxin

Autoradiogram

10%

inpu

t

GS

T

GS

T-S

iah-

1

Autoradiogram

35S-Zyxin

10%

inpu

t

GS

T

GS

T-S

iah-

1 1–

80J

GS

T-S

iah-

1 80

–282

GST-Siah-1

Coomassiestaining

GSTCoomassie

staining

GST

Siah-1 80-282

Siah-1 1-80

Figure 4. Zyxin colocalizes and interacts with Siah-1. A—C, Western blots of coimmunoprecipitations of exogenously expressed Myc-Zyxin or Myc-Nuc-Zyxin and HA-Siah-1 or ligase-deficient HA-Siah-1C44S from 293T cells probed with the antibodies indicated. D–H, confocal images of U2OS cells expressingthe indicated Zyxin (green) and Siah-1 (red) proteins. Colocalization is shown in yellow. I and J GST pulldown assays were performed with the indicated GST-Siah-1 fusion proteins and 35S-labeled in vitro translated Zyxin.

Crone et al.





stress. However, the functional relevance of HIPK2-Zyxininteraction in unstressed cells and DNA-damaged cells remainto be clarified and may pave the way to uncover novel cellularfunctions of HIPK2 and Zyxin. Moreover, potential functionalinterplay between HIPK2 and Zyxin in response to DNAdamage remains to be elucidated in the future.Previous reports have linked Zyxin to apoptosis regulation

and indicate both pro- and antiapoptotic activities of Zyxin,suggesting tissue and cell-type specific as well as stimulus-dependent functions of Zyxin (23, 25, 26). For example, Zyxinhas been shown to exert oncogenic activities by facilitatingcell migration in melanoma cells (38, 39), but it can also actas a tumor suppressor in Ewing carcinoma and prostatecancer cells (32, 33). Similar oncogenic versus tumor sup-pressive activities have been attributed to the ubiquitinligase Siah-1 (40, 41). Because our results here demonstrate

that Zyxin and Siah-1 interact and, furthermore, that Zyxinmodulates Siah-1 dimerization and thereby presumably itsactivity, it is tempting to speculate that increased Zyxinlevels, such as in case of DNA damage, contribute to uncou-pling the ubiquitin ligase Siah-1 from its substrates. As Zyxinpotently regulates HIPK2 stability in a Siah-1–dependentfashion, we propose that Zyxin may control HIPK2 stabilitythrough regulation of Siah-1 availability. The resulting sta-bilization of the Siah-1 target protein HIPK2 then alters thefate of the cells subjected to DNA damage by activating theapoptotic program.

Remarkably, in intact cells exclusively the ligase-deficientSiah-1 point mutant but not the ligase-proficient wild-typeform of Siah-1 could readily be shown to interact with Zyxin.This may suggest that the ligase activity of Siah-1 interfereswith Zyxin binding, possibly through interaction with the

Figure 5. Zyxin regulates Siah-1homodimerization. A and B,Western blot of acoimmunoprecipitationexperiment. 293T cells werecotransfected with (A) HA- andFlag-Siah-1 or (B) HA- and Flag-Siah-1C44S in the presence of theindicated Zyxin constructs andFlag-Siah-1 was precipitated fromthe lysates. Quantification of theratio of coprecipitated HA-Siah-1to precipitated Flag-Siah-1 wasperformed using the ImageJsoftware.

HA-Siah-1

Myc-Zyxin

+ + +

- - +Myc-Nuc-Zyxin - + -

Flag-Siah-1+

--

- + + +HA-Siah-1C44S

Myc-Zyxin

+ + +

- - +Myc-Nuc-Zyxin - + -

Flag-Siah-1C44S+

--

- + + +

BA

Flag-Siah-1IgG

HA-Siah-1

Zyxin

IP: Flag WB: HA

IP: Flag WB: Flag

lysate:WB: Myc

ratio HA/Flag: 1 0.3 0.6

HA-Siah-1

Zyxinlysate:

WB: Myc

lysate:

HA-Siah-1

Flag-Siah-1

IgG

IP: Flag WB: HA

IP: Flag WB: Flag

HA-Siah-1

Flag-Siah-1lysate:WB: Flag

lysate:WB: HA

HA Siah 1

Flag-Siah-1lysate:WB: Flag

WB: HA

Figure 6. Zyxin regulates DNAdamage-induced p53 Ser46phosphorylation, A and B,Western blots of HepG2 treatedwith UV (A) or adriamycin(B), probed with the indicatedantibodies. C, Western blot ofstably control- or Zyxin-depletedHepG2 cell pools treated withlethal UV doses, probed with theindicated antibodies. Note theincrease in Zyxin levels after DNAdamage induction. Caspase-mediated PARP cleavage wasused as an indicator of apoptosisinduction.

A

Zyxin

shGL2 shZyxin

untr

.

24 h

48 h

24 h

48 h

untr

.

70 J/m2 UV - -+ + + +

24 h

48 h

24 h

C

untr

eate

d

+Adria

HIPK2

Zyxin

untr

eate

d

6h 16 h

Zyxin

20 J/m2 70 J/m2

B

HIPK2

pSer46 p53

p53

p116 PARPp85

actin

HIPK2

p53

GAPDH

p53

HIPK2

actin

HepG2

p53 Ser46

p53 Ser46

actinGAPDH

HepG2

HepG2






E2 enzyme or Siah-1 autoubiquitination. Nontheless, theinhibiting effect of Zyxin on the dimerization of the wild-typeSiah-1 proteins is quite pronounced, arguing that a weak andtransient interaction between both factors may occur. Thisinterpretation is further supported by our finding that wild-type Siah 1 and Zyxin show partial colocalization. Althoughour data clearly indicate that Zyxin regulates HIPK2 stabilitythrough interference with Siah-1 function, it remains to bedetermined whether direct binding of Zyxin to Siah-1 and/orHIPK2 is required for the observed protection of HIPK2 fromSiah-1–mediated breakdown.

Taken together, our findings here indicate a novel functionfor Zyxin in the regulation of the p53 response and cell fatedecision in response to DNA damage. Based on our observa-tions, it appears conceivable to speculate that downregulationof Zyxin, such as described in a subset of human breast cancers(42), might influence the responsiveness to DNA-damagingcancer treatments such as radio- and chemotherapy.

Disclosure of Potentials Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

We are grateful to Tilman Polonio-Vallon for generation of Siah-1 constructs,the DKFZ core facilities for DNA sequencing and to the members of theHofmann laboratory for helpful comments and discussions.

Grant Support

This study was supported by funds from the Deutsche Forschungsge-meinschaft, the Deutsche Krebshilfe, the Helmholtz-Gemeinschaft and theBaden-W€urttemberg Stiftung (all to T.G. Hofmann).

The costs of publication of this article were defrayed in part by the paymentof page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received September 3, 2010; revised December 22, 2010; accepted January 12,2011; published OnlineFirst January 19, 2011.

References1. Bartek J, Bartkova J, Lukas J. DNA damage signalling guards against

activated oncogenes and tumour progression. Oncogene 2007;26:7773–9.

2. Branzei D, Foiani M. Regulation of DNA repair throughout the cellcycle. Nat Rev Mol Cell Biol 2008;9:297–308.

3. Bitomsky N, Hofmann TG. Apoptosis and autophagy: Regulation ofapoptosis by DNA damage signalling – roles of p53, p73 and HIPK2.FEBS J 2009;276:6074–83.

4. Sombroek D, Hofmann TG. How cells switch HIPK2 on and off. CellDeath Differ 2009;16:187–94.

5. Calzado MA, Renner F, Roscic A, Schmitz ML. HIPK2: a versatileswitchboard regulating the transcription machinery and cell death.Cell Cycle 2007;6:139–43.

6. Winter M, Sombroek D, Dauth I, Moehlenbrink J, Scheuermann K,Crone J, et al. Control of HIPK2 stability by ubiquitin ligase Siah-1 andcheckpoint kinases ATM and ATR. Nat Cell Biol 2008;10:812–24.

7. Choi DW, Seo YM, Kim EA, Sung KS, Ahn JW, Park SJ, et al.Ubiquitination and degradation of homeodomain-interacting proteinkinase 2 by WD40 repeat/SOCS box protein WSB-1. J Biol Chem2008;283:4682–9.

8. Kim SY, Choi DW, Kim EA, Choi CY. Stabilization of HIPK2 by escapefrom proteasomal degradation mediated by the E3 ubiquitin ligaseSiah1. Cancer Letters 2009;279:177–84.

9. Dauth I, Kruger J, Hofmann TG. Homeodomain-Interacting ProteinKinase 2 Is the Ionizing Radiation-Activated p53 Serine 46 Kinase andIs Regulated by ATM. Cancer Res 2007;67:2274–9.

10. Hofmann TG, Moller A, Sirma H, Zentgraf H, Taya Y, Droge W, et al.Regulation of p53 activity by its interaction with homeodomain-inter-acting protein kinase-2. Nat Cell Biol 2002;4:1–10.

11. D'Orazi G, Cecchinelli B, Bruno T, Manni I, Higashimoto Y, Saito S,et al. Homeodomain-interacting protein kinase-2 phosphorylates p53at Ser 46 and mediates apoptosis. Nat Cell Biol 2002;4:11–9.

12. Di Stefano V, Rinaldo C, Sacchi A, Soddu S, D'Orazi G. Home-odomain-interacting protein kinase-2 activity and p53 phosphoryla-tion are critical events for cisplatin-mediated apoptosis. Exp Cell Res2004;293:311–20.

13. Moller A, Sirma H, Hofmann TG, Rueffer S, Klimczak E, DrogeW, et al.PML is required for homeodomain-interacting protein kinase 2(HIPK2)-mediated p53 phosphorylation and cell cycle arrest but isdispensable for the formation of HIPK domains. Cancer Res2003;63:4310–4.

14. Hofmann TG, Will H. Body language: the function of PML nuclearbodies in apoptosis regulation. Cell Death Differ 2003;10:1290–9.

15. Bernardi R, Pandolfi PP. Role of PML and the PML-nuclear body in thecontrol of programmed cell death. Oncogene 2003;22:9048–57.

16. Krieghoff-Henning E, Hofmann TG. Role of nuclear bodies in apop-tosis signalling. Biochim Biophys Acta 2008;1783:2185–94.

17. Dellaire G, Bazett-Jones DP. Beyond repair foci: subnuclear domainsand the cellular response to DNAdamage. Cell Cycle 2007;6:1864–72.

18. Kadrmas JL, Beckerle MC. The LIM domain: from the cytoskeleton tothe nucleus. Nat Rev Mol Cell Biol 2004;5:920–31.

19. Nix DA, Fradelizi J, Bockholt S, Menichi B, Louvard D, Friederich E,et al. Targeting of zyxin to sites of actin membrane interaction and tothe nucleus. J Biol Chem 2001;276:34759–67.

20. Hoffman LM, Jensen CC, Kloeker S, Wang CL, Yoshigi M, BeckerleMC. Genetic ablation of zyxin causes Mena/VASP mislocalization,increased motility, and deficits in actin remodeling. J Cell Biol2006;172:771–82.

21. Nix DA, Beckerle MC. Nuclear-cytoplasmic shuttling of the focalcontact protein, zyxin: a potential mechanism for communicationbetween sites of cell adhesion and the nucleus. J Cell Biol1997;138:1139–47.

22. HervyM, Hoffman L, Beckerle MC. From themembrane to the nucleusand back again: bifunctional focal adhesion proteins. Curr Opin CellBiol 2006;18:524–32.

23. Kato T, Muraski J, Chen Y, Tsujita Y, Wall J, Glembitski CC, et al. Atrialnatriuretic peptide promotes cardiomyocyte survival by cGMP-dependent nuclear accumulation of zyxin and Akt. J Clin Invest2005;115:2716–30.

24. Yoshigi M, Hoffman LM, Jensen CC, Yost HJ, Beckerle MC.Mechanical force mobilizes zyxin from focal adhesions to actinfilaments and regulates cytoskeletal reinforcement. J Cell Biol2005;171:209–15.

25. Cerisano V, Aalto Y, Perdichizzi S, Bernard G, Manara MC, Benini S,et al. Molecular mechanisms of CD99-induced caspase-independentcell death and cell-cell adhesion in Ewing's sarcoma cells: actin andzyxin as key intracellular mediators. Oncogene 2004;23:5664–74.

26. Chan CB, Liu X, Tang X, Fu H, Ye K. Akt phosphorylation of zyxinmediates its interaction with acinus-S and prevents acinus-triggeredchromatin condensation. Cell Death Differ 2007;14:1688–99.

27. Pierantoni GM, Fedele M, Pentimalli F, Benvenuto G, Pero R, VigliettoG, et al. High mobility group I (Y) proteins bind HIPK2, a serine-threonine kinase protein which inhibits cell growth. Oncogene2001;20:6132–41.

28. Pierantoni GM, Rinaldo C, Mottolese M, Di Benedetto A, Esposito F,Soddu S, et al. High-mobility group A1 inhibits p53 by cytoplasmicrelocalization of its proapoptotic activator HIPK2. J Clin Invest2007;117:693–702.

29. Li XL, Arai Y, Harada H, Shima Y, Yoshida H, Rokudai S, et al.Mutations of the HIPK2 gene in acute myeloid leukemia and

Crone et al.





myelodysplastic syndrome impair AML1- and p53-mediated tran-scription. Oncogene 2007;26:7231–9.

30. Wei G, Ku S, Ma GK, Saito S, Tang AA, Zhang J, et al. HIPK2represses beta-catenin-mediated transcription, epidermal stem cellexpansion, and skin tumorigenesis. Proc Natl Acad Sci U S A 2007;104:13040–5.

31. Sanchez-Carbayo M, Socci ND, Charytonowicz E, Lu M, PrystowsyM, Childs G, et al. Molecular profiling of bladder cancer using cDNAmicroarrays: defining histogenesis and biological phenotypes. CancerRes 2002;62:6973–80.

32. Amsellem V, Kryszke MH, Hervy M, Subra F, Athman R, Leh H, et al.The actin cytoskeleton-associated protein Zyxin acts as a tumorsuppressor in Ewing tumor cells. Exp Cell Res 2005;304:443–56.

33. Yu YP, Luo JH. Myopodin-mediated suppression of prostate cancercell migration involves interaction with zyxin. Cancer Res 2006;66:7414–9.

34. Hofmann TG, Jaffray E, Stollberg N, Hay RT, Will H. Regulation ofhomeodomain-interacting protein kinase 2 (HIPK2) effector functionthrough dynamic small ubiquitin-related modifier-1 (SUMO-1) mod-ification. J Biol Chem 2005;280:29224–32.

35. Moehlenbrink J, Bitomsky N, Hofmann TG. Hypoxia suppresseschemotherapeutic drug-induced p53 Serine 46 phosphorylation bytriggering HIPK2 degradation. Cancer Letters 2009;292:119–24.

36. Matsuzawa S, Li C, Ni CZ, Takayama S, Reed JC, Ely KR. Structuralanalysis of Siah1 and its interactions with Siah-interacting protein(SIP). J Biol Chem 2003;278:1837–40.

37. Polekhina G, House CM, Traficante N, Mackay JP, Relaix F, SassoonDA, et al. Siah ubiquitin ligase is structurally related to TRAF andmodulates TNF-alpha signaling. Nat Struct Biol 2002;9:68–75.

38. Van Der Gaag EJ, Leccia MT, Dekker SK, Jalbert NL, Amodeo DM,Byers HR. Role of Zyxin in differential cell spreading and proliferationof melanoma cells and melanocytes. The Journal of investigativedermatology 2002;118:246–54.

39. Drees BE, Andrews KM, Beckerle MC. Molecular dissection of zyxinfunction reveals its involvement in cell motility. J Cell Biol 1999;147:1549–60.

40. Telerman A, Amson R. Themolecular programme of tumour reversion:the steps beyond malignant transformation. Nat Rev Cancer2009;9:206–16.

41. House CM, Moller A, Bowtell DD. Siah proteins: novel drug targets inthe Ras and hypoxia pathways. Cancer Res 2009;69:8835–8.

42. Wang W, Huper G, Guo Y, Murphy SK, Olson JA Jr., Marks JR.Analysis of methylation-sensitive transcriptome identifies GADD45aas a frequently methylated gene in breast cancer. Oncogene 2005;24:2705–14.

43. Hofmann TG, Stollberg N, Schmitz ML, Will H. HIPK2 RegulatesTransforming Growth Factor-beta-Induced c-Jun NH(2)-TerminalKinase Activation and Apoptosis in Human Hepatoma Cells. CancerRes 2003;63:8271–7.

44. Milovic-Holm K, Krieghoff E, Jensen K, Will H, Hofmann TG. FLASHlinks the CD95 signaling pathway to the cell nucleus and nuclearbodies. EMBO J 2007;26:391–401.






2011;71:2350-2359. Published OnlineFirst January 19, 2011.Cancer Res Johanna Crone, Carolina Glas, Kathrin Schultheiss, et al. AxisZyxin Is a Critical Regulator of the Apoptotic HIPK2-p53 Signaling

Updated version

10.1158/0008-5472.CAN-10-3486doi:

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/71/6/2350.full#ref-list-1

This article cites 44 articles, 15 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/71/6/2350.full#related-urls

This article has been cited by 6 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/71/6/2350To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-10-3486

http://cancerres.aacrjournals.org/content/71/6/2350.full#ref-list-1

http://cancerres.aacrjournals.org/content/71/6/2350.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/71/6/2350


zyxin is a critical regulator of the apoptotic hipk2-p53 ... · suppressor in ewing sarcoma (32)...

Documents