yu_yang_200811_phd

8/3/2019 Yu_Yang_200811_PhD

http://slidepdf.com/reader/full/yuyang200811phd 1/175

THE IDENTIFICATION AND CHARACTERIZATION OF AN

INNER ACROSOMAL MEMBRANE ASSOCIATED PROTEIN,

IAM38, RESPONSIBLE FOR SECONDARY SPERM-ZONA

BINDING DURING FERTILIZATION

by

Yang Yu

A thesis submitted to the Department of Anatomy and Cell Biologyin conformity with the requirements for

the degree of Doctor of Philosophy

Queen’s UniversityKingston, Ontario, Canada

(November, 2008)

Copyright ©Yang Yu, 2008

8/3/2019 Yu_Yang_200811_PhD


ii

ABSTRACT

During mammalian fertilization, the exposure of the inner acrosomal membrane

(IAM) after acrosomal exocytosis is essential for the secondary binding between sperm

and zona pellucida (ZP) of the oocyte, a prerequisite for sperm penetration through the

ZP. The identification of the sperm protein(s) responsible for secondary binding has

posed a challenge for researchers. We were able to isolate a sperm head fraction in which

the IAM was exposed. Attached to the IAM was an electon dense layer, which we termed

the IAM extracellular coat (IAMC). The IAMC was also observable in acrosome reacted

sperm. High salt extraction removed the IAMC including a prominent 38 kDa

polypeptide, referred to as IAM38. Antibodies raised against IAM38 confirmed its

presence in the IAMC of intact, sonicated, and acrosome-reacted sperm. Sequencing of

IAM38 revealed it as the ortholog of porcine SP38, a protein that was found to bind

specifically to ZP2 but whose intra-acrosomal location was not known. We showed that

IAM38 occupied the leading edge of sperm contact with the zona pellucida during

fertilization, and that secondary binding and fertilization were inhibited in vitro by

antibodies directed against IAM38. As for the mechanism of secondary sperm-zona

binding by IAM38, we provided evidence that the synthetic peptide derived from the

ZP2-binding motif of IAM38 had a competitive inhibitory effect on both sperm-zona

binding and fertilization while its mutant form was ineffective. In summary, our study

provides a novel approach to obtain direct information on the peripheral and integral

protein composition of the IAM and consolidates IAM38 as a genuine secondary sperm-

zona binding protein. In addition, our investigation also provides an ultrastructural

8/3/2019 Yu_Yang_200811_PhD


iii

description of the origin, expression and assembly of IAM38 during spermatogenesis. It

shows that IAM38 is originally secreted by the Golgi apparatus as part of the dense

contents of the proacrosomic granules but later, during acrosome capping phase of

spermiogenesis, is redistributed to the inner periphery of the acrosomal membrane. This

relocation occurs at the time of acrosomal compaction, an obligatory structural change

that fails to occur in Zpbp1-/- knockout mice, which do not express IAM38 and are

infertile.

8/3/2019 Yu_Yang_200811_PhD


iv

CO-AUTHORSHIP

In Chapter 2, results showing the retention of the IAMC after the porcine IVF and

the blockage of porcine IVF with the IAM38 antibodies (i.e. Figure 2.9 and Figure 2.10)

were contributed by Dr. Peter Sutovsky and Dr. Young-Joo Yi at the University of

Missouri-Columbia, USA.

8/3/2019 Yu_Yang_200811_PhD


v

ACKNOWLEDGEMENTS

I would like to thank Dr. Richard Oko for his mentorship and support throughout

the years. In providing me the opportunity to work and learn in his laboratory, he offered

me the invaluable gifts of knowledge and critical thinking, which I will cherish for life.

He teaches the virtues of a good scientist not by words but through setting an excellent

example. His enthusiasm and dedication for this study were inspiring. I am sincerely

grateful for his patience, encouragement, generosity and kindness.

I would like to express my gratitude to Dr. Stephen Pang, Dr. Frederick Kan, and

Dr. Charles Graham for their guidance, support and kindness. I also thank Dr. Peter

Sutovsky and his laboratory members for their help in the porcine fertilization study.

The Oko laboratory is a very positive working environment. I have learned a lot

more than research from each of the past and present members-- Ron Tovich, Alex Wu,

Ritu Aul, Jeremi Mountjy, Zheng Qin, MongHoa Tran, and Mahmoud Aarabi. Thank you

all for the years of support and friendship. Gina Lam and Alma Barajas-Espinosa, I will

always remember the moments when we laughed and cried together. Special thanks go to

Wei Xu for her countless help in many aspects of both my work and life; to Judy

Vanhorne, for her affecting smile and kind assistance.

The staff of the Department of Anatomy and Cell Biology are always helpful

beyond their call of duty. I would like to acknowledge the great work of Anita Lister,

Marilyn McCauley, Brenda McPhail and Ita McConnell. Sincere thanks to Dr. Yat Tse,

who is always willing to provide the most valuable advice and help.

8/3/2019 Yu_Yang_200811_PhD


vi

I would like to extend my wholehearted gratitude to Judy Pang for her friendship

and encouragement. Thank you for helping me through the hard time and sharing the

happiness.

I am thankful for the financial supports provided by NSERC, Ontario Graduate

Scholarship (OGS), Ontario Graduate Scholarship in Science and Technology (OGSST)

and the R. Samuel McLaughlin Foundation.

Last, but not least, I would like to acknowledge the patience, understanding and

support of my wonderful family who all took on additional responsibilities so that I could

complete my degree. A special thank you goes to my parents, who are so generously

helpful with their unconditional love. I owe a lot to my two lovely sons, Alan and Austin.

Your smiling faces are my inspiration all the time. And a thank-you goes to Simon.

8/3/2019 Yu_Yang_200811_PhD


vii

TABLE OF CONTENTS

ABSTRACT.................................................................................................................................... ii

CO-AUTHORSHIP ...................................................................................................................... iv

ACKNOWLEDGEMENTS .......................................................................................................... v

TABLE OF CONTENTS ............................................................................................................ vii

LIST OF FIGURES ......................................................................................................................ix

LIST OF TABLES……………………………………..……………………………………….. xi

LIST OF ABBREVIATIONS…………………………………………………………………. xii

CHAPTER 1: GENERAL INTRODUCTION ............................................................................ 1

1. STRUCTURE OF THE MAMMALIAN SPERMATOZOON............................................... 2

1.1 The sperm tail .................................................................................................................... 2

1.2 The sperm head.................................................................................................................. 4

2. SPERMATOGENESIS AND THE ACROSOME BIOGENESIS.......................................... 8

2.1 General review of spermatogenesis…………………………………………………...… 8

2.2 Acrosome biogenesis ....................................................................................................... 10

2.3 Proteins secreted to the acrosome .................................................................................... 12

2.4 Compartmentalization of the acrosomal content ............................................................. 17

3. FERTILIZATION..................................................................................................................18

3.1 Overview of fertilization..................................................................................................18

3.2 Zona Pellucida ................................................................................................................. 23

3.3 Acrosome reaction or acrosomal exocytosis....................................................................27

3.4 Molecules involved in sperm-oocyte binding.................................................................. 29

3.5 Zona penetration .............................................................................................................. 40

4. PROJECT HYPOTHESES AND OBJECTIVES.................................................................. 43

CHAPTER 2: THE EXTRACELLULAR PROTEIN COAT OF THE INNER

ACROSOMAL MEMBRANE IS INVOLVED IN ZONA PELLUCIDA BINDING AND

PENETRATION DURING FERTILIZATION: CHARACTERIZATION OF ITS MOST

PROMINENT POLYPEPTIDE (IAM38) ................................................................................. 45

Abstract……………………………………………………………………………………….. 46

Introduction................................................................................................................................ 47

Materials and Methods............................................................................................................... 48

Results........................................................................................................................................ 55

Discussion.................................................................................................................................. 75

8/3/2019 Yu_Yang_200811_PhD


viii

CHAPTER 3: IAM38 BINDS THE ACROSOME REACTED SPERM TO THE ZONA

PELLUCIDA OF THE OOCYTE VIA ITS KRLn MOTIF.................................................... 83

Abstract...................................................................................................................................... 84

Introduction................................................................................................................................ 85

Materials and Methods............................................................................................................... 86 Results........................................................................................................................................ 89

Discussion.................................................................................................................................. 97

CHAPTER 4: THE ORIGIN AND ASSEMBLY OF A ZONA PELLUCIDA BINDING

PROTEIN, IAM38, DURING SPERMIOGENESIS ............................................................. 102

Abstract.................................................................................................................................... 103

Introduction.............................................................................................................................. 105

Material and Methods .............................................................................................................. 109

Results...................................................................................................................................... 111 Discussion................................................................................................................................ 126

CHAPTER 5: GENERAL DISCUSSION................................................................................ 131

Summary and Conclusions ...................................................................................................... 139

REFERENCES........................................................................................................................... 140

8/3/2019 Yu_Yang_200811_PhD


ix

LIST OF FIGURES

Figure 1.1 A human sperm drawn by Nicolaas Hartsoeker in 1692 . .............................................. 3

Figure 1.2 Diagrammatic depiction of the head of a bovine spermatozoon……………………….5 Figure 1.3 Diagram of six steps required for successful fertilization.. .......................................... 19

Figure 1.4 Schematic representation of filaments that constitute the mouse egg ZP…………… 26

Figure 1.5 Schematic representation of sperm head during the acrosomal exocytosis................. 29

Figure 2.1 Procedure for obtaining apical tips from sonicated and isolated rat sperm heads…... 57

Figure 2.2 Electron microscopic analysis of ionophore (A23187) induced acrosomal exocytosis

in the rat and hamster spermatozoa………..………………………………………… 59

Figure 2.3 Ultrastructural and biochemical consequence of 1M KCl extraction on rat sperm

apical tips.…………………………………………………………………………... 61

Figure 2.4 Extraction of IAM proteins from sonicated and isolated bull sperm heads………… 63

Figure 2.5 Western blot of sperm extracts immunolabeled with antibodies raised against the

38 kDa polypeptide…………………………………….…………………………… 65

Figure 2.6 Nucleotide sequence of bovine IAM38 cDNA and its deduced amino acid

sequence……………………………………………………………………………. 66

Figure 2.7 Immunogold localization of IAM38 in the sperm head using anti-C38 antibody….. 68

Figure 2.8 Membrane permeabilization of the sperm head is required to retrive IAM38

antigenicity by immunofluorescence………………………………………….……. 70

Figure 2.9 Fluorescent study of IAM38 in boar sperm during acrosomal exocytosis and after

zona penetration……………………………………………………………………. 71

Figure 2.10 Effect of anti-C38 antibody on swine IVF………………………………………… 74

Figure 2.11 Schematic depiction of the IAMC of apical cross-sections through a falciform

sperm head after acrosomal exocytosis and following ultra-sonication….………. 76

Figure 3.1 Effect of the KRLn peptide on sperm-oocyte secondary binding during

mouse IVF………………………………………………………………………… 92

Figure 3.2 Morphological assessment of the KRLn peptide on mouse IVF………………….. 93

Figure 3.3 Quantitative assessment of the KRLn peptide on mouse IVF…………………….. 94

Figure 3.4 Effect of anti-C38 antibody on sperm-oocyte secondary binding during

mouse IVF…………………………………………….……………………….…. 95

Figure 3.5 Effect of anti-C38 antibody on mouse fertilization during IVF………………….. 96

8/3/2019 Yu_Yang_200811_PhD


x

Figure 4.1 Developmental northern blot detection of IAM38 mRNA from the testis of

11 to 40 day-old mice…………………………………………………………… 112

Figure 4.2 Immunoperoxidase staining of paraffin-embedded testicular sections through

portions of seminiferous tubules with affinity purified anti-C38 antibody………114

Figure 4.3 High power immunoperoxidase staining of paraffin-embedded rat testicular sections with anti-C38 antibody.………………………………………………… 116

Figure 4.4 Electron micrographs of testicular sections immunogold lableled with anti-C38

antibody during the round spermatid phase of spermiogenesis…………………. 119

Figure 4.5 Electron micrographs of elongating spermatid sections immunogold labeled with

anti-C38 antibody…………………………………………………………………121

Figure 4.6 Electron micrographs illustrate the distribution of IAM38 during the cap and

maturation phases of spermiogenesis……………...……………………………...123

Figure 4.7 Electron micrograph of mature bovine spermatozoon immunogold labeled withanti-C38 antibody…………………………………………………………………124

Figure 4.8 A graphic representation of the distribution of IAM38 during spermiogenesis…..128

8/3/2019 Yu_Yang_200811_PhD


xi

LIST OF TABLES

Table 1.1 Characteristics of mouse, pig and human oocyte zona pellucida

glycoproteins.………………………………………………………………….25

8/3/2019 Yu_Yang_200811_PhD


xii

LIST OF ABBREVIATIONS

AA ……………… amino acidABC ……………… avidin-biotin-peroxidase complexADAM ……………… a disintegrin and metalloproteinase proteinAG ……………… acrosomic granuleAR ……………… acrosome reactionATP ……………… adenosine triphosphateAV ……………… acrosomic vesicleBLAST ……………… basic local alignment search toolBSA ……………… bovine serum albumincAMP ……………… cyclic adenosine monophosphateCMPase …………… cytidine monophosphatasecDNA ……………… complementary deoxyribonucleic acidCOC ……………… cumulus oocyte complexCRISP ……………… cysteine-rich secretory protein DAB ……………… diamniobenzidine tetrachlorideDAG ……………… diacylglycerolDAPI ……………… 4, 6-diamino-2-phenylindoleDIC ……………… differential interference contrastdH2O ……………… distilled water DIG ……………… digoxygeninDNA ……………… deoxyribonucleotideELISA ……………… enzyme-linked-immunosorbent serologic assayEM ……………… electron microscopyER ……………… endoplasmic reticulumES ……………… equatorial segementFITC ……………… fluorescein isothiocyanateFSH ……………… follicle stimulating hormone

g ……………… acceleration of gravityGABAA …………… gamma-aminobutyric acid type AGalTase……………… galactosyltransferaseGPI ……………… glycophosphoinositolG-protein …………… guanyl nucleotide binding proteinsGTP ……………… guanosine triphosphateGVBD ……………… germinal vesicle breakdownHEPES ……………… 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acidHCG ……………… human chorionic gonadotropinHPLC ……………… high performance liquid chromatographyHTF ……………… human tubal fluid

ICSI ……………… intracytoplasmic sperm injectionIAM ……………… inner acrosomal membraneIAMC ……………… inner acrosomal membrane coatIgG ……………… immunoglobin GIP3 ……………… inositol triphosphateIVF ……………… in vitro fertilizationkDa ……………… kilo Daltons

http://www.all-acronyms.com/cat/5/CDNA

http://www.all-acronyms.com/cat/7/CRISP

http://www.all-acronyms.com/cat/7/CRISP

http://www.all-acronyms.com/cat/5/CDNA

8/3/2019 Yu_Yang_200811_PhD


xiii

LH ……………… luteinizing hormoneLM ……………… light microscopyLR ……………… London resinMII ……………… metaphase IImM ……………… millimolar mRNA ……………… messenger ribonucleic acid

NADPase …………… nicotinamide adenine dinucleotide phosphatase NB-DNJ …………… N-butyldeoxynojirimycin NE ……………… nuclear envelope NGS ……………… normal goat serum NSF ……………… N-ethylmaleimide-sensitive factor OAM ……………… outer acrosomal membranePAS ……………… periodic acid- Schiff PAS ……………… postacrosomal sheathPAWP ……………… postacrosomal sheath WW domain binding proteinPBST ……………… PBS with 0.05% Tween-20PG ……………… proacrosomal granulesPLC ……………… phospholipase C

PMSF ……………… phenylmethylsulfonyl fluoridePMSG ……………… pregnant mare's serum gonadotropinPN ……………… pronucleusPT ……………… perinuclear thecaPVA ……………… polyvinyl alcoholPVDF ……………… polyvinylidine difluoriderRNA ……………… ribosomal ribonucleic acidRSA ……………… rabbit sperm autoantigenSAL ……………… subacrosomal layer SDS ……………… sodium dodecyl sulphateSDS-PAGE………….. sodium dodecyl sulfate polyacrylamide gel electrophoresisSGG ……………… sulfogalactosylglycerolipid

SLF ……………… steel factor SLIP ……………… sulphoglycolipid immobilizing proteinSNARE ……………… soluble NSF attachment protein receptor SOAF ……………… sperm borne, oocyte-activating factor SSC ……………… saline-sodium citrate buffer SSpH ……………… sonicated sperm headTALP ……………… Tyrode's albumin lactate pyruvateTBM ……………… Tris-buffered mediumTBS ……………… Tris-buffered salineTCM 199 …………… tissue culture medium 199TEMED …………… N, N, N', N’-tetramethylethylenediamineTL ……………… Tyrode lactate

TRITC ……………… tetramethyl rhodamine isothiocyanateZP ……………… zona pellucidaZPBP ..…………… zona pellucida binding-protein

http://www.all-acronyms.com/cat/7/RRNA

http://www.all-acronyms.com/cat/7/RRNA

8/3/2019 Yu_Yang_200811_PhD


1

CHAPTER 1

GENERAL INTRODUCTION

8/3/2019 Yu_Yang_200811_PhD


2

In 1677, Anton van Leeuwenhoek observed and described human spermatozoa for

the first time. A century later, Lazzaro Spallanzani proved Leeuwenhoek’s hypothesis of

the role of spermatozoa in fertility. Since the depictive drawing of a sperm containing an

extremely cramped homunculus with a gigantic head by Nicholaas Hartsoeker (Figure

1.1), we have learnt that spermatozoon is not the seed with a preformed life inside it, but

a specifically differentiated cell with remarkable structural features and carrying unique

molecules to fulfill its mission of reproduction. Fertilization is an important biological

process for the genetic maintenance of species involving the union of a spermatozoon and

an oocyte. It consists of a series of complex structural and biochemical events, of which

the majority is still poorly understood. In this study we have characterized part of the

process involved in sperm binding and penetration of the extracellular coat of the

mammalian egg.

1. STRUCTURE OF THE MAMMALIAN SPERMATOZOON 1.1 The sperm tail

The sperm tail may be divided into four distinct regions—the connecting piece (or

neck piece) a short linking segment between the sperm head and the tail; the midpiece,

characterized by the highly packed helical array of mitochondria surrounding the central

cytoskeletal framework of the tail; the principal piece distal to the midpiece; the end

piece, the shortest and the most distal part of the tail. The full length of the tail contains a

central axial filament called the axoneme, which consists of eleven microtubules arranged

in the classic “9+2” pattern similar to that seen in the cilia and flagella (reviewed by Eddy

8/3/2019 Yu_Yang_200811_PhD


3

and O'Brien, 1994). The other important cytoskeletal features of the sperm tail are the

outer dense fibers (Oko, 1998), the mitochondrial sheath, and the fibrous sheath.

Figure 1.1. A human sperm drawn by Nicolaas Hartsoeker in 1692 containing a perfectly formed

little person. This shows the early views of sperm.

8/3/2019 Yu_Yang_200811_PhD


4

It is the sperm tail that facilitates the locomotion of the sperm. Spermatozoa first

acquire the potential for motility in the epididymis. Spermatozoa later acquire the

hyperactivated motility after a series of changes called the capacitation which takes place

in the female reproductive tract (Yanagimachi, 1994). Hyperactivation is required for

fertilization, providing the force needed to traverse the cervical mucus and to penetrate

the cumulus and zona pellucida surrounding the egg (Yanagimachi, 1994). The Ca2+-

independent flagellar dynein (Gibbons and Rowe, 1965) and ATP organize the low-

amplitude motility of the tail, while CatSper, a protein family localized on the principal

piece of the sperm tail, regulates the Ca

2+

influx and is critical for the hyperactive, large-amplitude motility of the capacitated spermatozoa (Ren et al., 2001; Qi et al., 2007).

1.2 The sperm head

The sperm head (Figure 1.2) contains the nucleus, the acrosome, a small amount of the

cytoplasm and the cytoskeleton. These structures are critical for the sperm to perform its

function of fertilizing the oocyte and initiating a new life. The size and shape of the

sperm head of different species vary significantly. For example, the sperm of most

mammalian species (e.g., human, bull and boar) have a spatulate head while that of the

rodents have a falciform head. However, the general structural components and the

arrangement of the structures are remarkable similar among different species.

The nucleus occupies the largest part of the sperm head. It carries the important

paternal genetic information in the highly condensed chromatin consisting of DNA

associated with arginine and cysteine-rich protein called protamines. The disulfide bonds

between the sperm DNA and the basic cysteine residues of the protamines (Kasinsky et

8/3/2019 Yu_Yang_200811_PhD


5

al., 1987) enable the compaction and the stability of the sperm DNA. As a result, the

sperm DNA is stable and completely inactive and does not replicate until after the sperm

enters the egg.

Figure 1.2. Diagrammatic depiction showing the mid-sagittal section through the head of

a bovine spermatozoon. ( Adapted from Oko and Maravei, 1994).

Plasma membrane

Outer acrosomal

membrane

Inner acrosomal

membrane

8/3/2019 Yu_Yang_200811_PhD


6

One of the cytoskeletal structures is the perinuclear theca (PT), which is a

condensed cytosolic proteinaceous shell enclosing the entire sperm nucleus except at the

base where the tail and the head join to each other (Lalli and Clermont, 1981; Oko and

Clermont, 1991). Apart from its importance as a structural component, the perinuclear

theca (PT) has been related more and more to the sperm function during fertilization. For

example, PAWP, a postacrosomal-PT protein has been found to be compulsory for

meiotic resumption and pronuclear development during egg activation (Wu et al., 2007).

The acrosome is a unique structure of the sperm head originating from the Golgi

apparatus. It covers the anterior portion of the nucleus and contains a variety of hydrolytic enzymes and proteases possibly significant to fertilization. During the

acrosome reaction, acrosomal contents are released by calcium-mediated exocytosis in

response to specific signals (Yanagimachi, 1994). Following the release and activation of

acrosomal enzymes, spermatozoa penetrate the zona pellucida surrounding the oocyte.

The acrosome plays an important role in the mammalian fertilization (reviewed

by Tulsiani et al., 1998). This has been very well documented both experimentally and

clinically. There are studies showing that spermatozoa of mice treated with the alkylated

imino sugar N -butyldeoxynojirimycin ( N B-DNJ) fail to form an acrosome and

subacrosomal layer during spermiogenesis and are unable to fertilize oocytes (Suganuma

et al., 2005; Walden et al., 2006). Globozoospermia, round-headed spermatozoa lacking

an acrosome, is an uncommon human disorder related to male sterility (Lalonde, 1988;

Dam et al., 2007; Kilani et al., 2004). Abnormal ionophore-induced and zona pellucida-

induced acrosome reaction have been discovered in patients with unexpected failure of

classic in vitro fertilization (Pampiglione, 1993; Liu and Baker, 1994). However,

8/3/2019 Yu_Yang_200811_PhD


7

infertility of abnormal acrosome-related etiologies can be successfully treated by

intracytoplasmic injection (ICSI) (Suganuma et al., 2005; Walden et al., 2006 ), a process

in which a single sperm is introduced into the cytoplasm of the oocyte. This implies that

structural and compositional integrity of the acrosome is essential for the extracellular

binding and penetration of the zona pellucida of mammalian oocyte (Wu et al., 2007).

Even though the importance of acrosome in fertilization is well documented, the actual

mechanisms for the involvment of acrosome in this process have not been clearly

elucidated.

The membrane of the acrosome can be regionally divided into the outer acrosomalmembrane (OAM), lying directly underneath the plasma membrane and the inner

acrosomal membrane (IAM), overlying the nuclear envelop. Caudally the OAM and the

IAM come in close opposition to each other in the equatorial segment region of the

acrosome, which is a stable region where the membrane fusion between the overlying

plasmalemma of the sperm and the oolemma of the oocyte occurs. During the acrosome

reaction, the OAM and the apical plasma membrane, above the equatorial segment, fuse

at multiple sites and create openings on the membrane, through which the acrosomal

contents are released. The enzyme-rich contents together with the exposed IAM may be

involved in both the sperm binding and penetrating the zona pellucida of the oocyte at the

early stage of fertilization (Fawcett, 1975; Huang et al., 1985). Only the acrosome-

reacted sperm can penetrate the zona pellucida and fuse with the plasma membrane of the

oocyte to initiate fertilization.

The shape of the acrosome is characteristic of the species (Fawcett et al., 1971).

The final shape of the acrosome may be influnced by extrinsic forces generated by the

8/3/2019 Yu_Yang_200811_PhD


8

cytoskeletal elements in the spermatid and/or Sertoli cell cytoplasm (Olson and Winfrey,

1985) or by intrinsic forces of the nucleus (Fawcett et al., 1971). Nonetheless, often the

acrosome can be divided into the three segments (Gerton, 2002). The portion of the

acrosomal cap extending beyond the anterior margin of the nucleus is the apical segment,

and the portion overlying the nucleus is referred to as the principal segment. The

equatorial segment forms a band that approximately overlies the equator of the head of

spatulate spermatozoa. In falciform-headed spermatozoa, the equatorial segment may

cover much of the lateral surfaces of the head. The equatorial segment persists until

sperm-egg fusion in most species (Yanagimachi, 1994). It has been suggested as the sitewhere the fusion between the sperm and the oocyte plasma membrane occurs (Bedford,

1991).

The acrosomal contents are topographically ordered in domains, which are

arranged during the spermiogenesis and epididymal maturation (reviewed by Yoshinaga,

2003). Subsequent biochemical analysis indicates that the acrosome contains both soluble

and insoluble components (Olson, 1985; Olson et al., 1988; Olson, 1994; Gerton, 2002).

These properties are believed to be involved in regulating the release of acrosome

proteins during the acrosomal exocytosis and zona pellucida interaction during

fertilization.

2. SPERMATOGENESIS AND THE ACROSOME BIOGENESIS 2.1 General review of spermatogenesis

Spermatozoa develop in the seminiferous tubules of the testis through the process

called spermatogenesis, which can be divided into three distinctive phases. In the first

8/3/2019 Yu_Yang_200811_PhD


9

mitotic phase spermatogonia, residing in the basal compartment of the seminiferous

tubule, proliferate and renew themselves finally giving rise to primary spermatocytes.

In the second meiotic phase, two reduction divisions of the spermatocytes result

in the haploid round spermatids. In the interphase before the first meiotic division, two

events important to genetic diversity take place. First is the random separation of

homologous chromosomes and second is the genetic material exchange between paired

homologous chromosomes. On entering meiosis, the primary diploid spermatocyte

replicates its DNA content. The long prophase is usually divided into different stages.

They are, in chronological order, preleptotene (DNA replication), leptotene (condensationof chromosome), zygotene (pairing up of homologous chromosomes), pachytene

(combination of maternal and paternal homologous chromosomes), diplotene

(desynapsis). After the diplotene stage the two meiotic divisions rapidly occur, leading to

four haploid round spermatids.

In the final phase, named the spermiogenesis, the haploid round spermatids

undergo dramatic structural changes including the formation of the acrosome, axonemal

assembly, nuclear elongation, chromatin condensation, the assembly of other accessory

components such as the mitochondria around the axoneme and reduction of cytoplasmic

volume to become the highly-specialized, hydrodynamic, mature spermatozoa.

Ultimately, the free spermatozoa are released into the lumen of the seminiferous tubules

by spermiation.

The successful completion of spermatogenesis requires a unique environment

within the seminiferous tubule. This is achieved through the organization of Sertoli cells,

which forms the blood-testis barrier by the tight junction formed between adjacent Sertoli

8/3/2019 Yu_Yang_200811_PhD


10

cells. The Sertoli cells provide spermatogonia the necessary nutritional, physical, and

hormonal supplies to undergo spermatogenesis (Yanagimachi, 1994; Barth and Oko,

1989).

Testosterone and FSH (Follicle Stimulating Hormone) are two major regulators

of spermatogenesis. They do not act directly on the germ cells themselves. Instead, they

stimulate the Sertoli cells to become mature and fully active in supporting

spermatogenesis. FSH beta gene knockout male mice show reduction in testicular size,

sperm counts, and sperm motility (Kumar, 1997). FSH receptor knockout mice

(Krishnamurthy et al., 2001) and men with inactive FSH receptors (Tapananien, 1997) both have impaired spermatogenesis. In addition, several other growth factors and

cytokines involve in regulating the mitotic activity of spermatogonia, eg. activin (Vale,

1994) and the c-Kit ligand, steel factor (SLF) acting through the c-Kit receptor system

(Rossi et al., 1993).

2.2 Acrosome biogenesis

The formation of the acrosome is one of the fascinating and feature events in

spermiogenesis. As early as in 1922, it has been found that the acrosome arises from the

Golgi complex (Bowen, 1922). Thereafter, there were a myriad of studies on the event of

the acrosome biogenesis and the biosynthesis of the acrosomal related proteins.

Leblond and Clermont were the first to connect the formation of the acrosomic

system with the glycoprotein secretory activity of the Golgi apparatus by using the

periodic acid- Schiff (PAS) staining technique for the detection of carbohydrates

(Leblond and Clermont, 1952; Clermont and Leblond, 1955). Spermiogenesis was

8/3/2019 Yu_Yang_200811_PhD


11

divided by these researchers into the Golgi, cap, acrosome and maturation phases, and

each phase being further subdivided into steps according to the changes observed in the

nucleus and the developing acrosomic system. Nineteen steps of spermiogenesis are

defined in the rat (Leblond and Clermont, 1952), 16 in the mouse (Oakberg, 1956), 14 in

the bull (Berndston and Desjardins, 1974; Barth and Oko, 1989) and 6 in the human

(Clermont, 1963).

During the Golgi phase, round haploid spermatids develop acrosome granules that

associate with the nuclear membrane. It corresponds to steps 1-3 of the spermiogenesis in

the bull and mouse. In this phase, the Golgi apparatus secretes several small and densesecretory granules rich in hydrolytic enzymes such as proacrosin (Bozzola et al., 1991).

These proacrosomic vesicles then coalesce to form a single larger, electron-dense cored,

spherical acrosomic vesicle, which associates with the nuclear envelope (NE) via a

proteinaceous layer referred to as the perinuclear theca (PT).

The cap phase is involved with the developing acrosomic cap over half of the

nucleus. It encompasses steps 4 to 7 of spermiogenesis. In this phase, the acrosomic

vesicle (AV) enlarges by fusing with numerous small carrier vesicles originating from the

trans face of the Golgi apparatus (Thorne-Tjomsland et al., 1988). As a result, there is a

continual addition of membrane and glycoprotein, allowing the less-dense cortex part of

the AV to expand over the nucleus and take the shape of a cap. It should be emphasized

that the expansion of the acrosomic system is synchronous with the expansion of the

underlying PT (Oko and Maravei, 1995; Oko, 1995; Oko, 1998; Aul and Oko, 2002).

The Golgi and cap phases, can be distinguished by two different phases of

secretory activity (Clermont et al., 1993; Smith et al., 1990; Susi et al., 1971; Oko and

8/3/2019 Yu_Yang_200811_PhD


12

Clermont, 1998; Tang et al., 1982; Thorne-Tjomsland et al., 1988). In this phase, the

Golgi apparatus is composed of short stacks of saccules with relatively large intersaccular

regions. These stacks, especially the middle NADPase positive saccules of the stacks,

appear to be involved in forming proacrosomic granules that are strongly NADPase

reactive (Smith et al., 1990). In the cap phase, the saccular regions of the Golgi apparatus

are extensive while the intersaccular regions are relatively short and it appears that the

CMPase positive saccules in the trans Golgi network are most active in supplying

vesicles for the growth of the CMPase positive acrosomic cap (Tang et al., 1982).

The acrosomic phase is often called the elongation phase, because during thisthird phase the condensation and elongation of the nucleus occurs. At the beginning of

this phase, the Golgi apparatus detaches from the acrosome, signifying the end of its

synthesis. Subsequently the acrosome gradually condenses and conforms to the shape of

the elongating nucleus, which shifts toward the cell surface. The acrosomic phase

corresponds to steps 8-12 in the bull, steps 8-13 in the mouse and steps 8-14 in the rat.

In the final maturation phase, the spermatids complete their differentiation. The

most obvious structural change to the acrosomic system is the thinning of the equatorial

segment.

2.3 Proteins secreted to the acrosome The acrosome was believed to be analogous to the lysosome as it contains some

lysosome-derived enzymes (Hartree, 1975). However, the fact that some typical

lysosomal markers are not present in the acrosome challenges this concept. As a result, it

is more accurately described as a modified secretory granule (Martinez, 1996).

8/3/2019 Yu_Yang_200811_PhD


13

Nevertheless, the acrosome is a complex organelle that includes several structurally and

biochemicaly distinct regions. It has characteristics of a regulated vesicle, contains many

sperm-specific proteins, and its growth and shaping relies on intense membrane

trafficking. The acrosomal vesicle contains a variety of acid glycohydrolases, proteases,

phosphatases, esterases, and aryl sulfatases (reviewed by Abou-Haila and Tulsiani, 2000),

which are believed to be needed by the mature sperm to transverse the cumulus complex

and zona pellucida of the ova. Amongst these are acrosome-unique molecules, such as

acrosin (Saling, 1981), acrogranin (Anakwe and Gerton, 1990), sperm protein AM67

(Foster et al., 1997) and PH-20 (Primakoff et al., 1985) which have been consignedspecific structural and functional roles.

The expression of genes involved in spermatid development is both tightly and

temporally regulated throughout the course of spermiogenesis. Compaction of DNA by

highly basic proteins (i.e., transition proteins and protamines) midway through

spermiogenesis results in the genome being transcriptionally inactive in elongating

spermatids. Consequently, transcripts encoding important proteins for spermatozoon

structure and function have to be produced during the round spermatid phase of

spermiogenesis or earlier, during spermatocyte development.

Synthesis of acrosomal proteins destined to become components of proacrosomic

granules begins before spermiogenesis (Susi et al., 1971; Tang et al., 1982; Thorne-

Tjomsland et al., 1988; Clermont and Tang, 1985; Peterson et al., 1992). For example,

synthesis of acrogranin begins in the pachytene spermatocyte stage of meiosis (Anakwe

and Gerton, 1990). So does the synthesis of acrosin (Moreno et al., 2000). Electron

microscopic studies have shown that acrosin is sorted and packed into an electron-dense

8/3/2019 Yu_Yang_200811_PhD


14

granule within the proacrosomal vesicles (Susi et al., 1971; Thorne-Tjomsland et al.,

1988; Moreno et al., 2000; Ramalho-Santos et al., 2001). The two different Golgi

secretory activities in the Golgi and cap phase during acrosome formation suggest that

proteins forming the acrosomal granule, the extracellular lining of the acrosomal

membrane and the various domains of the matrix of the acrosome can only get to their

destination via two routes: either via the route of the proacrosomic vesicles secreted in

the Golgi phase, or via those small carrier vesicles that expand the acrosomic system in

the cap phase. It is reasonable to assume that most proteins carried in the proacrosomic

vesicles, which form the acrosomic granule, will not be present in the small carrier vesicles of the cap phase. Interestingly, proteins that enter the acrosome via the

proacrosomic granules and form the acrosomal granule can be redistributed to occupy or

form other domains or regions of the acrosome later in spermiogenesis. For example,

after being synthesized and packed in the proacrosomic granules, proacrosin is first

located in the central electron-dense granule of the acrosomal cap and then redistributed

from the acrosomic granule to the principal segment of the boar acrosome during the

maturation phase (Bozzola et al., 1991). AM50, an acrosomal matrix component, is

shown to redistribute from the acrosomic granule to the peripheral matrix surrounding it

in cap phase of Guinea pig spermatids. AM50 eventually comes to reside in the ventral

matrix (M3) of the apical segment of the acrosome in the maturation phase (Westbrook-

Case et al., 1995). Whereas other acrosomal matrix components, AM22 and AM29,

arising from a common precursor protein in the acrosomic granule, occupy the entire

matrix of the apical and principal segments of hamster spermatozoa (Olson et al., 1998).

8/3/2019 Yu_Yang_200811_PhD


15

For the majority of acrosomal proteins identified so far their point of entry into

the acrosomic system as well as the domains they are sorted to within the acrosome are

unknown. In fact, there are more acrosomal proteins reported using the first or

proacrosomic route to gain access to the acrosome than those using the second route,

which is dependent on small Golgi vesicles continually fusing with and expanding the

acrosomal cap. One acrosomal protein that appears to utilize this latter route of entry is

zonadhesin (Olson et al., 2004). During spermiogenesis, zonadhesin did not appear in the

acrosomal granule formed by the coalesced proacrosomic granules, but was found

uniformly distributed between the outer and inner domains of the acrosomal membrane of cap-phase round spermatids. In late elongated spermatids, it eventually disappeared from

the inner acrosomal membrane entirely.

Potentially being essential for initiating the organization of the acrosomal contents

into the three major regions of the mature acrosome (i.e. apical, principal and equatorial

segments; Gerton, 2002), the integral acrosomal membrane proteins may be transferred

directly from the Golgi membrane system to the acrosomal membrane by carrier vesicles

during both phases of acrosomal secretion. Some integral proteins could arise at different

phases of secretory activity while others could be constitutively secreted throughout

acrosomal formation. However, up to date, except for two calcium-binding proteins

isolated from the outer acrosomal membrane (Sukardi et al., 2001), no integral membrane

proteins of the acrosomal membrane have been identified.

Even though targeting and incorporation of most of the acrosomal proteins during

the acrosme biogenesis are suggested using the endoplasmic reticulum–Golgi–acrosome

pathway, some acrosomal proteins have been suggested to use extra-Golgi pathways. For

8/3/2019 Yu_Yang_200811_PhD


16

example, MC41, an acrosomal protein seems to follow an ER-to-acrosome pathway

bypassing the Golgi (Tanii, 1992). The immunolabelling of MC41 was observed in the

endoplasmic reticulum (ER) throughout spermiogenesis, in the outer acrosomal

membrane and in the acrosomal matrix, but never in the Golgi region throughout

spermiogenesis. It was suggested that MC41 is synthesized in the ER of early spermatids,

and then presumably transferred to the outer acrosomal membrane in the acrosome phase

of spermiogenesis, and finally accumulated in the acrosomal matrix at the terminal step

of spermiogenesis. Endocytic trafficking is another “extra-Golgi” pathway suggested to

contribute to the acrosome biogenesis (West and Willison, 1996; Li, 2006). Nevertheless,more convincing experiments are needed to elucidate these “extra-Golgi” pathways.

Golgi-proacrosomal-derived vesicles are most likely transported to the nucleus for

their attachment oriented towards the nucleus and attached on microtubules because

sperm from both azh mutation mice with disorganization in the microtubule cytoskeleton

and mice with medication-induced disassembly of the microtubule network present

fragmentation of the acrosome (Moreno et al., 2006). Vesicular fusion and trafficking are

thought to be regulated by members of the large transmembrane protein family known as

soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein receptors

(SNAREs). As suggested, a v-SNARE on a vesicle interacts with a t-SNARE on a target

membrane to bring the vesicle to the target membrane (Ramalho-Santos et al., 2001).

Other possible regulators of membrane trafficking are the members of the rab family of

small GTP-binding proteins that regulate targeting and fusion of transport vesicles in the

secretory pathway (Grosshans et al., 2006), e.g. rab5, rab6, rab7 (Ramalho-Santos et al.,

2001) and rab2a (Mountjoy et al., 2008). A subacrosomal histone H2B variant, SubH2Bv

8/3/2019 Yu_Yang_200811_PhD


17

has been suggested to work in directing the acrosomic vesicle toward the nucleus and the

attachment of the acrosomic vesicle to the nucleus (Aul and Oko, 2002).

2.4 Compartmentalization of the acrosomal content

To enable the sperm to perform the multiple functions, the spermatozoon has

developed a highly specialized morphology with its various structural components

elegantly tailored to specific aspects of function. The compartmentalization is one of the

critically important features of the sperm structure enabling the cell to perform the variety

of tasks it must undertake. This arrangement is gained during the spermiogenesis and

epididymal maturation (Reviewed by Yoshinaga, 2003). The concept of dividing the

acrosome into different domains or compartments is helpful in understanding the process

and the mechanism of the acrosomal exocytosis. The biologic significance of the

compartmentalization of acrosome content is to regulate the release of acrosomal proteins

during the acrosome reaction and zona pellucida interaction at fertilization.

The content of acrosome can be divided into different domains according to some

of the chemical and physiological features. Distinct domains in the acrosomal matrices of

hamster and bull sperm were inferred from observed differences in the dispersion of

acrosomal matrix components with various chemical and physical procedures (Olson,

1985; Olson et al., 1988). Using the acrosome’s sensitivity to physical and chemical

disruption, Olson et al. (Olson, 1987) described three domains in the guinea pig matrix,

which they referred to as Ml, M2 and M3. Different components have been related to the

different domains. For example, MN7 and MC41are both localized to domain M1

(Yoshinaga et al., 1998; Yoshinaga et al., 2001). Proacrosin is related in domain M2 and

8/3/2019 Yu_Yang_200811_PhD


18

M3 (Westbrook-Case, 1994). A simila rmorphological compartmentalization is also

found in the rabbit (Olson, 1994), whose sperm acrosome consists of the apical, principal

and equatorial segment. In mouse, even though the acrosome is quite small, different

domains have also been defined according to the restricted distribution of certain

molecules, for example, MN7 and MC41 were localizated to the anterior part of the

acrosome (Tanii et al., 1995; Tanii et al., 2001). Biochemically, the domain concept can

be extended to divide the acrosome contents into a soluble protein compartment and an

insoluble acrosomal matrix. This definition is based on whether the acrosomal contents

solubilize following

extraction in Triton X-100 under conditions that block proteolysis or retain a structural form (Huang et al., 1985). This division might be helpful in explaining

and understanding the process of the acrosomal exocytosis, which is an alternative view

on the traditional concept of acrosome reaction. The acrosomal exocytosis recognize the

multiple intermediate states of the acrosome, whereas the prevailing acrosome reaction

model emphasizes only the two ends, considering sperm to be either “acrosome-intact” or

“acrosome-reacted”. During the multiple steps of the acrosomal exocytosis, a component

of the acrosomal matrix would be predicted to remain associated with the sperm head for

a longer period of time than would a soluble protein.

3. FERTILIZATION

3.1 Overview of fertilization

Fertilization is the process of the male and female gamete combining to form a

new individual. In mammals, this process includes several steps involving many

molecules and numerous complex biochemical events (Figure 1.3).

8/3/2019 Yu_Yang_200811_PhD


19

Figure 1.3. Diagram of six steps required for successful fertilization. Step 1 entails sperm

penetration of expanded cumulus cells. Step 2 requires sperm recognition of the zona pellucida,

including (a) primary binding, (b) undergoing the acrosomal exocytosis and secondary binding,

(c) penetrating the zona pellucida. Step 3 involves sperm/oocyte fusion events. Step 4encompasses the process of oocyte activation. Step 5 includes processes required for processing

of the sperm to release its nuclear contents. Step 6 completes the fertilization process through

formation of the PN. (Reprint with permission from Swain and Pool, 2008).

Freshly ejaculated mammalian sperm are not capable of fertilizing the oocyte.

Sperm must stay in the female reproductive tract for certain period of time, that varies

depending on the species, to gain the ability to fulfill their mission. During this residence,

sperm undergo a series of molecular, cellular and physiological changes collectively

called capacitation (Chang, 1951; Austin, 1951; Yanagimachi, 1994). This includes both

8/3/2019 Yu_Yang_200811_PhD


20

the surface and intracellular modifications such as the removal of decapacitation factors

from the seminal plasma, and the increase in membrane fluidity and protein tyrosine

phosphorylation (Yanagimachi, 1994; de Lamirande, 1997; Visconti, 2002). Protein

tyrosine phosphorylation is a phenomenon tightly controlled by calcium and reactive

oxygen species (Leclerc, 1998; Herrero, 1999; Dorval, 2002), whose increase is among

the earliest events during the process of capacitation (Baldi, 1991). An increase in cAMP

concentration also occurs during sperm capacitation, which is another factor involved in

the increase in protein tyrosine phosphorylation (Leclerc, 1996; Osheroff, 1999).

Capacitation takes place in the female reproductive tract where the spermatozoa are incontact with different cell types and secretions. Capacitation is considered to be complete

when capacitated spermatozoa attain hyperactivated motility and are able to undergo the

acrosome reaction (Florman and Babcock, 1991; Yanagimachi, 1994).

Before getting access to the zona pellucida, the capacitated sperm have to

penetrate through the surrounding cumulus cell mass, consisting of follicular cells

dispersed in a polymerized hyaluronic acid matrix (Yanagimachi, 1994). It was believed

for a while that the hyaluronidase activity of PH-20 on the sperm plasma membrane

enables sperm to penetrate the layer of cumulus cells surrounding the oocyte (Hunnicutt

et al., 1996). However, mice lacking the hyaluronidase PH-20 can still penetrate through

the egg cumulus cell mass (Baba et al., 2002). Some other candidate molecules with

hyaluronidase activity have presently been suggested to be responsible for sperm

penetration through the cumulus cell mass (Kim et al., 2005; Reitinger, 2007).

After passing through the cumulus cells, the capacitated sperm can now reach the

zona pellucida (ZP), an extracellular coat surrounding oocyte, and start interacting with

8/3/2019 Yu_Yang_200811_PhD


21

the zona surface proteins. The binding between the plasma membrane of sperm and zona

pellucida, or more specifically ZP3, one of the three ZP glycoproteins, is called “primary

binding”(Bleil and Wassarman, 1990; Wassarman et al., 2001). Shortly after this binding,

sperm undergo the acrosome reaction, a form of cellular exocytosis. Acrosome-reacted

sperm, losing their ZP3 receptors on their head plasma membrane, remain bound to the

zona by binding to another zona protein, ZP2, using the newly exposed inner acrosomal

membrane (IAM). This binding is referred to as “secondary binding”, which is

compulsory for subsequent sperm-zona penetration (Wassarman et al., 2001). The

penetration of the zona is thought to be completed by a combination of the vigoroussperm motility and enzymatic hydrolysis even though the debate between an enzymatic

and a mechanical theory on the sperm zona penetration has not yet settled (Bedford,

1998).

After zona crossing, acrosome-reacted sperm reach the perivitelline space,

binding to and fusing with the oocyte plasmalemma. In mammals, the site of attachment

and fusion on sperm is the plasmalemma overlying the equatorial segement (Bedford,

1991). For the oocytes, CD9, integrin α6β1 and glycosylphosphatidylinositol (GPI)-

anchored proteins have been proposed as candidate molecules for the sperm-egg fusion.

Among them CD9 is the only molecule whose role in sperm-oocyte fusion was

unequivocally established, when mice with deletions in this gene were generated in three

laboratories showing severely reduced fertility in the Cd9 –/– females (Miyado et al., 2000;

Le Naour et al., 2000; Kaji, 2000). The mice are healthy and viable, producing normal

number of mature oocytes. After mating, many sperm are found in the perivitelline space,

indicating that early sperm-oocyte interactions proceed normally and infertility results

8/3/2019 Yu_Yang_200811_PhD


22

from a failure of attachment or fusion at the plasma membrane. The role of integrins such

as α6β1, α3β1, αvβ3 and αvβ5 in the sperm-egg fusion has been excluded because

integrin knockout mice (Hodivala-Dilke, 1999; Miller et al., 2000; He et al., 2003)

lacking the integrins on their eggs have normal fertility in vivo and in vitro. Although it is

still possible that a role for some other oocyte integrins in sperm-egg fusion will be

found, further evidence is required. The fact that oocyte-specific knockout of GPI protein

biosynthesis results in infertility and dramatic reduction in ability of oocyte to fuse with

sperm (Alfieri et al., 2003) explains why GPI-anchored proteins are still considered as

candidates in the fusion process. As for the sperm molecules functioning in sperm-egg plasma membrane fusion, various candidates such as cysteine-rich secretory protein 1

(CRISP 1) or DE (Rochwerger et al., 1992), ADAMs (fertilinα, fertilinβ and cyritestin)

(Blobel, 1992), CD46 (Anderson et al., 1993) and SAMP32 (Hao et al., 2002) have been

reported. Among these, ADAM family proteins have been given the most attention.

However, none of the mice possessing disrupted ADAM1a, ADAM2 and ADAM3

showed a significant defect in the ability to fuse with eggs (Cho, 1998; Nishimura et al.,

2004; Nishimura et al., 2001), even though an impairment of sperm–zona binding ability

are shown. The sperm protein Izumo probably is the most promising candidate in sperm-

egg membrane fusion (Inoue et al., 2005). Izumo -/- mice were able to produce

morphologically normal sperm that bound to and penetrated the zona pellucida but were

incapable of fusing with eggs. In addition, antibodies raised against human Izumo render

the sperm unable to fuse with zona-free hamster eggs.

The gamete fusion triggers a series of signaling events in the egg, termed egg

activation (Schultz and Kopf, 1995). The commonly accepted theory is that the sperm

8/3/2019 Yu_Yang_200811_PhD


23

introduces an activating factor, commonly referred to as sperm borne, oocyte-activating

factor (SOAF), into the oocyte cytoplasm, resulting in a transient rise in intracellular Ca2+

levels (Ca2+ oscillations), which is believed to initiate numerous downstream oocyte

events (Parrington et al., 1996). The most compelling evidence supporting this theory is

that intracytoplasmic sperm injection (ICSI), a technique by which an intact sperm

delivered into the ooplasm is capable of initiating Ca 2+ release during fertilization

(Tesarik, 1994). SOAF has been suggested to be localized to the perinuclear theca

(Kimura et al., 1998; Perry et al., 1999; Sutovsky et al., 2003). Among several reported

SOAF candidates, an alkaline extractable protein of the perinuclear theca, PAWP(postacrosomal sheath WW domain-binding protein), shows many characteristics of

SOAF and has been reported as a promising SOAF candidate (Wu et al., 2007). It is

exclusively localized in the postacrosomal sheath region of the perinuclear theca and is

expressed and assembled in elongating spermatids (Wu et al., 2007). The transient rise in

intracellular Ca2+ concentration leads to the release of cortical granule, which is able to

modify the ZP structure. These modifications of the ZP prevent further sperm binding

and avoid polyspermy. Events that follow include decondensation of the sperm nucleus,

recruitment of maternal mRNAs, formation of pronucleus (PN), initiation of DNA

synthesis, and egg cleavage (Raz et al., 1998). Formation of male and female PN marks

the completion of mammalian fertilization.

3.2 Zona Pellucida

Zona pellucida is the extracellular coat surrounding the egg. It plays important

roles during oogenesis, fertilization, and preimplantation development (Dietl, 1989;

8/3/2019 Yu_Yang_200811_PhD


24

Yanagimachi, 1994). The zona pellucida of most eutherian mammals consists of three

major sulfated glycoproteins, each encoded by their corresponding genes, and each with

different molecular weights. Recent study has found that the human zona pellucida is

composed of four glycoproteins (Lefièvre et al.,2004; Conner et al., 2005). These

glycoproteins were usually termed as zona protein 1 (ZP1), zona protein 2 (ZP2) and

zona protein 3 (ZP3) (and ZP4 for the fourth human zona protein) according to their

apparent molecular weights on sodium dodecyl sulfate (SDS)-polyacrylamide gels (Bleil

and Wassarman, 1980a). As the zona proteins are variably glycosylated in different

species, it was suggested to name the proteins according to the length of their codingregions. This led to the name ZPA, ZPB and ZPC (Harris et al., 1994). As a matter of

fact, ZP1 corresponds to ZPB, ZP2 to ZPA, and ZP3 to ZPC. However, the former

nomenclature -- ZP1, ZP2, and ZP3 will be used here.

Human zona pellucida proteins have molecular masses of ~150-, 120-, 58- and

65- kDa for ZP1, ZP2, ZP3 and ZP4, respectively (Moos et al., 1995 and Chin et al.,

2008). In mice the sizes of ZP1, ZP2 and ZP3 are 180~200-, 120~140- and 83- kDa

respectively (Bleil and Wassarman, 1980a). For the pig, ZP1, ZP2 and ZP3 have

molecular masses of 65-, 90- and 55- kDa, respectively (see review by Wassarman,

1988b). The differences in molecular masses among species are thought to represent the

variation of glycosylation (Table 1.1). The thickness and protein content among the zona

of different species are also quite different. Zona pellucida surrounding fully grown

mouse oocyte is approximately 7 μm thick and contains 3-4 ng of protein (Bleil and

Wassarman, 1980a),while pig zona pellucida is about 16 μm thick and contains 30-35 ng

protein (Durbar, 1983).

8/3/2019 Yu_Yang_200811_PhD


25

Table 1.1 Characteristics of mouse, pig and human oocyte zona pellucida glycoproteins

Species Molecular Mass (kDa) Zona Pellucida Glycoproteins

ZP1 ZP2 ZP3 ZP4

Glycoprotein 180-200 120-140 83 -

Mousea

Polypeptide 75 67 37 -

Glycoprotein 65 90 55 -

Pig b

Polypeptide 46 79 42 -

Glycoprotein 150 120 58 65

Humanc,d

Polypeptide - 65 40 57

a: Bleil and Wassarman, 1980a; b: Wassarman, 1988b; c: Moos et al., 1995; d: Chin et al., 2008

Electron micrographs show that the three glycoproteins form a relatively

homogeneous matrix of 2-3μm long interconnected filaments. Each filament is reported

to contain a structural repeat thought to be a ZP2-ZP3 heterodimer, and the filaments

appear to be cross-linked by ZP1, a homodimeric protein (Bleil and Wassarman, 1980a).

The primary structure of each zona protein among different species is similar (Figure

1.4).

8/3/2019 Yu_Yang_200811_PhD


26

Figure 1.4. Schematic representation of filaments that constitute the mouse egg

ZP. Depicted are filaments composed of ZP2 and ZP3 that are crosslinked by ZP1to form an extracellular coat (ZP) around growing oocytes. (Based on

Wassarman, 1988b).

The genes encoding for ZP proteins are present as single copies on chromosomes.

For instance, in the mouse Zp1, Zp2, and Zp3 are located on chromosomes 19, 7, and 5,

respectively (Epifano, 1995; Wassarman, 2004). These genes are expressed during the

growth phase of the oocyte, but their transcripts are rapidly degraded when meiosis is

resumed. The expression of ZP2 and ZP3 is restricted to the oocyte proper, however,

there is some evidence that shows besides the oocyte proper, ZP1 transcript may be

transiently expressed in granulosa cells (Lee, 1993).

ZP3 acts as a ligand and binds to receptors on the sperm plasma membrane

acrosome-intact sperm right after they penetrate through the cumulus cell mass in a

species-specific manner. This “primary binding” activates a signal transduction cascade

leading to exocytosis of the acrosomal vesicle. Physically, the plasma membrane of the

8/3/2019 Yu_Yang_200811_PhD


27

sperm fuses with the outer acrosomal membrane forming many small openings in the

acrosome. The contents of the acrosome, including hydrolytic enzymes, are released for

what was long believed to be the enzymatic degradation of the zona pellucida. The

acrosome exocytosis results in the exposure of the IAM, which then binds to ZP2. This is

the secondary binding between the sperm and the egg that anchors the sperm to the zona

and faciliates the sperm’s penetration through the zona (Yanagimachi, 1994).

Besides acting as the sperm receptors or ligands for the primary and secondary

sperm-zona binding and induction of the acrosome reaction, other roles of ZP in

fertilization include providing a barrier for cross species breeding (Yanagimachi, 1994;Wassarman, 1999), blocking polyspermy and protecting the developing embryo prior to

implantation ( Yanagimachi, 1994).

3.3 Acrosome reaction or acrosomal exocytosis The acrosome reaction is a major exocytotic process over the entire apical region

of the sperm head. It is absolutely required for zona penetration. The prevailing acrosome

reaction model is a binary model, where the sperm is either acrosome-intact or acrosome-

reacted. The major problem related to this model is the ignorance of the transitional

intermediate acrosomal status. The acrosomal exocytosis model (Gerton, 2002) on the

other hand views the status of the acrosome reaction as a continuously changing process.

It takes into account the transitional intermediate acrosomal status (Kim and Gerton,

2003). This acrosomal exocytosis model fits well with the compartmentalized acrosome

of different domains (Figure 1.5). It is reasonable to assume that gradual acrosomal

8/3/2019 Yu_Yang_200811_PhD


28

exocytosis faciliates a sequence of stepwise events during sperm-egg interaction.

However these events have not been defined.

In mammalian sperm, the most powerful physiological acrosomal exocytosis

inducer is ZP3. ZP3-induced acrosomal exocytosis is mediated by signal transduction

cascades similar to those found in hormonally responsive somatic cells, with ZP3 as the

ligand. The coupling of ZP3 with the G coupling receptors (G proteins) on the plasma

and/or outer acrosomal membrane region overlying the acrosome induces a transient Ca2+

influx into the sperm through voltage-dependent nonselective cation channels (Ward et

al., 1992; Darszon et al., 1999), which in turn leads to activation of a pertussis toxin-

sensitive trimeric Gi/o protein-coupled PLC (Patrat, 2000). A tyrosine kinase-regulated

PLCγ may also be activated during ZP3-binding(Patrat, 2000). Activation of PLCγ

generate IP3, thereby mobilizing [Ca2+]I from the sperm’s intracellular Ca2+ store, the

acrosome. These early responses appear to promote a subsequent sustained Ca+influx

signal via store-operated channels (SOCs) that results in the arosomal exocytosis

(O'Toole et al., 2000; Breitbart, 2002).

Progesterone released from the cumulus cells, a major component of follicular

fluid, is also able to induce the acrosomal exocytosis in a physiological manner (Roldan

et al., 1994; Kobori et al., 2000). Although the mechanism of the progesterone inducing

the acrosomal exocytosis has not yet been clearly elucidated, it is thought to induce CA2+

influx by activating a GABAA-like progesterone receptor/Cl- channels (Meizel et al.,

1997). There is currently a debate as to whether progesterone acts on the surface of the

sperm head directly or by priming the sperm to response to ZP3 (Revelli, 1998).

8/3/2019 Yu_Yang_200811_PhD


29

Figure 1.5. Schematic representation of sperm head during the acrosomal exocytosis.

Hybridization of the plasma membrane (PM) and the outer acrosomal membrane (OAM) results

in the release of the acrosomal contents and the exposure of the inner acrosomal membrane

(IAM). The red part represents the post-acrosomal sheath; the yellow part is the subacrosomal

layer. ES= equatorial segment. (Adapted from Yanagimachi, 1994).

3.4 Molecules involved in sperm-oocyte binding

The binding between the sperm and the oocyte may be analogous to other cellular

adhesion events. There are molecules on the sperm head (“receptor”) recognizing and

binding to complementary molecules on the egg ZP (“ligand”) in a species-specifc

manner. As mentioned before, there are two levels of sperm-egg interaction after the

capacitated sperm reaches the ZP—the primary binding and the secondary binding. In

8/3/2019 Yu_Yang_200811_PhD


30

mammals, the carbohydrate-mediated events of sperm–egg binding are best understood in

the mouse, although there is some information in other species, including human

(Yanagimachi, 1994; Tulsiani et al., 1997).

3.4.1 The primary binding

This primary binding between the acrosome-intact sperm and the zona pellucida

is critical as it set the foundation for the following steps of the fertilization.

3.4.1.1 ZP3 as ligand of the primary binding

ZP3 was recognized as the sperm receptor on the zona pellucida based on theexperimental evidence that of the three glycoproteins that constitute the ZP, only purified

mZP3 binds exclusively to heads of acrosome-intact sperm and thereby prevents sperm

from binding to ovulated eggs in vitro in a dose dependent manner (Bleil and

Wassarman, 1980b; Bleil and Wassarman, 1986). ZP3 isolated from fertilized eggs is

unable to bind to capacitated sperm and inhibit sperm-egg binding as compared to ZP3

from ovulated eggs (Wassarman, 1988a). This fact further supports role of ZP3 in the

initial binding of the acrosome-intact sperm to the eggs, and suggests that ZP3 is

modified so that the sperm binding ability is lost. Human ZP3, a homologue of mouse

ZP3, has been demonstrated to have sperm binding and acrosome reaction inducing

activities (Chamberlin and Dean, 1990).

Each of the ZP glycoprotein consists of a unique polypeptide that is

heterogeneously glycosylated with both complex-type asparagines- (N-) linked and

serine/threonine- (O-) linked oligosaccharides (Benoff, 1997). It is well accepted that the

bond between the sperm and the zona is carbohydrate-dependent. Even though a role of

8/3/2019 Yu_Yang_200811_PhD


31

the polypeptide backbone of ZP was suggested by Chapman’s group (Chapman et al.,

1998), it has been well accepted that ZP3 oligosaccharides play a direct role in its sperm

receptor function. When ZP3 is treated with protease, the resulted small glycopeptide

fragments retain the ability to bind sperm. This suggests that the ZP3 polypeptide does

not play a direct role in binding to sperm, whereas the carbohydrate moieties are involved

in the sperm receptor function (Florman et al., 1984). Further evidence supporting this

concept is that various lectins, monosaccharides, and glycoconjugates have been shown

to be able to inhibit the binding of sperm to mammalian oocytes (Oikawa et al., 1973;

Huang Jr., 1982; Shur, 1982). O-linked oligosaccharides recovered from ZP3 by mildalkaline hydrolysis under reducing conditions (Bleil and Wassarman, 1988; Miller et al.,

1992) and certain synthesized O-linked oligosaccharides (Johnston et al., 1998) inhibit

binding of sperm to eggs. These results strongly suggest that the sperm receptor function

attributes to O-linked oligosaccharides on ZP3. Further studies revealed that the carboxyl

terminus of the ZP3 molecule between amino acids Cys328 and Asp343 has sperm

binding activity (Florman and Wassarman, 1985; Kinloch, 1995). Moreover, inactivation

of the binding site by site-directed mutagenesis for individual serine residues confirmed

that the O-linked oligosaccharides on Ser332 and Ser334 are responsible for sperm

binding (Chen et al., 1998). And these two Ser residues are conserved among mouse,

hamster, and human ZP3, suggesting their essential role in fertilization. Even though the

involvement of the N-linked oligosaccharides in sperm-egg binding has been reported

(Yonezawa, 1995, 1997) its function seems to be more related to the regulation of protein

conformation (reviewed by Benoff, 1997).

8/3/2019 Yu_Yang_200811_PhD


32

3.4.1.2 Sperm protein receptor for the primary binding

For a sperm protein to be qualified as the candidate of zona binding receptor

several criteria have to be met (Snell and White, 1996). First, the primary ZP-binding

protein(s) should be on the surface of live acrosome-intact sperm and should bind to ZP3.

Secondly, the candidate molecule(s) should display species specificity in binding, and

antibodies to it should interfere with the binding. At the same time, the sperm protein

should not bind to ZP3 from fertilized eggs. Thirdly, its function in binding should be

confirmed through gene disruption and gene transfer experiments. To date several sperm

proteins have been proposed as the candidates for primary binding between the sperm

and ZP: Galactosyltransferase (GalTase) (Shur and Neely, 1988; Miller et al., 1992),

Sp56 (Bleil and Wassarman, 1990; Bookbinder et al., 1995; Cheng et al., 1994),

Sulfogalactosylglycerolipid (SGG) (White et al., 2000), sulphoglycolipid immobilizing

protein (SLIP) (Tanphaichitr, 1993), zonadhesin (Hardy and Garbers, 1995; Gao and

Garbers, 1998) and spermadhesins (Topfer-Petersen, 1996).

Galactosyltransferase (GalTase) is a mouse sperm surface protein found on the

surface of mouse sperm overlying a discrete domain on the dorsal, anterior aspect of the

sperm head (Shur and Neely, 1988; Gong et al., 1995), which is consistent with the

expected location of a zona receptor. GalTase is able to bind to the N- acetylglucosamine

(GlcNAc) residues in the zona pellucida (Shur, 1982). Instead of using its enzymatic

activity, GalTase acts as a lectin through recognizing the terminal N-acetylglucosamine-

containing oligosaccharide ligands (Miller et al., 1992). GalTase specifically binds to the

same class of ZP3 oligosaccharides that possess sperm-binding activity, and removing or

masking the GalTase binding site on these oligosaccharides eliminates their sperm-

8/3/2019 Yu_Yang_200811_PhD


33

binding activity (Miller et al., 1992). Purified GalTase, inhibitors of GalTase, and

antibodies to GalTase each block sperm–egg binding (Shur and Neely, 1988). Transgenic

sperm that overexpress GalTase bind more ZP3 than do normal sperm, have accelerated

G-protein activation and undergo precocious acrosome reactions (Youakim et al., 1994).

However galactosyltransferase-null (gt-/-) males are fertile; gt -/- sperm still bind to the

zona pellucida, even though they show low levels of binding ZP3 ligand in solution (Lu

and Shur, 1997).

Sp56 is another molecule studied for its role as the primary binding receptor on

the sperm (Bleil and Wassarman, 1990). This 56kDa protein was localized on the head of acrosome-intact but not acrosome-reacted mouse sperm. It was radiolabeled

preferentially by a photoactivatable crosslinker covalently linked to purified mouse ZP3

(Bleil and Wassarman, 1990). Sp56 also binds tightly to ZP3 affinity columns and to ZP3

oligosaccharides recognized by sperm, but not to ZP from fertilized eggs. In addition,

purified Sp56 blocks sperm–egg binding (Bleil and Wassarman, 1990; Bookbinder et al.,

1995; Cheng et al., 1994). The recombinant mouse sperm Sp56 has an affinity for the ZP

of unfertilized eggs but not the ZP from 2-cell embryos (Buffone et al., 2008). Although

the above cited data support that Sp56 is a ZP3-binding protein, the reports that located

Sp56 to the acrosome matrix have cast doubt on the qualification of its role in the primary

binding between the acrosome-intact sperm and the ZP (Kim et al., 2001; Foster et al.,

1997).

8/3/2019 Yu_Yang_200811_PhD


34

3.4.2 The secondary binding

The primary binding between the sperm and the ZP triggers the acrosomal

exocytosis resulting in the removal of the sperm plasma membrane, the release of the

acrosomal content and the exposure of the acrosomal matrix and the IAM. This

acrosomal exocytosis is followed by the next level of the sperm –zona binding, referred

as the secondary binding. The secondary binding appears to be a preequisite for sperm

penetration through the zona.

3.4.2.1 ZP2 as ligand of the secondary binding

In mice and many other mammals, it is implied that the secondary binding is

between the IAM and ZP2 (Bleil and Wassarman, 1986; Bleil et al., 1988; Mortillo and

Wassarman, 1991; Kerr et al., 2002). Consistent with this is that antibodies against the

ZP2 glycoprotein did not affect the intial binding of sperm to the zona pellucida,

however, the maintainance of the binding was inhibited after the acrosome reaction in

greater than 90% of the sperm (Bleil and Wassarman, 1983; Bleil et al., 1988). Purified

mouse ZP2 does not inhibit the binding of acrosome-intact sperm to mouse egg in vitro

(Bleil and Wassarman, 1980a). The finding that purified ZP2 binds to acrosome-reacted

mouse sperm (Bleil and Wassarman, 1986) strongly implies that ZP2 is responsible for

the secondary binding.

The ZP2 genes have been cloned from various mammals including human, mice,

cats, dogs, pigs and rabbits. The chracterization of the primary structure of ZP2 reveals a

high extent of conservation of this protein among different species (Harris et al., 1994;

Hinsch, 1998). A recombinant protein corresponding to amino acid sequence shared by

8/3/2019 Yu_Yang_200811_PhD


35

the porcine and human ZP2 was observed to bind to acrosome-reacted spermatozoa from

several species in vitro but not to acrosome-intact spermatozoa (Tsubamoto et al., 1999).

Furthermore, mouse and rabbit antisera, raised against this specific recombinant ZP2 was

able to block human in vitro fertilization (Tsubamoto et al., 1999). A possible ZP2

domain of functional relevance to human sperm-oocyte interaction has been reported by

assessing antisera raised against synthetic peptides that are either conserved in the

structure of ZP2 from different mammalian species (AS ZP2-20) or present in the human

ZP2 but not in the mouse ZP2 amino acid sequence (AS ZP2-26) (Hinsch, 1998, 2003).

Antigen of the antiserum AS ZP2-20 can decrease the sperm binding to the zona, but onlyabout 50%, which implies the possibility of more domains on ZP2 responsible for

secondary binding. The characterization of the ZP2 functional domains is important for

understanding the secondary sperm-zona binding at the molecular level as well as in

seeking more options for immunnocontraceptive methods.

3.4.2.2 Sperm protein receptor for the secondary bindingAfter acrosome exocytosis, the IAM is exposed to the sperm surface and provides

both the physical and molecular domains for further sperm-zona interaction (Huang et al.,

1985). Similar to sperm protein receptors for primary binding, there are criteria for a

sperm protein to be considered as candidate for secondary zona binding. The candidate

should be on the sperm and exposed on the surface of the IAM following the AR. It

should also bind specifically to ZP2. Antibodies against this protein should be able to

inhibit the binding between the acrosome-reacted sperm and the zona pellucida. The

search for the secondary binding receptors on sperm has given rise to several candidate

8/3/2019 Yu_Yang_200811_PhD


36

molecules. Proacrosin/acrosin has received the most attention. Other players considered

as the secondary binding receptors for the ZP2 ligand were, PH-20, Sp17 (24/17kDa),

Sp10, SAMP32, SAMP14, MC41, SP38 (Cowan et al., 1991; Hunnicutt et al., 1996;

Yudin, 1999; Richardson et al., 1994; Hao et al., 2002; Shetty et al., 2003; Tanii et al.,

2001; Mori et al., 1993 and 1995). Acrosin, an acrosomal serine protease was considered

involved in sperm-zona pellucida interaction and essential for penetration of the ZP by

sperm (Saling, 1981; McLeskey, 1998). Acrosin has been reported to be present in all the

spermatozoa of all mammalian species studies till now (reviewed by Parrish, 1979). It is

synthesized and stored as the zymogen proacrosin in the sperm acrosome. Duringacrosome exocytosis, proacrosin is converted to acrosin and released by autocatalytical

activation (Moos, 1993; Kennedy, 1981; Tesarik, 1990; Zahn, 2002). It has been shown

that boar proacrosin/acrosin and homologous ZP2 glycoproteins bind strongly to each

other even after inactivation of protease activity (Brown and Jones, 1987; Jones, 1991;

Urch and Patel, 1991; Jansen, 1995; Moreno and Barros, 2000). The interaction was

believed to involve ionic bonds between polysulphate groups on ZP oligosaccharides and

basic residues on the surface of proacrosin/acrosin based on the fact that the binding can

be inhibited by dextran sulfate or fucoidan (Howes et al., 2001; Howes and Jones, 2002).

However, lack of disruption of ZP2 binding by keratin sulfate disputed the claim that the

polysulphate groups on ZP oligosaccharides and basic residues on the surface of

proacrosin/acrosin were responsible for proacrosin-ZP2 binding (Mori et al., 1993).

Alternatively both proacrosin and SP38 have been shown to bind specifically to ZP2 by

the motif KRLXX(XXX)LIE (Mori et al., 1995). However, in the case of proacrosin this

motif is proteolytically eliminated during the acrosome reaction (Baba et al., 1989)

8/3/2019 Yu_Yang_200811_PhD


37

implying that this motif does not participate in binding of acrosin to ZP2. The

importance of acrosin in fertilization has been implied in human clinical studies (Shimizu

et al., 1997; Mari et al., 2003). However, sperm from mice carrying a targeted mutation

of the acrosin gene, which are homozygous nulls for acrosin ( Acr −/−), can still penetrate

the ZP and fertilise eggs (Baba et al., 1994). This finding suggests that acrosin may not

be essential for the sperm-zona binding and penetration. But the absence of acrosin does

cause a delay in penetration of the ZP by sperm. One explanation is that

proacrosin/acrosin may be involved in the rate of dispersal of acrosomal contents

following the AR, the lack of acrosin may delay the dispersion of other acrosomal proteins directly involved in binding and penetration (Yamagata et al., 1998). Another

plausible explanation is there may be other proteolytic enzymes that can compensate

acrosin for zona-penetration. Acrosin’s involvement in sperm-zona binding and

penetration is reliant on it being localized to the inner acrosomal membrane of the sperm

head. Only one acrosin localization study, out of many, has provided ultrastructural

evidence that proacrosin/acrosin resides on the IAM (Johnson et al., 1983). Confirmation

of proacrosin/acrosin IAM association is needed, especially after induction of the

acrosome reaction, if acrosin is to be considered a sperm-zona binding and penetrating

molecule.

Another candidate is PH-20, a GPI-anchored hyaluronidase, displaying both

enzymatic activity and secondary binding. The N- and

C-terminal domains of PH-20 have

been reported to be responsible for the enzymatic and ZP binding functions, respectively

(Hunnicutt et al., 1996). PH-20 protein was suggested to be required for secondary

binding because antibodies against different epitopes of PH-20 can inhibit the binding of

8/3/2019 Yu_Yang_200811_PhD


38

acrosome-reacted sperm but not acrosome-intact sperm to the zona pellucida (Primakoff

et al., 1985; Myles, 1987; Hunnicutt et al., 1996). Further studies proposed the role of

PH-20 in sperm-zona binding is via the IAM (Huang et al., 1985; Myles, 1987).

However, the story of the migration of this sperm surface protein to the IAM makes the

role of PH-20 in the secondary binding suspicious. PH-20 is first detected during the

early stages of spermatid development. Immunofluorescence microscopy indicated that

the protein is inserted in the acrosomal membrane in cap phase spermatids but does not

enter into the intraacrosomal space. At late stages of spermatid development, the protein

is transported to the plasma membrane where it apparently initiates sperm attachment tothe zona pellucida prior to the acrosomal exocytosis in guinea pig and mouse (Primakoff

et al., 1985; Lathrop et al., 1990). It was reported by immunofluorescent detection to

translocate from the sperm plasma membrane to the surface of the IAM after the

acrosome reaction (Cowan et al., 1991). Immunogold labelling at the ultrastructural level

also localized PH20 to the IAM of acrosome reacted monkey(Yudin, 1999). Even though

the PH-20 protein is on the IAM prior to the acrosome reaction (Cowan et al., 1986), its

recruitment from the posterior head plasma membrane to the IAM after the acrosome

reaction is thought to increase the number of PH-20 binding sites on the IAM. In

contrast to the somewhat confusing localization data that supports the role of PH-20 in

secondary binding, there is a conflicting report showing that PH20 immunoreactivity is

lost during the acrosome reaction in bovine sperm and that its major distribution before

acrosomal exocytosis is in the sperm's postacrosomal sheath region (Lalancette et al.,

2001). Moreover, a more recent study shows that male mice with a disruptive mutation in

the PH-20 gene are still fertile. Among Ph20+/+, Ph20+/ , and Ph20 / mouse sperm

8/3/2019 Yu_Yang_200811_PhD


39

there is no significant difference in their ability to bind cumulus-free, ZP-intact eggs

(Baba et al., 2002), suggesting PH-20 is not as critical for the sperm-zona interaction.

SAMP32 (Hao et al., 2002), SAMP 14 (Shetty et al., 2003), and Sp10 (Herr et

al., 1990; Wright et al., 1990; Coonrod, 1996) are proteins shown to be retained on the

IAM after the acrosome reaction, and antibodies against individual molecules can inhibit

the binding and fusion of sperm to zona free hamster eggs. However, their involvement in

the secondary binding cannot be concluded until their direct specific affinity to ZP2 is

established.

Sp17 (24/17kDa), another proposed secondary binding sperm protein is a member

of the rabbit sperm autoantigen (RSA) family of proteins (O'Rand, 1981). Antibodies

against different epitopes of the RSA proteins can inhibit in vitro fertilization (O'Rand et

al., 1984). Sp17 has the ability to bind to heat-solubilized rabbit ZP and dextran sulfate in

ELISA (Richardson et al., 1994). It was shown to be present on the equatorial surface of

acrosome-reacted spermatozoa (Richardson et al., 1994). However, recombinant rabbit

Sp17 can bind to ZP1 and ZP3 but not to ZP2 (Yamasaki, 1995). More recently, Sp17 has

been reported to present in a wider range of cells with suggested involvement in tumor

cell to cell interaction (Frayne and Hall, 2002).

MC41 is an intra-acrosomal protein localized to the cortical region of the mouse

anterior acrosome (Tanii, 1995). The anti-MC41 antibody inhibits the fertilization of

zona-intact eggs but not zona-free eggs in vitro (Saxena, 1999), suggesting the

involvement of MC41 in sperm-zona interaction. MC41 can bind to mouse ZP2 in far

Western blotting, suggesting its involvement in secondary binding (Tanii et al., 2001).

8/3/2019 Yu_Yang_200811_PhD


40

However, immunogold labeling of MC41 does not localize it on the IAM. Moreover,

MC41 does not bind to ZP2 directly, but indirectly via other high-salt soluble serine

proteases (Tanii et al., 2001).

SP38 was purified by reverse phase HPLC from porcine sperm showing ZP2-

binding properties similar to those of proacrosin (Mori et al., 1993). SP38 and proacrosin

competitively bound to the 90-kDa ZP glycoprotein (mouse equivalent of ZP2) in a

calcium-dependent manner. Six residues of the 11-residue motif, of KRLSKAKNLIE, in

SP38 are conserved in the 8-residue motif, KRLQQLIE, of proacrosin (Mori et al., 1995).

These motifs were found to be solely responsible for the binding of the respective

proteins to porcine ZP2 (Mori et al., 1995). Affinity-purified anti-SP38 against the SP38

fusion protein was found to label the sperm head only after induction of the acrosomal

exocytosis with calcium ionophore A23 187, suggesting that SP38 was an intraacrosomal

porcine sperm protein. However, because this protein completely disappeared from the

acrosome after the completion of the acrosomal exocytosis it was disgarded as a

candidate for secondary binding (Mori et al., 1995) for not meeting the requirement of

being tethered to the IAM. As it will become evident in our study this was a mistaken

conclusion based on an erroneous interpretation of an in vitro acrosome reaction

induction experiment.

3.5 Zona penetration

Two theories have been acclaimed about the mechanisms used by the sperm to

penetrate through the zona pellucida. One is the zona lysin theory that stresses the soluble

enzymatic contents released and the exposure of bound sperm proteases to the IAM after

8/3/2019 Yu_Yang_200811_PhD


41

the acrosomal exocytosis digesting the zona (Jedlicki and Barros, 1985; Yanagimachi,

1994). The other is the mechanical thrust theory, which suggests that the mechanical

thrust provided by the hyperactivated motility driving the sperm through the zona (Austin

and Bishop, 1958a).

The trypsin-like serine protease proacrosin/acrosin was considered for the longest

time the most promising sperm candidate for penetrating the zona (Saling, 1981;

McLeskey, 1998). However, the fact that sperm from the proacrosin knockout mice could

still penetrate the zona pellucida and fertilize eggs dampened the enthusiasm for this

protease as a major player in this process (Baba et al., 1994; Adham, 1997). Presentlyseveral other sperm serine proteases (Kohno et al., 1998; Ohmura et al., 1999; Yamagata

et al., 1998; Honda et al., 2002; Cesari et al., 2005) and hydrolases (Tulsiani et al., 1998)

are being considered as candidates.

Different from the favored serine proteases, the involvement of ubiquitin-proteasome

system in the mammalian zona penetration has recently been proposed (Sutovsky et al.,

2004). In somatic cells, the degradation of ubiquitinated proteins by the proteasomes is a

fundamental catabolic process for the regulation of multiple physiological processes (see

review by Glickman and Ciechanover, 2002). Ubiquitinated epitopes on the outer face of

the porcine zona pellucida and proteasomes in the sperm acrosome have been reported.

Anti-proteasomal antibodies and inhibitors to proteasomes can block sperm penetrating

the ZP without inhibiting the acrosomal exocytosis (Sutovsky et al., 2004). The theory is

that proteasomes in the sperm acrosome can recognize and degrade the ubiquitinated

component of the ZP, thus playing an important role in sperm ZP penatration.

8/3/2019 Yu_Yang_200811_PhD


42

Apart from the soluable acrosome contents, the importance of the lytic enzymes

retained on the exposed IAM after the acrosomal exocytosis has been emphasized by

many researchers (Huang et al., 1985; Yanagimachi, 1994). However, except for the

proacosin, whose residing on the IAM is even promblematic, no other proteases have

been elaborated.

The change of the surface of the zona from fenestrated to smooth observed in mouse

and hamster under the electron microscope was thought due to the lytic effect of the

sperm head on the outer surface of the zona pellucida (Jedlicki and Barros, 1985).

However, the very narrow, clearly defined edge of the zona-penetration slit created by thespermatozoon has been observed in many species, including the rodents and human

(Austin and Bishop, 1958a; Pereda and Coppo, 1985) . It has been argued by some

researchers (Pereda and Coppo, 1985) that such a slit does not seem consistent with an

enzymatic digestion of the zona but rather the result of mechanic force.

Past and present defenders of the mechanical trust theory argue that the aerodynamic

shape of the sperm head, the structural rigidity of IAM (reinforcement by the PT or

perforatorium) together with the thrusting power provided by the hyperactivated motility

of capacitated sperm are enough to assure sperm penetration through the zona pellucida

(Huang et al., 1985; Green and Purves, 1984). However, after biophysical measurements

of the trusting force of sperm together with estimates of the lattice strength of the zona

pellucida, Green (1987) concluded that mammalian sperm are unable to penetrate the

zona by force alone. Without performing biophysical measurements, Bedford (1998)

counter-argued that if side-to-side oscillation of the sperm head were considered, the trust

force would be sufficient. Nevertheless, before solid proof emerges to support either the

8/3/2019 Yu_Yang_200811_PhD


43

enzymatic lysis or physical force theory of penetration, it is reasonable to assume that

spermatozoa use a combination of forward movement and enzymatic digestion to

penetrate the ZP (Green, 2002).

4. PROJECT HYPOTHESES AND OBJECTIVES

The present thesis was based on the general hypothesis that proteins associated

with the IAM and exposed after the acrosome reaction serve to secondarily bind to and

facilitate the penetration of the zona pellucida of the oocyte. Accordingly, several

objectives were developed as addressed in the following chapters:

Chapter 2:

1.To devise an isolation procedure by which we could obtain direct information on the

peripheral and integral protein composition of the sperm's IAM in the hope of identifying

candidate molecules for future investigations on sperm-zona interactions.

2. To molecularly and cytologically characterize the IAM proteins obtained by the above

procedure with the hope of identifying the elusive sperm receptors involved in binding

the acrosome reacted sperm head to the zona pellucida of the oocyte, a process coined as

“secondary binding”.

Chapter 3:

3. To assess the mechanism of secondary binding, utilizing the mouse in vitro

fertilization model, by a prominent IAM protein, IAM38, which we identified as acandidate receptor for ZP2-based zona pellucida binding.

8/3/2019 Yu_Yang_200811_PhD


44

Chapter 4:

4. To trace the origin and development of IAM38 during spermiogenesis with the

intention of clarifying how this protein gains assess to the IAM and why this protein, as

shown in its gene knockout, is essential for the structural biogenesis of the acrosome.

8/3/2019 Yu_Yang_200811_PhD


45

CHAPTER 2

THE EXTRACELLULAR PROTEIN COAT OF THE INNER

ACROSOMAL MEMBRANE IS INVOLVED IN ZONA

PELLUCIDA BINDING AND PENETRATION DURING

FERTILIZATION: CHARACTERIZATION OF ITS MOST

PROMINENT POLYPEPTIDE (IAM38)

Published in Developmental Biology 2006 290: 32-43

Copyright© 2005 Elsevier Inc.

8/3/2019 Yu_Yang_200811_PhD


46

Abstract

A consequence of the acrosome reaction is to expose the inner acrosomal

membrane (IAM), which is a requirement for the sperm’s ability to secondarily bind to

and then penetrate the zona pellucida (ZP) of the mammalian oocyte. However, the

proteins on the IAM responsible for binding and presumably penetrating the zona have

not been identified. This issue can be resolved if direct information is made available on

the composition of the IAM. For this purpose, we devised a methodology in order to

obtain a sperm head fraction consisting solely of the IAM bound to the detergent-resistant

perinuclear theca. On the exposed IAM surface of this fraction, we defined an electron

dense protein layer that we termed the IAM extracellular coat (IAMC), which was visible

on sonicated and acrosome-reacted sperm of several mammalian species. High salt

extraction removed the IAMC coincident with the removal of a prominent 38 kDa

polypeptide, which we termed IAM38. Antibodies raised against this polypeptide

confirmed its presence in the IAMC of intact, sonicated and acrosome-reacted sperm. By

immunoscreening of a bovine testicular cDNA library and sequencing the resulting

clones, we identified IAM38 as the equivalent of porcine SP38 (Mori et al., 1995), an

intra-acrosomal protein with ZP-binding ability, whose precise localization in sperm was

unknown. The blockage of IVF at the level of the zona with anti-IAM38 antibodies and

the retention of IAM38 after sperm passage through the zona support its involvement in

secondary sperm–zona binding. This study provides a novel approach to obtain direct

information on the peripheral and integral protein composition of the IAM for identifying

other candidates for sperm–zona interactions.

8/3/2019 Yu_Yang_200811_PhD


47

Introduction

The physical interactions between mammalian gametes that culminate in

fertilization begin with the penetration of capacitated sperm through the cumulus

oophorus followed by their binding to the zona pellucida (ZP), an extracellular coat

surrounding the oocyte (reviewed by Wassarman, 1988a and Yanagimachi, 1994). In

mouse, the plasma membrane of the sperm binds first to the ZP, or more specifically to

sperm receptor ZP3, one of the three ZP glycoproteins. In pig, the sperm receptor is a

complex of two distinct ZP proteins, the ZPB and ZPC (Yurewicz et al., 1998). The

initial binding to sperm receptor is called “primary binding” where species-specificity is

thought to reside (Wassarman, 1990; Bleil and Wassarman, 1990). Shortly after this

binding, sperm undergo the acrosome reaction or acrosomal exocytosis, a form of cellular

exocytosis where multiple vesiculations occur between the outer acrosomal membrane

(OAM) and the overlying plasma membrane, allowing release of acrosomal contents.

After completion of the acrosome reaction, most of the inner acrosomal membrane (IAM)

becomes exposed, except in the region of the equatorial segment where the OAM and the

plasma membrane retain their integrity (reviewed by Toshimori, 1998). Consequently,

the exposed IAM is free to contact the ZP and bind to a second kind of protein ligand

(ZP2) on the surface of the zona; this “secondary binding” is compulsory for subsequent

sperm–zona penetration (Bleil et al., 1988; Mortillo and Wassarman, 1991). Although

secondary binding to and penetration of the ZP are essential for successful natural

fertilization, the sperm molecules involved in these interactions remain enigmatic.

The discovery of a secondary binding step following the acrosome reaction

stimulated a search for sperm proteins involved in this critical fertilization step. Several

8/3/2019 Yu_Yang_200811_PhD


48

acrosomal proteins have been proposed, including proacrosin/acrosin (Topfer-Petersen,

1988; Urch and Patel, 1991; Jones, 1991), PH-20 (Cowan et al., 1991; Hunnicutt et al.,

1996; Yudin, 1999), SP17 (Richardson et al., 1994; Kong et al., 1995), MC41 (Tanii et

al., 2001), SAMP32 (Hao et al., 2002) and SAMP14 (Shetty et al., 2003). However,

either the localization of these putative receptors to the IAM before or after the acrosomal

exocytosis and during zona binding and penetration remains unresolved, or their ZP2-

binding ability is not established.

The objective of this study was to devise a procedure by which we could obtain

direct information on the peripheral and integral protein composition of the sperm's IAM,with the intent of identifying candidate receptors on IAM that could interact with ZP

during secondary binding. By devising such an approach, we have identified several

peripheral and integral IAM proteins that remain on this membrane during zona binding

and penetration. Here, we report the presence of a glycoprotein coat that remains on the

IAM after the acrosome reaction and whose most prominent constituent is a 38 kDa

peripherally attached protein (IAM38). This protein was previously reported to have

zona-binding ability on ZP2-solid support assays (Mori et al., 1993).

Materials and Methods

Sperm Head Isolation

Rat, bull and boar epididymal or ejaculated sperm were sonicated with a Vibrocell

Sonnicator (50 Watt model, Sonics and Materials Inc., Danbury, CT) to detach the sperm

head from the tail according to the procedure of Oko and Maravei (Oko and Maravei,

1994; 1995). The heads were separated from the tails in 80% sucrose by

8/3/2019 Yu_Yang_200811_PhD


49

ultracentrifugation at 200,000 × g in a T155 Beckman rotor for 1 h at 4°C. All steps were

done at 4°C with protease inhibitor (0.2 mM phenylmethylsulfonyl fluoride, PMSF)

added. The isolated sperm heads after this treatment were designated as sonicated sperm

heads (SSpH).

Isolation of the Apical Tips from Rat SSpH

Rat SSpH, suspended in 50 mM PBS, pH7.4, with protease inhibitors added were

sonicated at full intensity on ice for 15 s burst (approximately 4×) until most of the apical

tips detached from SSpH as evaluated by phase contrast microscopy. Subsequently, the

tips were separated from the tipless sperm heads in a 30/80% discontinuous sucrosegradient ultracentrifuged at 100,000 × g in a Beckman Ti41 rotor for 15 min at 4°C. The

apical tips were collected from the 30/80% interface while the tipless heads resided in the

pellet. The two fractions were then respectively washed in 50 mM PBS, pH7.4 to remove

the sucrose.

Extraction of Integral and Peripheral Membrane Proteins

The rat tips, tip-less heads and SSpH and bull SSpH were either extracted with

non-ionic detergent (0.2% Triton X-100 + 20 mM Tris–HCl, pH7.4 for 1 h at 4°C) or

high salt (1 M KCl+ 20 mM Tris–HCl, pH7.4 for 1 h or overnight at 4°C) in order to

remove integral or ionic bound membrane proteins, respectively, according to

Hjelmeland (1990). After centrifugation at 14,000 × g for 10 min, the supernatants were

then dialyzed overnight at 4°C with 4 changes of dH2O and lyophilized for subsequent

electrophoretic analysis. Additionally, rat, bull and boar SSpH were extracted for 1 h or

overnight at 4°C in Laemmli's sample buffer (Laemmli, 1970) containing 2% SDS but

8/3/2019 Yu_Yang_200811_PhD


50

without reducing agent added, centrifuged at 14,000 × g for 10 min, and the supernatant

(with or without reducing agent added) analyzed directly by SDS-PAGE.

SDS-PAGE and Western blotting

Lyophilized protein extracts and sperm head fractions before and after extraction

were dissolved in sample buffer containing 2% SDS with and without 5% β-

mercaptoethanol and run on 12% SDS-PAGE according to (Laemmli, 1970). SDS-PAGE

gels were silver stained (Wray et al., 1981) or Coomassie blue stained to show the protein

profile. Proteins separated by SDS-PAGE gel were electrophoretically transferred to

PVDF membrane (Millipore, Mississauga, ON) according to the transfer techniques proposed by Towbin et al. (1979) for Western blotting. The immunoreactivity on

Western blots was detected with peroxidase labeled goat anti-rabbit IgG (H + L) (Vector

Laboratories, Inc., Burlingame, CA) diluted 1:10,000 (v/v) using enhanced

chemiluminescent substrate (Pierce, Rockford, IL) with exposure to X-ray films.

Antibody Production

The high salt extract of bull SSpH (containing IAM38 as the major band) was

used to immunize New Zealand white rabbits as previously described (Tovich and Oko,

2003). The immune sera were affinity-purified on isolated IAM38 according to Oko and

Maravei (Oko and Maravei, 1994). The affinity-purified antibody, termed anti-IAM38,

was used for Western blotting, immunocytochemistry and immunoscreening of a bull

testicular cDNA expression library. After high salt extraction of bull SSpH, the

centrifuged and washed pellet was extracted in Triton X-100 to obtain an abundant

supply of IAM32 (see Fig. 2.4B). This extract was used to raise immune sera against

IAM32, which was then subsequently affinity-purified on isolated IAM32 and termed

8/3/2019 Yu_Yang_200811_PhD


51

anti-IAM32. Anti-PAWP antibody was raised in a similar way to IAM32 but produced

and affinity-purified against the recombinant PAWP protein.

Once IAM38 was cloned, a polyclonal antibody was raised in rabbits against a

synthetic oligopeptide chosen from a species conserved hydrophilic region of the

deduced open reading frame (see Fig. 2.6). This antibody, termed anti-C38, was affinity-

purified on recombinant IAM38 and used in IVF trials and for immunoblotting and

immunocytochemistry to confirm the specificity and localization of anti-IAM38.

Molecular cloning of cDNA encoding IAM38

Anti-IAM38 serum, recognizing only IAM38 on Western blots, was used toscreen a bull testicular ZAP Express™ cDNA library (Stratagene, La Jolla, CA)

following the method of Young and Davis (Young and Davis, 1983a,b). The phagemids

of two positive clones were excised by transfecting them with helper phage into XL-1

Blue cells and the resulting secreted and circularized plasmids were transformed into

XLOLR cells with kanamycin selection. The selected colonies were grown for plasmid

isolation and inserts released by restriction digest for agarose gel analysis. The plasmids

of both clones were then sequenced by Cortec Service (Queen's University, Kingston,

ON) using the ABI PRISM™ Dye Terminator Cycle Sequencing Kit with AmpliTag®

DNA polymerase. As both clones proved to be identical, only one clone with a 1.2 kb

insert was chosen for second and third round sequencing analysis in which both strands

were sequenced completely. The deduced amino acid sequence of the open reading frame

of this cDNA contained a sequence identical to the N-terminal of isolated IAM38

obtained by Edman's degradation (Sheldon Biotechnology Service, McGill University,

QC).

8/3/2019 Yu_Yang_200811_PhD


52

Induction of Acrosome Reaction

Isolated epididymal bovine, hamster, guinea pig, rat, and mouse sperm were

washed with 25 mM PBS (pH 7.4) and living sperm were collected using “swim-up” in

TALP medium. Rodent sperm was capacited with BSA. And bovine sperm was heparin-

capacited according to the procedure described by Handrow et al. (1989). Acrosome

reaction was induced in capacitated sperm with 2μM calcium ionophore A23187 (Sigma,

Oakville, ON), or by exposure to mouse zona pellucida (for mouse sperm only).

Ultrastructural Immunocytochemistry and Indirect Immunofluorescence

Epididymal sperm, sperm fractions, acrosome-reacted sperm and testis were fixedin 4% formaldehyde + 0.8% glutaraldehyde and embedded in LR white (Polysciences,

Inc., Warrington, PA) according to procedure described by Tovich et al. (Tovich et al.,

2004). Ultra thin sections were mounted on Formvar-coated nickel grids (Polysciences

Inc., Warrington, PA) for immunogold labeling using anti-IAM38 antibodies according

to the procedure of Oko et al. (Oko et al., 1996). A secondary 10 nm gold conjugated

goat anti rabbit IgG (Sigma, St. Louis, MO), diluted 1/20 (v/v) was used for visualization,

and sections were counterstained with uranyl acetate followed by lead citrate.

Acrosome-reacted spermatozoa were fixed with 3.7% paraformaldehyde,

mounted onto slides and labeled using anti-IAM38; secondary antibody was FITC

conjugated swine anti-rabbit IgG (1/20, v/v) (DAKO, Mississauga, ON).

To detect IAM38 during in vitro fertilization, porcine zygotes with intact ZP, and

those in which ZP was removed by protease treatment, were fixed in 2% formaldehyde as

described by Sutovsky(Sutovsky, 2004). Zygotes were sequentially incubated with anti-

C38 (dil. 1/20), washed and incubated with a mixture of TRITC-conjugated goat anti-

8/3/2019 Yu_Yang_200811_PhD


53

mouse IgG (Zymed, S. San Francisco, CA) and DNA staining DAPI (Molecular Probes,

Eugene, OR). Processed oocytes were mounted on microscopy slides and observed under

a Nikon Eclipse 800 epifluorescence microscope equipped with DIC optics and CoolSnap

HX CCD camera. Fluorescence and DIC channels were combined by MetaMorph image

acquisition software and edited by Adobe Photoshop 5.5 software. Negative control ova

fertilized in the presence of preimmune serum were photographed with settings

comparable to acquisition settings of ova processed with anti-C38.

Collection and In Vitro Maturation of Porcine Oocytes

Ovaries were collected from prepubertal gilts at a local slaughterhouse andtransported to the laboratory in a warm box (25–30°C). Ovaries were rinsed in 0.9%

NaCl solution containing 75μg/mL penicillin G and 50 μg/mL streptomycin sulfate at

room temperature (20–25°C). Cumulus oocyte complexes (COCs) were aspirated from

antral follicles (3 to 6 mm in diameter) using a 18 gauge needle attached to a 10 mL

disposable syringe. COCs were washed three times in HEPES-buffered Tyrode lactate

(TL-HEPES-PVA) medium containing 0.1% (w/v) polyvinyl alcohol (PVA) and three

times with the maturation medium. A total of 50 COCs were transferred to 500 μL of the

maturation medium that had been covered with mineral oil in a 4-well multidish (Nunc,

Roskilde, Denmark) and equilibrated at 38.5°C, 5% CO2 in air. The medium used for

oocyte maturation was tissue culture medium (TCM) 199 (Gibco, Grand Island, NY)

supplemented with 0.1% PVA, 3.05 mM d-glucose, 0.91 mM sodium pyruvate, 0.57 mM

cysteine, 0.5 μg/mL LH (L 5269, Sigma), 0.5 μg/mLFSH (F 2293, Sigma), 10 ng/mL

epidermal growth factor (E 4127, Sigma), 75 μg/mLpenicillin G and 50 μg/mL

8/3/2019 Yu_Yang_200811_PhD


54

streptomycin. After 22 h of culture, oocytes were cultured without LH and FSH for 22 h

at 38.5°C, 5% CO2 in air.

In Vitro Fertilization and Culture of Porcine Oocytes

After the completion of culture of oocytes for in vitro maturation, cumulus cells

were removed with 0.1% hyaluronidase in TL-HEPES-PVA medium and were washed

three times with TL-HEPES-PVA medium and Tris-buffered (mTBM) medium

(Abeydeera et al., 1998) containing 0.1% (w/v) BSA (A7888, Sigma), respectively.

Thereafter, 25–30 oocytes were placed into each of four 50μl drops of the mTBM

medium, which had been covered with mineral oil in 35°C 10-mm

2

polystyrene culturedish. The dishes were kept in the incubator for about 30 min until spermatozoa were

added for fertilization. A semen pellet was thawed in PBS containing 0.1% PVA (PBS-

PVA) and centrifuged at 600 × g on 80% and 60% two Percoll (Sigma) layers for 10 min.

The sperm were resuspended and washed twice in PBS-PVA at 1900 × g for 4 min,

respectively. At the end of washing procedure, the sperm was resuspended in mTBM

medium. After appropriated dilution, 50 μl of this sperm suspension was added to 50 μl

of the medium that contained ooctyes to give a final sperm concentration of 5 × 105

cells/mL. Oocytes were coincubated with spermatozoa for 6 h at 38.5°C, 5% CO2 in air.

One microliter of anti-C38 and other affinity-purified control sera at concentrations

specified in results were added to IVF medium at the time of insemination to examine the

possible immunoblock of IVF. At 6 h after IVF, oocytes were transferred into 500μl

NCSU-23 culture medium containing 0.4% BSA (A 6003, Sigma) for further culture of

19 h.

8/3/2019 Yu_Yang_200811_PhD


55

At 19 h after insemination, oocytes were fixed in 2% formaldehyde in PBS, with

and without permeabilization in 0.1% Triton-X-100, at room temperature for 40 min

(Sutovsky, 2004). To stain sperm and oocyte DNA, oocytes were incubated with 2.5

μg/mL DAPI (Molecular Probes, Eugene, OR) in PBS with 0.1% Triton-X-100 and

mounted on microscopy slides. Pronuclear formation, sperm penetration, embryo

cleavage and zona-bound sperm were counted under a Nikon Eclipse 800 epifluorescence

microscope at a magnification of 400. Oocytes were considered fertilized when they had

one or more swollen sperm heads and/or male pronuclei with their corresponding sperm

tails (Abeydeera et al., 1998), detected by differential interference contrast (DIC) opticsin the ooplasm.

Unless otherwise mentioned, all chemicals used in this study were purchased from

Sigma Chemical Co. (St. Louis, MO, USA).

Statistical Analysis

To measure the effect of anti-IAM38 antibodies on porcine fertilization in vitro,

the analysis of variance (ANOVA) was performed using the general linear model

procedure of the Statistical Analysis System (Cary, NC). The Duncan's multiple range

test was used to compare mean value of individual treatments, when the F value was

significant (P < 0.05).

Results

Isolation and High Salt Extraction of Tips

Isolated rat SSpH had tapering apical tips (Fig. 2.1A), which were broken off by

intense sonication (Fig.2.1B) leaving the SSpH with blunt ends (tipless heads). The tips

8/3/2019 Yu_Yang_200811_PhD


56

and tipless heads were then isolated from each other on a sucrose gradient (Fig. 2.1C).

Fig.2.1D is a schematic diagram comparing the morphology of the isolated tip to the

intact rat sperm head compiled from numerous electron micrographs. Ultrastructurally,

the isolated tips were free of the nucleus and consisted mainly of the IAM attached to the

perforatorium (Figs 2.1D–F). Some of the cross-sections of the tips displayed a central

oval cavity (arrows) where the nucleus had resided, while the majority displayed a central

triangular rod like structure containing the electron dense perforatorium (Fig. 2.1E). Of

particular interest was the visualization of an electron dense layer, covering the surface of

the inner acrosomal membrane (IAM), which we termed the inner acrosomal membranecoat (IAMC) (Fig. 2.1F). This coat was also evident in acrosome-reacted sperm from a

number of species (Fig. 2.2).

To provide evidence that the IAMC consists of ionic bound peripheral membrane

proteins, the intact tips (Fig. 2.3A) were extracted with 1 M KCl. In addition to analyzing

the protein content of the extract and of the tips, before and after extraction (Fig. 2.3B),

electron microscopy was used to examine the effect of the high salt extraction on the

IAMC of the tips (Fig. 2.3C). SDS-PAGE showed a decrease in the intensity of a 38 kDa

protein band in the tips after extraction (compare lanes 1 and 2 in Fig. 2.3B) coincident

with both the appearance of a 38 kDa band in the extract (Fig. 2.3B, lane 3) and the

removal of most of the IAMC from the IAM (Fig. 2.3C), when compared to tips before

extraction (Fig. 2.3A).

8/3/2019 Yu_Yang_200811_PhD


57

Figure 2. 1. Procedure for obtaining apical tips from isolated and sonicated rat sperm

heads (SSpH). A) Phase contrast micrograph of sperm heads with intact tapering tips.

Bar=10 μm. B) After an intense sonnication, the apical tips (arrowhead) break off from

the whole sperm heads, leaving the SSpH with blunt ends, referred to as tipless heads.

Bar=10 μm C) Apical tip fraction separated from tipless heads by sucrose gradient

centrifugation. Bar=10μm. D) A schematic diagrammatic comparison of the morphologyof the intact rat sperm head and an apical tip (bold arrow). The stippled region of the rat

sperm head represents the perinuclear theca (PT) or perforatorium (P). The dash line

within the stippled region represents the location of the nucleus under the PT. 1 and 2 are

representative cross-sections of the apical sperm head from regions with and without the

nucleus, respectively. As a comparison, profile 3 represents a cross section through an

isolated apical tip, which is devoid of the nucleus (dashed line) and is made up solely of

the perforatorium, IAM and its coat. E) Survey electron micrograph of cross sections of

apical tips. Arrow points to where nuclei would have been. Bar, 0.4 μm. F) Higher

magnification cross-section of apical tip. The white line is the inner acrosomal membrane

(IAM) and the densely stained material above it is the inner acrosomal membrane coat

(IAMC). Bar=0.1 μm. PM, postacrosomal membrane; OAM, outer acrosomal membrane;

ES, quatorial segment; A, acrosome; P, perforatorium.

8/3/2019 Yu_Yang_200811_PhD


58

8/3/2019 Yu_Yang_200811_PhD


59

Figure 2. 2. Electron microscopic analysis of ionophore (A23187) induced acrosomal exocytosis

in the rat and hamster spermatozoa. Cross-sections through the apical rat sperm head before (A),

in the process (B) and after (C) acrosome reaction. Bars=0.2 μm. Longitudinal sections through

the hamster sperm head before (D) and after (E) acrosomal exocytosis. The IAMC (arrows)

appears to be retained after the acrosomal exocytosis. Note that even before the exocytosis (D),

the IAMC is clearly visible within the acrosome. Bars=0.2μm. A, acrosome; P, perforatorium; N,

nucleus; OAM, outer acrosomal membrane; ES, equatorial segment; IAMC, inner acrosomal

membrane coat; AG, acrosome ghost.

8/3/2019 Yu_Yang_200811_PhD


60

8/3/2019 Yu_Yang_200811_PhD


8/3/2019 Yu_Yang_200811_PhD


62

High Salt and Non-ionic Detergent Extraction of Bull SSpH

In order to scale up our extraction procedure (to obtain enough protein for

antibody production and peptide sequencing), we used isolated and sonicated bull sperm

heads (SSpH) (Fig. 2.4A) that by ultrastructural evaluation were missing their

plasmalemma and acrosomal contents but retained their IAM. As was the case for rat

SSpH, the major salt-extractable protein of the bull SSpH was a protein of 38 kDa (Fig.

2.4B, lane 3). Importantly, we found that Triton X-100 extracted the 38 kDa protein

along with another prominent 32 kDa protein from the bull SSpH (Fig. 2.4B, lane 4).

However, prior salt extraction removed the 38 kDa protein so that on subsequent TritonX-100 extraction only the 32 kDa protein of was found (Fig. 2.4B, lanes 5).

Antibody Specificity and Verification of Cross-species Protein Identity

Anti-IAM38 serum raised and affinity-purified against the salt extractable 38 kDa

polypeptide specifically labeled a 38 kDa band found in whole sperm and KCl extracts of

SSpHs in both bull and rat (Fig. 2.5A). As was the case for KCL extracts, the 38 kDa

polypeptide was also found to be a prominent component in SDS extracts of rat, bull and

boar SSpH (Fig. 2.5B).

Isolation and Sequencing of cDNA Clones

Several positive cDNA clones were obtained from immunoscreening of a bull testicular

ZAP Express cDNA library using affinity-purified anti-IAM38 antibody. The nucleotide

sequence of the longest cDNA clone and the deduced amino acid sequence of its open

reading frame are shown in Fig. 2.6. Residues 1–14 of the deduced amino acid sequence

were identical to the first 14 residues found in the high salt-extracted 38 kDa protein by

8/3/2019 Yu_Yang_200811_PhD


63

Figure 2. 4. EExxttr r aaccttiioonn of IAM proteins from sonicated and isolated bull sperm heads (SSpH). A)

Bull SSpH seen by phase-contrast microscopy. Bar=5 μm. B) SDS-PAGE analysis (under

reducing conditions) of salt-extractable (1M KCl) bull SSpH proteins revealed a major

polypeptide with a molecular mass of 38 kDa (asterisk, lane 3). Lane 1 is the molecular mass

standards in kDa and lane 2 is the whole protein profile of the SSpH. This 38 kDa protein was

also extractable from SSpH in 0.2% TritonX-100 along with another prominent protein of 32 kDa(lane 4), however, if KCL extraction was done prior to Triton X-100 extraction only the 32 kDa

protein remained (lane 5). The SDS-PAGE mobility of both proteins was the same under

reducing and non-reducing conditions indicating that both proteins are non-covalently bound in

situ.

8/3/2019 Yu_Yang_200811_PhD


64

Edman's degradation, verifying the authenticity of our clone. BLAST analysis (Altschul,

1990) identified IAM38 cDNA as the bull equivalent of previously cloned porcine SP38

(Mori et al., 1995) and showed the nucleotide sequence to be 90% identical to porcine

SP38 mRNA and 89% identical to the human homologue. Protein alignment using

LALIGN showed 92.2% identity to porcine SP38 in 306aa overlap.

The sequence KRLXX(XXX)LIE, which according to Mori et al. (1995) is

responsible for ZP2 binding, is also present in bull, murid and human IAM38.

Localization of IAM38 on Sperm

After IAM38 was cloned, a polyclonal antibody, anti-C38, was raised in rabbitagainst a synthetic oligopeptide conserved among bull, mouse, pig and human. Identical

to anti-IAM38, affinity-purified anti-C38 labeled one band in whole sperm and 1 M KCl

SSpH extracts (not shown). As predicted from the biochemical extractions, anti-C38

immunogold labeled the IAMC of rat and bull sperm (Figs. 2.7A–E). Isolated and

sonicated rat sperm head tips clearly showed that the labeling was on the surface of the

IAM (Fig. 2.7B). Only in the equatorial region was labeling found adjacent to the outer

acrosomal membrane (Figs. 2.7A and E). Permeabilization of the sperm head with Triton

X-100 was required in order to label IAM38 by immunofluorescence (Fig. 2.8),

reinforcing the intra-acrosomal location of this protein and proposing anti-C38 as an

excellent probe indicator of acrosomal exocytosis.

Retention of the IAMC after the Acrosome Reaction and IVF

Retention of IAM38 immunolabeling on the exposed IAM surface was short lived

in sperm induced to undergo the acrosome reaction by ionophore (i.e., within 60 min of

induction, most of the surface immunolabeling had disappeared). We reasoned that this

8/3/2019 Yu_Yang_200811_PhD


65

disappearance of surface epitopes was artifactual and could be explained by proteolysis

induced by a multiple variety of hydrolytic enzymes released from the acrosome within

the confined space of a test tube. In order to validate this assumption, we chose to trace

the fate of IAM38 during in vitro fertilization (IVF) in the swine. Immunofluorescence

labeling of IAM38 was retained on the surface of the IAM both before (Fig. 2.9A) and

after sperm penetration (Fig. 2.9B) of the zona pellucida, indicating that during natural

Figure 2. 5. Western blots of sperm extracts immunolabeled with antibodies raised against the 38

kDa polypeptide (IAM38). (A) Anti-IAM38 serum affinity-purified on the isolated 38 kDa band,

specifically labeled a 38 kDa polypeptide in whole bull sperm (lane 1), KCl extract of bull SSpH

(lane 2), whole rat sperm (lane 3) and KCl extract of rat SSpH (lane 4). Molecular mass markers

are in kDa. The samples were run on SDS-PAGE under reducing conditions and then transferred

to Western blots for immunoblotting. (B) 2% SDS extracts of rat- (lanes 1, 2), bull- (lanes 3, 4)

and boar- (lanes 5, 6) SSpH that were Coomassie stained and immunolabeled with affinity- purified anti-C38 serum, respectively. It is important to note that the Commassie staining was

done after the immunoblotting on the same lane. The extracts were run on SDS-PAGE without

the addition of reducing agents. The molecular mass markers are in kDa.

8/3/2019 Yu_Yang_200811_PhD


66

Figure 2. 6. Partial nucleotide sequence of bovine IAM38 cDNA and its deduced amino acid

sequence obtained by immunosreening a testicular cDNA library. The N-terminal amino acid

sequence of the isolated mature protein was determined by Edman degradation and found to be

encoded in this clone (underlined in bold). The amino acid sequence KRLXX(XXX)LIE,

suggested to be responsible for binding to the ZP2 (Mori, et al, Dev Biol 168, 575-583, 1995) is

shown in italic. The amino acid sequence of the oligopeptide used for producing anti C-38

antibody is shown in bold.

8/3/2019 Yu_Yang_200811_PhD


67

1 - TCGGCACGAGAGTTGCCCCAAGATTCAGTGAAAATAGTGGGATCACCAAATATTCCAGTG

- S A R E L P Q D S V K I V G S P N I P V

61 - AAAGTATATGTTATGCTCCATCAAAAGAGTCCACATGTGTTATGTGTAACCCAGCGGCTG

- K V Y V M L H Q K S P H V L C V T Q R L

121 - CGGAATTCTGAACTGGTAGACCCATCATTCCAGTGGCATGGGCCTAAAGGAAAAATCATT

- R N S E L V D P S F Q W H G P K G K I I

181 - TCAGAAAACAGCACTGCACAAATCACCTCCACAGGAAGCCTTGTATTCCAGAACTTTGAG

- S E N S T A Q I T S T G S L V F Q N F E

241 - GAAAGCATGAGTGGTGTTTACACATGTTTTCTGGAGTATAAACCTACTGTGGAAGAAGTC

- E S M S G V Y T C F L E Y K P T V E E V

301 - ATCAAAAATCTCCAACTGAAATATGTTGTATATGCTTATCGTGAGCCGCATTATTATTAC

- I K N L Q L K Y V V Y A Y R E P H Y Y Y

361 - CAGTTCACAGCTCGATATCATGCAGCTCCCTGCAACAGTATCTATAATATTTCTTTTGAG

- Q F T A R Y H A A P C N S I Y N I S F E

421 - AAGAAACTTCTTCAGATTTTAAGCAAACTTGTTCTTGACCTTTCATGTGAAGTTTCCTTA

- K K L L Q I L S K L V L D L S C E V S L

481 - CTTAAGTCTGAATGTCATCGTGTTAAAATGCAAAGAGCTGGTTTGCAAAATGAATTGTTT

- L K S E C H R V K M Q R A G L Q N E L F

541 - TTTACATTTTCAGTTTCATCTCTAGACACCGAAAAAGGACCCAAGCCATGTGCAGACCAT

- F T F S V S S L D T E K G P K P C A D H

601 - AGTTGTGAATCTTCCAAAAGACTGTCTAAGGCTAAAAATCTCATAGAGCGGTTTTTTAAT

- S C E S S K R L S K A K N L I E R F F N

661 - CAACAAGTGGAAGTTTTGGGCAGACGTGCAGAGCCATTGCCTGAGATATACTATATTGAA

- Q Q V E V L G R R A E P L P E I Y Y I E

721 - GGTACCCTCCAAATGGTTTGGATTAATCGCTGCTTCCCAGGGTATGGAATGAATATCCTG

- G T L Q M V W I N R C F P G Y G M N I L

781 - AAACACCCACGATGTCCTGAGTGCTGTGTAATCTGCAGCCCTGGATCTTATAACTCCCGT

- K H P R C P E C C V I C S P G S Y N S R

841 - GATGGAATTCACTGCCTTCAGTGCAATAGCAGCCTGGTGTTTGGAGCAAAAGCATGTTTA

- D G I H C L Q C N S S L V F G A K A C L

901 – TAGGTCCATTTTGAGCTCGTCGATGGTTTGTCAAACACAAAAGTATATTTTTGAAGTATT

- * V H F E L V D G L S N T K V Y F

961 - AATATATAATAAATCACTATTATGCCAAAATTAAATGTATTAGATTTTACCAAAAAAAAA

1021 - AAAAAAAAA

8/3/2019 Yu_Yang_200811_PhD


68

Figure 2. 7. IImmmmuunnooggoolldd llooccaalliizzaattiioonn oof f IIAAMM3388 iinn tthhee ss p peer r mm hheeaadd uussiinngg aannttii--CC3388 aannttii b booddyy.. In

cross-sections of the mature rat sperm (A) and isolated rat tips (B), the labeling is mainly

associated with the IAM and IAMC. Similarly, immunogold labeling is over the IAM and IAMC

(arrows) of the epididymal bull spermatozoa (C, D, E). Notice the presence of the labeling in the

equatorial segment and the absence of labeling in the perinuclear theca (E). IAM, inner acrosomal

membrane; IAMC, inner acrosomal membrane coat; ES, equatorial segment; PS, postacrosomal

sheath; Bars=0.2μm.

8/3/2019 Yu_Yang_200811_PhD


69

8/3/2019 Yu_Yang_200811_PhD


70

Figure 2. 8. Membrane permeabilization of the sperm head is required to retrieve IAM38

antigenicity by immunofluorescence. Phase contrast micrographs (A,D) of same fields (B,C),

respectively, immunofluorescence labeled with anti IAM38 serum (anti-C38). Bull sperm before

(A,B) and after (C,D) Triton X-100 permeabilization. Bars=5 μm.

8/3/2019 Yu_Yang_200811_PhD


71

Figure 2. 9. Dual epifluorescence (A–D) and DIC-microcopy (A′ –D′) imaging of IAM38 in

boar sperm during zona pellucida-induced acrosome reaction (A, C, D) and after zona

penetration (B) of swine oocytes. In panel A, the acrosome-reacted spermatozoa are adjacent to

the ZP (A′). Inset shows a side view of a zona-bound spermatozoon. In panel B, the sperm have

already penetrated the zona and are attached to oolemma (B′). Zona pellucida was removed

from this egg prior to immunofluorescence processing, leaving only the oolemma-bound

spermatozoa. Panels C and D show the confirmation of the specific binding of anti-C38

antibody to sperm IAM during IVF-antibody block studies. The binding of anti-C38 (C) and a

control, unrelated rabbit antibody (D) was detected by the incubation of inseminated, fixed ova

with goat-anti rabbit IgG-TRITC (GAR-TRIC; red). DNA in all figures was counterstained

with DAPI (blue). ZP, zona pellucida; Ool., oolemma. Scale bars = 5 μm.

8/3/2019 Yu_Yang_200811_PhD


72

8/3/2019 Yu_Yang_200811_PhD


73

fertilization the integrity of the IAMC is preserved after the acrosome reaction.

Preimmune serum to anti-C38 served as a negative control (not shown).

Anti-IAM38 Antibodies Block Porcine In Vitro Fertilization

Retention of the IAM38 on the sperm surface after the acrosome reaction in situ

suggested a role for this major IAMC protein in zona binding and penetration. Indeed,

adding affinity-purified anti-C38 serum at a dilution of 1/100 into the IVF medium

(toattain a final concentration of 0.14 μg/mL) significantly decreased the porcine IVF rate

when compared to a no antibody control, and such an effect was not observed in the

presence of other control immune sera (Fig. 2.10A) or with increased dilutions of anti-C38 (1/200) (not shown). Control immune sera were against another prominent IAM

protein (anti-IAM32; final concentration in the IVF medium of 0.17 μg/mL) and a sperm

postacrosomal sheath WW domain binding protein (anti-PAWP; final concentration in

IVF medium of 0.25 μg/mL) likely involved in egg activation. The specificity of the

binding of anti-C38 antibody from IVF medium to IAM of acrosome-reacted

spermatozoa was confirmed by secondary detection with fluorescence labeled goat anti-

rabbit IgG (Fig. 2.9C) and appropriate negative controls (Fig. 2.9D).

The reduction in fertility, with anti-C38 bound to acrosome-reacted sperm, was

coincident with a significant decrease in the amount of sperm bound to the zona pellucida

when compared to the controls (Fig. 2.10B). Importantly, with anti-C38 (0.14 μg/mL) in

the IVF mediium, no sperm were ever found adjacent to the oolemma in the unfertilized

eggs, implying blockage of zona penetration. Reducing the concentration of anti-C38 in

half abolished its blocking effect on zona binding (not shown). It is noteworthy that one

of the control sera used was raised against IAM32, another prominent IAM protein (Fig.

8/3/2019 Yu_Yang_200811_PhD


74

2.4), but it was ineffectual in preventing fertilization in vitro even though it coated the

exposed IAM during IVF (unpublished data). This diminishes the argument that steric

hindrance by antibody coating of the IAM could have led to blockage of zona binding

and/or penetration. In context of SP38′s previously shown ZP2-binding ability (Mori et

al., 1995), this result resurrects the idea of this protein's involvement in secondary

sperm–egg binding.

Figure 2. 10. Effect of anti-IAM38 antibody (anti-C38) on swine IVF. A. Block graph depicting

mean percentage +/-SE of oocytes (numer of oocytes =38-43 included in 2 trials) that werefertilized after incubation with sperm in IVF medium containing anti-IAM38, anti-IAM32, anti-

PT32 (PAWP) or no antibodies (No Ab). B. Graph showing the mean number +/- SE of sperm

bound to the zona pellucida after insemination of oocytes in the same trial and conditions as

above. Superscripts a and b in both figures denote a significant difference at P < 0.05.

8/3/2019 Yu_Yang_200811_PhD


75

Discussion

Figure 2.11 consolidates our biochemical, ultrastructural and

immunocytochemical evidence for the existence in mammalian sperm of an inner

acrosomal membrane coat (IAMC) that becomes exposed after the acrosome reaction

(Fig. 2.11B) and potentially harbors proteins involved not only in sperm–zona pellucida

secondary binding, but zona penetration as well. It illustrates how our sonicated sperm

head “tip” (Fig. 2.11C) serves as an appropriate model to selectively extract these

proteins from the IAMC, as the only underlying structure is the detergent and high salt-

resistant perforatorium. In this study, we provide evidence that IAM38 is a prominent

peripheral protein of the IAM. However, we have evidence that several other proteins,

including proteolytic ones, make up this peripheral membrane coat. We suggest that these

peripheral proteins are attached by non-covalent bonds (as is IAM38) to underlying

integral membrane proteins of the IAM (e.g., IAM32) that in turn are attached to the

underlying perinuclear theca or perforatorial proteins (Fig. 2.9D). The concept that the

IAM contains specialized proteins involved in secondary binding and penetration of the

zona pellucida is not new and has been proposed by Yanagimachi (Yanagimachi, 1994)

and Wassarman (Wassarman, 1999) in their comprehensive reviews on fertilization. We

strengthen this concept by providing: physical evidence for the existence of an

extracellular electron dense layer adjacent to the IAM, biochemical evidence that the

proteins in this layer are bound to the IAM by ionic bonds and developmental evidence

that these proteins are retained on the IAM surface after zona pellucida-induced acrosome

reaction in situ. Characterization of the most prominent of these peripheral proteins,

IAM38, provides compelling support for this layer's role in fertilization.

8/3/2019 Yu_Yang_200811_PhD


76

Figure 2. 11. Schematic ddee p piiccttiioonn oof f aa p piiccaall ccr r oossss--sseeccttiioonnss tthhr r oouugghh aa f f aallcciif f oor r mm ss p peer r mm hheeaadd b beef f oor r ee

((AA)) aanndd aaf f tteer r ((BB)) aaccr r oossoommaall eexxooccyyttoossiiss aanndd f f oolllloowwiinngg uullttr r aa--ssoonniiccaattiioonn ttoo b br r eeaak k oof f aa p piiccaall ttii p pss ((CC))..

BBootthh tthhee aaccr r oossoommaall eexxooccyyttoossiiss aanndd ssoonniiccaattiioonn r r eessuulltt iinn tthhee eexx p poossuur r ee oof f tthhee iinnnneer r aaccr r oossoommaall

mmeemm b br r aannee ccooaatt ((IIAAMMCC)),, wwhhiicchh iiss aattttaacchheedd ttoo tthhee iinnnneer r aaccr r oossoommaall mmeemm b br r aannee ((IIAAMM)).. AA tteennttaattiivvee

mmooddeell oof f tthhee IIAAMM mmeemm b br r aannee aanndd iittss r r eellaattiioonnsshhii p p ttoo tthhee uunnddeer r llyyiinngg p peer r f f oor r aattoor r iiuumm aanndd oovveer r llyyiinngg

ccooaatt iiss ddee p piicctteedd iinn ((DD)).. P, perforatorium.

8/3/2019 Yu_Yang_200811_PhD


77

The search for sperm proteins involved in secondary binding to the zona pellucida

turned up several candidates. The most studied one, shown to exhibit secondary zona-

binding activity even after inactivation of protease activity, was proacrosin (Topfer-

Petersen, 1988). The binding was thought to be due to strong ionic interactions between

polysulfate groups on ZP glycoproteins and the carbohydrate moieties and basic residues

on the surface of proacrosin (Urch and Patel, 1991; Jones, 1991). However, Mori et al.

(Mori et al., 1995) demonstrated that the conversion of proacrosin to acrosin attenuated

the ZP-binding activity of proacrosin. They found that this loss in binding was most

likely due to the proteolytic loss of proacrosin residues 365–372 (KRLQQLIE).Furthermore, proacrosin-null mice were able to fertilize female mice, although zona

binding and penetration in vitro were substantially reduced when compared to wild type

controls (Baba et al., 1994). In addition, competitive experiments using recombinant

acrosin to preincubate with oocytes before IVF suggested that there are other proteins

that participate in secondary binding as well (Crosby and Barros, 1999). Finally, as far as

we are aware, no evidence exists that proacrosin resides on the IAM. Another candidate

displaying both hyaluronidase activity and secondary binding to the zona is PH 20

(Hunnicutt et al., 1996), a 64/53 kDa protein, which after the acrosome reaction was

reported on the basis of immunofluorescence detection to translocate from the guinea pig

sperm plasma membrane to the surface of the IAM (Cowan et al., 1991). Immunogold

labeling at the ultrastructural level localized PH20 to the IAM of acrosome-reacted

monkey sperm (Yudin, 1999). In contrast, PH20 immunoreactivity was reported to be

lost in acrosome-reacted bovine sperm and its major distribution was in the

postacrosomal sheath region (Lalancette et al., 2001). Moreover, recent studies showed

8/3/2019 Yu_Yang_200811_PhD


78

that despite the absence of sperm PH20, the mutant male mice were still fertile (Baba et

al., 2002). Sp17 (24/17 kDa), another proposed secondary binding sperm protein was

shown to be present on the equatorial surface of acrosome-reacted rabbit and mouse

spermatozoa (Richardson et al., 1994). However, recombinant rabbit Sp17 can bind to

ZP1 and ZP3 but not to ZP2 (Yamasaki, 1995). This is at odds with the studies of Bleil

and Wasserman (Bleil et al., 1988), which predicted ZP2 as the ligand involved in

secondary binding. The MC41 protein of mouse acrosomal cortical matrix has been

shown to have ZP2-binding activity. However, it is an intra-acrosomal protein not found

on the IAM after the acrosome reaction. In addition, it is suggested not to bind to ZP2directly, but indirectly via other high-salt soluble proteins (Tanii et al., 2001). SAMP32

and SAMP14 are two proteins associated with the IAM and retained after the acrosome

reaction, but their affinities to the ZP2 have not been specified (Hao et al., 2002; Shetty

et al., 2003). Their suggested functions are at the level of sperm-oocyte membrane

binding/fusion. The 26S proteasome, a multi-subunit acrosomal protease implicated in

the process of sperm-ZP penetration and retained on IAM (Sutovsky et al., 2004), could

be held in place by the IAMC after acrosomal exocytosis.

The original, binary model of acrosome reaction emphasizes two states for

spermatozoa: acrosome-intact and acrosome-reacted, ignoring any intermediate stages

between the two. An updated, analog model of acrosome reaction, referred to as

acrosomal exocytosis, proposes the existence of transitional states of acrosomal

exocytosis during sperm–cumulus oophorus and –zona pellucida interactions (Gerton,

2002). This concept stresses the role of proteins present in the inner acrosomal matrix, a

structure within the acrosome adjacent to the outer acrosomal membrane (Olson et al.,

8/3/2019 Yu_Yang_200811_PhD


79

2004). It is speculated that this structure, at least in the hamster and shrew, acts as a tether

on the surface of the zona pellucida enabling sperm penetration through the zona. A

major protein of this matrix is zonadhesin, which in the hamster was shown to bind to the

zona pellucida in a species-specific manner (Hardy and Garbers, 1994; Bi et al., 2003).

Most likely, the peripheral lawn of proteins we have identified on the IAM represents the

final state of acrosomal exocytosis, as this protein coat is retained after the acrosomal

reaction and during zona penetration. Its most abundant protein constituent, IAM38, may

interact with a prominent 32 kDa protein of the IAM (IAM32), as they coextract in

stoichemetric amounts in non-ionic-detergents. Salt extraction prior to detergentextraction eliminates IAM38 indicating that IAM38 and IAM32 are peripheral- and

integral-membrane proteins, respectively. IAM32, which we have cloned and

characterized, immunolocalizes to the IAM and also appears to connect to the underlying

perinuclear theca (unpublished data). As these two proteins are the most prominent

members of the IAM complex, characterizing their relationship to each other and to the

underlying perinuclear theca could be fundamental to understanding the molecular

structure and function of the IAM during fertilization.

We have identified IAM38 as the bull equivalent of porcine SP38 (Mori et al.,

1993, 1995). SP38 was originally purified from a detergent extract of porcine sperm and

shown along with proacrosin, by a solid-phase binding assay, to bind to ZP2 in a calcium

dependent manner (Mori et al., 1993). Its mRNA contains a 1053 nt open reading frame,

which encodes a precursor protein of 350 AA, which is then processed during

spermiogenesis to a mature form of 299 AA (Mori et al., 1995). SP38 was shown to

contain 3 potential N -glycosylation sites and based on the molecular mass reduction of

8/3/2019 Yu_Yang_200811_PhD


80

SP38 after glycanase treatment it was concluded that most likely two of these sites are

indeed glycosylated (Mori et al., 1995).

These investigators found SP38 to be intra-acrosomal by immunofluorescence

labeling but showed that the reactivity disappeared in acrosome-reacted sperm after a 60-

min ionophore induction. Furthermore, hydrophobicity plots of the mature form of SP38

argued against it being membrane integrated. They thus concluded that this protein is

released following the acrosome reaction, which did not lend support to its role of

binding the IAM surface of sperm to the zona pellucida during fertilization. For the

reasons outlined in the results, we also found IAM38 immunoreactivity to diminish over time in the acrosome after ionophore induction in several species of sperm. However, our

in situ immunolocalization data during IVF indicate that this protein is retained on the

IAM surface after the acrosome reaction and after zona penetration and thus rekindles the

idea of IAM38 as an important player in sperm–zona secondary binding. Precaution is

therefore warranted in deciding on an acrosomal protein's longevity based on induction of

the acrosome reaction in a test tube.

Unlike anti-IAM32 serum, which was raised against the whole molecule, anti-C38

was raised against a species conserved 16 amino acid segment of IAM38. Both antibodies

were affinity-purified on respective isolated or recombinant proteins before their use in

IVF. Importantly, both polyclonal antibodies labeled the surface of the IAM after sperm

zona penetration, but only anti-C38 was able to block penetration in IVF trials even

though presumably anti-IAM32 should have recognized many more epitopes than anti-

C38 on the IAM surface. This comparative IVF result, therefore, argues against steric

hindrance-induced blockage of zona binding/penetration by antibody coating of the IAM,

8/3/2019 Yu_Yang_200811_PhD


81

but favorably for IAM38′s secondary zona binding role. It also suggests that secondary

binding is prerequisite for zona penetration. However, even if one should adopt the view

of steric hindrance as the cause of anti-C38 serum blockage of zona penetration, the

result clearly bolsters the hypothesis that the IAM and especially its peripheral coat

(IAMC) are essential for the penetration of the zona pellucida of the oocyte during

fertilization. In this context, together with IAM38, we have salt extracted several

proteolytic proteins and proteasomal subunits from the surface of the IAM, which

potentially may be involved in lytic activity during zona penetration.

Several lines of evidence argue in favor of IAM38/SP38′s potential universal rolein secondary-zona binding during mammalian fertilization. First, the nucleotide and

amino acid sequences of boar, bull, human and murid IAM38 are highly conserved (

90%). Secondly, IAM38 appears to be testis-specific (Mori et al., 1995) and exclusively

associated with the acrosomal membrane of spermatids and spermatozoa. Thirdly,

IAM38 is likely the most abundant protein to be retained on the IAM after the acrosomal

reaction. Finally, its motif, KRLSKANLIE, whose synthetic peptide was shown by Mori

et al. (Mori et al., 1995) to effectively inhibit binding of boar SP38 to ZP glycoprotein is

conserved in bull, human and murid. However, final confirmation of its universal role

will depend on cross-species IVF inhibition trials utilizing specific blocking peptides and

antibodies and perhaps ultimately by nullifying the gene in mice.

In summary, we have devised a sperm head fractionation procedure that allows

for a more direct approach in the compositional analysis of the IAM. Utilizing this

approach, we have identified an inner acrosomal membrane coat and its prominent

constituent, IAM38, among several other less conspicuous polypeptides. The discovery

8/3/2019 Yu_Yang_200811_PhD


82

of this layer may provide a new perspective in tackling the issue of sperm–zona

interaction. Since IAM38 is the most prominent protein of the IAMC, is present on the

IAM of acrosome-reacted and zona penetrating sperm, specifically binds to ZP2 and

antibodies raised against it can block IVF, we suggest that it is a strong candidate for

secondary sperm–zona binding.

8/3/2019 Yu_Yang_200811_PhD


83

CHAPTER 3

IAM38 BINDS THE ACROSOME REACTED SPERM TO

THE ZONA PELLUCIDA OF THE OOCYTE VIA ITS KRLn

MOTIF

8/3/2019 Yu_Yang_200811_PhD


84

Abstract

IAM38/SP38 is a prominent protein of the inner acrosomal membrane

extracellular coat (IAMC) of spermatozoa retained on the inner acrosomal membrane

after acrosomal exocytosis (Yu et al., 2006). We have shown that IAM38 occupies the

leading edge of sperm contact with the zona pellucida of the oocyte during fertilization,

and that secondary binding and porcine fertilization were inhibited in vitro by antibodies

directed against IAM38. In this study we were interested in resolving the mechanism

used by IAM38 to attach the sperm to the zona pellucida. Utilizing mouse in vitro

fertilization as our model, we provide evidence that the synthetic peptide derived from

the ZP2-binding motif of IAM38, KRLSKAKNLIE, has a competitive inhibitory effect

on both sperm-zona binding and fertilization while its mutant form, in which two basic

amino terminal residues were substituted for by acidic residues was ineffective. A similar

blocking effect on secondary binding and mouse fertilization was achieved with

antibodies directed against IAM38. These results bolster our hypothesis that IAM38 is

an important player in secondary binding during mammalian fertilization and identify the

KRLXX(XXX)LIE sequence of IAM38 as at least partially responsible for the secondary

binding that exists between sperm and zona-pellucida during in vitro fertilization.

8/3/2019 Yu_Yang_200811_PhD


85

Introduction

The sperm-zona pellucida interactions are compulsory for natural fertilization to

occur. After passing through the cumulus cells of the secondary oocyte, the capacitated

sperm starts the initial interaction via primary binding between the receptor on the plasma

membrane of sperm and zona protein ZP3 (Bleil and Wassarman, 1990). Primary binding

induces the cascade event of acrosomal exocytosis, which results in the release of the

soluble acrosomal contents including a variety of hydrolytic enzymes and the exposure of

the inner acrosomal membrane (IAM). The exposed IAM provides the ground for the

secondary binding between the sperm and the ZP (Wassarman et al., 2001). It was

established that the ZP2 is the critical ligand on the oocyte for the secondary binding

(Bleil et al., 1988), however the identity of the sperm receptor for ZP2 on the IAM posed

a challenge.

By designing a sperm head fractionation procedure which exposed the proteins on

the IAM and made them readily available for high salt or detergent extraction we

identified a prominent inner acrosomal membrane protein, IAM38, which met the

requirements of a sperm receptor for secondary binding (Yu et al., 2006). These

requirements included retention on the exposed IAM after acrosomal exocytosis, specific

binding to ZP2, and the inhibition of sperm-zona secondary binding and fertilization by

antibodies against this protein. IAM38 turned out to be the bovine and mouse ortholog of

porcine SP38, a protein considered to be a secondary binding protein (Mori et al., 1993)

until its abandonment as a candidate (Mori et al., 1995). Its apparent disappearance from

the sperm head after ionophore-induced acrosome reaction suggested that SP38 was part

of the expelled contents and therefore unlikely to anchor the sperm head to the zona

8/3/2019 Yu_Yang_200811_PhD


86

(Mori et al., 1995). Contrary to this conclusion we showed that SP38/IAM38 is ionically

attached to the acrosomal membrane and is retained even after sperm penetration through

the zona (Yu et al., 2006). However, before abandonment of SP38 as a potential

secondary binding protein, Mori et al. (1995) discovered a ZP2-binding motif,

KRLXX(XXX)LIE (KRLn), common to both SP38 and proacrosin. They showed that

synthetic analogs of this KRLn motif could completely inhibit the binding of 125I labeled

SP38 or proacrosin to the porcine 90kDa glycoprotein equivalent of mouse ZP2, in a

solid-phase ELISA assay (Yu et al., 2006). Because the KRLn motif is lost after

acrosome-induced proteolysis of proacrosin (Baba et al., 1989) only the KRLn motif inIAM38 can be considered as a prime contender for sperm secondary binding.

Acknowledging that ZP2 binding is an essential requirement for a sperm protein to be

considered as a secondary binding candidate and that the KRLn motif is conserved in

mouse, human, and bull IAM38 we hypothesized that sperm-zona secondary binding is

dependent on the integrity of the KRLn motif. To test this assumption we performed

competitive inhibition in vitro fertilization trials in the mouse utilizing synthetic analogs

of KRLn.

Materials and Methods

Peptide synthesize and preparation

The peptide EASKRLSKAKNLIER (referred to as KRLn) and the mutant peptide

EASEDLSKAKNLGER (referred to as mKRLn) were prepared by AnaSpec Inc. (San

Jose, CA, USA) and McGill Sheldon Biotechnology Center (Montreal, QC, Canada)

respectively. The purity of both peptides exceeded 90%.

8/3/2019 Yu_Yang_200811_PhD


87

Antibody Preparation

Polyclonal rabbit immune serum (anti-C38) was raised against a synthetic

oligopeptide designed from a conversed region of IAM38 found in various mammalian

species (i.e., mouse, rat, bovine, pig, human). The immune serum was affinity purified on

recombinant IAM38 according to a method described previously (Oko and Maravei,

1994). The specificity of the affinity-purified antibody was confirmed on Western blots

of salt extracts of sonnicated and isolated sperm heads (Yu et al., 2006).

Superovolation and oocyte collection

8-10 week-old CD-1 female mice (Charles River, St-Constant, QC, Canada) wereinduced to superovulate by intraperitoneal injection of 7.5 IU pregnant mare serum

gonadotropin (PMSG, Sigma, St. Louis, MO, USA) followed by 5.0 IU human chorionic

gonadotropin (hCG, Sigma, St. Louis, MO, USA) 48 hr later. Oocytes were collected

from oviducts into M2 Medium (Sigma, St. Louis, MO, USA) about 15 hr after hCG

injection. Cumulus oophorus cells were removed by a brief exposure to 0.1%

hyaluronidase in M2 Medium. The cumulus-free oocytes were rinsed thoroughly in HTF

medium for three times and get recovery in HTF medium at 37°C, 5% CO2 for 30

minutes before being used for in vitro fertilization.

Sperm preparation

After sacrificing the male mice (CD-1, 3 to 4 months old, Charles River, St-

Constant, QC, Canada) the caudate epididymides were excised and freed of as much of

the connective tissue and blood vessels as possible and placed in M16 medium containing

4mg/mL bovine serum albumin (BSA). The contents of the epididymides were squeezed

out, using sterile watchmakers forceps. Sperm were allowed to "swim out" for 10 minutes

8/3/2019 Yu_Yang_200811_PhD


88

in the incubator at 37°C, 5% CO2. The sperm suspension was overlaid with 2x vol. of

HTF for 30 min at 37°C, 5% CO2 for “swim-up”. The top 1/3 part of the sperm was

counted and the concentration adjusted to 4 x 106 sperm per mL for fertilizing the

oocytes.

Wherever the effect of anti-C38 on fertilization and sperm-zona was assessed, the

sperm was incubated with 1/100 anti-C38 (this dilution was found to have the optimal

effect) or an unrelated IgG serum for 30 minutes before being used to inseminate the

oocytes.

In Vitro Sperm-ZP Binding Approximately 10–15 cumulus-free eggs were incubated at 37°C, 5% CO2 with

5μg peptide in 50μl of HTF containing 4mg/mL of BSA for 30 minutes. This

concentration of peptide (1mM) was found to have an optimal blocking effect.. Then

capacitated sperm was added with a concentration of 1x104 sperm and incubated for 1 hr.

Subsequently, sperm-egg complexes were washed gently in three fresh M16 droplets

through a drawn Pasteur pipette with a bore size of about 200-µm-diameter to remove

loosely attached sperm. The complexes were then placed into a 10µl M16 droplet,

overlaid with mineral oil, and examined under an inverted phase-contrast microscope.

Because numerous sperm bound to the egg ZP, only those observed in the same focal

plane of the egg diameter were counted. The results were expressed as mean ± SE

(standard error) of the average numbers of sperm bound per egg on three individual

experiments.

8/3/2019 Yu_Yang_200811_PhD


89

In Vitro fertilization

A group of 20-25 cumulus-free oocytes were incubated at 37°C, 5% CO2 without

or with 5μg peptide (KRLn or mKRLn) in 50μl of HTF containing 4mg/mL of BSA for

30 minutes. The oocytes were then inseminated with 1x106 above capacitated sperm at

37°C, 5% CO2. Fertilization was assessed 18 hr later by evaluating the pronuclei

formation or zygote cleavage under a phase-contrast microscopy. The in vitro fertilization

(IVF) rate was expressed as percent eggs fertilized, with the total number of eggs

inseminated defined as 100%. Experiments were repeated on four different experiments.

Alternatively, fertilization was assessed under Zeiss Axiovert 200 invertedfluorescent microscope (Zeiss, Oberkochen, Germany) after the sperm-egg complexes

were fixed for 40 minutes with 2% formaldehyde in 0.1 M PBS at room temperature and

labeled the pronucli or the sperm nuclei with 1 μM SYTOX Green stain (Molecular

Probes Inc., Eugene, OR) for 20 min at room temperature in the dark.

Statistical Analysis

To measure the effect of anti-IAM38 antibodies on porcine fertilization in vitro,

the analysis of variance (ANOVA) was performed using the general linear model

procedure of the Statistical Analysis System (Cary, NC). The Duncan's multiple range

test was used to compare mean value of individual treatments, when the F value was

significant (P < 0.05).

Results

Effect of the Synthetic Peptide

In vitro sperm-zona binding

8/3/2019 Yu_Yang_200811_PhD


90

To test the hypothesis that the KRLn motif of IAM38 partakes in secondary

binding during fertilization, mouse IVF was carried out on oocytes, preincubated before

insemination with either media alone (CTRL), medium containing KRLn peptide or

medium containing the mutant form of this peptide (mKRLn), in which amino acid K , R

and I were replaced by E , D and G respectively. One hour after insemination the sperm-

oocyte complexes were washed vigorously to remove loosely bound sperm before

counting the number of sperm bound. As a rule secondary bound sperm are firmly

tethered to the zona as compared to those primary bound or non-specifically attached

(Bleil and Wassarman, 1980b; Bleil et al., 1988) The oocytes preincubated with the peptide KRLn had a large decrease in number of sperm bound per oocyte (8.19 ± 1.94)

when compared to those with no peptide (62.06 ± 16.13) or with mutant peptide (51.26 ±

10.78) and this change was significantly different (P<0.01) from both controls (Fig. 3.1).

These results indicated that the sequence KRLSKAKNLIE has an essential role in

secondary sperm-ZP binding.

In vitro fertilization

Based on the significantly large inhibiting effect of the KRLn motif on the

secondary sperm-zona binding, we assumed that blocking this motif during IVF should

have negative consequences on fertilization. To test this hypothesis, mouse IVF was

carried out on oocytes preincubated before insemination with either media alone (CTRL),

media containing KRLn peptide or media containing mKRLn. Fertilization was evaluated

18 hours after insemination and was considered successful when ova cleaved, displayed

both male and female pronuclei or had undergone meiotic resumption (Fig. 3.2a,c) and

unsuccessful when oocytes were detected with only one polar body (Fig. 3.2b).

8/3/2019 Yu_Yang_200811_PhD


91

Preincubation of oocytes with KRLn significantly inhibited in vitro fertilization

compared to no peptide and the mutant mKRLn controls (Fig. 3.3). The mouse IVF rate

in the no peptide group (CTRL) ranged from 81% to 100% in four separate trials with an

average rate of 88.59 ± 4.09% while in the presence of the KRLn peptide the rate of

fertilization dropped significantly (P<0.05) to 46.11 ± 4.85%. This drop was not due to

steric hindrance (i.e., a peptide effect) because the rate of fertilization in the presence of

the mutant peptide (mKRLn) was found not to vary significantly from the control group

without peptide.

Effect of the Antibodies Against IAM38

In this study the synthetic analog of the KRLn motif inhibited both secondary

sperm-zona binding and fertilization in mouse IVF. However, the moderate decrease in

the fertilization rate obtained did not appear proportional to the relatively large decrease

in secondary binding and did not correlate with the results of our previous porcine IVF

study in which the inhibiting effect of an antibody (anti-C38) against IAM38 on

secondary binding and fertilization was more proportionate, i.e, low binding versus low

fertilization rate (Yu et al., 2006). Therefore in order to rule out that the discrepancy

between the two studies was due to the difference in blocking effects of the competitive

peptide versus antibody we evaluated the effects of the same antibody (anti-C38) on

secondary binding and fertilization in the mouse IVF model. The anti-C38 antibody was

raised against a species conserved oligopeptide segment of IAM38, separate from the

KRLn motif.

8/3/2019 Yu_Yang_200811_PhD


92

Figure 3. 1. Effect of the KRLn peptide on sperm-oocyte secondary binding during mouse IVF

assessed 1h after insemination of the cumulus-free oocytes preincubated without, with RKLn or

mKRLn. a). Phase-contrast images show much less sperm are bound to the zona pellucida of

oocytes after preincubation with KRLn (aii) as compared to sham control (ai, aiii). Bar=20μm. b).

Quantitative appraisal of the secondary sperm-zona binding. Bars represent the mean number of

sperm bound to the oocyte ± standard error of 3 individual experiments. Total number of oocytes

per groups is 31, 27, and 31, respectively. “a” and “b” denote a significant difference at P<0.01

between a and b.

i ii iii

a

0

10

20

30

40

50

60

70

80

90

100

Ctrl KRLn mKRLn

# o f S p e r m - B i n d i n g / O o c y t e a

a

b

b

8/3/2019 Yu_Yang_200811_PhD


93

Figure 3. 2. Morphological assessment of the state of mouse IVF 18 hours after insemination of

oocytes treated with RKL peptides. Oocytes preincubated with sham (a) or mutant peptide

mKRLn (c) have a much higher rate of fertilization than those preincubated with KRLn (b) as is

evident by the resulting 2-cell cleavage embryos. DNA was stained with SYTOX green.

Bar=20μm.

a

b

c

8/3/2019 Yu_Yang_200811_PhD


94

Figure 3.3. Quantitative appraisal of IVF result, 18 hours after insemination of oocytes

preincubated with sham (Ctrl), KRLn or mKRLn. Bars show the mean percentage of fertilization

± standard error of four individual experiments. Total number of oocytes per groups is 100, 92,

and 114, respectively. “a” and “b” denote a significant difference at P<0.05 between a and b.

0

20

40

60

80

100

Ctrl KRLn mKRLn

% o

f F e r t i l i z a t i o n

a

a

b

8/3/2019 Yu_Yang_200811_PhD


95

In vitro sperm-ZP binding

After preincubation with anti-C38, the sperm’s ability to bind to the oocytes was

greatly reduced (Fig. 3.4), to a similar extent as with the KRLn peptide (Fig. 3.1). In the

anti-C38 treated group, the number of sperm bound to each oocyte was 11.45 ± 2.59,

whereas in the no antibody control group, the number was 62.06 ± 16.13. The difference

was statistically significant (P<0.01).

Figure 3. 4. Effect of anti-IAM38 antibody (anti-C38) on sperm-oocyte secondary binding during

mouse IVF. Capacitated mouse sperm preincubated with no or 1/100 anti-C38 was used for

insemination. Bars represent the mean number of sperm bound to the oocyte ± standard error of 3

individual experiments. Total number of oocytes in both groups is 31. “a” and “b” denote a

significant difference at P<0.01 between a and b.

0

10

2030

40

50

60

70

80

90

Ctrl Anti-C38

# o f S p e

r m - B i n d i n g / O o c y t

b

a

8/3/2019 Yu_Yang_200811_PhD


96

In vitro fertilization

As shown in figure 3.5, preincubation of sperm with anti-C38 antibody (1/100)

led to a modest decrease in fertilization similar to the decrease obtained after

preincubation with the KRLn peptide in figure 3.3. The fertilization rate dropped

significantly (P<0.05%) from 88.59±4.09% and 87.45± 0.33% in the no antibody and

unrelated IgG control groups to 39.87%± 1.99% after anti-C38 treatment. The similarity

in effects on secondary binding and fertilization by anti-C38 antibody and KRLn peptide

treatments rule out differential blocking effects between the two inhibitors and strongly

suggest a species variability in the extent that fertilization is dependent on secondary binding by IAM38.

Figure 3. 5. Effect of anti-IAM38 antibody (anti-C38) on mouse fertilization. Bar graph depictingmean percentage +/-standard error of oocytes in three individual experiemnts that were fertilized

after 18h of insemination with sperm preincubated with anti-C38, unrelated IgG or no antibodies

(Ctrl). Total number of oocytes per groups is 100, 95 and 74, respectively. “a” and “b” denote a

significant difference at P<0.05 between a and b.

0

20

40

60

80

100

Ctrl IgG Anti-C38

% o

f F e r t i l i z a t i o n

a

a

b

8/3/2019 Yu_Yang_200811_PhD


97

Discussion

By competitive inhibition experiments we provide evidence that the

KRLXX(XXX)LIE motif of IAM38 is not only responsible for this protein’s interaction

with the zona pellucida during fertilization but for a large part of the secondary binding

interaction between sperm and zona. The specificity of binding shown between IAM38

and the zona pellucida during IVF compliments previous attributes used to designate

IAM38/SP38 as a candidate for the secondary sperm-zona binding (Yu et al., 2006) and

elevates this protein from contender to genuine secondary zona binding status. The

previous criteria used to designate IAM38/SP38 as a candidate for the secondary sperm-

zona binding were based on the protein’s binding selectivity for ZP2 rather than ZP3, its

localization and retention to the IAM after zona-induced acrosome reaction and zona

penetration, its highly conserved sequence among eutharian mammals and the ability of

antibodies raised against it to block secondary sperm-zona binding.

The KRLXX(XXX)LIE motif was suggested to be critical for the interaction of

both the IAM38 and proacrosin with an acidic amino acid sequence in ZP2 (Mori et al.,

1995). Our mutation strategy of substituting the critical basic amino acids with acidic

(K=E and R=D) or neutral amino acid (I=G) resulted in making the KRLn peptide

ineffective in competing for the ZP2 in mouse IVF providing direct proof for the

importance of these basic amino acids in the IAM38-ZP2 binding. The inhibiting effects

of the KRLn peptide or anti-IAM38 antibodies on sperm-zona binding in both murine

(this study) and porcine (Yu et al., 2006) IVF were approximately 75% effective

suggesting that there may be other sperm molecules or factors involved in ‘secondary’

sperm binding to the zona. This type of compensatory effect has been suggested for in

8/3/2019 Yu_Yang_200811_PhD


98

other critical steps of mammalian fertilization such as sperm-egg recognition, when 100%

inhibition is not achieved when blocking one factor or molecule (Evans et al., 1997).

Taking into consideration the significance of fertilization in the maintenance of a species,

it is reasonable to assume that more than one sperm molecule may participate in

individual biological processes associated with fertilzation. What then are some of the

other potential secondary sperm-zona binding molecules? Proacrosin has been postulated

as a potential player for the secondary binding between the IAM and ZP2 for several

decades (reviewed by McLeskey SB, 1998). In fact proacrosin contains the same ZP2-

binding KRLXX(XXX)LIE motif as IAM38 and we (Lin, Yu and Oko, unpublished data)and another group (Johnson et al., 1983) have provided direct evidence that a large

portion of proacrosin within the acrosome is attached to the IAM of bovine, mouse and

porcine spermatozoa. These criteria are in line with its role in secondary binding.

However, during the acrosome reaction, autoproteolytic activation of proacrosin to

acrosin takes place at both the N and C termini of the molecule (Baba et al., 1989). The

N-terminal end (the light chain) is retained by linking to the main part of the molecule

(the heavy chain) through disulfide bonding whereas the C-terminal end containing the

KRLn motif is lost from the molecule due to the enzymatic cleavage between the two

basic amino acids, K and R of the KRLn motif, making it unlikely that secondary binding

of acrosin is via this motif (Baba et al., 1989; Jansen, 1995). Although there are no

studies identifying which segment of the proacrosin sequence attaches the molecule to the

inner acrosomal membrane, our investigation into the molecules that reside on the IAM

(utilizing the SSpH extraction approach we have developed; see Yu et al., 2006) indicate

that acrosin is retained on the IAM. This suggests that the cleavable C-terminal end of

8/3/2019 Yu_Yang_200811_PhD


99

proacrosin is not used for attachment to the IAM, implying the short incomplete KRLn

motif is not retained on the IAM.

It was suggested though that acrosin could secondarily bind to sulphated

polysaccharides on ZP through a polysulfate-binding domain (PSBD) identified as

IFMYHNNRRYHTCGGILL (Moreno and Barros, 2000). However, a follow up IVF

study showed that antibodies raised against this suggested ‘PSBD’ domain were

ineffective in inhibiting sperm-zona binding, even though fertilization was impaired

(Moreno et al., 2002; Jansen, 1998). In fact the synthetic analog to this ‘PSBD’ domain

inhibited the acrosome reaction during mouse IVF (Moreno and Barros, 2000).Furthermore, Mori et al. (1993 and 1995) clearly showed that the KRLn peptide derived

from proacrosin could effectively out compete its parent protein for ZP2 binding making

it unlikely that there is another compensatory ZP2 binding site on proacrosin. A similar

conclusion can be made for IAM38 as its KRLn peptide also effectively out competed

IAM38 for ZP2 binding. Besides proacrosin/acrosin, other proteins that have been

proposed as the candidates for the secondary sperm-zona binding are PH-20 (Hunnicutt et

al., 1996; Primakoff et al., 1985), SAMP32 (Hao et al., 2002), SAMP 14 (Shetty et al.,

2003), Sp10 (Herr et al., 1990), Sp17 (24/17kDa) (O'Rand, 1981) and MC41 (Tanii,

1995, Saxena, 1999). However, neither the localization of these candidate receptors to the

IAM is resolved nor is their ZP2-binding ability established.

One puzzling phenomenon observed from the current study is the discrepancy

between the degrees of the inhibition of mouse sperm-zona binding and fertilization

regardless of whether KRLn peptide or anti-C38 antibody was used to inhibit IAM38.

These results differed from the porcine IVF study where the anti-C38 antibody inhibited

8/3/2019 Yu_Yang_200811_PhD


100

sperm-zona binding and fertilization to a high degree and to a comparable extent (Yu et

al, 2006). In the mouse IVF, a relatively high degree of sperm-zona binding inhibition

was obtained compared to a medium degree of inhibition of fertilization. This might be

due to a much higher sperm number used in IVF of mouse (3 x 104 sperm/egg) compared

to that of porcine (5 x 103 sperm/egg), implying that the peptide is very effective.

Alternatively, there might be some difference in the mechanisms of zona penetration

between the two species. Although we are not sure what these difference are it should not

be forgotten that leading the penetration of the mouse sperm head through the zona is the

perforatorium not found in spatulate shaped sperm such as the porcine (Austin andBishop, 1958b). The perforatorium is triangular in shape with three relatively sharp edges

and a pointed apex (Oko and Clermont, 1988) that may assist the sperm to penetrate

through the zona and hence increase the efficiency of fertilization. In context of our

secondary binding inhibition trials, sperm that still remained on the zona after inhibition

may have been more efficient in penetrating the zona pellucida and hence fertilizing if

they contained the perforatorium.

Secondary binding and zona penetration are thought to be continuous stages of the

interaction between the acrosome reacted sperm and the zona pellucida (Huang et al.,

1985; Bleil et al., 1988; Mortillo and Wassarman, 1991). After acrosomal exocytosis is

initiated by primary binding between the plasma membrane and the zona pellucida, the

connection between the spermatozoa and the oocyte may be lost temporally following the

vesiculation of the outer acrosomal and plasma membranes and consequent shedding of

the acrosomal shroud. It was proposed by Wassarman and colleagues (Bleil et al., 1988;

Mortillo and Wassarman, 1991) that the exposed IAM, at this point, provides a

8/3/2019 Yu_Yang_200811_PhD


101

receptor/receptors for the secondary binding between the spermatozoa and the oocyte,

which prevents the vigorously mobile spermatozoa from straying and holds them close

enough to the zona pellucida for proteolytic molecules on the IAM to begin to digest the

zona and facilitate sperm penetration. Our investigations reinforce this hypothesis by

identifying a ‘secondary binding’ receptor on the exposed IAM surface (Yu et al., 2006)

and providing evidence in situ that this receptor, IAM38, binds the zona by a specific

mechanism (this study). Our preliminary investigations bolster this hypothesis even more

by providing evidence that a host of proteinases, which we are characterizing at this time,

are IAM residents and thus potentially involved in sperm penetration through the zona pellucida.

8/3/2019 Yu_Yang_200811_PhD


102

CHAPTER 4

THE ORIGIN AND ASSEMBLY OF A ZONA PELLUCIDA

BINDING PROTEIN, IAM38, DURING SPERMIOGENESIS

Accepted to Microscopy Research and Technique

8/3/2019 Yu_Yang_200811_PhD


103

Abstract

IAM38 is the most prominent protein of the inner acrosomal membrane

extracellular coat (IAMC) of spermatozoa. It is retained by the inner acrosomal

membrane after the acrosome reaction and is implicated in secondary sperm-zona binding

(Yu et al., 2006). Its gene knockout, Zpbp1-/-, prevents acrosome compaction and leads to

acrosome fragmentation and sterility in male mice (Lin et al., 2007). Because of this

protein’s important role in acrosomal formation and fertilization we were interested in

tracing its origin and expression during spermiogenesis. We reasoned that a detailed

immunocytochemical investigation, utilizing anti-IAM38 antibodies as probes at the

ultrastructural level, could reveal the processes involved in assembly of the IAMC and

the compaction of the acrosome. High level of the IAM38 mRNA transcript was already

detectable at postnatal day 20, corresponding to the time in mouse testis development

when round spermatids first appear and acrosomal formation is initiated. IAM38 protein

was first seen during this time (Golgi phase of spermiogenesis) within the dense core of

the proacrosomal granules (PG) of round spermatids. After PG fusion to form the

acrosomic vesicle (AV) the immunoreactivity was concentrated in the centrally located

acrosomic granule (AG) of the AV, until acrosomal-nuclear docking occurred.

Subsequently, in the cap phase, IAM38 migrated from the AG to the extracellular side of

the acrosomal membrane, eventually disappearing altogether from the AG. During the

elongation phase IAM38 labeling disappeared from the outer acrosomal membrane

(OAM) in the apical and principal segments of the acrosome but remained lining the

OAM in the equatorial segment (ES) as well as the entire IAM of the acrosome.

Compaction of the ES in the maturation phase of spermiogenesis coincided with the

8/3/2019 Yu_Yang_200811_PhD


104

IAM38-labeled extracellular coat of the inner and outer acrosomal membranes coming

together in close proximity of each other to form a ‘zipper-like’ structure found in the ES

of mature spermatozoa. In summary, our results set a precedent, showing for the first

time that glycoproteins, which originate in the acrosomic granule, can be transferred to

the acrosomal membrane during acrosome formation. Furthermore, the localization of

IAM38 on the extracellular side of both the inner and outer acrosomal membrane during

the cap phase of acrosomal development supports the role of this prominent protein in

acrosomal compaction.

8/3/2019 Yu_Yang_200811_PhD


105

Introduction

Spermiogenesis is the third and last phase of spermatogenesis in which a round

haploid spermatid differentiates into an elongated spermatozoon. During this cellular

metamorphosis, the major changes that take place are the formation of the acrosome,

axonemal assembly, nuclear elongation and chromatin condensation and the assembly of

accessory components including mitochondria around the axoneme. Using the periodic

acid-Schiff (PAS) staining technique for the detection of carbohydates, Leblond and

Clermont (Clermont and Leblond, 1955; Leblond and Clermont, 1952) were first to

connect the formation of the acrosomic system with the glycoprotein secretory activity of

the Golgi apparatus. This histological technique also allowed them to follow the

development of the acrosome in relationship to the shape changes in the spermatid

nucleus and consequently to divide spermiogenesis into four phases (Golgi, cap,

acrosome and maturation), each phase incorporating multiple steps.

The Golgi and cap phases, can be distinguished by two different phases of

secretory activity (Clermont et al., 1993; Smith et al., 1990; Susi et al., 1971; Tang et al.,

1982; Thorne-Tjomsland et al., 1988; Oko and Clermont, 1998). In the first phase (steps

1-3) the Golgi apparatus secretes several small and dense secretory granules rich in

hydrolytic enzymes such as proacrosin (Bozzola et al., 1991). These proacrosomic

vesicles coalesce to form a single larger, dense cored, spherical acrosomic vesicle, which

associates with the nuclear envelope (NE) via a proteinaceous layer referred to as the

perinuclear theca (PT). In this phase, the Golgi apparatus is composed of short stacks of

saccules with relatively large intersaccular regions. These stacks, especially the middle

NADPase positive saccules of the stacks, appear to be involved in forming proacrosomic

8/3/2019 Yu_Yang_200811_PhD


106

granules that are strongly NADPase reactive (Smith et al., 1990). In the second phase

(steps 4-7) the acrosomic vesicle (AV) enlarges by fusing with numerous small carrier

vesicles originating from the trans face of the Golgi apparatus (Thorne-Tjomsland et al.,

1988). As a result, there is a continual addition of membrane and glycoprotein, allowing

the less dense cortex part of the AV to expand over the nucleus and take the shape of a

cap. It should be emphasized that the expansion of the acrosomic system is synchronous

with the expansion of the underlying PT (Oko and Maravei, 1995; Mountjoy et al., 2008;

Oko, 1995; Oko, 1998; Aul and Oko, 2002).

In the cap phase, the saccular regions of the Golgi apparatus are extensive whilethe intersaccular regions are relatively short and it appears that the CMPase positive

saccules in the trans Golgi network are most active in supplying vesicles for the growth

of the CMPase positive acrosomic cap (Tang et al., 1982; Thorne-Tjomsland et al.,

1988). At the beginning of the acrosomic phase, the Golgi apparatus detaches from the

acrosome, signifying the end of its synthesis. During this third phase (the acrosomic

phase: steps 8-12, bull; steps 8-13, mouse) the acrosome gradually condenses and

conforms to the changing shape of the condensing and elongating nucleus and therefore

an equally appropriate description for this phase, which often is used, is the elongation

phase. In the final maturation phase the most obvious structural change to the acrosomic

system is the thinning of the equatorial segment. The two phases of Golgi secretory

activity during acrosome formation suggest that proteins forming the acrosomal granule,

the extracellular lining of the acrosomal membrane and the various domains of the matrix

of the acrosome can only get to the acrosome in two ways: either by way of the

8/3/2019 Yu_Yang_200811_PhD


107

proacrosomic vesicles secreted in the Golgi phase or by way of small carrier vesicles that

expand the acrosomic system in the cap phase.

It is likely then that most proteins carried in the proacrosomic vesicles, which

form the acrosomic granule, will not be present in the small carrier vesicles of the cap

phase. Interestingly, proteins that enter via the proacrosomic granules and form the

acrosomal granule can be redistributed to occupy or form other domains or regions of the

acrosome later in spermiogenesis. For example, proacrosin is redistributed from the

acrosomic granule to the principal segment of the boar acrosome during the maturation

phase (Bozzola et al., 1991); AM50 is redistributed, in cap phase Guinea pig spermatids,from the acrosomic granule to the peripheral matrix surrounding it, eventually being

confined in the maturation phase to the ventral matrix (M3) of the apical segment of the

acrosome (Westbrook-Case et al., 1995); and AM22/AM29, arising from a common

precursor protein in the acrosomic granule of hamster spermatids, occupy the entire

matrix of the apical and principal segments of spermatozoa (Olson et al., 1998).

Unfortunately, for the majority of acrosomal proteins identified their point of entry into

the acrosomic system, as well as the domains they are sorted to within the acrosome are

unknown. In fact, examples of acrosomal proteins entering the acrosomic system in the

second secretory phase (cap phase) are difficult to find. An acrosomal protein that

appears to utilize this route of entry is zonadhesin as it was reported not to be found in the

acrosomal granule but rather shown to be equally distributed between the outer and inner

domains of the acrosomal membrane during the cap phase, eventually disappearing from

the inner acrosomal membrane entirely (Olson et al., 2004).

8/3/2019 Yu_Yang_200811_PhD


108

The integral acrosomal membrane proteins, on the other hand, which would be

essential for initiating the organization of the acrosomal contents into the three major

regions of the mature acrosome (i.e., apical, principal and equatorial segments; see

Gerton, 2002), would most likely be transferred directly from the Golgi membrane

system to the acrosomal membrane by means of carrier vesicles during both phases of

secretion. The possibility arises that some integral proteins could be produced and

secreted at different phases of secretory activity and others would be constitutively

secreted throughout acrosomal formation. Presently, with the exception of IAM32, a

protein found in the inner acrosomal membrane (Yu et al., 2006) and two calcium- binding proteins isolated from the outer acrosomal membrane (Sukardi et al., 2001), no

integral membrane proteins of the acrosomal membrane have been identified as far as we

are aware.

In order to better understand the overall organization and hence functional

strategy of the acrosome during capacitation, acrosome reaction and fertilization it is

essential to ultrastructurally trace the routes acrosomal proteins use to access the

acrosome during the Golgi and cap phases of spermiogenesis and their sorting pathways

once within the acrosome to form distinct morphological domains. In this study we

describe the origin and developmental distribution of the acrosomal protein IAM38,

which is a prominent member of the extracellular coat of the inner acrosomal membrane

of spermatozoa. This protein has been implicated in acrosomal compaction during

spermiogenesis (Lin et al., 2007) and secondary-zona pellucida binding during

fertilization (Yu et al., 2006). The strategies employed to assemble IAM38 within the

8/3/2019 Yu_Yang_200811_PhD


109

acrosome give insights into how this protein may be involved in compaction and how the

inner acrosomal membrane coat is constructed.

Material and Methods

Antibody Preparation

Polyclonal rabbit immune serum (anti-C38) was raised against a synthetic

oligopeptide designed from a conserved region of IAM38 found in various mammalian

species (i.e., mouse, rat, bovine, pig, human). The immune serum was affinity purified on

western blot-immobilized recombinant IAM38 according to a method described

previously (Oko and Maravei, 1994). The specificity of the affinity-purified antibody wasconfirmed on Western blots of salt extracts of sonnicated and isolated sperm heads.

Tissue Preparation

Mature CD1 mice and Sprague-Dawley rats (Charles River, St-Constant, QC,

Canada) and bull testes were processed for immunoperoxidase microscopy and

immunogold electron microscopy as previously described (Oko, 1998; Wu et al., 2007).

Briefly, for light microscopy, testes were perfusion fixed with Bouin’s fixative; following

fixation, the tissue was washed in several changes of 70% ethonal before dehydration and

embedding in paraffin. For electron microscopy, after perfusion fixation in 4%

formaldehyde + 0.8% glutaraldehyde in PBS, the testis was dehydrated in graded series

of ethanol up to 90% before embedding in LR white (Polyscience, Inc., Warrington,

PA).

Northern Blot Analysis

Testes of 11, 20, 25, 30 days postnatal and adult mice were freshly collected and

total RNA isolated by using RNeasy Mini-Preparation Kit (Qiagen, Mississauga, ON,

8/3/2019 Yu_Yang_200811_PhD


110

Canada) according to manufacture’s instruction. Digoxygenin (DIG)-labeled sense and

anti-sense riboprobes of IAM38 were created by in vitro transcription using an IAM38

cDNA cloned from the bull testis cDNA library as template. Hybridization was

performed in DIG Easy Hyb Buffer (Roche Biomolecular, Germany) overnight at 68̊ C.

The blots were then washed twice at room temperature in a buffer of 2X SSC containing

0.1% SDS followed by two stringency washes at 68˚C in 0.5%SSC containing 0.1%

SDS. Lumi-Films (Roche Biomolecular, Germany) were exposed for 15 min at room

temperature. The 18S rRNA was used as an internal comparison for quality control.

Immunoperoxidase staining for Light microscopy (LM)

Immunoperoxidase staining was carried out as described previously (Oko et al.,

1996). Paraffin-embedded tissue was cut into 5 μm section and mounted on poly-L-

Lysine (Sigma, St. Louis, MO)-coated slides. Following deparaffinization in Xylene and

hydration through a concentration graded series of ethanol; immunolabeling was

conducted using an avidin-biotin-peroxidase complex (ABC) kit (Vector Labs,

Burlingame, CA). Nonspecific sites were blocked by avidin- and biotin-blocking serum,

followed by 10% normal goat serum (NGS) in TBS. Tissue sections were incubated with

primary antibody overnight at 4̊ C. After washing five times in 25 mM Tris-buffered

saline (TBS, pH 7.35) containing 0.1% Tween, the sections were incubated with

biotinylated goat anti-rabbit IgG secondary antibody (1:200, Vector Labs, Burlingame,

CA) for one hr at 37˚C, followed by incubation with ABC. Peroxidase reaction was

visualized by incubation for 10 minwith 0.03% hydrogen peroxide and 0.05%

diamniobenzidine tetrachloride (DAB, Sigma, St. Louis, MO). After washing, the

8/3/2019 Yu_Yang_200811_PhD


111

sections were counterstained with 0.1% methylene blue, dehydrated in graded ethanol,

immersed in xylene, and mounted in Permount.

Control sections were incubated in either preimmune rabbit serum, or with

primary antibody preabsorbed with the synthesized oligopeptide used for producing the

anti-C38 serum. For mouse testicular tissue, a microwave antigen retrieval procedure was

performed to unmask the antigenic epitopes according to Tovich et al. (2004).

Immunogold labeling for Electron Microscope (EM)

Immunogold labeling was carried out according to Tovich et al. (2004).

Immunogold labeling was carried out according to Tovich et al. (2004). LR white embedded

tissue was cut into ultrathin section and mounted on Formvar-coated nickel grids (Polyscience

Inc., Warrington, PA). After blocking with 10%NGS the sections were incubated overnight at

4˚C with primary antibody. Following thorough washing, the sections were incubated with goat

anti-rabbit IgG conjugated to 10nm colloidal gold (1/20; Sigma, Mississauga, ON, Canada). The

sections were counterstained with uranyl acetate and lead citrate and examined by transmission

electron microscope (EM; Hitachi 7000). Control sections were incubated in either the absence of

primary antibody or with preimmune rabbit serum.

Results

Developmental Northern Blot Analysis

To detect mRNA expression of IAM38 during spermiogenesis, northern blots of total

RNA isolated from testis of mice 11 to 45 days after birth were probed with DIG-labeled

antisense riboprobe transcribed from IAM38 cDNA (Fig. 4.1). As expected, hardly any

signal was detected 11 days postpartum, corresponding to the time when early pachytene

spermatocytes first develop. On day 20 postpartum a very strong signal over a 1.4 kb

8/3/2019 Yu_Yang_200811_PhD


112

transcript was found, corresponding to the time early round spermatids first begin to

develop. Thereafter, the signal intensity over this transcript remained strong into

adulthood. The 18S rRNA (Fig. 4.1, lower panel) was used as an internal comparison for

load control and sense riboprobes served as negative controls (not shown).

1 2 3 4 5

Figure 4. 1. Developmental Northern blot of 10-μg samples of total RNA from the testis of 11 to

40 day-old mice (Lane 1-5= postnatal Day10, 20, 25, 30 and mature) hybridized with DIG-

labeled antisense RNA transcribed from pBK-CMV containing the IAM38 cDNA clone. A strong

signal is first detected on a 1.4-kb transcript on day 20 postpartum, corresponding to the time of

development when spermatids first appear. The presence of the 18S ribosomal RNA band within

each sample is indicated below. Spermatogenic cells representing the most advanced stage of

development for each sampling date are shown at the bottom. EP, early pachytene spermatocyte;

RS, round spermatid; ES, elongating spermatid; EdS, elongated spermatid; MS, mature

spermatid.

18S

IAM38

rRNA

mRNA

EP RS ES EdS MS

8/3/2019 Yu_Yang_200811_PhD


113

Immunocytochemical Analysis of IAM38 Expression

Light Microscopy: Survey testicular sections of bull and murid testes, immunoperoxidase

stained with the affinity purified anti-C38, provided evidence that IAM38 was expressed

solely during spermiogenesis and was mainly associated with the forming acrosome of

round and elongated spermatids (Fig. 4.2A,C). Even at this relatively low power

immunoperoxidase staining was seen associated with the acrosomic vesicle during the

Golgi phase (steps 1-3) of spermiogenesis, with the spreading acrosome during the cap

phase (steps 4-7) and with the anterior half of the elongating spermatid head in the

acrosome (steps 8-12) and maturation phases. No immunostaining was detected in

Sertoli cells, spermatogonia, spermatocytes or cells of the interstitial tissue. In control

sections no detectable immunoperoxidase reactivity was observed in testicular sections

probed with preimmune serum (Fig. 4.2B) or anti-C38 antibody preabsorbed with the

synthesized peptide it was raised against (Fig. 4.2D). Inspection of IAM38-

immunoreactivity at higher power indicated that in the Golgi phase the

immunoperoxidase staining was most intense over the medullary core of the

proacrosomic vesicles and less intense on the periphery of the proacrosomic vesicles

(Fig. 4.3AI – AIII). In this focusing series the proaccrosomic vesicles are in the process

of fusing to form acrosomic vesicles. In the cap phase, immunoreactivity was more or

less equally distributed in the acrosomic granule and periphery of the expanding

acrosome cap (Fig. 4.3B,D) while in the acrosome and maturation phases the intense

immunostaining of the acrosome together with its compaction made it difficult to regionalize

where in the acrosome IAM 38 was located (Fig. 4.3C,D).

8/3/2019 Yu_Yang_200811_PhD


114

Figure 4. 2. Immunoperoxidase staining of paraffin-embedded testicular sections through

portions of seminiferous tubules with the affinity purified anti-C38 antibody. (A) In bovine testis,

the dark brown immunoperoxidase reaction product stained the acrosomal vesicle (arrowheads)

of step 3 spermatids and the acrosomal region (arrows) of step 14 spermatids in stage III of the

cycle of seminiferous epithelium. In stage VI, the immunostaining was associated with the

acrosome (arrowhead) as it caps and spreads over the apical portion of the nucleus of step 6

spermatids. (C) In mouse testis, the immunoperoxidase staining was also associated with the

acrosomal vesicles (arrowheads) of step 4 spermatids in stage IV, and the acrosomes

(arrowheads) of step 6 and 9 spermatids in stage VI and IX, respectively. No immunostaining was

detected in Sertoli cells, spermatogonia, spermatocytes or cells of the interstitial tissue. No

detectable immunoperoxidase reactivity was observed in testicular sections probed with

preimmune serum (B) or with anti-C38 antibody that was preabsorbed with the synthetic peptide

it was raised against (D). Bars=10 μm.

8/3/2019 Yu_Yang_200811_PhD


115

II

I

DIV

VI

IX

VII

V

XI

B VI

VI

A

VI

III

III

8/3/2019 Yu_Yang_200811_PhD


116

Figure 4. 3. High power immunoperoxidase staining of paraffin-embedded rat testicular sections

with anti-C38 antibody. During the Golgi phase of spermiogenesis (A) the most intense

immunoreactivity was associated with the dense central granule of the proacrosomic vesicles

(arrows), which are in the process of fusing to form the acrosomal vesicle (AV). A relatively

weaker immunoreactivity was associated with the periphery of acrosomic vesicles. Figures AI-AIII

represent the same field of step 2 spermatids taken at different focal planes. In A II it looks as if

the immunoreactivity is associated with the entire content of the proacrosomic vesicles when in

reality as shown in AI and AIII it is associated with the central granule and membrane of the

vesicles. Early in the cap phase (B), immunoreactivity becomes more equally associated with the

central granule and membrane of the acrosome cap (arrows). In the acrosome phase (C) and

maturation phase (D; refer to step 16 spermatids seen below the dashed line which separates steps

7 and 16 spermatids), the immunostaining was observed covering the caudal region of the sperm

head (arrows), but its exact association with the acrosome could not be discerned at this

resolution. Bars=5μm.

8/3/2019 Yu_Yang_200811_PhD


117

A

C D

A

A

I

II

III

step5

step9

step7

step16

step2

8/3/2019 Yu_Yang_200811_PhD


118

Electron Microscopy: In order to reinforce the IAM38-immunolocalization pattern found

at the light microscope and to provide more subcellular detail on the ontogeny of IAM38

during acrosome formation immunogold labeling on LR white embedded testicular

sections was performed. During the Golgi phase of spermatid development immunogold

labeling was mostly confined to the electron-dense core of proacrosomal vesicles of step

2 spermatids (Fig. 4.4A). At the transition of the Golgi and cap phases in step 4 the

immunogold labeling remained most intense in the dense granule of the acrosomic

vesicle, which was attached to the nucleus (Fig. 4.4B, C). However, a relatively small

amount of immunogold labeling could be seen distributed along the entire acrosomalmembrane. During the process of acrosome capping, it appeared as if the immunogold

labeling remained in the acrosomic granule and most of the labeling was associated with

the acrosomic membrane (Fig. 4.5A). Early in the acrosome phase, the immunogold

labeling, which was associated with the entire acrosomal membrane, became regionalized

to the inner acrosomal membrane (IAM) and to the caudal portion of the outer acrosomal

membrane (OAM) (Fig. 4.5B). This regionalized association with the acrosomal

membrane was maintained in the maturation phase (Fig. 4.6 A, C) during which time the

equatorial segment (ES) formed. A consequence of ES formation is to bringing the

IAM38 labeled IAM and OAM in close opposition in the caudal part of the acrosome

collar, which most likely explains the heavy concentration of immunogold labeling in the

ES of mature spermatids or spermatozoa (Fig. 4.7). A higher resolution image of the ES

(Fig. 4.7, inset) shows that its electron dense core is divided equally by a ‘zipper-like’,

electron translucent line (white arrow). IAM38 being a peripheral membrane protein would be on

8/3/2019 Yu_Yang_200811_PhD


119

Figure 4.4. Electron micrographs of testicular sections immunogold labeled with anti-C38

antibody during the round spermatid phase of spermiogenesis. (A) A portion of a step 2 spermatid

showing immunogold labeling of the proacrosomal granules (PG) in the medullary region of the

Golgi apparatus. (B) A portion of a step 4 spermatid, showing the attachment of the acrosomic

vesicle (AV) to the nucleus (N). The immunogold labeling is most intense in the center dense

core of the vesicle with occasional peripheral membrane labeling (arrowhead). (C) A portion of a

step 6 spermatid, showing the acrosomic system capping the nucleus (N). At this stage of

development, there appears to be an equal distribution of gold particles in the granular core and

acrosomal membrane. Bars=0.2 μm.

8/3/2019 Yu_Yang_200811_PhD


120

A B

C

PG

N

AV

AV

N

8/3/2019 Yu_Yang_200811_PhD


121

Figure 4. 5. Electron micrographs of elongating spermatid sections immunogold labeled withanti-C38 antibody. (A) In step 8 spermatids, the immunogold particles are now mostly associated

with the entire acrosomal membrane with only scant labeling in the central core of the acrosome.

(B) At step 10, the immunogold labelling pattern suggests that IAM38 has relocated to the IAM

overlying the nucleus and to the part of the OAM, which will become the future equatorial

segment. SM, Sertoli mantle. Bars=0.2 μm.

8/3/2019 Yu_Yang_200811_PhD


122

A

SM

B

8/3/2019 Yu_Yang_200811_PhD


123

Figure 4. 6. (A) An electron micrograph of a testicular section immunogold labeled with anti-

C38 antibody to further illustrate the distribution of IAM38 during the cap and maturation phases.

(B) A portion of step 5 round spermatid showing the immunogold particles on both sides of the

acrosomal membrane. (C) A step 15 elongated spermatid showing the immunogold particles

lining the IAM and the part of the OAM belonging to the future equatorial segment. N, nucleus.

Bars=0.2 μm.

N

N

N

N

C

BA

8/3/2019 Yu_Yang_200811_PhD


124

Figure 4. 7. Electron micrograph of mature bovine spermatozoa immunogold labeled with anti-

C38 antibody (Bar=0.2μm). In the apical (AS) and principal segment (PS) of the acrosome, the

labeling is on the IAM side. While in the equatorial segment (ES) the immunogold labelling is on

both the IAM and OAM side of the acrosome. The inset (Bar= 0.02μm) shows that the equatorial

segment’s electron dense core is divided equally into two parts by a less dense “zipper-like”

region (white arrow). We speculate that both parts are made of a peripheral membrane protein

coat containing IAM38. IAM, inner acrosomal membrane; OAM, outer acrosomal membrane.

8/3/2019 Yu_Yang_200811_PhD


125

ES

OAM

IAM

AS

PS

8/3/2019 Yu_Yang_200811_PhD


126

both sides of this ‘zipper’ and most likely contribute significantly to the electron dense

membrane coat located on each of the membranes.

Discussion

The important role of the acrosome during fertilization is well documented both

experimentally and clinically. Spermatozoa from mice treated with the alkylated imino

sugar N -butyldeoxynojirimycin ( N B-DNJ) fail to form an acrosome and subacrosomal

layer during spermiogenesis and are unable to fertilize oocytes (Suganuma et al., 2005;

Walden et al., 2006). Globozoospermia, round-headed spermatozoa lacking an acrosome,

is an uncommon human disorder related to male sterility (Lalonde L, 1988; Dam et al.,

2007; Kilani et al., 2004). Disordered ionophore-induced and zona pellucida-induced

acrosome reaction have been discovered in patients with unexpected failure of classic in

vitro fertilization (Pampiglione JS, 1993; Liu and Baker, 1994). However, infertility of

abnormal acrosome related etiologies can be successfully treated by intracytoplasmic

injection (ICSI) (Suganuma et al., 2005; Walden et al., 2006), a process in which a single

sperm is introduced into the cytoplasm of the oocyte, which implies that the structural

and compositional integrity of the acrosome is essential for the extracellular binding and

penetration of the zona pellucida of the mammalian oocyte.

The zona pellucida binding protein gene knockout ( Zpbp1-/-) (Lin et al., 2007)

sets an important precedent as it shows that an acrosomal protein (IAM38/SP38/ZPBP1)

implicated in secondary binding to the zona pellucida during fertilization can also play a

critical architectural role during acrosomal formation. Failure of such a protein, or an

interacting partner, to assemble properly has the potential to disrupt acrosomal structure

8/3/2019 Yu_Yang_200811_PhD


127

to the extent that all the specific fertilization functions of the acrosome are eliminated.

Our ultrastructural evaluation of IAM38 assembly during the 16 steps of mouse

spermiogenesis provides an insight to the importance of this glycoprotein’s positional

rearrangement and membrane association in acrosomal compaction, a critical event

dependent on the integrity of the Zpbp1+/+

gene.

IAM38 is a testis-specifically expressed protein (Mori, et al., 1995; Yu, Vanhorne

and Oko, unpublished data, 2006). It is initially secreted by the Golgi apparatus as part

of the dense core of the proacrosomal vesicles, which abound in the Golgi medullary

region of late spermatocytes and early spermatids. As summarized in Figure 4.8, duringthe Golgi phase, IAM38, initially following the route common to several other acrosomal

resident proteins, such as acrosin (Moreno et al., 2000; Ramalho-Santos et al., 2001; Susi

et al., 1971) and SAMP32 (Hao et al., 2002), is found in the central granule of the

proacrosomal vesicles and acrosomic vesicle of step 2 and step 3 spermatids. In the cap

phase (step 4-7), there appears to be a migration of IAM38 from the central dense core to

the extracellular side of the acrosome membrane so that by the early acrosome phase

(step 8), most of IAM38 is relocated on the inner and outer acrosomal membranes and the

granule is devoid of IAM38. By step 10, IAM38 completely disappears from the apical

and principal segments of the OAM but is retained on the IAM and the part of the OAM

destined to form the equatorial segment. What is not shown in this summarizing diagram

is the “zipper-like” structure in the equatorial segment, which forms when the equatorial

segment condenses in a late step of spermiogenesis bringing IAM38 on the inside of the

IAM and OAM in close opposition to each other.

8/3/2019 Yu_Yang_200811_PhD


128

Figure 4. 8. A graphic representation of the distribution of IAM38 during spermiogenesis. The

dots represent IAM38. IAM38 is predominantly found in the dense core of both proacrosomal

granules and acrosomic vesicles in Golgi phase spermatids (steps 1- 3 spermatids). In the cap

phase (steps 4-7 spermatids), IAM38 appears to migrate from the central granule to the inner

periphery of the acrosomal membrane. By early spermatid elongation (step 8), most of IAM38

has relocated to the periphery of the acrosomal membrane. While later in the elongation phase

(step 10), the distribution of IAM38 becomes permanent, with most of the protein residing along

the entire IAM and on the inner periphery of the OAM in the region of the acrosome, which will

become equatorial segment.

Step 6 Step 8 Step 10

Step 2 Step 4

Step 6 Step 8 Step 10

Step 2

8/3/2019 Yu_Yang_200811_PhD


129

To our knowledge, this developmental study is the first to show the redistribution

of a protein, IAM38, from the acrosomal granule to the periphery of the acrosomal

membrane, although the possibility exists from previous studies (Bozzola et al., 1991;

Johnson et al., 1983) that proacrosin may follow a similar developmental pathway,

ending up residing on the acrosomal membrane of spermatozoa . The redistribution of

IAM38 occurs mainly during the acrosome-capping phase and predicts that an integral

acrosomal membrane protein receptor binds to IAM38. We have previously shown that

there is an ionic interaction in spermatozoa between IAM38 and the IAM possibly via anintegral membrane protein, IAM32, which we have also isolated and localized to the

IAM (unpublished data, Barajas-Espinosa, Yu and Oko). Although IAM32 originates and

remains an integral membrane protein, it follows a similar course of development as

IAM38 (unpublished data, Barajas-Espinosa, Yu and Oko, 2008), ending up confined to

the IAM and to the part of the OAM destined to form the equatorial segment (see step 10,

Fig.4.8). Most likely the organization of the acrosome into the three major regions (i.e.,

apical, principal and equatorial segments) is in a large part regulated by integral

acrosomal membrane proteins, which regionalize during development and initiate the

organization of the contents of the acrosome into distinct regions. A question arising from

our study is how IAM38 is transported from the dense central granule to the internal

membrane periphery of the acrosome during the cap phase of development. It is possible

that this protein diffuses passively from the central core into the expanding cap where it

would be captured by its membrane receptor. Very little is known about the mechanisms

of regional rearrangements of glycoproteins within secretory vesicles. The dynamic

8/3/2019 Yu_Yang_200811_PhD


130

factors responsible for the varying distribution patterns of acrosomal proteins are

certainly worthy of further investigation.

Lin et al.(2007) showed ultrastucturally that by the end of the cap phase, Zpbp1-/-

spermatids (i.e., missing IAM38/SP38) had acrosomes that failed to undergo compaction

and consequently had a ballooned appearance. This knockout phenotype clearly showed

that the OAM and IAM of the cap were much further apart than normally found.

Coincidentally, the failure in compaction corresponds to the time in normal

spermiogenesis when IAM38 becomes distributed along the entire inside of the acrosome

membrane (this study) implying that this distribution is critical for acrosomal compactionto occur. This positioning suggests that the IAM38 proteins on opposite sides of the

acrosomic vesicle may be involved in the suspension of a molecular lattice which would

condense and hence bring the two sides of the vesicle together. As shown by Lin et

al.(2007) in the Zpbp1-/- knockout model, failure of acrosomal compaction during the cap

phase leads to fragmentation of the acrosome during spermatid elongation, leading to

misshapen spermatozoa that have large segments of their acrosome missing. In the

context of acrosomal compaction our study also suggests that the disposition of IAM38

on the inside of the IAM and OAM in the posterior segment of the acrosome is critical

for its condensation and thinning to become the equatorial segment, a process that

happens at the end of spermiogenesis during the maturation phase. In summary, IAM38’s

redistribution from the acrosomic granule to the acrosomal membrane is most likely a

prerequiste for the compaction of the acrosome during spermiogenesis and secondary

binding during fertilization.

8/3/2019 Yu_Yang_200811_PhD


131

CHAPTER 5

GENERAL DISCUSSION

8/3/2019 Yu_Yang_200811_PhD


132

The spermatozoon has highly specialized cellular features that distinguish it from

the somatic cell. These features have evolved to insure successful fertilization (Eddy and

O'Brien, 1994). Perhaps most notable among the specialized organelles of the

spermatozoon is the acrosome, whose function is critical for the success of the

spontaneous mammalian fertilization (Lalonde et al., 1988) but still remains poorly

understood (Kilani et al., 2004; Walden et al., 2006). An early event related to the

acrosome in fertilization is a signal cascade initiated by the primary binding between the

plasma membrane of the sperm and the extracellular investment, the zona pellucida, of

the oocyte (Yanagimachi, 1994). The result of this signaling is “acrosomal exocytosis”,which involves multiple fusions between the OAM and the overlying plasma membrane

leading to the release of acrosomal contents and the exposure of the inner acrosomal

membrane (Wassarman, 1999; Kim and Gerton, 2003). The exposed IAM, situated in the

anterior half of the sperm head contacts the ZP and binds firmly to ZP2, one of the three

prominent zona glycoproteins, in a process termed secondary binding (Huang et al.,

1985; Bleil et al., 1988; Mortillo and Wassarman, 1991). These classical studies led to

the proposition that there must be a receptor molecule(s) in or on the IAM that binds to

ZP2. Supporting this hypothesis, freeze-fracture studies indicated that the IAM has a very

rich content of intramembranous particles, arranged in para crystalline-like arrays

(Stackpole and Devorkin, 1974; Koeheler, 1975). In addition, the content of the hamster

and bovine acrosome was shown to be compartmentalized into different domains (Olson,

1985) making it feasible that IAM supports a matrix which is functionally distinct (Olson

et al., 1988). The experiments and concepts above inspired our efforts of seeking the

sperm receptors for secondary binding. Because many attempts were made at identifying

8/3/2019 Yu_Yang_200811_PhD


133

the receptors with no conclusive results (Urch and Patel, 1991; Primakoff et al., 1985;

Richardson et al., 1994; Hao et al., 2002; Shetty et al., 2003; Herr et al., 1990; Tanii et

al., 2001), we devised a strategic sperm head fractionation approach by which we could

gain direct access to the IAM for protein extraction purposes. By this methodology we

were able to identify and hence begin to characterize a number of IAM associated

glycoproteins that may be involved in secondary binding and penetration of the zona

pellucida. In this thesis the emphasis was put on identifying and characterizing the most

prominent member of peripherally attached IAM proteins, IAM38.

Extraction of IAM38 with high salt from the IAM-containing fraction of thesperm head implied that it was an ionic bonded peripheral membrane protein. Its

extraction was coincident with the disappearance of the electron dense IAM coat (IAMC)

suggesting that it is a constituent of this peripheral coat, which was latter confirmed by

ultrastructural immunolocalization in several species of mammalian sperm. In order to

sequence identify IAM38, a specific immune serum raised against this PAGE isolated

protein was used to immunoscreen a cDNA testicular expression library and isolate the

cDNA phagemid expressing this protein for nucleotide sequence analysis. The deduced

amino sequence identified bull IAM38 as an orthologue of porcine SP38 (Mori et al.,

1993). It is conserved among a variety of eutherian mammals including human, rat and

mouse (Yu et al., 2006). Northern blot analysis of a variety of organs provided evidence

that IAM38 is most likely testis specific and arises from a single mRNA species.

Comparison of the deduced aa sequence of this mRNA to the amino terminal sequence of

IAM38 found in spermatozoa indicated that this protein is originally synthesized as a

precursor protein of 350 amino acids and then posttranslationally processed during

8/3/2019 Yu_Yang_200811_PhD


134

spermiogenesis to its mature form of 299 aa.

A criterion essential to establish that a sperm protein is a contender as a receptor

for zona pellucida binding is that it should be retained on the surface of IAM after the

acrosome reaction. In contrast to the failure of localizing SP38/IAM38 on the IAM

surface after sperm were induced to undergo acrosomal exocytosis in vitro in a test tube

(Mori et al., 1995), our in situ localization of this protein during IVF provided proof that

IAM38 is not only retained after the acrosomal exocytosis but remains present on the

IAM surface after sperm penetration through the zona of the oocyte. Verification of this

important criterion naturally led us to test whether antibodies specific to IAM38 couldinterfere with sperm-zona secondary binding and hence fertilization. On affirmation that

anti-IAM38 antibodies did indeed block secondary binding and fertilization we turned

our attention to elaborating the mechanism by which IAM38 most likely bound the sperm

to the zona pellucida. Based on the ELISA experiment by which the KRLSKAKNLIE

(KRLn) synthetic sequence derived from porcine SP38(IAM38) could competitively

inhibit the binding of SP38(IAM38) to ZPA (Mori et al., 1995), the ZP2 mouse

equivalent, we tested whether this synthetic analogue could inhibit sperm-zona secondary

binding with in vitro fertilization trials. As a control peptide in this trial we substituted

the two basic amino acids of the KRLn synthetic sequence with acidic amino acids as

they had been previously determined by ELISA to be obligatory for the IAM38 and ZP2

interaction (Mori et al., 1995). The outcome of these competitive inhibition IVF trials

reinforced the concept that the KRLXX(XXX)LIE motif of IAM38 is most likely

responsible for binding IAM38 to the zona pellucida during fertilization and identified

IAM38 as an important player in secondary binding during mammalian fertilization.

8/3/2019 Yu_Yang_200811_PhD


135

Both the synthetic peptides 256KRLSKAKNLIE266 from porcine SP38(IAM38)

and 365KRLQQLIE372 from proacrosin were found to competitively inhibit the binding of

SP38(IAM38) to ZPA in a solid-phase ELISA assay (Mori et al., 1993 and 1995)

suggesting at that time that the KRLXX(XXX)LIE motif of both proteins may be

responsible for the secondary binding between sperm and oocyte during fertilization. In

the case of proacrosin however, another important criterion has to be met in order for

proacrosin to be considered as a secondary binding candidate. The retaining of proacrosin

on the sperm’s IAM after the zona induced acrosomal exocytosis has not yet

convincingly shown as far as we are aware. We (Lin, Yu and Oko, unpublished data,2008) have extracted acrosin (but not proacrosin) from the IAM and immuno-localized it

to the IAM in sonnicated bull, boar or mouse sperm heads. Barros (Barros C, 1992) has

also immuno-localized acrosin on the IAM after the acrosome reaction in a variety of

species including human. However, it is important to note that the conversion of

proacrosin to acrosin during the acrosome reaction leads to the loss of the KRLn-ZP2

binding site from acrosin (Baba et al., 1989). So even if acrosin is retained on the IAM,

the ZP2 binding site of proacrosin is not. Since very little if any proacrosin is left after the

acrosome reaction (Jones R, 1990) it most likely would not play a major role in

secondary binding. In this context we are surprised that a secondary binding trial in

mouse IVF was not performed utilizing the acrosin null mouse model that was available

(Baba et al., 1994; Adham, 1997).

So far no other sperm proteins have been put forward other than IAM38 that meet

the three critical criteria needed to qualify as a genuine secondary binding protein. These

are retention on the IAM after the acrosome reaction, specific binding to ZP2, and

8/3/2019 Yu_Yang_200811_PhD


136

suppression of secondary sperm-oocyte binding with antibodies or competitive inhibitors

against the candidate. Unfortunately the zpbp1 mouse knockout (coding for the IAM38

protein) disrupts the acrosome during spermiogenesis (Lin et al., 2007) making it

impossible to confirm IAM38’s role in secondary binding at least in this KO model.

Confirmation could eventually be possible by employing a targeted mutation strategy

where the nucleotide sequence of zpbp1 coding for the KRLn motif is disrupted or

replaced while keeping the rest of the coding sequence intact to preserve IAM38’s

structural role in forming the acrosome.

Sperm of Zpbp1

-/-

mice have an abnormal acrosome due to the failure of theacrosome to compact during the cap phase (Lin et al., 2007). It appears that the OAM and

IAM of the acrosome cap in Zpbp1-/- spermatids are much further apart than in normal

wildtype spermatids. Our developmental immunocytochemical ultrastructural study in

normal mouse testes shows that early in the cap phase of spermiogenesis, IAM38

(ZPBP1) migrates from the acrosomal granule to attach along the inner surface of the

acrosomal membrane. This positioning of IAM38 on both IAM and OAM during the cap

phase in context of the knockout result clearly indicates a structural involvement of this

protein in compaction of the acrosome. Its exact structural mechanism in the acrosomal

condensation process is unknown, however the positioning of this protein on opposing

acrosomal membranes suggests that it may be involved in bridging the two membranes

together. Later in spermiogenesis when IAM38 disappears from most of the OAM,

except in the equatorial segment (ES), the opposing membranes of the ES come together

very closely to form the thin collar characteristic of this acrosomal segment in mature

sperm. The high concentration of IAM38 along both sides of the acrosomal membrane of

8/3/2019 Yu_Yang_200811_PhD


137

the ES, forming a protein coat on both sides, suggests that IAM38 most likely plays a

structural role in the condensation of the ES as well. In context of secondary binding

however, it is clear from our immunocytochemical study that most of IAM38 ends up on

the IAM of mature spermatids and spermatozoa as part of a peripheral protein coat.

Interestingly unpublished research from our lab (Lin, Yu and Oko, 2008) indicates that

proacrosin follows a similar distribution pattern as IAM38 during spermiogenesis the

only major difference being that during spermatid elongation and maturation proacrosin

is retained on both IAM and OAM and remains in this position in spermatozoa. Our

developmental localization study is in agreement with an earlier proacrosin EMlocalization study on spermatozoa by Johnson et al. (1983) where they also localized

proacrosin to the IAM and OAM. Our developmental study therefore sets a precedent

showing that proteins secreted as part of the acrosomal granule can redistribute

themselves during spermiogenesis to the acrosomal membrane and contribute to making

a peripheral extracellular glycocalyx which we have coined the inner acrosomal

membrane coat (IAMC).

Our investigation has resurrected a protein that was abandoned as a candidate for

secondary binding based on it disappearance from the sperm acrosome after the induction

of the acrosomal exocytosis by calcium ionophore A23187 (Mori et al., 1995). We also

found an abrupt diminishing of IAM38 immunoreactivity over time in ionophore-induced

acrosomal exocytosis in bovine, mouse, rat and hamster sperm. This was in sharp contrast

to our in situ immunolocalization data during IVF indicating that this protein is retained

the IAM surface during the acrosomal exocytosis and zona penetration (Yu et al., 2006).

Our interpretation of these opposing in vitro and in situ results is that the acrosomal

8/3/2019 Yu_Yang_200811_PhD


138

reaction induced in the test tube, usually containing millions of sperm, releases a large

variety of proteolytic enzymes in relatively high concentration which not surprisingly

over time will degrade any protein they encounter including proteins bound to the IAM.

In situ, during IVF relatively fewer sperm (50 –100) undergo acrosomal exocytosis on the

surface of the zona and thus the concentration of proteolytic proteins is relatively diluted

making the likelihood of ‘non-specific’ protein degradation less. Furthermore, the

acrosomal content and shroud is relatively quickly dispersed from the sperm head

providing less chance for the enzymes released to degrade the exposed IAM surface. A

take home message is that results obtained from in vitro induction of the acrosomalreaction need careful and critical interpretation and alternative strategies should be used

to confirm such results.

8/3/2019 Yu_Yang_200811_PhD


139

Summary and Conclusions

The exposure of the IAM after the acrosomal exocytosis provides a contact surface

for the sperm to bind to the zona pellucida of the oocyte during mammalian fertilization

(Huang et al., 1985). The IAM surface has been proposed to comprise specialized

proteins involved in secondary binding and penetration of the zona pellucida

(Yanagimachi, 1994; Wassarman et al., 2004). However, the longstanding research in

this reproductive area has not been able to identify the ZP2 binding receptors on

spermatozoa. In this study, we have used a reliable model to work on molecules directly

related to the IAM. Of the many IAM related molecules, we have identified and

characterized IAM38 as the prominent component of the IAMC and provided molecular,

cytological, physiological and developmental data that qualify IAM38 as a secondary

binding receptor for the ZP on spermatozoa. Apart from its function in the sperm-zona

interaction, IAM38 is also important for the structural development of normal sperm

acrosome based on the zpbp1gene knockout study (Lin et al., 2007).

The novel sperm fractionation approach we have designed allows us to identify

and characterize other peripheral and integral proteins on and in the IAM, in addition to

IAM38. Based on the data we have collected so far, we suggest that IAM forms an

important foundation for the attachment of peripheral proteins involved in both sperm

binding and penetration of the zona pellucida. We believe that molecular characterization

of the IAM proteins will lead to a better understanding of sperm-zona interaction in

mammals.

8/3/2019 Yu_Yang_200811_PhD


140

REFERENCES

Abeydeera, L.R., Wang, W.H., Prather, R.S., Day, B.N. 1998. Maturationin vitro of pig oocytes in protein-

free culture media: fertilization and subsequent embryo development in vitro. Biol. Reprod. 58, 1316-1320.

Abou-Haila, A. and Tulsiani, D.R.P. 2000. Mammalian sperm acrosome: formation, contents, and function.

Arch. Biochem. Biophys. 379, 173-182.

Adham, I.M., Nayernia, K., Engel, W. 1997. Spermatozoa lacking acrosin protein show delayed

fertilization. Mol. Reprod. Dev. 46, 370-376.

Alfieri, J.A., Martin, A.D., Takeda,J., Kondoh,G., Myles,D.G., Primakoff, P. 2003. Infertility in female

mice with an oocyte-specific knockout of GPI-anchored proteins. J. Cell Sci.116, 2149-2155.

Altschul, S., Gish, W., Miller, W., Myers, E.W., Lipman, D.J. 1990. Basic local alignment search tool. J.

Mol. Biol. 215, 403-410.

Anakwe, O.O. and Gerton, G.L. 1990. Acrosome biogenesis begins during meiosis: evidence from the

synthesis and distribution of an acrosomal glycoprotein, acrogranin, during guinea pig spermatogenesis.

Biol. Reprod. 42, 317-328.

Anderson, D.J., Abbott, A.F., Jack,R.M. 1993. The role of complement component C3b and its receptors in

sperm-oocyte interaction. Proc. Natl. Acad. Sci. U.S.A.90, 10051-10055.

Aul, R.B. and Oko, R.J. 2002. The major subacrosomal occupant of bull spermatozoa is a novel histone

H2B variant associated with the forming acrosome during spermiogenesis. Dev. Biol.242, 376-387.

Austin, C.R. 1951. Observations on the penetration of the sperm in the mammalian egg. Aust. J. Sci. Res.

(B) 4, 581-596.

Austin, C.R. and Bishop, M.W.H. 1958a. Role of the rodent acrosome and perforatorium in fertilization.

Proc. Royal Soci.London. Series B, Biological Sciences149, 241-248.

Austin, C.R. and Bishop, M.W.H. 1958b. Some features of the acrosome and perforatorium in mammalian

spermatozoa. Proc. Royal Soci. London. Series B, Biological Sciences149, 234-240.

Baba, D., Kashiwabara, S., Honda, A., Yamagata, K., Wu,Q., Ikawa,M., Okabe,M., Baba,T. 2002. Mouse

sperm lacking cell surface hyaluronidase PH-20 can pass through the layer of cumulus cells and fertilize

the egg. J. Biol. Chem. 277, 30310-30314.

8/3/2019 Yu_Yang_200811_PhD


141

Baba, T., Azuma, S., Kashiwabara, S., Toyoda,Y. 1994. Sperm from mice carrying a targeted mutation of

the acrosin gene can penetrate the oocyte zona pellucida and effect fertilization. J. Biol. Chem.269,

31845-31849.

Baba, T., Kashiwabara, S., Watanabe,K., Itoh,H., Michikawa,Y., Kimura,K., Takada,M., Fukamizu,A.,

Arai,Y. 1989. Activation and maturation mechanisms of boar acrosin zymogen based on the deduced

primary structure. J. Biol. Chem. 264, 11920-11927.

Baldi, E., Casano, R., Falsetti, C., Krausz, C., Maggi, M., Forti, G. 1991. Intracellular calcium

accumulation and responsiveness to progesterone in capacitating human spermatozoa. J. Androl.12,

323-330.

Barros, C., Capote, C., Perez, C., Crosby, J.A., Becker, M.I., De Ioannes, A. 1992. Immunodetection of

acrosin during the acrosome reaction of hamster, guinea-pig and human spermatozoa. Biol. Res.25, 31-

40.

Barth, A.D. and Oko,R.J. 1989. Normal bovine spermatogenesis and sperm maturation. In “Abnormal

morphology of bovine spermatozoa”. Iowa State University Press, Ames, pp. 19-88.

Bedford, J.M. 1991. The co-evolution of mammalian gametes. In “A Comparative

Overview of Mammalian Fertilization”. (Dunbar, B.S. and O’Rand, M. G. Eds.). New York, Plenum

Press. pp3-35.

Bedford, J.M. 1998. Mammalian fertilization misread? Sperm penetration of the eutherian zona pellucida is

unlikely to be a lytic event. Biol. Reprod.59, 1275-1287.

Benoff, S. 1997. Carbohydrates and fertilization: an overview. Mol. Hum. Reprod.3, 599-637.

Berndston, W.E. and Desjardins, C. 1974. The cycle of the seminiferous epithlium and spermatogenesis in

the bovine testis. Am. J. Anat.140, 167-179.

Bi, M., Hickox,J., Winfrey,V., Olson,G., Hardy,D. 2003. Processing, localization and binding activity of

zonadhesin suggest a function in sperm adhesion to the zona pellucida during exocytosis of the

acrosome. J. Biochem. 375, 477-488.

Bleil, J.D., Greve, J.M., Wassarman, P.M. 1988. Identification of a secondary sperm receptor in the mouse

egg zona pellucida: role in maintenance of binding of acrosome-reacted sperm to eggs. Dev. Biol.128,

376-385.

8/3/2019 Yu_Yang_200811_PhD


142

Bleil, J.D. and Wassarman, P.M. 1986. Autoradiographic visualization of the mouse egg's sperm receptor

bound to sperm. J. Cell Biol. 102, 1363-1371.

Bleil, J.D. and Wassarman, P.M. 1988. Galactose at the nonreducing terminus of O-linked oligosaccharides

of mouse egg zona pellucida glycoprotein ZP3 is essential for the glycoprotein's sperm receptor activity.

Proc. Natl. Acad. Sci. U. S. A.85, 6778-6782.

Bleil, J.D. and Wassarman, P.M. 1990. Identification of a ZP3-binding protein on acrosome-intact mouse

sperm by photoaffinity crosslinking. Proc. Natl. Acad. Sci. U. S. A.87, 5563-5567.

Bleil, J.D. and Wassarman, P.M. 1980a. Structure and function of the zona pellucida: Identification and

characterization of the proteins of the mouse oocyte's zona pellucida. Dev. Biol.76, 185-202.

Bleil, J.D. and Wassarman, P.M. 1980b. Mammalian sperm-egg interaction: Identification of a glycoprotein

in mouse egg zonae pellucidae possessing receptor activity for sperm. Cell20, 873-882.

Bleil, J.D. and Wassarman, P.M. 1983. Sperm-egg interactions in the mouse: Sequence of events and

induction of the acrosome reaction by a zona pellucida glycoprotein. Dev. Biol.95, 317-324.

Blobel, C.P. 1992. A potential fusion peptide and an integrin ligand domain in a protein active in sperm-

egg fusion. Nature 356, 248-252.

Bookbinder, L.H., Cheng, A., Bleil,J.D. 1995. Tissue- and species-specific expression of sp56, a mouse

sperm fertilization protein. Science 269, 86-89.

Bowen, R.H. 1922. On the idiosome, Golgi apparatus and acrosome in the male germ cells. Anat.Rec.24,

158-180.

Bozzola, J.J., Polakoski, K., Haas,N., Russell,L.D., Campbell,P., Peterson,R.N. 1991. Localization of boar

sperm proacrosin during spermatogenesis and during sperm maturation in the epididymis. Am. J. Anat.

192, 129-141.

Breitbart, H. 2002. Intracellular calcium regulation in sperm capacitation and acrosomal reaction. Mol.

Cell. Endo. 187, 139-144.

Brown, C.R. and Jones, R. 1987. Binding of zona pellucida proteins to a boar sperm polypeptide of Mr

53,000 and identification of zona moieties involved. Development 99, 333-339.

8/3/2019 Yu_Yang_200811_PhD


143

Buffone, M.G., Zhuang,T., Ord,T.S., Hui,L., Moss,S.B., Gerton,G.L. 2008. Recombinant mouse sperm

ZP3-binding protein (ZP3R/sp56) forms a high order oligomer that binds eggs and inhibits mouse

fertilization in vitro. J. Biol. Chem. 283, 12438-12445.

Cesari, A., Katunar, M.R., Monclus,M.A., Vincenti,A., de Rosas,J.C., Fornes,M.W. 2005. Serine protease

activity, bovine sperm protease, 66 kDa (BSp66), is present in hamster sperm and is involved in sperm-

zona interaction. J. Reprod. Fertil. 129, 291-298.

Chamberlin, M.E. and Dean, J. 1990. Human homolog of the mouse sperm receptor. Proc. Natl. Acad. Sci.

U. S. A. 87, 6014-6018.

Chang, M.C. 1951 Fertilizing capacity of spermatozoa deposited into the fallopian tubes. Nature168, 697-

698.

Chapman, N., Kessopoulou, E., Andrews, P., Hornby, D., Barratt, C.R. 1998. The polypeptide backbone of

recombinant human zona pellucida glycoprotein-3 initiates acrosomal exocytosis in human spermatozoa

in vitro. J. Biochem. 330, 839-845.

Chen, J., Litscher, E.S., Wassarman, P.M. 1998. Inactivation of the mouse sperm receptor, mZP3, by site-

directed mutagenesis of individual serine residues located at the combining site for sperm. Proc. Natl.

Acad. Sci. U. S. A.95, 6193-6197.

Cheng, A., Le, T., Palacios, M., Bookbinder,L.H., Wassarman,P.M., Suzuki,F., Bleil,J.D. 1994. Sperm-egg

recognition in the mouse: characterization of sp56, a sperm protein having specific affinity for ZP3. J.

Cell Biol. 125, 867-878.

Chiu, P.C.N., Wong, B.S.T., Lee, C.L., Pang, R.T.K., Lee, K.F., Sumitro, S.B., Gupta, S.K. and Yeung,

W.S.B. 2008. Native human zona pellucida glycoproteins: purification and binding properties. Hum.

Reprod. 23(6), 1385-1393

Cho, C. 1998. Fertilization defects in sperm from mice lacking fertilin beta. Science281, 1857-1859.

Clermont, Y. 1963. The cycle of the seminiferous epithelium in man. Am. J. Anat.112, 35-51.

Clermont, Y. and Leblond, C.P. 1955. Spermiogenesis of man, monkey, ram and other mammals as shown by the periodic acid-Schiff technique. Am. J. Anat. 96, 229-253.

Clermont, Y., Oko,R.J., Hermo,L. 1993. Cell and molecular biology of the testis. In “Cell biology of

mammalian spermatogenesis”. (Desjardins, C. and Ewing, L. Eds.). Oxford University Press, New

York, pp. 332-376.

8/3/2019 Yu_Yang_200811_PhD


144

Clermont, Y. and Tang, X.M. 1985. Glycoprotein synthesis in the Golgi apparatus of spermatids during

spermiogenesis of the rat. Anat. Rec. 213, 33-43.

Conner, S.J., Lefievre, L., Hughes, D.C., Barratt, C.L. 2005. Cracking the egg: increased complexity in the

zona pellucida. Hum. Reprod. 20, 1148–1152

Coonrod, S.A., Herr, J.C., Westhusin,M.E. 1996. Inhibition of bovine fertilizationin vitro by antibodies to

SP-10. J. Reprod. Fertil. 107, 287-297.

Cowan, A.E., Primakoff, P., Myles, D.G. 1986. Sperm exocytosis increases the amount of PH-20 antigen

on the surface of guinea pig sperm. J. Cell Biol. 103, 1289-1297.

Cowan, A., Myles, D., Koppel, D. 1991. Migration of the guinea pig sperm membrane protein PH-20 from

one localized surface domain to another does not occur by a simple diffusion-trapping mechanism. Dev.

Biol. 144, 189-198.

Crosby, J. and Barros, C. 1999. Effect of recombinant boar {beta}-acrosin on sperm binding to intact zona

pellucida during in vitro fertilization. Biol. Reprod. 61, 1535-1540.

Dam, A.H.D.M., Feenstra, I., Westphal,J.R., Ramos,L., van Golde,R.J.T., Kremer,J.A.M. 2007.

Globozoospermia revisited. Hum. Reprod. Update13, 63-75.

Darszon, A., Labarca, P., Nishigaki,T., Espinosa,F. 1999. Ion channels in sperm physiology. Physiol. Rev.

79, 481-510.

de Lamirande, E., Leclerc, P., Gagnon, C. 1997. Capacitation as a regulatory event that primes spermatozoa

for the acrosome reaction and fertilization. Mol. Hum. Reprod.3, 175-194.

Dietl, J. 1989. The Mammalian Egg Coat. (Dietl, J., Ed). Springer, Berlin.

Dorval, V., Dufour, M., Leclerc, P. 2002. Regulation of the phosphotyrosine content of human sperm

proteins by intracellular Ca2þ. Role of Ca2þ-adenosine triphoshatases. Biol. Reprod. 67, 1538-1545.

Durbar, B.S. 1983 Morphological, biochemical and immunochemical characterization of the mammalian

zona pellucida. In “Mechanism and Control of Animal Fertilization”. (Hartmann, J.F. Ed). AcademicPress, New York.

Eddy, E.M. and O'Brien, D.A. 1994. The spermatozoon. In “The Physiology of Reproduction”. (Knobil, E.,

Neill, J.D. Eds.), Raven Press Ltd., New York, pp. 29-77.

8/3/2019 Yu_Yang_200811_PhD


145

Epifano, O., Liang, L.F., Familari, M., Moos, M.C.Jr and Dean, J. 1995. Coordinate expression of the three

zona pellucida genes during mouse oogenesis. Development 121, 1947-1956.

Evans, J.P., Kopf,G.S., Schultz,R.M. 1997. Characterization of the binding of recombinant mouse sperm

fertilin beta subunit to mouse eggs: Evidence for adhesive activity via an egg beta-1 integrin-mediated

interaction. Dev. Biol. 187, 79-93.

Fawcett, D.W., Anderson,W.A., Phillips,D.M. 1971. Morphogenetic factors influencing the shape of the

sperm head. Dev. Biol. 26, 220-251.

Fawcett, D.W., 1975. The mammalian spermatozoon. Dev. Biol.44, 394-436.

Florman, H.M. and Babcock, D.F. 1991 Progress toward understanding the molecular basis of capacitation.

In "Elements of Mammalian Fertilization". (Wassarman, P.M. Ed.) CRC Press, Boca Raton. pp.105-

132.

Florman, H.M., Bechtol, K.B., Wassarman, P.M. 1984. Enzymatic dissection of the functions of the mouse

egg's receptor for sperm. Dev. Biol. 106, 243-255.

Florman, H.M. and Wassarman, P.M. 1985. O-linked oligosaccharides of mouse egg ZP3 account for its

sperm receptor activity. Cell 41, 313-324.

Foster, J.A., Friday, B.B., Maulit, M.T., Blobel,C., Winfrey,V.P., Olson,G.E., Kim,K.S., Gerton,G.L. 1997.

AM67, a secretory component of the guinea pig sperm acrosomal matrix, is related to mouse sperm

protein sp56 and the complement component 4-binding proteins. J. Biol. Chem.272, 12714-12722.

Frayne, J., Hall, L. 2002. A re-evaluation of sperm protein 17 (Sp17) indicates a regulatory role in an A-

kinase anchoring protein complex, rather than a unique role in sperm-zona pellucida binding. J. Reprod.

Fertil. 124, 767-774.

Gao, Z. and Garbers, D.L. 1998. Species diversity in the structure of zonadhesin, a sperm-specific

membrane protein containing multiple cell adhesion molecule-like domains. J. Biol. Chem.273, 3415-

3421.

Gerton, G.L. 2002. Function of the sperm acrosome. In “Fertilization”. (Hardy, D.M. Ed.). AcademicPress, New York, pp. 265-302.

Gibbons, I.R. and Rowe, A.J. 1965. Dynein: a protein with adenosine triphosphatase activity from cilia.

Science 149, 424-426.

8/3/2019 Yu_Yang_200811_PhD


146

Glickman, M.H. and Ciechanover, A. 2002. The ubiquitin-proteasome proteolytic pathway: destruction for

the sake of construction. Physiol. Rev. 82, 373-428.

Gong, X., Dubois, D.H., Miller, D.J. and Shur, B.D. 1995. Activation of a G protein complex by

aggregation of ¦Â-1,4- galactosyltransferase on the surface of sperm. Science269, 1718-1721.

Green, D.P., Purves,R.D., 1984. Mechanical hypothesis of sperm penetration. Biophys. J.45, 659-662.

Green, D.P. 2002. Fertilization biophysics. In “Fertilization”. (Hardy, D.M. Ed.). Academic Press, New

York, pp. 387-399.

Grosshans, B.L., Ortiz, D., Novick, P. 2006. Rabs and their effectors: Achieving specificity in membrane

traffic. Proc. Natl. Acad. Sci. U. S. A.103, 11821-11827.

Handrow, R.R., First, N.L., Parrish, J.J. 1989. Calcium requirement and increased association with bovine

sperm during capacitation by heparin. J. Exp. Zool. 252,174-182.

Hao, Z., Wolkowicz, M.J., Shetty,J., Klotz,K., Bolling,L., Sen,B., Westbrook,V.A., Coonrod,S., Flickinger,

C.J., Herr,J.C. 2002. SAMP32, a testis-specific, isoantigenic sperm acrosomal membrane-associated

protein. Biol. Reprod. 66, 735-744.

Hardy, D.M. and Garbers, D.L. 1994. Species-specific binding of sperm proteins to the extracellular matrix

(zona pellucida) of the egg. J. Biol. Chem.269, 19000-19004.

Hardy, D.M. and Garbers, D.L. 1995. A sperm membrane protein that binds in a species-specific manner to

the egg extracellular matrix is homologous to von willebrand factor. J. Biol. Chem.270, 26025-26028.

Harris, J.D., Hibler, D.W., Fontenot, G.K., Hsu, K.T., Yurewicz, E.C., Sacco, A.G. 1994. Cloning and

characterization of zona pellucida genes and cDNAs from a variety of mammalian species: The ZPA,

ZPB and ZPC gene families. Mitochondrial DNA4, 361-393.

Hartree, E.F. 1975. The acrosome-lysosome relationship. J. Reprod. Fertil.44,125-126.

He, Z.Y., Brakebusch, C., FΣssler,R., Kreidberg,J.A., Primakoff,P., Myles,D.G. 2003. None of the

integrins known to be present on the mouse egg or to be ADAM receptors are essential for sperm-egg binding and fusion. Dev. Biol. 254, 226-237.

Herr, J.C., Flickinger, C.J., Homyk,M., Klotz,K., John,E. 1990. Biochemical and morphological

characterization of the intra-acrosomal antigen SP-10 from human sperm. Biol. Reprod. 42, 181-193.

8/3/2019 Yu_Yang_200811_PhD


147

Herrero, M.B., de Lamirande, E. and Gagnon, C. 1999. Nitric oxide regulates human sperm capacitation

and protein-tyrosine phosphorylation in vitro. Biol. Reprod. 61, 575-581.

Hinsch, E., Groeger, S., Oehninger,S., Hinsch, K.D. 2003. Localization and functional importance of a

conserved zona pellucida 2 protein domain in the human and bovine ovary using monoclonal anti-ZP2

peptide antibodies. Theriogenology 60, 1331-1344.

Hinsch, E., Hagele,W., Bohle,R.M.,Schill,W.B.,Hinsch,K.D. 1998. Evaluation of ZP2 domains of

functional importance with antisera against synthetic ZP2 peptides. J. Reprod. Fertil.114, 245-251.

Hjelmeland, L.1990. Solubilization of native membrane proteins. In “Guide to protein purification,

Methods in Enzymology”. ( Deutscher, M. Ed.). Academic Press, Inc., San Diego, CA, pp. 253-264.

Hodivala-Dilke, K.M., McHugh, K.P., Tsakiris, D.A., Rayburn, H., Crowley, D., Ullman-Cullere, M.,

Ross, F.P., Coller, B.S., Teitelbaum, S., Hynes, R.O. 1999. beta 3-integrin-deficient mice are a model

for Glanzmann thrombasthenia showing placental defects and reduced survival. J. Clin. Invest.103,

229-238.

Honda, A., Siruntawineti, J., Baba, T. 2002. Role of acrosomal matrix proteases in sperm-zona pellucida

interactions. Hum. Reprod. Update 8, 405-412.

Howes, E., Pascall, J.C., Engel,W., Jones,R. 2001. Interactions between mouse ZP2 glycoprotein and

proacrosin; a mechanism for secondary binding of sperm to the zona pellucida during fertilization. J

Cell Sci. 114, 4127-4136.

Howes, L. and Jones, R. 2002. Interactions between zona pellucida glycoproteins and sperm

proacrosin/acrosin during fertilization. J. Reprod. Immunol.53, 181-192.

Huang, T.J., Hardy, D., Yanagimachi,H., Teuscher,C., Tung,K., Wild,G., Yanagimachi,R. 1985. pH and

protease control of acrosomal content stasis and release during the guinea pig sperm acrosome reaction.

Biol. Reprod. 32, 451-462.

Huang, T. J., Ohzu, E., Yanagimachi R . 1982. Evidence suggesting that L-fucose is part of a recognition

signal for sperm-zona pellucida attachment in mammals. Gamete Res. 5, 355-361.

Huang, T.J and Yanagimachi, R. 1985. Inner acrosomal membrane of mammalian spermatozoa: Its

properties and possible functions in fertilization. Am. J. Anat.174, 249-268.

8/3/2019 Yu_Yang_200811_PhD


148

Hunnicutt, G., Primakoff, P., Myles,D. 1996. Sperm surface protein PH-20 is bifunctional: one activity is a

hyaluronidase and a second, distinct activity is required in secondary sperm-zona binding. Biol. Reprod.

55, 80-86.

Inoue, N., Ikawa,M., Isotani,A., Okabe,M. 2005. The immunoglobulin superfamily protein Izumo is

required for sperm to fuse with eggs. Nature434, 234-238.

Jansen, S., Jones, R., Jenneckens, I., Marschall, B., Kriegesmann, B., Coadwell, J., Brenig, B. 1998. Site-

directed mutagenesis of boar proacrosin reveals residues involved in binding of zona pellucida

glycoproteins. Mol. Reprod. Dev. 51, 184-192.

Jansen, S., Quigley, M., Reik, W. and Jones, R. 1995. Analysis of polysulfate-binding domains in porcine

proacrosin, a putative zona adhesion protein from mammalian spermatozoa. Int. J. Dev. Biol.39, 501-

510.

Jedlicki, A. and Barros, C. 1985. Scanning electron microscope study of in vitro prepenetration gamete

interactions. Gamete Res. 11, 121-131.

Johnson, L.A., Garner, D.L., Truitt-Gilbert,A.J., Lessley,B.A. 1983. Immunocytochemical localization of

acrosin on both acrosomal membranes and in the acrosomal matrix of porcine spermatozoa. J. Androl.

4, 222-229.

Johnston, D.S., Wright,W.W., Shaper,J.H., Hokke,C.H., Van den Eijnden,D.H., Joziasse,D.H. 1998.

Murine sperm-zona binding, a fucosyl residue is required for a high affinity sperm-binding ligand. A

second site on sperm binds a nonfucosylated, beta -galactosyl-capped oligosaccharide. J. Biol. Chem.273, 1888-1895.

Jones, R. 1990. Identification and functions of mammalian sperm-egg recognition molecules during

fertilization. J. Reprod. Fertil. Suppl. 42, 89-105.

Jones, R. 1991. Interaction of zona pellucida glycoproteins, sulphated carbohydrates and synthetic

polymers with proacrosin, the putative egg-binding protein from mammalian spermatozoa.

Development 111, 1155-1163.

Kaji, K. 2000. The gamete fusion process is defective in eggs of CD9-deficient mice. Nature Genet.24,

279-282.

8/3/2019 Yu_Yang_200811_PhD


149

Kasinsky, H.E., Mann, M., Huang,S.Y., Fabre,L., Coyle,B., Byrd,E.W., Jr. 1987. On the diversity of sperm

basic proteins in the vertebrates: V. Cytochemical and amino acid analysis in Squamata, Testudines,

and Crocodylia. J. Exp. Zool. 243, 137-151.

Kennedy, W.P. and Polakoski, K.L. 1981. Evidence of an intrazymogen mechanism in the conversion of

proacrosin into acrosin. Biochemisty 20, 2240-2245.

Kerr, C.L., Hanna, W.F., Shaper,J.H., Wright,W.W. 2002. Characterization of Zona Pellucida glycoprotein

3 (ZP3) and ZP2 binding sites on acrosome-intact mouse sperm. Biol. Reprod.66, 1585-1595.

Kilani, Z., Ismail, R., Ghunaim,S., Mohamed,H., Hughes,D., Brewis,I., Barratt,C.L.R. 2004. Evaluation

and treatment of familial globozoospermia in five brothers. Fertil. Steril.82, 1436-1439.

Kim, E., Baba, D., Kimura,M., Yamashita,M., Kashiwabara,S.i., Baba,T. 2005. Identification of a

hyaluronidase, Hyal5, involved in penetration of mouse sperm through cumulus mass. Proc. Natl. Acad.

Sci. U. S. A. 102, 18028-18033.

Kim, K.S., Cha,M.C., Gerton,G.L. 2001. Mouse sperm protein sp56 is a component of the acrosomal

matrix. Biol. Reprod. 64, 36-43.

Kim, K.S. and Gerton,G.L. 2003. Differential release of soluble and matrix components: evidence for

intermediate states of secretion during spontaneous acrosomal exocytosis in mouse sperm. Dev. Biol.

264, 141-152.

Kimura, Y., Yanagimachi,R., Kuretake,S., Bortkiewicz,H., Perry,A.C., Yanagimachi,H. 1998. Analysis of mouse oocyte activation suggests the involvement of sperm perinuclear material. Biol. Reprod.58,

1407-1415.

Kinloch, R.A., Sakai, Y. and Wassarman, P.M. 1995. Mapping the mouse ZP3 combining site for sperm by

exon swapping and site-directed mutagenesis. Proc. Natl. Acad. Sci. U. S. A.92, 263-267.

Kobori, H., Miyazaki,S., Kuwabara,Y. 2000. Characterization of intracellular Ca2+ increase in response to

progesterone and cyclic nucleotides in mouse spermatozoa. Biol. Reprod. 63, 113-120.

Koeheler, J.K. 1975. Periodicities in the acrosome or acrosomal membrane: some observations on

mammalian spermatozoa. In “The Biology of Male Gamete”. (Duckett, J.G. and Racey, P.A. Ed.).

Academic, New York, pp. 337-342.

8/3/2019 Yu_Yang_200811_PhD


150

Kohno, N., Yamagata,K., Yamada,S., Kashiwabara,S., Sakai,Y., Baba,T. 1998. Two novel testicular serine

proteases, TESP1 and TESP2, are present in the mouse sperm acrosome. Biochem. Biophys. Res.

Commun. 245, 658-665.

Kong, M., Richardson,R.T., Widgren,E.E., O'Rand,M.G. 1995. Sequence and localization of the mouse

sperm autoantigenic protein, Sp17. Biol. Reprod. 53, 579-590.

Krishnamurthy, H., Suresh Babu,P., Morales,C.R., Sairam,M.R. 2001. Delay in sexual maturity of the

follicle-stimulating hormone receptor knockout male mouse. Biol. Reprod. 65, 522-531.

Kumar, R.T., Wang, Y., Lu, N., Matzuk, M.M. 1997. Follicle stimulating hormone is required for ovarian

follicle maturation but not male fertility. Nature Genet. 15, 201-204.

Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4.

Nature 227, 680-685.

Lalancette, C., Dorval,V., Leblanc,V., Leclerc,P. 2001. Characterization of an 80-Kilodalton bull sperm

protein identified as PH-20. Biol. Reprod. 65, 628-636.

Lalli, M. and Clermont, Y. 1981. Structural changes of the head components of the rat spermatid during

late spermiogenesis. Am. J. Anat. 160, 419-434.

Lalonde, L., Langlais, J., Antaki. P., Chapdelaine, A., Roberts, K.D., Bleau, G. 1988. Male infertility

associated with round-headed acrosomeless spermatozoa. Fertil. Steril. 49, 316-321.

Lathrop, W.F., Carmichael,E.P., Myles,D.G., Primakoff,P. 1990. cDNA cloning reveals the molecular

structure of a sperm surface protein, PH-20, involved in sperm-egg adhesion and the wide distribution

of its gene among mammals. J. Cell Biol. 111, 2939-2949.

Le Naour, F., Rubinstein,E., Jasmin,C., Prenant,M., Boucheix,C. 2000. Severely reduced female fertility in

CD9-deficient mice. Science 287, 319-321.

Leblond, C.P. and Clermont, Y. 1952. Spermiogenesis of rat, mouse, hamster and guinea pig as revealed by

the periodic acid-fuchsin sulfurous acid technique. Am. J. Anat. 90, 167-215.

Leclerc, P., de Lamirande, E., Gagnon, C. 1996. Cyclic adenosine 30,50monophosphate-dependent

regulation of protein tyrosine phosphorylation in relation to human sperm capacitation and motility.

Biol. Reprod. 55, 684-692.

8/3/2019 Yu_Yang_200811_PhD


151

Leclerc, P., de Lamirande, E., Gagnon, C. 1998. Interactions between Ca2þ, cyclic 30,50 adenosine

monophosphate, the superoxide anion, and tyrosine phosphorylation pathways in the regulation of

human sperm capacitation. J. Androl. 19, 434-443.

Lee, V.H. and Dunbar, B.S. 1993. Developmental expression of the rabbit 55-kDa zona pellucida protein

and messenger RNA in ovarian follicles. Dev. Biol.155, 371-382.

Lefièvre, L., Conner, S.J., Salpekar, A., Olufowobi, O., Ashton, P., Pavlovic, B., Lenton, W., Afnan, M.,

Brewis, I.A., Monk, M. et al.. 2004. Four zona pellucida glycoproteins are expressed in the human.

Reprod. 19,1580–1586.

Li, Y., Hu, X., Zhang, K., Guo, J., Hu. Z., Tao, S., Xiao, L., Wang, Q., Han, C., Liu. Y. 2006. Afaf, a novel

vesicle membrane protein, is related to acrosome formation in murine testis. FEBS Letters580, 4266-

4273.

Lin, Y.N., Roy, A., Yan,W., Burns,K.H., Matzuk,M.M. 2007. Loss of zona pellucida binding proteins in

the acrosomal matrix disrupts acrosome biogenesis and sperm morphogenesis. Mol. Cell Biol.27, 6794-

6805.

Liu, D.Y. and Baker, H.W.G. 1994. Andrology: Disordered acrosome reaction of spermatozoa bound to

the zona pellucida: a newly discovered sperm defect causing infertility with reduced sperm-zona

pellucida penetration and reduced fertilization in vitro. Hum. Reprod. 9, 1694-1700.

Lu, Q. and Shur, B.D. 1997. Sperm from beta 1,4-galactosyltransferase-null mice are refractory to ZP3-

induced acrosome reactions and penetrate the zona pellucida poorly. Development124, 4121-4131.

Mari, S.I., Rawe,V., Biancotti,J.C., Charreau,E.H., Dain,L., Vazquez-Levin,M.n.H. 2003. Biochemical and

molecular studies of the proacrosin/acrosin system in patients with unexplained infertility. Fertil. Steril

79, 1676-1679.

Martinez, M.J., Geuze, H.J., Ballesta, J. 1996. Evidence for a non-lysosomal origin of the acrosome. J.

Histochem. Cytochem. 44, 313-320.

McLeskey, S.B., Dowds, C., Carballada, R., White, R.R., Saling, P.M. 1998. Molecules involved in

mammalian sperm-egg interaction. Int Rev Cytol. 177, 57-113.

Meizel, S., Turner, K.O., Nuccitelli, R. 1997. Progesterone triggers a wave of increased free calcium during

the human sperm acrosome reaction. Dev. Biol. 182, 67-75.

8/3/2019 Yu_Yang_200811_PhD


152

Miller, B.J., Georges-Labouesse,E., Primakoff,P., Myles,D.G. 2000. Normal fertilization occurs with eggs

lacking the integrin {alpha}6{beta}1 and is CD9-dependent. J. Cell Biol. 149, 1289-1296.

Miller, D.J., Macek, M.B., Shur, B.D. 1992. Complementarity between sperm surface [beta]-l,4-galactosyl-

transferase and egg-coat ZP3 mediates sperm-egg binding. Nature 357, 589-593.

Miyado, K., Yamada, G., Yamada, S., Hasuwa, H., Nakamura,Y., Ryu,F., Suzuki,K., Kosai,K., Inoue,K.,

Ogura,A., Okabe,M., Mekada,E. 2000. Requirement of CD9 on the egg plasma membrane for

fertilization. Science 287, 321-324.

Moos, J., Faundes, D., Kopf, G.S., Schultz, R.M. 1995. Composition of the human zona pellucida and

modifications following fertilization. Hum. Reprod. 10, 2467–2471.

Moos, J., Pekniciva, J. and Tesarik, J. 1993. Relationship between molecular conversions of acrosin and the

progression of exocytosis in the calcium ionophore-induced acrosome reaction. Biochi. Biophy. Acta

1176, 199-207.

Moreno, R. and Barros, C. 2000. A basic 18-amino acid peptide contains the polysulfate-binding domain

responsible for activation of the boar proacrosin/acrosin system. Biol. Reprod. 62, 1536-1542.

Moreno, R.D., Bustamante, E., Schatten, G., Barros, C. 2002. Inhibition of mousein vitro fertilization by

an antibody against a unique 18-amino acid domain in the polysulfate-binding domain of

proacrosin/acrosin. Fertil. Steril. 77, 812-817.

Moreno, R.D., Palomino, J., Schatten, G. 2006. Assembly of spermatid acrosome depends on microtubuleorganization during mammalian spermiogenesis. Dev. Biol. 293, 218-227.

Moreno, R.D., Ramalho-Santos, J., Sutovsky, P., Chan, E.K.L., Schatten,G., 2000. Vesicular traffic and

Golgi apparatus dynamics during mammalian spermatogenesis: implications for acrosome architecture.

Biol. Reprod. 63, 89-98.

Mori, E., Baba, T., Iwamatsu, A., Mori, T. 1993. Purification and characterization of a 38-kDa protein,

sp38, with zona pellucida-binding property from porcine epididymal sperm. Biochem. Biophys. Res.

Commun. 196, 196-202.

Mori, E., Kashiwabara, S., Baba, T., Inagaki, Y., Mori, T. 1995. Amino acid sequences of porcine SP38

and proacrosin required for binding to the zona pellucida. Dev. Biol.168, 575-583.

Mortillo, S. and Wassarman, P.M. 1991. Differential binding of gold-labeled zona pellucida glycoproteins

mZP2 and mZP3 to mouse sperm membrane compartments. Development113, 141-149.

8/3/2019 Yu_Yang_200811_PhD


153

Mountjoy, J.R., Xu, W., McLeod, D., Hyndman, D., Oko, R.J. 2008. RAB2A: A major subacrosomal

protein of bovine spermatozoa implicated in acrosomal biogenesis. Biol. Reprod. 79, 223-232.

Myles, D.G., Hyatt, H. and Primakoff, P. 1987. Binding of both acrosome-intact and acrosome-reacted

guinea pig sperm to the zona pellucida during in vitro fertilization. Dev. Biol. 121, 559-567.

Nishimura, H., Kim, E., Nakanishi, T., Baba, T. 2004. Possible function of the ADAM1a/ADAM2 fertilin

complex in the appearance of ADAM3 on the sperm surface. J. Biol. Chem.279, 34957-34962.

Nishimura, H., Cho, C., Branciforte, D.R., Myles, D.G., Primakoff, P. 2001. Analysis of loss of adhesive

function in sperm lacking cyritestin or fertilin [beta]. Dev. Biol.233, 204-213.

O'Rand, M.G., Irons, G.P., Porter, J.P. 1984. Monoclonal antibodies to rabbit sperm autoantigens. I.

Inhibition of in vitro fertilization and localization on the egg. Biol. Reprod. 30, 721-729.

O'Rand, M.G. 1981. Inhibition of fertility and sperm-zona binding by antiserum to the rabbit sperm

membrane autoantigen RSA-1. Biol. Reprod. 25, 621-628.

O'Toole, C.M.B., Arnoult, C., Darszon, A., Steinhardt, R.A., Florman, H.M. 2000. Ca2+ entry through

store-operated channels in mouse sperm is initiated by egg ZP3 and drives the acrosome reaction. Mol.

Biol. Cell 11, 1571-1584.

Oakberg, E.F. 1956. A description of spermiogenesis in the mouse and its use in analysis of the

seminiferous epithelium and germ cell renewal. Am. J. Anat.99, 391-414.

Ohmura, K., Kohno, N., Kobayashi,Y., Yamagata,K., Sato,S., Kashiwabara,S., Baba,T. 1999. A

homologue of pancreatic trypsin is localized in the acrosome of mammalian sperm and is released

during acrosome reaction. J. Biol. Chem. 274, 29426-29432.

Oikawa, T., Yanagimachi, R., Nicolson, G.L. 1973. Wheat germ agglutinin blocks mammalian fertilization.

Nature 241, 256-259.

Oko, R.J. 1995. Developmental expression and possible role of perinuclear theca proteins in mammalian

spermatozoa. Reprod. Fertil. Dev. 7, 777-797.

Oko, R.J. 1998. Occurrence and formation of cytoskeletal proteins in mammalian spermatozoa. Andrologia

30, 193-206.

Oko, R.J. and Clermont, Y. 1988. Isolation, structure and protein composition of the perforatorium of rat

spermatozoa. Biol. Reprod. 39, 673-687.

8/3/2019 Yu_Yang_200811_PhD


154

Oko, R.J.and Clermont, Y. 1998. Spermiogenesis. In “Encyclopedia of Reproduction”. (Knobil,E.,

Neill,J.D. Eds.). Academic Press, San Diego, pp. 602-609.

Oko, R.J. and Maravei, D. 1994. Protein composition of the perinuclear theca of bull spermatozoa. Biol.

Reprod. 50, 1000-1014.

Oko, R.J. and Maravei, D. 1995. Distribution and possible role of perinuclear theca proteins during bovine

spermiogenesis. Microsc. Res. Tech. 32, 520-532.

Oko, R.J. and Clermont, Y. 1991. Biogenesis of specialized cytoskeletal elements of rat spermatozoa. Ann.

N. Y. Acad. Sci.637, 203-223.

Oko, R.J., Jando, V., Wagner, C.L., Kistler, W.S., Hermo, L.S. 1996. Chromatin reorganization in rat

spermatids during the disappearance of testis-specific histone, H1t, and the appearance of transition

proteins TP1 and TP2. Biol. Reprod. 54, 1141-1157.

Olson, G.E. and Winfrey, V.P. 1994. Structure of acrosomal matrix domains of rabbit sperm. J. Struct.

Biol. 112, 41-48.

Olson, G.E., Winfrey, V.P., Winer, M.A., Davenport, G.R. 1987. Outer acrosomal membrane of guinea pig

spermatozoa: isolation and structural characterization. Gamete Res. 17, 77-94.

Olson, G.E. and Winfrey, V.P. 1985. Structure of membrane domains and matrix components of the bovine

acrosome. J Ultrastruct Res. 90, 9-25.

Olson, G.E. and Winfrey, V.P. 1985. Substructure of a cytoskeletal complex associated with the hamster

sperm acrosome. J. Ultrastruct. Res. 92, 167-179.

Olson, G.E., Winfrey, V.P., Bi,M., Hardy,D.M., NagDas,S.K. 2004. Zonadhesin assembly into the hamster

sperm acrosomal matrix occurs by distinct targeting strategies during spermiogenesis and maturation in

the epididymis. Biol. Reprod. 71, 1128-1134.

Olson, G.E., Winfrey, V.P., Davenport, G.R. 1988. Characterization of matrix domains of the hamster

acrosome. Biol. Reprod. 39, 1145-1158.

Olson, G.E., Winfrey, V.P., NagDas, S.K. 1998. Acrosome biogenesis in the hamster: ultrastructurally

distinct matrix regions are assembled from a common precursor polypeptide. Biol. Reprod.58, 361-

370.

8/3/2019 Yu_Yang_200811_PhD


155

Osheroff, J.E., Visconti, P.E., Valenzuela, J.P., Travis, A.J., Alvarez, J. and Kopf, G.S. 1999. Regulation

of human sperm capacitation by a cholesterol effluxstimulated signal transduction pathway leading to

protein kinase A mediated up regulation of protein tyrosine phosphorylation. Mol. Hum. Reprod.5,

1017-1026.

Pampiglione, J.S., Tan, S.L., Campbell, S. 1993. The use of the stimulated acrosome reaction test as a test

of fertilizing ability in human spermatozoa. Fertil. Steril.59, 1280-1284.

Parrington, J., Swann, K., Shevchenko,V.I., Sesay, A.K., Lai, F.A. 1996. Calcium oscillations in

mammalian eggs triggered by a soluble sperm protein. Nature 379, 364-368.

Parrish, R.F. and Polakoski, K.L. 1979. Mammalian sperm proacrosin-acrosin system. Intern. J. Biochem.

10, 391-395.

Patrat, C., Serres, C. and Jouannet, P. 2000. The acrosome reaction in human spermatozoa. Biol. Cell92,

255-266.

Pereda, J. and Coppo, M. 1985. An electron microscopic study of sperm penetration into the human egg

investments. Anat. Embryo. 173, 247-252.

Perry, A.C., Wakayama, T., Yanagimachi, R. 1999. A novel trans-complementation assay suggests full

mammalian oocyte activation is coordinately initiated by multiple, submembrane sperm components.

Biol. Reprod. 60, 747-755.

Peterson, R.N., Bozzola, J., Polakoski, K. 1992. Protein transport and organization of the developingmammalian sperm acrosome. Tissue Cell 24, 1-15.

Primakoff, P., Hyatt,H., Myles,D.G. 1985. A role for the migrating sperm surface antigen PH-20 in guinea

pig sperm binding to the egg zona pellucida. J. Cell Biol.101, 2239-2244.

Qi, H., Moran, M.M., Navarro, B., Chong, J.A., Krapivinsky,G., Krapivinsky, L., Kirichok, K., Ramsey,

I.S., Quill,T.A. and Clapham,D.E. 2007. All four CatSper ion channel proteins are required for male

fertility and sperm cell hyperactivated motility. Proc. Natl. Acad. Sci. U. S. A.104, 1219-1223.

Ramalho-Santos, J., Moreno, R.D., Wessel,G.M., Chan,E.K., Schatten,G. 2001. Membrane traffickingmachinery components associated with the mammalian acrosome during spermiogenesis. Exp. Cell

Res. 267, 45-60.

Raz, T., Eliyahu, E., Yesodi,V., Shalgi, R. 1998. Profile of protein kinase C isozymes and their possible

role in mammalian egg activation. FEBS Letters431, 415-418.

8/3/2019 Yu_Yang_200811_PhD


156

Reitinger, S., Laschober, G.T., Fehrer, C., Greiderer, B. and Lepperdinger, G. 2007. Mouse testicular

hyaluronidase-like proteins SPAM1 and HYAL5 but not HYALP1 degrade hyaluronan. J. Biochem.

401, 79-85.

Ren, D., Navarro, B., Perez, G., Jackson, A.C., Hsu, S., Shi, Q., Tilly, J.L., Clapham, D.E. 2001. A sperm

ion channel required for sperm motility and male fertility. Nature413, 603-609.

Revelli, A., Massobori, M. and Tesarik, J. 1998. Nongenomic actions of steroid hormones in reproductive

tissues. Endocrine. Reviews. 19, 3-17.

Richardson, R., Yamasaki,N., O'Rand,M. 1994. Sequence of a rabbit sperm zona pellucida binding protein

and localization during the acrosome reaction. Dev. Biol. 165, 688-701.

Rochwerger, L., Cohen, D.J., Cuasnicu,P.S. 1992. Mammalian sperm-egg fusion: the rat egg has

complementary sites for a sperm protein that mediates gamete fusion. Dev. Biol.153, 83-90.

Roldan, E.R.S., Murase, T., Shi, Q.X. 1994. Exocytosis in spermatozoa in response to progesterone and

zona pellucida. Science 266, 1578-1581.

Rossi, P., Dolci, S., Albanesi, C., Grimaldi, P., Ricca, R., Geremia, R. 1993. Follicle-stimulating hormone

induction of steel factor (SLF) mRNA in mouse sertoli cells and stimulation of DNA synthesis in

spermatogonia by soluble SLF. Dev. Biol. 155, 68-74. 1993.

Saling, P.M. 1981. Involvement of trypsin-like activity in binding of mouse spermatozoa to zonae

pellucidae. Proc. Natl. Acad. Sci. U. S. A.78, 6231-6235.

Saxena, D.K., Tanii, I., Yoshinaga, K. and Toshimori, K. 1999. Role of intra-acrosomal antigenic

molecules acrin 1 (MN7) and acrin 2 (MN41) in penetration of the zona pellucida in fertilization in

mice. J. Reprod. Fertil. 117, 17-25.

Schultz, R.M. and Kopf, G.S. 1995. Molecular basis of mammalian egg activation. Curr. Top. Dev. Biol.

30, 21-62.

Shabanowitz, R.B.and O'Rand, M.G 1988. Characterization of the human zona pellucida from fertilized

and unfertilized eggs. J.Repro.Fertil. 82, 151-161.

Shetty, J., Wolkowicz, M.J., Digilio,L.C., Klotz,K.L., Jayes,F.L., Diekman,A.B., Westbrook,V.A.,

Farris,E.M., Hao,Z., Coonrod,S.A., Flickinger,C.J., Herr,J.C. 2003. SAMP14, a novel, acrosomal

membrane-associated, glycosylphosphatidylinositol-anchored member of the Ly-6/urokinase-type

8/3/2019 Yu_Yang_200811_PhD


157

plasminogen activator receptor superfamily with a role in sperm-egg interaction. J. Biol. Chem.278,

30506-30515.

Shimizu, Y., Kodama, H., Fukuda, J., Tanaka, T. 1997. Evidence of proacrosin molecule abnormality as a

possible cause of low acrosin activity and unexplained failure of fertilization in vitro. J. Androl. 18,

281-288.

Shur, B.D. and Hall, N.G. 1982. A role for mouse sperm surface galactosyltransferase in sperm binding to

the egg zona pellucida. J. Cell 95, 574-579.

Shur, B.D. and Neely, C.A. 1988. Plasma membrane association, purification, and partial characterization

of mouse sperm beta 1,4-galactosyltransferase. J. Biol. Chem.263, 17706-17714.

Smith, C.E., Hermo, L., Fazel, A., Lalli, M.F., Bergeron,J.J. 1990. Ultrastructural distribution of NADPase

within the Golgi apparatus and lysosomes of mammalian cells. Prog. Histochem. Cytochem.21, 1-120.

Snell, W.J.and White, J.M. 1996. The molecules of mammalian fertilization. Cell85, 629-637.

Stackpole, C.W. and Devorkin. D. 1974. Memberane organization in mouse spermatozoa revealed by

freeze etching. J. Ultrastruct. Res. 49, 167-187.

Suganuma, R., Walden, C.M., Butters,T.D., Platt,F.M., Dwek,R.A., Yanagimachi,R., van der Spoel,A.C.

2005. Alkylated imino sugars, reversible male infertility-inducing agents, do not affect the genetic

integrity of male mouse germ cells during short-term treatment despite induction of sperm deformities.

Biol. Reprod. 72, 805-813.

Sukardi, S., Elliott, R.M., Withers,J.O., Fontaine,U., Millar,J.D., Curry,M.R., Watson,P.F. 2001. Calcium-

binding proteins from the outer acrosomal membrane of ram spermatozoa: potential candidates for

involvement in the acrosome reaction. Reproduction. 122, 939-946.

Susi, F.R., Leblond, C.P., Clermont, Y. 1971. Changes in the Golgi apparatus during spermiogenesis in the

rat. Am. J. Anat. 130, 251-267.

Sutovsky, P., Manandhar, G., McCauley,T., Caamano,J., Sutovsky,M., Thompson,W., Day,B., 2004.

Proteasomal interference prevents zona pellucida penetration and fertilization in mammals. Biol.Reprod. 71, 1625-1637.

Sutovsky, P. 2004. Visualization of sperm accessory structures in the mammalian spermatids, spermatozoa,

and zygotes by immunofluorescence, confocal, and immunoelectron microscopy. Methods Mol. Biol.

253, 59-77.

8/3/2019 Yu_Yang_200811_PhD


158

Sutovsky, P., Manandhar, G., Wu,A., Oko,R., 2003. Interactions of sperm perinuclear theca with the

oocyte: implications for oocyte activation, anti-polyspermy defense, and assisted reproduction. Microsc.

Res. Tech. 61, 362-378.

Swain, J.E. and Pool, T.B. 2008. ART failure: oocyte contributions to unsuccessful fertilization. Hum.

Reprod. Update 14, 431-446.

Tang, X.M., Lalli, M.F., Clermont, Y. 1982. A cytochemical study of the Golgi apparatus of the spermatid

during spermiogenesis in the rat. Am. J. Anat. 163, 283-294.

Tanii, I., Toshimori, K., Araki, S., Oura, C. 1995. Further characterization of intra-acrosomal MN7 and

MC41 antigens, with specifical reference to immunoelectron microscopic comparison of releasing

process during the acrosome reaction in the mouse. Acta Histochem. Cytochem.28, 447-452.

Tanii, I., Oh-oka, T., Yoshinaga,K., Toshimori,K., 2001. A mouse acrosomal cortical matrix protein,

MC41, has ZP2-binding activity and forms a complex with a 75-kDa serine protease. Dev. Biol.238,

332-341.

Tanii, I., Toshimori, K., Araki, S. and Oura, C. 1992. Extra-Golgi pathway of an acrosomal antigen during

spermiogenesis in the rat. Cell Tissue Res. 270, 451-457.

Tanphaichitr, N., Smith, J., Mongkolsirikieart, S., Gradil, C., Lingwood, C.A. 1993. Role of a gamete-

specific sulfoglycolipid immobilizing protein on mouse sperm-egg binding. Dev. Biol.156, 164-175.

Tapananien, J.S., Aittomaki, K., Min, J., Vaskivuo, T., Huhtaniemi I.T. 1997. Men homozygous for aninactivating mutation of the follicle-stimulating hormone (FSH) receptor gene present variable

suppression of spermatogenesis and fertility. Nature Genet.15, 205-206.

Tesarik, J., Drahorad, J., Testart, J., Mendoza, C. 1990. Acrosin activation follows its surface exposure and

precedes membrane fusion in human sperm acrosome reaction. Development110, 391-400.

Tesarik, J., 1994. Calcium in oocyte maturation. How the spermatozoon awakens the oocyte: lessons from

intracytoplasmic sperm injection. Hum. Reprod. 9, 977-978.

Thorne-Tjomsland, G., Clermont,Y., Hermo,L. 1988. Contribution of the Golgi apparatus components tothe formation of the acrosomic system and chromatoid body in rat spermatids. Anat. Rec.221, 591-598.

Topfer-Petersen, E. and Calvete, J.J. 1996. Sperm-associated protein candidates for primary zona pellucida-

binding molecules: structure-function correlations of boar spermadhesins. J. Reprod. Fertil. Suppl.50,

55-61.

8/3/2019 Yu_Yang_200811_PhD


159

Topfer-Petersen, E. and Henschen, A. 1988. Zona pellucida-binding and fucose-binding of boar sperm

acrosin is not correlated with proteolytic activity. Biol. Chem. Hoppe. Seyler.369, 69-76.

Toshimori, K. 1998. Maturation of mammalian spermatozoa: modifications of the acrosome and plasma

membrane leading to fertilization. Cell Tissue Res. 293, 177-187.

Tovich, P.R. and Oko, R.J. 2003. Somatic histones are components of the perinuclear theca in bovine

spermatozoa. J. Biol. Chem. 278, 32431-32438.

Tovich, P.R., Sutovsky, P., Oko, R.J. 2004. Novel aspect of perinuclear theca assembly revealed by

immunolocalization of non-nuclear somatic histones during bovine spermiogenesis. Biol. Reprod. 71,

1182-1194.

Towbin, H., Staehelin, T., Gordon, J. , 1979. Electrophoretic transfer of proteins from polyacrylamide gels

to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U. S. A.76, 4350-

4354.

Tsubamoto, H., Hasegawa, A., Nakata,Y., Naito,S., Yamasaki,N., Koyama,K., 1999. Expression of

recombinant human zona pellucida protein 2 and its binding capacity to spermatozoa. Biol. Reprod.61,

1649-1654.

Tulsiani, D.R., Abou-Haila, A., Loeser,C.R., Pereira,B.M. 1998. The biological and functional significance

of the sperm acrosome and acrosomal enzymes in mammalian fertilization. Exp. Cell Res.240, 151-

164.

Tulsiani, D.R., Yoshida-Komiya,H., Araki,Y. 1997. Mammalian fertilization: a carbohydrate-mediated

event. Biol. Reprod. 57, 487-494.

Urch, U.A. and Patel, H. 1991. The interaction of boar sperm proacrosin with its natural substrate, the zona

pellucida, and with polysulfated polysaccharides. Development 111, 1165-1172.

Vale, W.W., Bilezikjiana, L.M., Rivier, B. 1994. Inhibins and actins. In “The physiology of Reproduction”.

(Knobil, E. and Neill, J.D. Eds.), New York: Raven Press, pp.1861-1878.

Visconti, P.E., Westbrook, V.A., Chertihin, O., Demarco, I., Sleight, S.,Diekman, A.B. 2002. Novelsignaling pathways involved in sperm acquisition of fertilizing capacity. J. Reprod. Immunol.53, 133-

150.

Walden, C.M., Butters,T.D., Dwek,R.A., Platt,F.M., van der Spoel,A.C. 2006. Long-term non-hormonal

male contraception in mice using N-butyldeoxynojirimycin. Hum. Reprod. 21, 1309-1315.

8/3/2019 Yu_Yang_200811_PhD


160

Ward, C.R., Storey, B.T., Kopf, G.S. 1992. Activation of a Gi protein in mouse sperm membranes by

solubilized proteins of the zona pellucida, the egg's extracellular matrix. J. Biol. Chem.267, 14061-

14067.

Wassarman, P.M. 1988a. Fertilization in mammals. Sci. Am.259, 78-84.

Wassarman, P.M. 1988b. Zona pellucida glycoproteins. Ann. Rev. Biochem. 57, 415-442.

Wassarman, P.M. 1990. Profile of a mammalian sperm receptor. Development108, 1-17.

Wassarman, P.M. 1999. Mammalian fertilization: molecular aspects of gamete adhesion, exocytosis, and

fusion. Cell 96, 175-183.

Wassarman, P.M., Jovine, L., Litscher, E.S. 2001. A profile of fertilization in mammals. Nat. Cell Biol.3,

E59-E64.

Wassarman, P.M., Jovine, L., Litscher, E.S. 2004. Mouse zona pellucida genes and glycoproteins.

Cytogenet. Genome Res. 105, 228-234.

Wassarman, P.M., Jovine, L., Litscher, E.S., Qi, H., Williams,Z. 2004. Egg-sperm interactions at

fertilization in mammals. Europ. J. Ob. Gyn.115, S57-S60.

Wassarmana, P. M. and Litschera, E.S. 1995. Sperm-egg recognition mechanisms in mammals. Current

Top. Dev. Biol. 30, 1-19.

West, A.P. and Willison, K.R. 1996. Brefeldin A and mannose 6-phosphate regulation of acrosomic related

vesicular trafficking. Europ. J. Cell Biol. 70, 315-321.

Westbrook-Case, V.A., Winfrey, V.P. and Olson, G.E. 1994. A domain-specific 50-Kilodalton structural

protein of the acrosomal matrix is processed and released during the acrosome reaction in the guinea

pig. Biol. Reprod. 51, 1-13.

Westbrook-Case, V.A., Winfrey, V.P., Olson,G.E., 1995. Sorting of the domain-specific acrosomal matrix

protein AM50 during spermiogenesis in the guinea pig. Dev. Biol.167, 338-349.

White, D., Weerachatyanukul, W., Gadella, B., Kamolvarin, N., Attar, M., Tanphaichitr, N. 2000. Role of

sperm sulfogalactosylglycerolipid in mouse sperm-zona pellucida binding. Biol. Reprod. 63, 147-155.

Wray, W., Boulikas, T., Wray, V., Hancock,R. 1981. Silver staining of proteins in polyacrylamide gels.

Analyt. Biochem. 118, 197-203.

8/3/2019 Yu_Yang_200811_PhD


161

Wright, R.M., John,E., Klotz,K., Flickinger,C.J., Herr,J.C. 1990. Cloning and sequencing of cDNAs coding

for the human intra-acrosomal antigen SP-10. Biol. Reprod.42, 693-701.

Wu, A., Sutovsky, P., Manandhar,G., Xu,W., Katayama,M., Day,BN., Park,K.W., Yi,YJ., Xi,YW.,

Prather,RS., Oko,R.J. 2007. PAWP, A sperm specific ww-domain binding protein, promotes meiotic

resumption and pronuclear development during fertilization. J. Biol. Chem.282, 12164-12175.

Yamagata, K., Murayama, K., Okabe, M., Toshimori,K., Nakanishi,T., Kashiwabara,S., Baba,T. 1998.

Acrosin accelerates the dispersal of sperm acrosomal proteins during acrosome reaction. J. Biol. Chem.

273, 10470-10474.

Yamasaki, N., Richardson, R.T. and O'Rand M.G. 1995. Expression of the rabbit sperm protein Sp17 in cos

cells and interaction of recombinant Sp17 with the rabbit zona pellucida. Mol. Reprod. Dev.40, 48-55.

Yanagimachi, R. 1994. Mammalian fertilization. In: “Physiology of Reproduction”. (Knobil, E. and Neil,

J.D. Eds.), Raven Press, NY, pp. 189-317.

Yonezawa, N., Aoki, H., Hatanaka, Y., Nakano, M. 1995. Involvement of N-linked carbohydrate chains of

pig zona pellucida in sperm-egg binding. Eur. J. Biochem.233, 35-41.

Yonezawa, N., Mitsui, S., Kudo, K., Nakano, M. 1997. Identification of an N-glycosylated region of pig

zona pellucida glycoprotein ZPB that is involved in sperm binding. Eur. J. Biochem.248, 86-92.

Yoshinaga, K., Toshimori, K. 2003. Organization and modifications of sperm acrosomal molecules during

spermatogenesis and epididymal maturation. Micro. Res. Tech. 61, 39-45.

Yoshinaga, K., Tanii, I., Saxena,D.K., Toshimori,K. 1998. Immunocytochemical alterations in the intra-

acrosomal antigen MN7 during epididymal maturation of guinea pig spermatozoa. Cell Tissue Res.292,

427-433

Yoshinaga, K., Tanii,I., Oh-oka,T., Toshimori,K. 2001. Changes in distribution and molecular weight of

the acrosomal protein acrin2 (MC41) during guinea pig spermiogenesis and epididymal maturation.

Cell Tissue Res. 303, 253-261

Youakim, A., Hathaway, H.J., Miller, D.J., Gong, X., Shur, B.D. 1994. Overexpressing sperm surface beta1,4-galactosyltransferase in transgenic mice affects multiple aspects of sperm-egg interactions. J. Cell

Biol. 126, 1573-1583.

Young, R. and Davis, R. 1983a. Efficient isolation of genes by using antibody probes. Proc. Natl. Acad.

Sci. U. S. A. 80, 1194-1198.

8/3/2019 Yu_Yang_200811_PhD


Young, R.and Davis, R. 1983b. Yeast RNA polymerase II genes: Isolation with antibody probes. Science

222, 778-782.

Yu, Y., Xu, W., Yi,Y.J., Sutovsky,P., Oko,R.J. 2006. The extracellular protein coat of the inner acrosomal

membrane is involved in zona pellucida binding and penetration during fertilization: characterization of

its most prominent polypeptide (IAM38). Dev. Biol. 290, 32-43.

Yudin, A.I., Vandevoort C.A., Li, M.W., Overstreet, J.W.C. 1999. PH-20 but not acrosin involved in sperm

penetration of the macaque zona pellucida. Mol. Reprod. Dev.53, 350-362.

Yurewicz, E., Sacco,A., Gupta,S., Xu,N., Gage,D. 1998. Hetero-oligomerization-dependent binding of pig

oocyte zona pellucida glycoproteins zpb and zpc to boar sperm membrane vesicles. J. Biol. Chem.273,

7488-7494.

Zahn, A., Furlong, L.I., Biancotti, J.C., Ghiringhelli, P.D., Marin-Briggiler, C.I., Vazquez-Levin, M.H.

2002. Evaluation of the proacrosin/acrosin system and its mechanism of activation in human sperm

extracts. J. Reprod. Immun. 54, 43-63.

yu_yang_200811_phd

Documents