yellow tailflower mild mottle virus and pelargonium...

MURDOCH RESEARCH REPOSITORY

This is the author’s final version of the work, as accepted for publication following peer review but without the publisher’s layout or pagination.

The definitive version is available at :

http://dx.doi.org/10.1111/ppa.12416

Li, H., Zhang, C., Luo, H., Jones, M.G.K., Sivasithamparam, K., Koh, S-H, Ong, J.W.L. and Wylie, S.J. (2016) Yellow tailflower mild mottle virus and

Pelargonium zonate spot virusco-infect a wild plant of red-striped tailflower in Australia. Plant Pathology, 65 (3). pp. 503-509.

http://researchrepository.murdoch.edu.a/27335/

Copyright: © 2015 British Society for Plant Pathology It is posted here for your personal use. No further distribution is permitted.

http://dx.doi.org/10.1111/ppa.12416

http://researchrepository.murdoch.edu.a/27335/

Acc

epte

d A

rtic

le

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/ppa.12416

This article is protected by copyright. All rights reserved.

Article Type: Original Article

Yellow tailflower mild mottle virus and Pelargonium zonate spot virus co-infect a wild

plant of red-striped tailflower in Australia

Hua Li, C. Zhang, H. Luo, M.G.K. Jones, K. Sivasithamparam, S-H Koh, J.W.L. Ong, S.J.

Wylie*

Plant Biotechnology Group –Plant Virology, Western Australian State Agricultural

Biotechnology Centre, School of Veterinary and Life Sciences, Murdoch University, Perth,

Western Australia 6150, Australia.

*Corresponding author. Email: [email protected]

Running head: YTMMV, PZSV infect Anthocercis ilicifolia

Key words: Plant virus ecology; Solanaceae; tobamovirus; anulavirus, indigenous plant virus,

virus invasion, virus emergenc

Abstract

Isolates of an Australian indigenous virus Yellow tailflower mild mottle virus (YTMMV-

Kalbarri) and an exotic virus Pelargonium zonate spot virus (PZSV-SW13) are described

from Anthocercis ilicifolia Hook. subspecies ilicifolia (red striped tailflower, family

Solanaceae), a species endemic to Western Australia. This is the first report of either virus

from this plant species. The complete genome sequences of YTMMV-Kalbarri and of PZSV-

Acc

epte

d A

rtic

le


SW13 were obtained. YTMMV-Kalbarri shared 97% nucleotide pairwise identity with the

sequence of the type isolate YTMMV-Cervantes. The sequence PZSV-SW13 shared greatest

sequence identity with the partial sequence of an Australian isolate of PZSV also from a wild

plant, and with a sunflower-derived isolate of PZSV from Argentina. An experimental host

range study was done of YTMMV-Kalbarri using cultivated and wild solanaceous and non-

solanaceous plants. Most solanaceous plants became systemically infected, with symptoms of

systemic infection ranging from asymptomatic to whole plant necrosis. Based on these

studies, we suggest that YTMMV has the potential to become a pathogen of commercial

species of Solanaceae. This study provides further evidence that PZSV is present in wild

plants in Australia, in this case an indigenous host species, and possible routes by which it

invaded Australia are discussed.

Introduction

Anthocercis (family Solanaceae, subfamily Nicotianoideae) is a genus of 15 plant species

endemic to southern Australia (Haegi, 1986). Previously, we isolated a tobamovirus (Genus

Tobamovirus, family Virgaviridae) from A. littoria (yellow tailflower), a spindly shrub 3 m in

height that grows along the coastline in calcareous sand, limestone ridges and sand dunes on

south-western Australia, but the virus was not detected from A. viscosa (sticky tailflower)

plants growing in Albany, 400 km to the south. The new tobamovirus was named Yellow

tailflower mild mottle virus (YTMMV) (Wylie et al 2014).

Pelargonium zonate spot virus (PZSV) (genus Anulavirus, family Bromoviridae) was first

isolated from Pelargonium zonale (Geraniaceae) in Italy (Quacquarelli and Gallitelli, 1979),

but has since been shown to have a broader host range, notably capsicum and tomato

(Solanaceae), in which it is vertically transmitted, sunflower and globe artichoke

Acc

epte

d A

rtic

le


(Asteraceae), kiwifruit (Actinidiaceae), and several weeds from the families Brassicaceae,

some of which it has been shown to be vertically transmitted in, and Asteraceae (Gallitelli,

1982; Luis-Arteaga et al. 2000; Gebre-Selassie et al. 2002; Finetti-Sialer and Gallitelli, 2003;

Liu and Sears, 2007; Escriu et al. 2009; Gulati-Sakhuja et al. 2009; Lapidot et al. 2010;

Biccheri et al. 2012; Giolitti et al. 2014). Its geographical range includes much of Europe and

the Americas. In Australia, PZSV was recently described for the first time in Cakile maritima

(Brassicaceae), a self-introduced exotic weed species (Luo et al. 2010).

Here, we describe the complete genome sequences of new isolates of YTMMV and PZSV

that co-infected a wild plant of Anthocercis ilicifolia subsp. ilicifolia (red-striped tailflower),

a new host species for both viruses. Although details of the host range of PZSV have been

published, the potential host range of YTMMV is not known. The natural hosts of YTMMV

live at the interface between wild and managed systems, and consequently the opportunity

exists for the virus to expand its host range into cultivated plant species. Thus, we undertook

an experimental host range study of the new YTMMV isolate and the type YTMMV isolate,

and we discuss the potential of YTMMV to emerge as a pathogen of commercial importance.

Further, we speculate as to how PZSV may have entered Australia, given that it has not yet

been detected there in commercial plantings.

Materials and Methods

Virus identification

In October 2013 leaves were collected from a red striped tailflower plant exhibiting leaf

chlorosis and a number of dead or dying branches (Fig. 1a). The plant was in visibly poor

health amongst a group of more healthy-looking plants scattered along a limestone ridge

overlooking the Indian Ocean near the coastal town of Kalbarri. Total nucleic acids were

Acc

epte

d A

rtic

le


extracted from 1 g of leaves and enriched for dsRNA using a cellulose-based method (Morris

and Dodds, 1979) modified by replacing Whatman CF11 cellulose powder with Machery-

Nagel MN100 cellulose powder. cDNA was synthesized from 1 μg heat denatured RNA

using adaptor-tailed random primers and GoScript™ reverse transcription system (Promega).

PCR amplification was carried out using tagged primers that annealed to the adaptor

sequences at the ends of cDNA strands. Amplicons were purified using Mag PCR clean-up

beads (Axygen Biosciences). Library construction and paired-end sequencing of cDNA over

150 cycles using Illumina HiSeq2000 technology (Illumina Inc, San Diego, CA) were done

by Macrogen Inc, Seoul.

Analysis of sequences and assembly of contigs were done after trimming off 20 nucleotides

(nt) from each end of each sequence read. The ‘De Novo Assembly’ function in CLC

Genomics Workbench v7 (Qiagen) was used with default (automatic) word size and bubble

size. Contigs sequences were used to interrogate NCBI GenBank using BlastN and BlastX,

and sequences representing genomes of YTMMV-Kalbarri and PZSV-SW13 RNAs 1-3 were

identified. Editing and alignment of contigs to generate consensus nucleotide (nt) and amino

acid (aa) sequences were done in CLC Genomics Workbench using a Gap open cost of 10

and Gap extension cost of 1.0.

Experimental host range of YTMMV

Macerated leaf material from the original host plants of YTMMV-Kalbarri and YTMMV-

Cervantes was inoculated to plants of N. benthamiana (accession RA-4). Virus-specific

primers (below) were used to confirm that severely symptomatic N. benthamiana plants were

infected with YTMMV, but not with PZSV. Macerated leaf material from symptomatic N.

benthamiana plants was used to inoculate 1-12 plants each of 12 solanaceous species in five

Acc

epte

d A

rtic

le


genera, comprising commercial species, weeds, and two indigenous species. Additionally, 3-

6 plants of 16 non-solanaceous species were inoculated with the same inoculum (Table 1).

Inoculum consisted of macerated new leaves of YTMMV-infected N. benthamiana mixed

with chilled 100 mM phosphate buffer (pH 7.0). This was gently applied to leaves of test

plants using diatomaceous earth (Sigma-Alrich) as an abrasive. In each case, an equal number

of mock-inoculated plants were tested. Plants were grown in a rotted bark and sand mix to

which 5 g each of lime and dolomite and 40 g of slow release NPK fertiliser were added per

40 L of potting mix. Plants were grown in a temperature-controlled and insect-proof

glasshouse under natural light at 22°C and scored for symptoms there 35 days post-

inoculation (dpi). The presence of YTMMV was tested for using virus-specific primers

(below).

Symptom development indices.

Symptom development was monitored on inoculated plants every day until 35 dpi when they

were scored using a simple qualitative assessment of symptom severity:

1. No infection as determined by RT-PCR using YTMMV-specific primers

2. Local lesions or asymptomatic presence in inoculated leaves only. No systemic

infection detected.

3. No symptoms of infection observed. Systemic spread confirmed by RT-PCR.

4. Mild symptoms of chlorosis, mosaic and/or leaf deformation evident. Slight stunting

may be evident. Ring patterns or small necrotic lesions sometimes visible.

5. Moderate symptoms of chlorosis, mosaic and/or leaf deformation. Moderate to

significant stunting of growth and small necrotic lesions may be present. Flowers

usually present.

Acc

epte

d A

rtic

le


6. Large necrotic lesions on leaf/stem, severe stunting. Plant remains alive but no

flowers present.

7. Plant is dead

RT-PCR assays for YTMMV and PZSV.

All inoculated plants were screened at 20, or 25 and/or 35 dpi for presence of YTMMV and

PZSV using virus-specific primers in RT-PCR assays. MyTaq™ One-Step RT-PCR system

(Bioline) was used to synthesise cDNA and amplify fragments of virus genomes in the

presence of virus-specific forward and reverse primers from total RNA extracted from plants

using the RNeasy Plant Mini kit (Qiagen), or the dsRNA enrichment protocol described

above. Virus-specific primers that annealed within the replicase gene of YTMMV were

YTMMV461F 5’-GATGTTCGTGACGTCATGCG-3’ and YTMMV809R 5’-

TAGCGGGTAACTCCACGGTA-3’ to yield an amplicon of 348 bp. Primers used to detect

the PZSV genome were R3-F 5’ CTCACCAACTGAATGCTCTGGAC 3’ and R3-R 5’

TGGATGCGTCTTTCCGAACC 3’ (Liu and Sears, 2007) that annealed to the movement

protein gene in RNA3 to yield an amplicon of 427 bp.

Transmission Electron Microscopy.

A single YTMMV-Kalbarri infected Solanum betaceum leaf was collected and cut to expose

leaf sap. A small quantity of sap was dropped onto a 400 mesh square copper grid and coated

with formvar stain by adding a drop of 1 % phosphotungstic acid. It was left to incubate at

room temperature for 5 min, with excess liquid was removed by blotting onto filter paper.

The grid was viewed under a Philips CM100 Bio transmission electron microscope and

images recorded.

Acc

epte

d A

rtic

le


Results

Genome assembly and sequence analysis.

The complete genome sequence of the YTMMV-Kalbarri, isolated from a plant of A.

ilicifolia subspecies ilicifolia was 6548 nt in length. The consensus genome sequence was

assembled from 4599 reads. Coverage ranged from 14-fold at nt 3573 within the replicase to

636-fold at nt 5469 within the movement protein. Overall mean coverage across the genome

was 76.5-fold. Pairwise identity was 96.6%.

Comparison of the new isolate with the type isolate YTMMV-Cervantes showed they shared

96.7% nt identity. Nucleotide (nt) and amino acid (aa) pairwise identities of individual

proteins between the two YTMMV isolates were: Replicase, 96.7% nt, 99.3% aa; Movement

Protein (MP), 98.0% nt, 98.9% aa; Coat Protein (CP), 98.5% nt, 98.7% aa. The overall

nucleotide sequence difference is below 10%, a species demarcation criterion advised by the

International Committee on the Taxonomy of Viruses for tobamoviruses (King et al. 2012),

confirming that the new virus isolate is a strain of Yellow tailflower mild mottle virus. The

genome sequence of YTMMV-Kalbarri was granted GenBank accession KJ683937.

The complete genome sequence of new isolate of PZSV was determined and compared with

the complete genomes available from tomato in Italy (GenBank accessions AJ272327,

AJ272328, AJ272329) and from sunflower in Argentina (JQ350736, JQ350737, JQ350739),

and partial genomes from capsicum and tomato from Spain (GQ178216, GQ178217), and

tomato from the USA (EU906913) (Table 2). RNA1, encoding Methyltransferase and

Helicase domains of the replicase, was 3386 nt in length. RNA1 shared 89 % and 95 % aa

pairwise identities with isolates from tomato and sunflower, respectively. The RNA2

sequence, encoding the RNA-dependent RNA polymerase domain of the replicase, was 2433

Acc

epte

d A

rtic

le


nt in length. It shared 95 % and 97 % aa identity with the tomato and sunflower isolates of

PZSV, respectively. RNA3, encoding a movement protein and coat protein, was 2664 nt in

length. The movement protein (MP) sequence shared 97 % and 99 % aa identity with the

tomato and sunflower isolates, respectively. The partial movement protein sequences of

Spanish isolates collected from capsicum and tomato shared 97 % aa with the new sequence,

and was identical to the other Australian isolate of PZSV from Cakile maritima (GenBank

accession GU046705) (Luo et al. 2010). The three complete genome fragments of PZSV-

SW13 were granted GenBank accession codes KF790760 (RNA1), KF790761 (RNA2) and

KF790762 (RNA3).

Symptoms associated with virus infection.

YTMMV-Kalbarri and PZSV-SW13 isolates naturally co-infected a symptomatic plant of A.

ilicifolia subsp. ilicifolia. When leaf sap from the original host plant was inoculated to N.

benthamiana plants, YTMMV was able to systemically infect them, but not PZSV, despite

PZSV having been reported to systemically infect N. benthamiana plants (Lapidot et al.

2010).

Host responses to the new YTMMV isolate were compared to those induced by the type

isolate YTMMV-Cervantes. Leaf sap from infected N. benthamiana plants was used to

inoculate a range of experimental host plants. Visible symptoms were recorded if present, and

RT-PCR assays of inoculated and new (uninoculated) leaves were done. In most cases,

visible responses by the plants to the two isolates could not be distinguished (Table 1).

Acc

epte

d A

rtic

le


Amaranthaceae: Chenopodium amaranticolor exhibited local lesions but did not become

systemically infected. In contrast, A. quinoa exhibited no response to inoculation, and no

virus could be detected from inoculated leaves 35 dpi.

Amaryllidaceae: Neither of the two Allium species tested exhibited visible symptoms of

infection or became locally or systemically infected.

Asteraceae: Neither sunflower nor lettuce exhibited visible symptoms of infection or became

locally or systemically infected.

Brassicaceae: Of the three species tested, none exhibited symptoms of infection. YTMMV-

Cervantes was detected in the inoculated leaves of all plants of Chinese cabbage tested 25

dpi. Sap extracted from these Chinese cabbage leaves was not infectious on N. benthamiana

plants.

Cucurbitaceae: The three cucurbits tested did not exhibit visible symptoms of infection or

became locally or systemically infected.

Fabaceae: Common bean plants exhibited no symptoms nor supported local or systemic

infection.

Lamiaceae: Basil plants exhibited no symptoms nor supported local or systemic infection.

Malvaceae: Okra plants exhibited no symptoms nor supported local or systemic infection.

Acc

epte

d A

rtic

le


Solanaceae:Only one Yellow tailflower (Anthocercis littoria) seedling was inoculated with

YTMMV-Kalbarri because of the difficulty of achieving seed germination in this species.

Compared to the mock-inoculated plant, the YTMMV-infected A. littoria plant exhibited

premature yellowing of leaves and slower growth. The two Nicotiana species tested

responded differently to YTMMV infection. Plants of N. benthamiana accession RA-4

(indigenous to Australia) died quickly after infection (Fig.1b.), whereas plants of N. glutinosa

(indigenous to Peru) exhibited local necrotic lesions but systemic infection did not occur.

Two cultivars of Capsicum annuum (bell and chili pepper varieties) exhibited mild mottling

symptoms on young leaves, or there was more generalized chlorosis and reduction in leaf

size, and plants became stunted and yellow (Fig. 1d). Fruits produced from infected plants

were smaller and distorted in comparison to those produced from mock-infected control

plants. The upper leaves of infected Petunia hybrida plants were slightly distorted and

mottled, and flower petals were paler between the veins while the petal veins were darker.

Flowers were smaller and distorted. Petunia plants infected by YTMMV-Cervantes exhibited

more severe symptoms than those induced by YTMMV-Kalbarri. Two of the three members

of the genus Physalis tested - P angulata (wild gooseberry, Mullaca,), P. philadelphica

(tomatillo) – exhibited similar symptoms to one another; leaves and fruits senesced

prematurely and were shed. In contrast, P. peruviana (Cape gooseberry, Inca berry) plants

exhibited comparatively milder symptoms. Members of the genus Solanum exhibited

variable responses to YTMMV infection. S. betaceum (tamarillo) plants became severely

stunted, oval-shaped lesions appeared on stems and petioles, leaves were heavily distorted,

and no flower was produced (Fig. 1h, i). Infected S. lasiophyllum (flannel bush, an Australian

native species) plants exhibited no obvious symptom on leaves, but infected plants grew less

vigorously than control plants. In S. lycopersicum cv Money Maker, symptoms were initial

pallor and/or a faint mosaic on young leaves followed by a generalised chlorosis and

Acc

epte

d A

rtic

le


reduction in leaf size as plants aged (Fig. 1c). In S. lycopersicum cv Pomodoro Marglobe, the

symptoms resembled those seen in the other tomato cultivar with the addition of bunching of

young leaves. Infection in S. melongena (eggplant) was associated with pallor, chlorosis,

mosaic, and moderate to significant stunting (Fig. 1f). Few fruits were produced, and those

produced were lighter in colour (pink rather than purple) and smaller than controls. In S.

nigrum (black nightshade, a naturalised weed), symptoms of infection of YTMMV-Kalbarri

were not apparent until the fourth week post inoculation when mild mottling and leaf

distortion became visible on young leaves. There was no visible difference in size or number

of fruit between infected and control plants. In contrast, S. nigrum plants infected with

YTMMV-Cervantes exhibited more severe symptoms, resulting in generalized stunting.

YTMMV infection of S. tuberosum (potato) plants resulted in small local lesions on

inoculated leaves (Fig. 1e, 1g) followed by systemic infection. The emerging leaves of

infected plant showed faint mottling symptoms.

Electron microscopy.

Rod-shaped virus particles of 240 nm long and 14 nm wide were observed in YTMMV

infected leaf tissue of S. betaceum (Fig. 2), consistent with those produced by other

tobamoviruses (Hatta et al. 1983).

Discussion

In this study, we sampled a single affected A. ilicifolia subsp. ilicifolia plant from a site near

Kalbarri Western Australia and found that it was infected with isolates of two viruses –

YTMMV and PZSV.

Acc

epte

d A

rtic

le


A host range study showed that most solanaceous plants are susceptible to systemic infection

by YTMMV-Kalbarri, including Anthocercis littoria, the species from which the type isolate

of YTMMV was described. The exception was N. glutinosa, the original source of the

Tobacco mosaic virus (genus Tobamovirus) resistance gene in N. tabacum (Holmes, 1938).

Thus, YTMMV isolates probably have the potential to infect members of the Solaneaceae, of

which approximately 192 indigenous and naturalised exotic species grow in Western

Australia (Anon, 1998), in addition to the commercially important cultivated food and flower

species.

The two isolates of YTMMV tested are genetically close, yet a comparison of symptom

induction revealed small differences in virulence on solanaceous hosts, notably on petunia

and black nightshade plants where symptoms were consistently more severe upon infection

with YTMMV-Cervantes. The detection of YTMMV-Cervantes in inoculated leaves of

Chinese cabbage was surprising, as solanaceous-infected tobamoviruses have not been

recorded infecting brassicas (Stobbe et al. 2012). The RT-PCR assay result was robust and

consistent in all Chinese cabbage samples tested. However, we were unable to establish

infection in highly vulnerable N. benthamiana plants using sap from apparently locally-

infected Chinese cabbage plants, indicating that virus particle titre was probably very low.

PZSV has a broad recorded host range including members of five plant families (Gallitelli,

1982; Liu and Sears, 2007), and as such constitutes a potentially greater risk to indigenous

plant communities and to commercial production species in Australia. YTMMV and PZSV

infected red-striped tailflower, a species whose geographical range overlaps those of five

other Anthocercis species: A. anisantha, A. genistoides, A. gracilis (threatened), A. intrica

(threatened) and A. littoria. Other wild solanaceous species that live naturally within the same

Acc

epte

d A

rtic

le


geographical range are S. aviculare, S. capsiciforme, S. lasiophyllum, S. linneanum, S.

symonii, and the exotic weed S. nigrum. The mild symptoms shown by both S. lasiophyllum

and S. nigrum (YTMMV-Kalbarri) under experimental conditions suggest that some

YTMMV-infected wild plants may be difficult to identify from the presence of visual

symptoms alone. Similarly, YTMMV-infected potatoes, tomatoes, capsicums and cape

gooseberries exhibited mild symptoms. Cultivars of potato, tomato and capsicum are farmed

within the natural geographical range of Anthocercis species. Thus, it is conceivable that

YTMMV infection of commercial species has already occurred naturally, but so far has gone

unnoticed or unrecorded. No attempt was made in the current study to quantify potential

losses to commercial crops by YTMMV infection, but further research is underway to

examine this.

The presence of PZSV was unexpected. Most reports of PZSV from the Americas, the

Middle East and Europe are from horticultural crop species, with a minority from weeds (Liu

et al. 2007; Escriu et al. 2009; Lapidot et al. 2010; Biccheri et al. 2012; Giolitti et al. 2014),

but in Australia both reports are from wild plants, one an exotic weed (C. maritima) (Luo et

al. 2010) and the other indigenous (A. ilicifolia) . The location of the doubly-infected red-

striped tailflower was 150 km north of the nearest horticultural production area (Geraldton)

and more than 600 km north of Woodman point where the other Australian isolate of PZSV

was identified from C. maritima (Luo et al. 2010). The sequence of the new PZSV isolate

shared greatest identity with the other Australian isolate, suggesting that the two Australian

isolates have the same original source. How PZSV came to Australia is unknown, but it may

not be in tomato seed because PZSV infection is characterised by chlorotic and necrotic ring

patterns on the leaves and fruit, plant stunting, leaf malformation, reduced fruit set, and plant

death (Gallitelli, 1982), all symptoms that commercial growers would notice and report to

Acc

epte

d A

rtic

le


authorities. A clue to the source of PZSV may be in the identity of one of its hosts and the

proximity of both Australian hosts to the ocean. The first isolate was described from C.

maritima (sea rocket) plants growing on a beach, and the new isolate described here is also

from a plant growing within metres of the same ocean. PZSV is described as seed borne in

the brassica Diplotaxis erucoides (White wall rocket) (Lapidot et al. 2010), and it is

reasonable to assume seed transmission also occurs in Cakile species, although this has not

been tested. We hypothesise that PZSV entered Australia in seed of C. maritima or C.

edentula carried on ocean currents from other continents, where it subsequently spread to

tailflower plants nearby via the aphids that widely colonise both species. The fruit of Cakile

is adapted to dispersal by sea currents, and viability of seed and seedlings is not affected by

immersion in salt water for at least 10 weeks (Barbour, 1970; Clausing et al. 2000). The two

Cakile species that occur commonly along Australian coastlines were self-introduced at least

100 years ago (Rodman, 1986), and the original source location is unknown. Elsewhere,

Cakile species have spread along coastlines in the Americas, Europe and western and eastern

Asia (Clausing et al. 2000; Fukuda et al. 2013). The nearest continent to Australia is Asia,

and ocean currents originating from South-east Asia sweep in a north to south direction past

the collection sites of the two Australian PZSV isolates. A survey for PZSV in Cakile

populations in Australia and elsewhere may clarify the origin of PZSV in Australia.

The risks of YTMMV and PZSV in managed and wild plant systems are difficult to assess

without more information on distribution, host range and natural transmission. PZSV is

vertically transmitted through seed and pollen in tomato and brassicas (Vovlas et al. 1989;

Lapidot et al. 2010), but its transmission status in Anthocercis seed is unknown.

Tobamoviruses are also transmitted vertically, although this has not been tested with

YTMMV, and tobamovirus particles are highly stable, enabling incidental transmission to

Acc

epte

d A

rtic

le


new hosts through direct contact between plants and by humans, animals, invertebrates,

vehicles, etc. Thus, the inadvertent spread of these viruses through human-mediated

transport of infected host plants or propagules such as seeds and cuttings is probably the

principle means by which they may emerge into commercial species. Identification and

characterisation of viruses from wild plants has been a neglected area of research, yet it is an

important one (Anderson et al. 2004). Studies such as this relate to how viruses harboured by

wild plants may potentially respond to new opportunities presented by changes in land use,

weather patterns and water flow, human movement and trade.

Acknowledgements

This study was funded in part by Australia Research Council Linkage grant LP110200180

and by studentships granted to JWLO and SHK by Murdoch University.

References

Anderson PK, Cunningham AA, Patel NG, Morales FJ, Epstein PR, Daszak P, 2004.

Emerging infectious disease of plants: pathogen pollution, climate change and

agrotechnology drivers. Trends in Ecology and Evolution 19, 535-544.

Anon. 1998. Western Australian Herbarium. FloraBase-the Western Australian Flora.

Department of Parks and Wildlife. [https://florabase.dpaw.wa.gov.au/]. Accessed 13

March 2015.

Barbour MG, 1970. Germination and early growth of the strand plant Cakile maritima.

Bulletin of the Torrey Botanical Club 97, 13-22.

Biccheri R, Babini AR, Blouin A, Lanzoni C, Pisi A, Poggi-Pollini C, Credi R, Laghi L,

Rocculi P, Rubies-Autonell C, Pearson MN, Ratti C, 2012. Pelargonium zonate spot

Acc

epte

d A

rtic

le


virus infecting kiwifruit plants in Italy. Proceedings 22nd International Conference on

Virus and Other Graft Transmissible Diseases of Fruit Crops, 2012. Rome, 27.

Clausing G, Vickers K, Kadereit JW, 2000. Historical biogeography in a linear system:

genetic variation of sea rocket (Cakile maritima) and sea holly (Eryngium maritimum)

along European coasts. Molecular Ecology 9, 1823–1833.

Dawson WO, Hilf ME, 1992. Host-range determinants of plant viruses. Annual Review of

Plant Physiology and Plant Molecular Biology 43, 527-555.

Escriu F, Cambra MA, Luis-Arteaga M, 2009. First report of pepper as a natural host for

Pelargonium zonate spot virus in Spain. Plant Disease 93, 1346-1346.

Finetti-Sialer M, Gallitelli D, 2003. Complete nucleotide sequence of Pelargonium zonate

spot virus and its relationship with the family Bromoviridae. Journal of General

Virology 84, 3143-3151.

Fukuda T, Kato Y, Sato H, Taran AA, 2013. Naturalization of Cakile edentula (Brassicaceae)

on the beaches of Kunashiri and Etorofu Islands – the first record for the species from

the Kuril Islands. Journal of Japanese Botany 88, 124-128.

Gallitelli D, 1982. Properties of a tomato isolate of Pelargonium zonate spot virus. Annals of

Applied Biology 100, 457-466.

Gebre-Selassie K, Delecolle B, Gognalons P, Dufour O, Gros C, Cotillon AC, Parrella G,

Marchoux G, 2002. First report of an isolate of Pelargonium zonate spot virus in

commercial glasshouse tomato crops in Southeastern France. Plant Disease 86, 1052.

Gibbs AJ, 1999. Evolution and origins of tobamoviruses. Philosophical Transactions of the

Royal Society London B 354, 593-602.

Giolitti F, Bejerman N, Nome C, Visintin G, Breuil S. de Lenardon S, 2014. Biological and

molecular characterization of an isolate of Pelargonium zonate spot virus infecting

sunflower in Argentina. Journal of Plant Pathology 96, 189-194.

Acc

epte

d A

rtic

le


Gulati-Sakhuja A, Sears JL, Nunez A, Liu HY, 2009. Production of polyclonal antibodies

against Pelargonium zonate spot virus coat protein expressed in Escherichia coli and

application for immunodiagnosis. Journal of Virological Methods 160, 29-37.

Haegi L, 1986. The affinities of Anthocercis (Solanaceae) and related genera. In: D’Arcy

WG, ed. Solanaceae: Biology and Systematics. New York: Columbia University

Press, 27-40.

Hatta T, Francki RIB, Grivell CJ, 1983. Particle morphology and cytopathology of galinsoga

mosaic virus. Journal of General Virology 64, 687-692.

Holmes FO, 1938. Inheritance of resistance to tobacco mosaic disease in tobacco.

Phytopathology 28, 553–561.

King AM, Adams MJ, Carstens EB, Lefkowitz EJ, eds, 2012. Virus taxonomy: classification

and nomenclature of viruses: Ninth Report of the International Committee on

Taxonomy of Viruses. Amsterdam, the Netherlands: Elsevier/Academic Press.

Lapidot M, Guenoune-Gelbart D, Leibman D, Holdengreber V, Davidovitz M, Machbash Z,

Klieman-Shoval S, Cohen S, Gal-On A, 2010. Pelargonium zonate spot virus is

transmitted vertically via seed and pollen in tomato. Phytopathology 100, 798-804.

Liu HY, Sears JL, 2007. First report of Pelargonium zonate spot virus from tomato in the

United States. Plant Disease 91, 633.

Luis-Arteaga M, Cambra MA, 2000. First report of natural infection of greenhouse-grown

tomato and weed species by Pelargonium zonate spot virus in Spain. Plant Disease

84, 807.

Luo H, Wylie, SJ, Jones MGK, 2010. Identification of plant viruses using one-dimensional

gel electrophoresis and peptide mass fingerprints. Journal of Virological Methods

165, 297-301.

Acc

epte

d A

rtic

le


Luo H, Wylie SJ, Coutts B, Jones RAC, Jones MGK, 2011. A virus of an isolated indigenous

flora spreads naturally to an introduced crop species. Annals of Applied Biology 159,

339-347.

Morris TJ, Dodds JA, 1979. Isolation and analysis of double-stranded RNA from virus-

infected plant and fungal tissue. Phytopathology 69, 854-858.

Ollier CD, 1995. Tectonics and landscape evolution in southeast Australia. Geomorphology

12, 37-44.

Quacquarelli A, Gallitelli D, 1979. Three viruses of Pelargonium zonale in Apulia.

Phytopathologia Mediterranea 18, 61-70.

Rodman JE, 1986. Introduction, establishment and replacement of sea-rockets (Cakile,

Cruciferae) in Australia. Journal of Biogeography 13, 159-171.

Särkinen T, Bohs L, Olmstead RG, Knapp, S, 2013. A phylogenetic framework for

evolutionary study of the nightshades (Solanaceae): a dated 1000-tip tree. BMC

Evolutionary Biology 13, 214.

Stobbe AH, Melcher U, Palmer MW, Roossinck MJ, Shen G, 2012. Co-divergence and host-

switching in the evolution of tobamoviruses. Journal of General Virology 93, 408-

418.

Vovlas C, Gallitelli D, Conti M, 1989. Preliminary evidence for an unusual mode of

transmission in the ecology of Pelargonium zonate spot virus (PZSV). IVth

International Plant Virus Epidemiology Workshop. Montpellier, France: 302-305.

Wylie SJ, Li H, Jones MGK, 2014. Yellow tailflower mild mottle virus: a new tobamovirus

described from Anthocercis littorea (Solanaceae) in Western Australia. Archives of Virology

159, 791-795.

Acc

epte

d A

rtic

le


Fig. 1. Red-striped tailflower (Anthocercis ilicifolia) plant and symptoms of plants infected

with Yellow tailflower mild mottle virus. a: A Red-striped tailflower (A. ilicifolia) plant in its

natural environment. b: Infected Nicotiana benthamiana accession RA-4 35 days post

inoculation (dpi). c: Infected tomato plant: arrow indicates leaf distortion. d: Infected chilli

plant: plant was stunted, with mosaic leaves. e: Infected N. glutinosa showing necrotic lesions

from YTMMV infection (arrow). f: Infected eggplant: plant stunted, with yellow and mosaic

leaves. g: Infected potato plant 14 dpi. Arrow indicates position of local necrotic lesions on

inoculated leaf. h: oval-shaped necrotic rings and lesions on the stem (arrow) on tamarillo. i:

tamarillo exhibiting stunting, leaf distortion, mosaic and necrotic lesions on emerging leaves.

Fig. 2. Transmission electron micrograph negatively stained showing tobamovirus-like

particles in sap from a Solanum betaceum (tamarillo) leaf infected with Yellow tailflower

mild mottle virus.

Acc

epte

d A

rtic

le


Table 1

Plants species used in this study and a comparison of responses to inoculation with Yellow

tailflower mild mottle virus isolates Kalbarri and Cervantes.

Plant species Family Common name/cultivar/line (if known)

Number of plants

tested per virus

isolate

Symptom severity index

YTMMV-Kalbarri

Symptom severity index

YTMMV-Cervantes

Allium tuberosum Amaryllidaceae

Chinese Chive 3-6 1 1

A. cepa var. aggregatum

Amaryllidaceae

Shallot 3-6 1 1

Anthocercis littoria Solanaceae Yellow tailflower 1 4

Brassica chinensisa Brassicaceae Chinese cabbage cv Pai-Tsai

3-6 1 1

Brassica napus Brassicaceae Canola 3-6 1 1

Capsicum annuum Solanaceae Bell pepper 3-6 4 4

Capsicum annuum Solanaceae Chili 3 4

Chenopodium amaranticolor

Amaranthaceae

- 5-6 2 2

Chenopodium quinoa Amaranthaceae

Quinoa 5-6 1 1

Cucumis melo Cucurbitaceae Rockmelon cv Planters Jumbo

3-6 1 1

Cucumis sativus Cucurbitaceae Cucumber cv Burpless F1

3-6 1 1

Cucurbita pepo Cucurbitaceae Squash cv White scallop

3-6 1 1

Helianthus annus Asteraceae Sunflower 3-6 1 1

Hibiscus esculentus Malvaceae Okra cv Yellow F1 3-6 1 1

Lactuca sativa Asteraceae Lettuce cv Great Lakes

3-6 1 1

Nicotiana benthamiana

Solanaceae RA-4 6-12 7 7

Nicotiana glutinosa Solanaceae - 6-9 2 2

Ocimum basilicum Lamiaceae Basil cv Gourmet 3-6 1 1

Petunia hybrida Solanaceae Petunia, Mixed cv 4 3 4

Acc

epte

d A

rtic

le


Phaseolus vulgaris Fabaceae Bean cv Blue Lake 3-6 1 1

Physalis angulata Solanaceae Balloon cherry 3 5

Physalis peruviana Solanaceae Cape gooseberry 3 4

Phyalis philadelphica Solanaceae Tomatillo 5 5

Raphanus sativus L. Brassicaceae Chinese radish 3-6 1 1

Solanum betaceum Solanaceae Tamarillo 4 5

S. lasiophyllum Solanaceae Flannel bush 3 2

S. lycopersicum Solanaceae Tomato cv Money Maker

5-6 4 4

S. lycopersicum Solanaceae Tomato cv Pomodoro Marglobe

5 4

S. melongena Solanaceae Eggplant. 1722 6 4 4

S. nigrum Solanaceae Black nightshade 3-6 3 5

S. tuberosum Solanaceae Potato cv Nadine 3 3

S. tuberosum Solanacea Potato cv Royal Blue 3 3

Zea mays Poacea Sweet corn cv Sweet bicolour F1

3-6 1 1

a YTMMV detected by RT-PCR on inoculated leaves of all inoculated plants 25 dpi, but no symptoms of local

infection or evidence of systemic infection was found.

Acc

epte

d A

rtic

le


Table 2 Comparison of pairwise identities of amino acid and nucleotide (in parentheses) sequences of open reading frames (ORF) of Pelargonium zonate spot virus isolate SW13 (red-striped tailflower, Australia, KF790760, KF790761, KF790762) with those of isolates Tomato (tomato, Italy, AJ272327, AJ272328, AJ272329), Parana (sunflower, Argentina, JQ350736, JQ350737, JQ350739), Woodman Point (sea rocket, Australia, GU046705), P-1-06 (capsicum, Spain, GQ178217), T-2-06 (tomato, Spain, GQ178216), and California (tomato, USA, EU906913).

a Met, methyltransferase domain of replicase; Hel, helicase domain of replicase; RdRp, RNA polymerase domain of replicase; MP, movement protein; CP, capsid protein.

b Partial ORF sequence

ORFa PZSV-Tomato

PZSV-Parana

PZSV Woodman Pointb

PZSV P-1-06b

PZSV T-2-06b

PZSV-California

RNA 1a (Met, Hel)

89 (89) 95 (96) - - - -

RNA 2a (RdRp)

97 (95) 98 (97) - - - -

RNA 3a (MP)

97 (96) 99 (98) 100 (100) 97 (94) 97 (94) -

RNA 3b (CP)

95 (92) 98 (98) - - - 95 (93)

Acc

epte

d A

rtic

le


yellow tailflower mild mottle virus and pelargonium...

Documents