yan at at san eejit 2013

8/20/2019 Yan at at San Eejit 2013

http://slidepdf.com/reader/full/yan-at-at-san-eejit-2013 1/7

XRCC1 gene polymorphisms and risk of ameloblastoma

Pattamawadee Yanatatsaneejit a, Titiporn Boonsuwan a, Apiwat Mutirangura b,Nakarin Kitkumthorn c ,* a Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok 10330, ThailandbCenter of Excellence in Molecular Genetics of Cancer and Human Diseases, Department of Anatomy, Faculty of Medicine,

Chulalongkorn University, Bangkok 10330, ThailandcDepartment of Oral and Maxillofacial Pathology, Faculty of Dentistry, Mahidol University, Bangkok 10400, Thailand

1. Introduction

Ameloblastoma is a common benign odontogenic tumour

which frequently occurs in maxillary and mandibular bone.

This tumour is found in young adult male and female in the

median age of 35 years old.1–6 Although ameloblastoma is a

benign tumour and rarelymetastasis, it is locally aggressiveby

infiltrating and destroying surrounding bone tissue resulting

in symptoms that includes swelling, facial deformity, loose

teeth, and these can be associated without pain that can

progress to pain.7–9 Ameloblastoma has a high recurrent rate,

thus after treatment by wild excision, long term follow up

should be arranged.6,9,10 Ameloblastoma is mainly classified

into multicystic, peripheral, desmoplastic and unicystic

type.6–8 Multicystic and unicystic type are the most common

of intrabony. Notably, the multicystic type is the most

aggressive form, in comparison to the unicystic.8 It is also

believed that ameloblastoma can transform to ameloblastic

carcinoma.11

Various genetic alterations can lead to tumour formation.

Normally, cells have an inherent ability to correct these

changes unless their repair function is decreased or defective.

Polymorphism of repair genes is one of the leading causes

a r c h i v e s o f o r a l b i o l o g y 5 8 ( 2 0 1 3 ) 5 8 3 – 5 8 9

a r t i c l e i n f o

Article history:

Accepted 21 October 2012

Keywords:

Ameloblastoma

XRCC-1

Polymorphism

a b s t r a c t

Objective: Ameloblastoma is a common benign odontogenic tumour with inherently ag-

gressive behaviour. Genetic susceptibility of single nucleotide polymorphism (SNP) can

likely predictameloblastoma at riskpatients butthis dataremains limited. Here, we studied

XRCC1 polymorphism as a risk factor for ameloblastoma.

Design: Eighty-two ameloblastoma samples and blood from 140 healthy controls were used

to perform polymerase chain reaction–restriction fragment length polymorphism (PCR–

RFLP) for XRCC1 at codons 194, 280 and 399, and confirmed by sequence analysis.

Results: Compare to healthy control, a significant increase was noted in the occurrence of

polymorphism at codon 194 and 399 in ameloblastoma patients. At codon 194, tryptophan

encoded by T, was the susceptibility allele showed an ODD ratio of (95% CI) = 1.62 (1.05–2.48),

p = 0.027. At codon 399,glycine encoded by A wasthe susceptibility allele showing ODD ratio

of (95% CI) = 1.83 (1.19–2.84), p = 0.005. Moreover at codon 399, we found AG as the suscepti-bility genotype (2.06 (1.14–3.72), p = 0.015). However, we did not find any significant increase

in polymorphic occurrence in ameloblastoma patients at codon 280. For haplotype analysis

of 3 codons, we found GGC as protective haplotype, and AGT as the risk haplotype.

Conclusion: Our data suggestthat polymorphism at codons 194 and 399,likely contributes to

the risk of developing ameloblastoma.

# 2012 Elsevier Ltd. All rights reserved.

* Corresponding author. Tel.: +66 2203 6470; fax: +66 2203 6470.E-mail addresses: [email protected], [email protected] (N. Kitkumthorn).

Available online at www.sciencedirect.com

journal homepage: http://www.elsevier.com/locate/aob

0003–9969/$ – see front matter # 2012 Elsevier Ltd. All rights reserved.

http://dx.doi.org/10.1016/j.archoralbio.2012.10.016


mailto:[email protected]


http://www.sciencedirect.com/science/journal/00039969



http://www.sciencedirect.com/science/journal/00039969






impacting repair function. In this context, the X-ray Repair

Cross-Complementing gene (XRCC1) encodes for one of DNA

repair proteins (XRCC1), playing a crucial role in base excision

repair (BER) pathway. There are many steps and proteins

involved in this pathway to remove small, non-helix-distort-

ing base lesions from the genome. XRCC1 which is one of BER

proteins essentially acts as a scaffold protein interacting with

several repair proteins, for example DNA polymerase b, ligaseIII, APEI and PARP.12,13

Single nucleotide polymorphisms (SNP) of XRCC1 have

been widely studied, especially Arg194Trp, Arg280His and

Arg399Gln which have been reported to be involved in

susceptibility to several cancers, such as colon,14 lung,15

cervix,16 bladder,17 gastric,18 and prostate.19

Ameloblastoma has a high recurrent rate and surgery is the

most common treatment strategy, leading to facial malfunc-

tion and discomfort impacting quality of life. Therefore, a

genetic test to screen patients at risk for ameloblastoma

susceptibility may be important for understanding the

biological basis of disease progression, leading to the

development of effective drug therapy for treatment andprevention. With no evidence of an association between

XRCC1 and ameloblastoma, we sought to investigate poly-

morphisms of XRCC1 in ameloblastoma prevalent in a Thai

population. In this regard, we hypothesized that, Tryp at

codon 194, His at codon 280 and Gln at codon 399 may

represent allelic risk, essentially as these are minor alleles,

and numerous studies have revealed that they are associated

with several cancers.20 Thus the investigation of the associa-

tion between allele frequency of the three polymorphisms as

susceptibility allele and ameloblastoma can hold potential for

disease diagnosis and prevention in Thai population in the

future.

2. Materials and methods

2.1. Patient samples and DNA extraction

Eighty-two paraffin embedded tissues, pathologically diag-

nosed with ameloblastoma were collected between 2002 and

2011, and obtained from the Faculty of Dentistry, Mahidol

University. Clinical and radiological data were obtained from

patient’s file. For the control group, subjects undergoing

routine health examination and those assessed to be free of

cancer were enrolled for the study. After obtaining written

informed consent, 6 mL of peripheral blood wascollected from

140 healthy Thai populations, who matched to the amelo-

blastoma group with respect to age, sex and nationality.

Each ameloblastoma case underwent H&E histopatholog-

ical evaluation prior to analysis, and those sections consisting

at least of 80% tumour cells were included in the study. For

analysis, 3–5 sections of 5 mM thick were collected in the

microtube underwent DNA isolation using the DNA QIAamp

DNA FFPE tissue (Qiagen, CA, USA). DNA from the peripheralblood of each subject was extracted by proteinase K and

incubated overnight at 50 8C followed by phenol/chloroform

extraction and ethanol precipitation. Finally, the purified

genomicDNA was elutedand stored at20 8C untilneeded for

use as a template in genotyping analysis.

2.2. XRCC1 genotyping

DNA extracted from both ameloblastomas and healthy

controls underwent genotyping of XRCC1 at codons 194, 280

and 399 by PCR–RFLP (polymerase chain reaction–restriction

fragment length polymorphism). The sequence of primers,

and restriction enzymes used for genotyping are shown inTable 1. SNP at codon 194 can be CGG, encoding a major allele

arginine, or TGG, encoding the minor allele tryptophan.

Whereas SNP at codon 280 can be CGT, encoding a major

allele arginine, or CAT, encoding the minor allele histidine.

Finally, SNP at codon 399 can be CGG, encoding major allele

arginine, or CAG encoding minor allele glycine. The PCR–RFLP

gel electrophoresis was demonstrated in Figs. S1–S3. All

experiments were performed in duplicate, and double blind.

Ten percent of genotyping results were randomly confirmed

by sequence analysis.

Supplementary data associated with this article can be

found, in the online version, at doi:10.1016/j.archoral-

bio.2012.10.016.

2.3. Statistical analysis

Hardy–Weinberg equilibrium calculator was used for asses-

sing the consistency of genotype frequencies among normal

control. Allele and genotype frequency were compared

between patient and control groups. ODDS ratio (OR) and

95% confidence interval (CI) were used as parameters to

compare the frequency of SNP as risk factors in ameloblas-

toma. OR > 1 and 95% CI excluding 1 together with p value

<0.05 indicates a positive association or increase risk between

the SNP allele and ameloblastoma. Three SNPs were analysed

Table 1 – Primer sequences, restriction enzymes and product sizes of PCR–RFLP at XRCC1 codons 194, 280 and 399.

Codon (rs no.) Primer sequence Enzyme for RFLP Product size (b.p.)

194 (1799782) Forw ard: AGAAGGTGACAGTGACCAAG PvuII Uncut: 131

Reverse: ACGTTGTCCGAGCTCACCT Cut: 40 and 91

280 (25489) Forward: TTGACCCCCAGTGGTGCT RsaI Uncut: 133

Reverse: TGCCTTCTCCTCGGGGTTT Cut: 63 and 70

399 (25487) Forward: CCCCAAGTACAGCCAGGTC MspI Uncut: 142

Reverse: CCCAGCACAGGATAAGGAGC Cut: 48 and 94




for haplotype blocks. The PLINK v1.07 program21 was used for

performing the statistical analysis. Percentage of coefficient of

variance (% CV) was used to analyse the distribution of density

of the PCR band of each heterozygous sample to demonstrate

that there was no mosaisicm from the oral epithelium and

connective tissue (% CV 10, indicated that there was no

distribution of data).

3. Results

3.1. Genotyping of SNP of XRCC1 at codons 194, 280 and

399

The genotypic data is summarized in Tables 2–4. Essential-

ly, this study demonstrated that the frequency of Arg/Arg,

Trp/Trp and Arg/Trp genotype at codon 194, were 40.24%,

17.07% and 42.68%, respectively, in ameloblastomas.

Whereas in healthy controls, these were 52.86%, 8.57%

and 38.57%, respectively. At codon 280, the genotype Arg/

Arg, His/His and Arg/His were at a frequency of 70.73%,3.66% and 25.61%, respectively, in ameloblastomas, and

73.57%, 4.29% and 22.14%, respectively, in healthy controls.

Finally at codon 399, the genotype Arg/Arg, Gln/Gln and

Arg/Gln were 32.93%, 12.20% and 54.88% in ameloblasto-

mas, and 55.00%, 7.86% and 34.17%, respectively, in healthy

controls. Thedistribution of thegenotype of codons 194, 280

and 399 among the controls was in the Hardy–Weinberg

equilibrium ( p > 0.05).

3.2. SNP analysis of XRCC1 at codons 194, 280 and 399

The raw data and allele frequency between ameloblastomas

and healthy controls are shown in Tables 2–4, and genotyping

data are concluded in Table 5. The data indicated that there

was a significant risk association of SNP at codons 194and 399.

At codon 194, OR (95% CI) was 1.62 (1.05–2.48), p = 0.027 among

ameloblastomas with T as the susceptibility allele. The OR(95% CI) of unicystic and conventional type of ameloblastoma

with T susceptibility allele, was 1.82 (0.91–3.63) and 1.54 (0.95–

2.49), respectively. The OR (95% CI) of genotypic frequency,

with TT as the susceptibility genotype was2.20 (0.9–5.41) while

CT as the susceptibility genotype was 1.19 (0.66–2.14).

At codon 399, OR (95% CI) was 1.83 (1.19–2.84), p = 0.005

among ameloblastomas with A as the susceptibility allele.The

OR (95% CI) of unicystic and conventional type of ameloblas-

toma with A susceptibility allele was 1.35 (0.65–2.76) and 2.05

(1.27–3.30), respectively. The OR (95% CI) of genotypic

frequency, AA as the susceptibility genotype was 1.63

(0.61–4.37) while AG as the susceptibility genotype was 2.06

(1.14–3.72).However, there wasinsignificance at codon 280,OR (95%CI)

was 1.09 (0.62–1.89), p = 0.862 among ameloblastoma with A

susceptibility allele. The OR (95% CI) of unicystic and

conventional type of ameloblastoma with A susceptibility

allele was 1.34 (0.56–3.15) and 0.99 (0.52–1.87), respectively.

The OR (95% CI) of genotypic frequency, AA as the suscepti-

bility genotype was 0.85 (0.16–3.96) while GA as the suscepti-

bility genotype was 1.21 (0.61–2.40).

Table 2 – XRCC1 codon 194 polymorphisms in ameloblastoma patients and control subjects.Groups No. of

samplesAve.age

XRCC1 genotypes [n (%)] Allele frequency [n (%)] Allelic testOR

(95% CI)

p value

Arg Hetero Trp C T

C/C C/T T/T

Controls 140 30.8 74 (52.86%) 54 (38.57%) 12 (8.57%) 202 (72.14%) 78 (27.86%) Ref.

Sex

Male 71 (50.71%) 29.9 38 (53.52%) 27 (38.03%) 6 (8.45%) 103 (72.54%) 39 (27.46%) Ref.

Female 69 (49.29%) 31.43 36 (52.17%) 27 (39.13%) 6 (8.70%) 99 (71.74%) 39 (28. 26%) Ref.

Ameloblastomas 82 35.96 33 (40.24%) 35 (42.68%) 14 (17.07%) 101 (61.59%) 63 (38.41%) 1.62 (1.05–2.48) 0.027

Sex

Male 41 (50%) 41.54 20 (48.78%) 14 (34.15%) 7 (17.07%) 54 (65.85%) 28 (34.15%) 1.37 (0.73–2.57) 0.367

Female 41 (50%) 31.39 13 (31.71%) 21 (51.22%) 7 (17.07%) 47 (57.32%) 35 (42. 68%) 1.89 (1.02–3.49) 0.041Adjust OR 1.61 (1.05–2.48) 0.028

Clinical types

Unicystic type 23 35.96 7 (30.44%) 13 (56.52%) 3 (13.04%) 27 (58.70%) 19 (41. 30%) 1.82 (0.91–3.63) 0.093

Sex

Male 12 (52.17%) 41.54 4 (33.33%) 7 (58.34%) 1 (8.33%) 15 (62.50%) 9 (37.50%) 1.58 (0.58–4.25) 0.447

Female 11 (47.83%) 31.39 3 (27.27%) 6 (54.55%) 2 (18.18%) 12 (54.55%) 10 (45. 45%) 2.12 (0.77–5.79) 0.168

Adjust OR 1.83 (0.91–3.63) 0.094

Conventional type 59 26 (44.07%) 22 (37.29%) 11 (18.64%) 74 (62.71%) 44 (37. 29%) 1.54 (0.95–2.49) 0.081

Sex

Male 29 (49.15%) 41.54 15 (51.72%) 8 (27.59%) 6 (20.69%) 38 (65.52%) 20 (34. 48%) 1.39 (0.69–2.81) 0.414

Female 30 (50.85%) 31.39 11 (36.67%) 14 (46.67%) 5 (16.66%) 36 (60.00%) 24 (40. 00%) 1.69 (0.85–3.35) 0.143

Adjust OR 1.54 (0.95–2.49) 0.082

OR: odd ratio; CI: confidence interval.

a r c h i v e s o f o r a l b i o l o g y 5 8 ( 2 0 1 3 ) 5 8 3 – 5 8 9 585



Table 3 – XRCC1 codon 280 polymorphisms in ameloblastoma patients and control subjects.

Groups No. of samples

Ave.age

XRCC1 genotypes [n (%)] Allele frequency [n (%)] Allelic testOR

(95% CI)

p value

Arg Hetero His G A

G/G G/A A/A

Controls 140 30.8 103 (73.57%) 31 (22.14%) 6 (4.29%) 237 (84.64%) 43 (15.36%) Ref.

Sex

Male 71 (50.71%) 29.9 56 (78.87%) 11 (15.49%) 4 (5.63%) 123 (86.62%) 19 (13.38%) Ref.

Female 69 (49.29%) 31.43 47 (68.12%) 20 (28.99%) 2 (2.90%) 114 (82.61%) 24 (17.39%) Ref.

Ameloblastomas 82 35.96 58 (70.73%) 21 (25.61%) 3 (3.66%) 137 (83.54%) 27 (16.46%) 1.09 (0.62–1.89) 0.862

Sex

Male 41 (50%) 41.54 29 (70.73%) 9 (21.95%) 3 (7.32%) 67 (81.71%) 15 (18.29%) 1.45 (0.65–3.22) 0.427

Female 41 (50%) 31.39 29 (70.73%) 12 (29.27%) 0 (0.00%) 70 (85.37%) 12 (14.63%) 0.81 (0.36–1.83) 0.729

Adjust OR 1.09 (0.62–1.89) 0.864

Clinical types

Unicystic type 23 35.96 15 (65.22%) 7 (30.43%) 1 (4.35%) 37 (80.43%) 9 (19.57%) 1.34 (0.56–3.15) 0.613

Sex

Male 12 (52.17%) 41.54 9 (75.00%) 2 (16.67%) 1 (8.33%) 20 (83.33%) 4 (16.67%) 1.29 (0.33–4.63) 0.911

Female 11 (47.83%) 31.39 6 (54.55%) 5 (45.45%) 0 (0.00%) 17 (77.27%) 5 (22.73%) 1.40 (0.40–4.57) 0.76

Adjust OR 1.35 (0.56–3.17) 0.606

Conventional type 59 43 (72.88%) 14 (23.73%) 2 (3.39%) 100 (84.75%) 18 (15.25%) 0.99 (0.52–1.87) 0.899

Sex

Male 29 (49.15%) 41.54 19 (65.52%) 8 (27.59%) 2 (6.89%) 46 (79.31%) 12 (20.69%) 1.69 (0.71–4.01) 0.279

Female 30 (50.85%) 31.39 24 (80.00%) 6 (20.00%) 0 (0.00%) 54 (90.00%) 6 (10.00%) 0.53 (0.18–1.46) 0.263

Adjust OR 0.99 (0.52–1.87) 0.898


Table 4 – XRCC1 codon 399 polymorphisms in ameloblastoma patients and control subjects.

Groups No. of samples

Ave.age

XRCC1 genotypes [n (%)] Allelefrequency[n (%)] Allelic test OR (95% CI) p value

Arg Hetero Gln G A

G/G G/A A/A

Controls 140 30.8 77 (55.00%) 52 (37.14%) 11 (7.86%) 206 (73.57%) 74 (26. 43%) Ref.

Sex

Male 71 (50.71%) 29.9 47 (66.20%) 20 (28.17%) 4 (5.63%) 114 (80.28%) 28 (19.72%) Ref.

Female 69 (49.29%) 31.43 30 (43.48%) 32 (46.38%) 7 (10.14%) 92 (66.67%) 46 (33.33%) Ref.

Ameloblastomas 82 35.96 27 (32.93%) 45 (54.88%) 10 (12.20%) 99 (60.37%) 65 (39.63%) 1.83 (1.19–2.81) 0.005

Sex

Male 41 (50%) 41.54 16 (39.02%) 21 (51.22%) 4 (9.76%) 53 (64.63%) 29 (35.37%) 2.23 (1.15–4.31) 0.015

Female 41 (50%) 31.39 11 (26.83%) 24 (58.54%) 6 (14.63%) 46 (56.10%) 36 (43. 90%) 1.57 (0.86–2.85) 0.154Adjust OR 1.84 (1.19–2.84) 0.005

Clinical types

Unicystic type 23 35.96 8 (34.78%) 15 (65.22%) 0 (0.00%) 31 (67.39%) 15 (32.61%) 1.35 (0.65–2.76) 0.488

Sex

Male 12 (52.17%) 41.54 5 (41.67%) 7 (58.33%) 0 (0.00%) 17 (70.83%) 7 (29.17%) 1.68 (0.57–4.84) 0.435

Female 11 (47.83%) 31.39 4 (36.36%) 7 (63.64%) 0 (0.00%) 15 (68.18%) 7 (31.82%) 0.93 (0.32–2.66) 0.917

Adjust OR 1.23 (0.58–2.58) 0.677

Conventional type 59 19 (32.20%) 30 (50.85%) 10 (16.95%) 68 (57.63%) 50 (42. 37%) 2.05 (1.27–3.30 0.002

Sex

Male 29 (49.15%) 41.54 9 (31.04%) 16 (55.17%) 4 (13.79%) 34 (58.62%) 24 (41. 38%) 2.87 (1.40–5.91) 0.002

Female 30 (50.85%) 31.39 8 (26.67%) 16 (53.33%) 6 (20.00%) 32 (53.33%) 28 (46. 67%) 1.75 (0.90–3.40) 0.104

Adjust OR 2.19 (1.36–3.56) 0.001





3.3. Haplotype analysis

Haplotype analysis of SNP at codons 194, 280 and 399 was

performed. Haplotype GGT, AGC andGGC were found as major

haplotypes as shown in Table 6. GGC was found as protective

haplotype, and this frequency haplotype in ameloblastoma

was 21.62% whereas in controls, this was 37.61%, p = 0.0005.

Furthermore, the minor allele haplotype (AGT) was found as

risk haplotype, with a frequency in ameloblastoma of 10.37%,and 2.87% ( p = 0.0009) in controls (Table 6).

3.4. Model of inheritance

Model of inheritance in each of the three codons of XRCC1

were analysed as following.

At codon 194, when the mode of inheritance was dominant,

theOR(95%CI)ofCCorCTwas1.66(0.92–3.00),sexadjusted1.66

(0.92–3.01). Whenthe modeof inheritance wasrecessive, the OR

(95% CI) of TT was 2.61 (0.88–5.33), sex adjusted 2.20 (0.90–5.41).

For codon 280, when the mode of inheritance was

dominant, the OR (95% CI) of AA or AG was 1.15 (0.60–2.20),

sex adjusted 1.15 (0.60–2.21). When the mode of inheritancewas recessive, the OR (95% CI) of AA was 0.85 (0.16–3.96), sex

adjusted 0.85 (0.16–4.04).

For codon 399, when the mode of inheritance was

dominant, the OR (95% CI) of AA or AG was 2.49 (1.36–4.58),

sex adjusted 2.55 (1.38–4.79). When the mode of inheritance

was recessive, the OR (95% CI) of AA was 1.63 (0.61–4.37).

3.5. Distribution of PCR density band of heterozygous

samples

To confirm that there was no mosaisicm from the oral

epithelium and adjacent connective tissue, we randomly

measured the percentage of density of 3 PCR band from 35

heterozygous samples at codon 194 (C, T at 40 b.p. and T at 91

b.p.), 21 heterozygous samples at codon 280 (A, G at 63 b.p. andG at70 b.p.) and 15 heterozygous samples at codon 399 (A, G at

48 b.p. and G at 94 b.p.). At codon 194, the % coefficient of

variance (CV) of C band, T band at 40 b.p. and T band at 91 b.p.

were 2.55,8.36and 9.85, respectively. At codon 280, the % CV of

A band, G band at 63 b.p. and G band at 70 b.p. were 4.04, 6.40

and 7.61, respectively. Finally, at codon 399, the % CV of A

band, G bandat 48b.p. and G bandat 94b.p. were3.40,4.05 and

6.51, respectively. The density average, standard deviation

(SD) and % CV of each band were shown in Table 7.

4. Discussion

Early-stage ameloblastoma is difficult to diagnose because it

displays mild or nonspecific clinical symptoms. Hence, the

analysis of potential genetic risk factors for the prediction of

ameloblastoma in patients without clinical symptoms is likely

to be a valuable diagnostic strategy. In our previous study, we

revealed a significant association between ameloblastoma

and polymorphism of p53 at codon 72.22 Not only Arg allele of

P53 at codon 72, CGG8 repeat allele of PTCH1 can also be the

risk for ameloblastoma.22,23 In this study, we found a

significant association between ameloblastoma and XRCC1

polymorphism. XRCC1 gene encodes XRCC1 protein, playing

an important role in BER pathway.

BER pathway is important for keeping stability of cells,essentially by removing small damaged bases from the

genome and replace with normal bases. Several proteins

are responsible for BER including XRCC1 playing a crucial

role in this process. XRCC1 essentially acts as a scaffold

protein which can bind to many other proteins in the

repair process, and these include DNA polymerase b, APE1,

ligase III, PARP1 and PARP2.12 Many studies have focused

on 3 polymorphisms in XRCC1, codon 194, 280 and 399.

Codon 194 lies at the N-terminal, and readily binding with

DNA polymerase b,24,25 while codon 399 lies within the

BRCT1 domain and binding with APE1, PARP1 and

PARP2.26,27 Hence, polymorphism at these codons might

be expected to impact the function and the ability to

Table 5 – OR (95% CI) of genotypic frequency at codon 194,280 and 399 of XRCC1 in ameloblastoma patients andcontrol subjects.

Codon Genotype OR (95% CI) p value

194 TT 2.20 (0.9–5.41) 0.092

CT 1.19 (0.66–2.14) 0.645

280 AA 0.85 (0.16–3.96) 0.901

GA 1.21 (0.61–2.40) 0.671

399 AA 1.63 (0.61–4.37) 0.407

AG 2.06 (1.14–3.72) 0.015

Table 6 – Haplotype analysis showing the protective andrisk haplotypes for ameloblastoma.

Haplotype Haplotype frequency p value

Ameloblastomas Healthy controls

AAT NA NA 0.0022

GAT 0.0302 0.0273 0.8581

AGT 0.1037 0.0287 0.0009

GGT 0.2502 0.2226 0.5063

AAC 0.0274 0.0166 0.4401

GAC 0.1071 0.1097 0.9315

AGC 0.2653 0.219 0.2681

GGC 0.2162 0.3761 0.0005

Table 7 – Density average, standard deviation andcoefficient variation of heterozygous samples at codon194, 280 and 399.

Densityaverage (%)

Standarddeviation

Coefficient of variance (%)

Codon 194

C band 66.7 1.7 2.55

T band at 91 b.p. 19.58 1.64 8.36T band at 40 b.p. 13.71 1.35 9.85

Codon 280

A band 34.09 1.38 4.04

G band at 70 b.p. 33.2 2.13 6.4

G band at 63 b.p. 32.7 2.49 7.61

Codon 399

A band 37.81 1.29 3.4

G band at 94 b.p. 32.19 1.3 4.05

G band at 48 b.p. 30 1.95 6.51




interact with these proteins. In contrast, codon 280 lies

between the N-terminal and BRCT1 domain, and with

function that remains unknown. Here, we studied poly-

morphism of XRCC1 at codons 194, 280 and 399. Interest-

ingly, we found significant association between allele risk

at codon 194 (T) and 399 (A), and ameloblastoma. Moreover,

the 399 allele A was prominent associated with the

conventional type of ameloblastoma rather than theunicystic type. We also found that genotype AG (Arg/Gln)

at codon 399 was the risk genotype in ameloblastoma,

whereas genotype TT (Trp/Trp) and CT (Arg/Trp) at codon

194 were trend to be genotypic risks in ameloblastoma. In

this context, many studies have shown the association of

codon 399 polymorphism, and cancer risk in Asian

populations such as lung cancer in Korean,28 oesophageal

squamous cell carcinoma (ESCC) in Chinese,29 and gastric

cancer in Chinese.30 Importantly, some studies have found

that codon 399 of XRCC1 was related to the risk to cancer in

Asian and Western population.31,32

Association studies of codon 194 have been controversial,

with some indicating that T allele was a risk factor in cancerwhile others revealed that T was the protective allele.17,33 In

our study, we found that T was the risk allele of ameloblas-

toma. Moreover, we found the genotype TT and CT with an

increased risk, although this was not statistically significant.

At codon 280, frequency of allele T is low (0.13 in Asians and

0.07 in Caucasians).20 This may be due to limitation of the

sample size of our study, and hence we cannot find significant

association between allele T as susceptibility allele and

ameloblastoma. In our study, we suggest that allele T at

codon 194 and allele A at codon 390 might be the risk allele of

ameloblastoma. In addition, from our data suggest that

genotype AG at codon 399 could be genotypic risk, but we

cannot conclude that CT or TT at codon 194 as the genotypicrisks. We conclude that XRCC1 SNP at codon 399 is more

influential than at codon 194 in ameloblastoma in Thai

population.

Finally, the data from haplotype analysis of the three

codons, we found both protective andrisk haplotype. GGC was

found as protective haplotype whereas AGT was found as risk

haplotype. We noted that both protective and risk haplotype

consisted of allele G at codon 280, and therefore likely

confirming that codon 280 was not involved in ameloblastoma

in Thai population. Taken together, we conclude that XRCC1

could be one of the useful molecular markers for ameloblas-

toma diagnosis in Thai population.

Funding

This study was financially supported by Research Chair Grant

2011 from the National Science and Technology Development

Agency (NSTDA), Thailand, TRF-MRG young scientific re-

searcher grant No. MRG 5380010, and research fund from the

Faculty of Science, Chulalongkorn University.

Competing interests

The authors declare that they have no conflict of interest.

Ethical approval

The research protocol was approved by the Institutional

Review Board of the Faculty of Medicine, Chulalongkorn

University (IRB 093/54).

Acknowledgements

The authors thank Mr. Dusit Bumalee for help in preparing the

tissue samples and Dr. Viomesh Patel (NIDCR/NIH) for

critically reviewing the manuscript.

r e f e r e n c e s

1. Fernandes AM, Duarte EC, Pimenta FJ, Souza LN, Santos VR,Mesquita RA, et al. Odontogenic tumors: a study of 340 casesin a Brazilian population. Journal of Oral Pathology and

Medicine 2005;34(10):583–7.2. Ladeinde AL, Ajayi OF, Ogunlewe MO, Adeyemo WL, Arotiba

GT, Bamgbose BO, et al. Odontogenic tumors: a review of 319cases in a Nigerian teaching hospital. Oral Surgery Oral

Medicine Oral Pathology Oral Radiology and Endodontics

2005;99(2):191–5.3. Luo HY, Li TJ. Odontogenic tumors: a study of 1309 cases

in a Chinese population. Oral Oncology 2009;45(8):706–11.

4. Ebenezer V, Ramalingam B. A cross-sectional survey of prevalence of odontogenic tumours. Journal of Maxillofacial

and Oral Surgery 2010;9(4):369–74.5. Osterne RL, Brito RG, Alves AP, Cavalcante RB, Sousa FB.

Odontogenic tumors: a 5-year retrospective studyin a Brazilian population and analysis of 3406 cases

reported in the literature. Oral Surgery Oral Medicine OralPathology Oral Radiology and Endodontics 2011;111(4):474–81.

6. Barnes L, Reichart EJ, Sidransky PD. World Health Organization

classification of tumours. Pathology and genetics of head and neck

tumours. Lyon: IARC Press; 2005.7. Mendenhall WM, Werning JW, Fernandes R, Malyapa RS,

Mendenhall NP. Ameloblastoma. American Journal of Clinical

Oncology 2007;30(6):645–8.8. Reichart PA, Philipsen HP, Sciubba JJ. The new classification

of head and neck tumours (WHO)—any changes? Oral

Oncology 2006;42(8):757–8.9. Carlson ER, Marx RE. The ameloblastoma: primary, curative

surgical management. Journal of Oral and Maxillofacial Surgery

2006;64(3):484–94.

10. Eckardt AM, Kokemuller H, Flemming P, Schultze A.Recurrent ameloblastoma following osseousreconstruction—a review of twenty years. Journal of Cranio-

Maxillo-Facial Surgery 2009;37(1):36–41.11. Abiko Y, Nagayasu H, Takeshima M, Yamazaki M,

Nishimura M, Kusano K, et al. Ameloblastic carcinomaex ameloblastoma: report of a case-possible involvementof CpG island hypermethylation of the p16 gene inmalignant transformation. Oral Surgery Oral Medicine Oral

Pathology Oral Radiology and Endodontics 2007;103(1):72–6.

12. Hoeijmakers JH. Genome maintenance mechanisms forpreventing cancer. Nature 2001;411(6835):366–74.

13. Li Y, Marion MJ, Zipprich J, Freyer G, Santella RM, Kanki C,et al. The role of XRCC1 polymorphisms in base excision

repair of etheno-DNA adducts in French vinyl chloride




workers. International Journal of Occupational Medicine and

Environmental Health 2006;19(1):45–52.14. Yin G, Morita M, Ohnaka K, Toyomura K, Hamajima N,

Mizoue T, et al. Genetic polymorphisms of XRCC1, alcoholconsumption, and the risk of colorectal cancer in Japan.

Journal of Epidemiology 2012;22(1):64–71.15. Schneider J, Classen V, Helmig S. XRCC1 polymorphism and

lung cancer risk. Expert Review of Molecular Diagnostics

2008;8(6):761–80.16. Roszak A, Lianeri M, Jagodzinski PP. Involvement of the

XRCC1 Arg399Gln gene polymorphism in the developmentof cervical carcinoma. International Journal of Biological

Markers 2011;26(4):216–20.17. Wang C, Sun Y, Han R. XRCC1 genetic polymorphisms and

bladder cancer susceptibility: a meta-analysis. Urology

2008;72(4):869–72.18. Xue H, Ni P, Lin B, Xu H, Huang G. X-ray repair cross-

complementing group 1 (XRCC1) genetic polymorphismsand gastric cancer risk: a HuGE review and meta-analysis.American Journal of Epidemiology 2011;173(4):363–75.

19. Wei B, Zhou Y, Xu Z, Ruan J, Zhu M, Jin K, et al. XRCC1Arg399Gln and Arg194Trp polymorphisms in prostatecancer risk: a meta-analysis. Prostate Cancer and Prostatic

Diseases 2011;14(3):225–31.20. Qu T, Morimoto K. X-ray repair cross-complementing group

1 polymorphisms and cancer risks in Asian populations: amini review. Cancer Detection and Prevention 2005;29(3):215–20.

21. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA,Bender D, et al. PLINK: a tool set for whole-genomeassociation and population-based linkage analyses.American Journal of Human Genetics 2007;81(3):559–75.

22. Kitkumthorn N, Yanatatsaneejit P, Rabalert J,Dhammawipark C, Mutirangura A. Association of P53 codon72 polymorphism and ameloblastoma. Oral Diseases

2010;16(7):631–5.23. Kawabata T, Takahashi K, Sugai M, Murashima-Suginami A,

Ando S, Shimizu A, et al. Polymorphisms in PTCH1 affect

the risk of ameloblastoma. Journal of Dental Research2005;84(9):812–6.

24. Marintchev A, Robertson A, Dimitriadis EK, Prasad R, WilsonSH, Mullen GP. Domain specific interaction in the XRCC1–DNA polymerase beta complex. Nucleic Acids Research

2000;28(10):2049–59.25. Bhattacharyya N, Banerjee S. A novel role of XRCC1 in the

functions of a DNA polymerase beta variant. Biochemistry

2001;40(30):9005–13.26. Schreiber V, Ame JC, Dolle P, Schultz I, Rinaldi B, Fraulob V,

et al. Poly(ADP-ribose) polymerase-2 (PARP-2) is required forefficient base excision DNA repair in association with PARP-1 and XRCC1. Journal of Biological Chemistry

2002;277(25):23028–36.27. Vidal AE, Boiteux S, Hickson ID, Radicella JP. XRCC1

coordinates the initial and late stages of DNA abasic siterepair through protein–protein interactions. EMBO Journal

2001;20(22):6530–9.28. Park JY, Lee SY, Jeon HS, Bae NC, Chae SC, Joo S, et al.

Polymorphism of the DNA repair gene XRCC1 and risk of primary lung cancer. Cancer Epidemiology Biomarkers and

Prevention 2002;11(1):23–7.29. Yu HP, Zhang XY, Wang XL, Shi LY, Li YY, Li F, et al. DNA

repair gene XRCC1 polymorphisms, smoking, andesophageal cancer risk. Cancer Detection and Prevention

2004;28(3):194–9.30. Shen H, Xu Y, Qian Y, Yu R, Qin Y, Zhou L, et al.

Polymorphisms of the DNA repair gene XRCC1 and risk of gastric cancer in a Chinese population. International Journal

of Cancer 2000;88(4):601–6.31. Zhou W, Liu G, Miller DP, Thurston SW, Xu LL, Wain JC, et al.

Polymorphisms in the DNA repair genes XRCC1 and ERCC2,smoking, and lung cancer risk. Cancer Epidemiology

Biomarkers and Prevention 2003;12(4):359–65.32. Divine KK, Gilliland FD, Crowell RE, Stidley CA, Bocklage TJ,

Cook DL, et al. The XRCC1 399 glutamine allele is a riskfactor for adenocarcinoma of the lung. Mutation Research

2001;461(4):273–8.33. Chen S, Tang D, Xue K, Xu L, Ma G, Hsu Y, et al. DNA repair

gene XRCC1 and XPD polymorphisms and risk of lung

cancer in a Chinese population. Carcinogenesis2002;23(8):1321–5.


yan at at san eejit 2013

Documents