xian wen tan thesis - swinburne research bank | openequella
TRANSCRIPT
![Page 1: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/1.jpg)
I
Extraction and Analysis of Antioxidant Capacity
in Rice Bran Extracts from Different Sarawak
Local Rice Varieties
By
Tan Xian Wen
A thesis submitted to the
Faculty of Engineering, Computing and Science,
Swinburne University of Technology Sarawak Campus,
Malaysia
in fulfilment of the requirements for the degree of
Master of Science by Research
2015
![Page 2: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/2.jpg)
II
Abstract
Sarawak is blessed with many different local rice varieties. However, the
nutritional contents and value-added processing possibilities of these local rice
varieties remain underexplored. This research project was conducted to extract
and assess natural antioxidant contents from rice bran of selected Sarawak
local rice varieties. The rice bran extracts (RBE) were then further tested with in
vitro chemical- and cell-based antioxidant assays preliminarily to evaluate their
respective antioxidant capacities in alleviating oxidative injuries. The results
revealed that RBE of different Sarawak local rice varieties contain significant
amount of natural antioxidants. According to the current finding, Bajong LN RBE
has the highest contents of phenolic compounds, flavonoids, and γ-oryzanol
among all the tested samples. It was also discovered that higher average total
phenolic, flavonoids, and tocotrienols contents were detected in RBE of
Sarawak local rice varieties studied as compared to those in certain rice
varieties cultivated elsewhere. In vitro chemical-based antioxidant assays
further revealed the dose-dependent 2,2-diphenyl-1-picrylhydrazyl (DPPH) free-
radical scavenging capabilities of RBE to which the effectiveness differed
among RBE of different local rice varieties. Among all the tested rice varieties,
highest free-radical scavenging activity was detected with Bajong LN RBE and
was significantly higher than that with RBE of commercial rice variety, MR219.
Both Bajong LN and MR219 RBE were selected for in vitro cell-based
antioxidant assay. Here, the H9c2(2-1) cardiomyocyte was used and the cellular
induction effects with selected RBE and H2O2 were studied. Incubation of
H9c2(2-1) with RBE and H2O2 showed dose-dependent cytotoxic effects
respectively. Such observation revealed the potential prooxidant activity of RBE
which consequently reduced cell viability at higher concentration. Cellular
induction with safe dose range of RBE showed significant improvement in
enzymatic activities of superoxide dismutase (SOD), catalase (CAT) and
glutathione peroxidase (GPx) in H9c2(2-1). Co-incubation of H9c2(2-1) with
RBE and H2O2 further revealed the potential of RBE in alleviating H2O2-induced
oxidative injuries as observed through a right shift in IC50 of H2O2. Higher
increment in IC50 of H2O2 was detected with Bajong LN RBE as compared to
MR219 RBE. Besides that, significant up-regulations in enzymatic activity and
![Page 3: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/3.jpg)
III
expression of CAT were also reported from H9c2(2-1) co-incubated with RBE
and H2O2. As a summary, the present result put forward the potential of RBE as
a source of antioxidants for alleviation of oxidative injuries in cardiovascular
diseases (CVD). Additional studies are still required to further investigate the
utilization of RBE as a strategy to combat oxidative stress-induced CVD.
![Page 4: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/4.jpg)
IV
Acknowledgement
I would like to express my sincerest gratitude to my supervisor, Dr.
Hwang Siaw San, for her persistent guidance, advice and support throughout
the progression of my research project as well as the completion of this
dissertation. It is an honourable pleasure to have her as supervisor who show
endless care for my work and diligently responded to my doubts at times of
difficulties of my research. In addition to that, I would like to acknowledge my
co-supervisors Dr. Alan Fong Yean Yip, Dr. Ng Sing Muk and Dr. Irine Henry
Ginjom for their valuable advice and for sharing their knowledge and
experiences on technical related uncertainties in my research.
I would like to sincerely thank Prof. Mrinal Bhave from Swinburne
University of Technology Melbourne for providing technical advices and funding
support to facilitate the research work. I would like to further extend my
gratitude to Prof. Yuen Kah Hay and Dr. Sherlyn Lim Sheau Chin from Universiti
Sains Malaysia (USM), Penang for granting access to their HPLC analytical
laboratory and also providing necessary technical advice, chemicals and
consumables required for the HPLC analysis work of this research. Also, I am
delighted to express my gratitude to Dr. Paul Neilsen from Swinburne University
of Technology, Sarawak Campus, and Prof. Eiji Matsuura, Dr. Kazuko
Kobayashi and Dr. Shen Lian Hua from Okayama University Graduate School
of Medicine, Dentistry and Pharmaceutical Sciences for their assistance in
providing invaluable technical advices on cell culture-related work.
I must express my gratitude to my family, especially my parents and
brother for their continuous support, encouragement and patience for
experiencing the peaks and valleys at times of my research. Also not to forget
the guidance and supports from my fellow lab mates: Jessica Fong, Diana Choo,
Melissa Chang, Yan Huey, Reagan and lab colleagues, Jia Ni, Rafika and Nurul
for keeping my things in perspective.
Last but not least, I would like to thank Faculty of Engineering,
Computing and Science, Swinburne Sarawak and Research Consultancy Office
Swinburne Sarawak for providing the necessities which have allowed me to
![Page 5: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/5.jpg)
V
pursue this research. The expenses for the research work, conferences and
research attachment were supported by Swinburne Sarawak Research Grant
2013 (SSRG Grant 2-5503), Melbourne-Sarawak Research Collaboration
Scheme Grant (MSRCS 2013) and Strategic Research Grant (StraRG 2-5607).
Permission has been granted by Sarawak Biodiversity Centre (SBC), Malaysia
for accession to the collection and research on the selected Sarawak local rice
varieties (Research Agreement No.: SBC-RA-0093-HSS).
![Page 6: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/6.jpg)
VI
Declaration by Candidate
I, Tan Xian Wen, higher degree research student of Masters of Science
by Research, from Faculty of Engineering, Computing and Science, Swinburne
University of Technology Sarawak Campus hereby declare that this dissertation
is original and contains no material which has been accepted for award to the
candidate of any other degree or diploma, except where due reference is made
in the text of the examinable outcome. To the best of candidate’s knowledge,
this thesis contains no material previously published or written by another
person except where due reference is made in the text of the examinable
outcome; and where the work is based on joint research or publications, the
relative contributions of the respective workers or authors has been disclosed.
__________________________ (TAN XIAN WEN)
As the principal coordinating supervisor, I hereby acknowledge and certify that
the above mentioned statements are legitimate to the best of my knowledge.
___________________________
(DR. HWANG SIAW SAN)
![Page 7: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/7.jpg)
VII
Table of Contents
Abstract ....................................................................................................................... II
Acknowledgement ...................................................................................................... IV
Declaration by Candidate ............................................................................................ VI
Conference Presentation ............................................................................................ XI
Conference Awards .................................................................................................... XI
List of Figures and Tables .......................................................................................... XII
Chapter 1: Introduction ................................................................................................ 1
1.1. Research Background ........................................................................................ 1
1.2. Research Aims and Objectives ........................................................................... 5
1.3. Research Contributions and Impact to Society ................................................... 6
Chapter 2: Extraction of Natural Antioxidant from Rice Bran ........................................ 7
2.1 Executive Summary ............................................................................................ 7
2.2 Literature Review ................................................................................................ 8
2.2.1 Rice and Rice Brans .......................................................................... 8
2.2.2 Extraction and Analysis of Antioxidants ........................................... 10
2.2.3 Rice Antioxidants ............................................................................. 15
2.2.3.1 Polyphenols ..................................................................................... 16
2.2.3.1.1 Phenolic Acids in Rice .................................................................. 19
2.2.3.1.2 Flavonoids in Rice ........................................................................ 19
2.2.3.1.3 Anthocyanins in Rice .................................................................... 21
2.2.3.1.4 Heath Benefits of Polyphenols ...................................................... 21
2.2.3.2 Gamma-Oryzanol ............................................................................ 24
2.2.3.2.1 Health benefits of γ-Oryzanol ........................................................ 24
2.2.3.3 Vitamin E ......................................................................................... 27
2.2.3.3.1 Health Benefits of Vitamin E (Tocotrienols) ................................... 28
2.3 Research Aims and Objectives ......................................................................... 31
2.4 Experimental Design......................................................................................... 31
2.4.1 Materials and Chemicals ................................................................. 31
2.4.1.1 Rice Samples .................................................................................. 31
2.4.1.2 Chemicals ....................................................................................... 33
2.4.2 Rice Sample Treatment and Preparation of Rice Bran Sample ....... 34
2.4.3 Methodology .................................................................................... 35
2.4.3.1 Simple Solvent Extraction ................................................................ 35
2.4.3.3 Determination of Total Flavonoid Content ........................................ 36
![Page 8: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/8.jpg)
VIII
2.4.3.4 Determination of Total Anthocyanin Content.................................... 37
2.4.3.5 Determination of Total Gamma Oryzanol (γ-Oryzanol) Content ....... 38
2.4.3.6 Determination of Vitamin E Content ................................................. 39
2.4.3.7 Statistical Analysis ........................................................................... 39
2.4.4 Results and Discussion ................................................................... 40
2.4.4.1 Determination of Total Phenolic Content ......................................... 40
2.4.4.2 Determination of Total Flavonoid Content ........................................ 44
2.4.4.3 Determination of Total Anthocyanin Content.................................... 46
2.4.4.4 Determination of Total Gamma Oryzanol (γ-Oryzanol) Content ....... 48
2.4.4.5 Determination of Vitamin E Content ................................................. 50
2.4.5 Conclusion ...................................................................................... 54
Chapter 3: Bioactivity Studies of Natural Antioxidants Derived from Rice Bran of
Different Sarawak Local Rice Varieties .......................................................................57
3.1 Executive Summary .......................................................................................... 57
3.2 Literature Review .............................................................................................. 58
3.2.1 Reactive Oxygen Species (ROS) and Oxidative Stress ............................. 58
3.2.2 Oxidative Stress Related Disease ............................................................. 60
3.2.2.1 Cardiovascular Diseases ................................................................. 61
3.2.2.1.1 Atherosclerosis ................................................................................ 62
3.2.2.1.2 Myocardial Infarction (MI) and Myocardial Reperfusion Injury .......... 66
3.2.3 Antioxidants .............................................................................................. 69
3.2.3.1 Endogenous antioxidant .................................................................. 70
3.2.3.1.1 Superoxide Dismutase (SOD) ......................................................... 70
3.2.3.1.2 Catalase (CAT) ................................................................................ 71
3.2.3.1.3 Glutathione Peroxidase (GPx) ......................................................... 72
3.2.3.2 Exogenous Antioxidants .................................................................. 73
3.3 Research Aims and Objectives ......................................................................... 75
3.4 Experimental Design......................................................................................... 75
3.4.1 Materials and Chemicals ................................................................. 75
3.4.2 Test Samples .................................................................................. 76
3.4.3 Methodology .................................................................................... 76
3.4.3.1 In Vitro Chemical-Based System ..................................................... 78
3.4.3.1.1 DPPH Free Radical Scavenging Assay ........................................... 78
3.4.3.1.2 Trolox Equivalent Antioxidant Capacity (TEAC) Assay .................... 78
3.4.3.1.3 Statistical Analysis ........................................................................... 79
3.4.3.2 In Vitro Cell Culture-Based System ................................................. 80
![Page 9: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/9.jpg)
IX
3.4.3.2.1 Cell Culture and Growth Curve Study ........................................... 80
3.4.3.2.2 Cell cytotoxicity Assay .................................................................. 81
3.4.3.2.3 Induction of Oxidative Stress ........................................................ 82
3.4.3.2.4 Endogenous Antioxidant Enzyme Activity Studies ........................ 82
3.4.3.2.5 Endogenous Antioxidant Enzyme Gene Expression Studies ........... 83
3.4.3.2.6 Statistical Analysis ........................................................................... 85
3.4.4 Results and Discussions ................................................................. 86
3.4.4.1 In Vitro Chemical-Based System ..................................................... 86
3.4.4.1.1 DPPH Free Radical Scavenging Assay ........................................... 86
3.4.4.1.2 Trolox Equivalent Antioxidant Capacity (TEAC) Assay .................... 93
3.4.4.2 In Vitro Cell Culture-Based System ................................................. 98
3.4.4.2.1 Morphology and Growth of H9c2(2-1) Cardiomyocytes ................. 98
3.4.4.2.2 Cell Cytotoxicity Assay (RBE) ..................................................... 101
3.4.4.2.3 Cell Cytoxicity Assay (Hydrogen Peroxide) ................................. 109
3.4.4.2.4 Cell Viability Assay (Rice Bran Extract + Hydrogen Peroxide) .... 112
3.4.4.2.5 Effects of Different Treatments on Activities and Gene Expression
of Endogenous Cellular Antioxidant Enzymes in H9c2(2-1) Cells ............... 118
(A) Superoxide Dismutase (SOD) ....................................................... 119
(i) Effects of RBE on total SOD enzymatic activity and gene expression
of SOD2 in H9c2(2-1) Cells ........................................................... 119
(ii) Effects of H2O2 on total SOD enzymatic activity and gene expression
of SOD2 in H9c2(2-1) Cells ........................................................... 121
(iii) Effects of H2O2 on total SOD enzymatic activity and gene expression
of SOD2 in H9c2(2-1) cells pre-treated with RBE .......................... 123
(B) Catalase (CAT) .............................................................................. 129
(i) Effects of RBE on total enzymatic activity and gene expression of
CAT in H9c2(2-1) cells .................................................................. 129
(ii) Effects of Hydrogen peroxide (H2O2) on total enzymatic activity and
gene expression of CAT in H9c2(2-1) cells .................................... 131
(iii) Effects of H2O2 on total enzymatic activity and gene expression of
CAT in H9c2(2-1) cells pre-treated with RBE ................................. 133
(C) Glutathione Peroxidase (GPx) ....................................................... 137
(i) Effects of RBE on total GPx enzymatic activity and gene expression
of GPx1 in H9c2(2-1) cells ............................................................. 137
(ii) Effects of Hydrogen peroxide (H2O2) on total GPx enzymatic activity
and gene expression of GPx1 in H9c2(2-1) cells ........................... 139
(iii) Effects of H2O2 on total GPx enzymatic activity and gene expression
of GPx1 in H9c2(2-1) cells pre-treated with RBE ........................... 141
3.4.5 Conclusion .................................................................................... 145
![Page 10: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/10.jpg)
X
Chapter 4: Research Limitations and Future Works .................................................. 149
4.1 Project Limitations .......................................................................................... 149
4.2 Future Works .................................................................................................. 152
Appendices ............................................................................................................... 153
5.1 Graphical representations ............................................................................... 153
5.2 Tabulation of Data .......................................................................................... 166
References ............................................................................................................... 167
![Page 11: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/11.jpg)
XI
Conference Presentation
1. Tan, XW, Fong, AYY, Ng, SM, Ginjom, IR & Hwang, SS 2014,
‘Preliminary screening of γ-oryzanol (γ-ory) content in local rice varieties
of Sarawak’, The 18th Biological Sciences Graduate Congress (BSGC),
University of Malaya (UM), Kuala Lumpur, January 6 – January 8, 2014.
2. Tan, XW, Fong, AYY & Hwang, SS 2014, ‘The studies on antioxidant
activity of Sarawak local rice varieties’, 2nd International Conference on
Advances in Plant Sciences (ICAPS 2014), Kuching, Sarawak ,
Malaysia, November 18 – November 22, 2014.
3. Tan, XW, Bhave, M, Fong, AYY & Hwang, SS 2015, ‘Potential
cytoprotective effects of rice bran extracts against oxidative stress in rat
cardiomyocytes’, The Annual Conference on Life Sciences and
Engineering (ACLSE), Osaka, Japan, August 25 – August 27, 2015.
Conference Awards
1. ‘The Gold Medal Winner for Poster Presentation’, Applied Science and
Biotechnology category, The 18th Biological Sciences Graduate
Congress (BSGC), University of Malaya (UM), Kuala Lumpur,
January 6 – January 8, 2014.
2. ‘Upstream Category Silver Award – Best Poster’, 2nd International
Conference on Advances in Plant Sciences (ICAPS 2014), Kuching,
Sarawak, Malaysia, November 18 – November 22, 2014.
![Page 12: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/12.jpg)
XII
List of Figures and Tables
1. Figures
Figure 2-1: An example of Sarawak local rice varieties, ‘Padi Bario’ (also known as
Bario rice. ................................................................................................... 2
Figure 2-1: Local rice varieties of Sarawak ................................................................... 8
Figure 2-2: Chemical structure of phenol functional group. ......................................... 16
Figure 2-3: Basic structural configurations of different flavone and flavonol derivatives
[image source: (Tanaka & Takahashi 2013)] ............................................ 20
Figure 2-4: General pharmacological properties and biological mechanism/molecular
targets of polyphenols ..................................................................................
Figure 2-5: Chemical structure of four major constituents of γ-oryzanol: (A) cycloartenyl
ferulate; (B) campesteryl ferulate; (C) 24-methlenecycloartenyl ferulate; (D)
β-sitosteryl ferulate. .................................................................................. 25
Figure 2-6: General pharmacological properties and biological mechanism/molecular
targets of γ-oryzanol .....................................................................................
Figure 2-7: General chemical Structures of (A) tocopherol and (B) tocotrienol. [Image
source: (Wolf 2005)] ................................................................................. 27
Figure 2-8: General pharmacological properties and biological mechanism/molecular
targets of tocotrienol ................................................................................. 30
Figure 2-9: Overview of experimental approaches applied for extraction of antioxidants
from rice bran samples and determination of the contents of antioxidants in
the extracts. .............................................................................................. 35
Figure 2-10: HPLC chromatograms of (a) Tocomin50 and (b) RBE of Bajong LN. Delta
T3: δ-tocotrienols; Gamma T3: γ-tocotrienols; Alpha T3: α-tocotrienols;
Tocopherol: mainly α-tocopherol .............................................................. 50
Figure 2-11: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in different
RBE were expressed in units of %. The data represented mean ± standard
deviation of three repetitions (n=3). T3 = Tocotrienols; T = Tocopherol. ... 53
Figure 3-1: Graphical representation of atherosclerotic plaque formation [Image
source:(Quillard & Libby 2012a)] .............................................................. 64
Figure 3-2: Developmental stages of atherosclerosis (Quillard & Libby 2012b; Toh et al.
2014) ........................................................................................................ 65
Figure 3-3: Graphical representation of acute myocardial infarction (MI). Normal blood
flow to heart is disrupted at site of arterial blockage and subsequently
damages the heart muscles and tissues. [Image source: (Antipuesto 2014) ]
................................................................................................................. 67
Figure 3-4: Overview of experimental approaches applied for bioactivity studies of
antioxidants from rice bran extracts ..............................................................
Figure 3-5: DPPH free radical scavenging activities of different concentrations of
different crude RBE. The data represented mean ± standard deviation of
three repetitions (n=3). ............................................................................. 89
Figure 3-6: Cell image of healthy H9c2(2-1) cardiomyocytes taken through an inverted
light microscope (Magnification: 200x) ...................................................... 98
![Page 13: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/13.jpg)
XIII
Figure 3-7: Growth curve of H9c2(2-1) cardiomyocytes over 8 days of incubation period.
Each alphabet represents different growth phases of the cells. (a): Log
phase; (b): Exponential phase; (c): Stationary phase; (d): Doubling time
(~2.73 days) ............................................................................................. 99
Figure 3-8: Microscope (40x magnification) images of H9c2(2-1) cardiomyocytes at
different time points (1st to 8th day). ......................................................... 100
Figure 3-9: Cell images of (a) healthy H9c2(2-1) cardiomyocytes (negative control)
and (b) H9c2(2-1) cells induced with lethal dosage of Bajong LN extract
(500 µg/mL). Red oval inset in (b) showed apoptotic H9c2(2-1) cells.
*Magnification: 40x ................................................................................. 101
Figure 3-10: Cell viability curves of H9c2(2-1) cardiomyocytes treated with different
concentrations (6.25µg/mL to 500µg/mL) of (A) Bajong LN and (B) MR219
RBE over 24, 48 and 72 hours of incubation time respectively. Best fit
curves were drawn by using excel for visual purposes. .......................... 103
Figure 3-11: Cell viability curves of H9c2(2-1) cells treated with different concentrations
of hydrogen peroxide (H2O2). The insets showed the inhibition
concentration (IC50) of H2O2 on H9c2(2-1) cells determined via GraphPad
Prism (GraphPad Software, Inc. USA). Best fit curve were drawn using
excel for visual purpose. ......................................................................... 109
Figure 3-12: Effects of H2O2 inductions on cell viabilities of H9c2(2-1) cardiomyocytes
pre-treated with different concentrations of Bajong LN RBE (25µg/mL and
50µg/mL) and MR219 RBE (50µg/mL and 100µg/mL) ............................ 114
Figure 3-13: (A) Total SOD enzymatic activities and (B) gene expression levels of
SOD2 in H9c2(2-1) cells pre-treated with RBE. Data represent mean ±
standard deviation of three repetitions (n=3). ‘*’: significantly different from
negative control at P ≤0.05 and ‘**’: significantly different from negative
control at P ≤0.01. .................................................................................. 120
Figure 3-14: (A) Total SOD enzymatic activities and (B) gene expression levels of
SOD2 in H9c2(2-1) cells after induction with different concentrations of
H2O2. Data represent mean ± standard deviation of three repetitions (n=3).
‘*’: significantly different from negative control at P ≤ 0.05 and ‘**’:
significantly different from negative control at P≤0.01. ........................... 122
Figure 3-15: (A) Total SOD enzymatic activities and (B) gene expression levels of
SOD2 in RBE pre-treated H9c2(2-1) cells after induction with 125µM of
H2O2. Data represent mean ± standard deviation of three repetitions (n=3).
‘*’: significantly different from negative control (P ≤0.05); ‘**’: significantly
different from negative control (P ≤0.01) ................................................ 124
Figure 3-16: (A) Total enzymatic activities and (B) gene expression levels of CAT after
treated with RBE. Data represent mean ± standard deviation of three
repetitions (n=3). ‘*’: significantly different from negative control at P ≤0.05
and ‘**’: significantly different from negative control at P ≤0.01. ............. 130
Figure 3-17: (A) Total enzymatic activities and (B) gene expression levels of CAT after
induction with different concentrations of H2O2. Data represent mean ±
standard deviation of three repetitions (n=3). ‘*’: significantly different from
negative control at P ≤0.05 and ‘**’: significantly different from negative
control at P ≤0.01. .................................................................................. 132
![Page 14: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/14.jpg)
XIV
Figure 3-18: (A) Total enzymatic activities and (B) gene expression levels of CAT in
RBE pre-treated H9c2(2-1) cells after induction with 125µM of H2O2. Data
represent mean ± standard deviation of three repetitions (n=3). ‘*’:
significantly different from negative control (P≤ 0.05); ‘**’: significantly
different from negative control (P ≤0.01) ................................................ 135
Figure 3-19: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx1
after treated with RBE. Data represent mean ± standard deviation of three
repetitions (n=3). ‘*’: significantly different from negative control at P ≤0.05
and ‘**’: significantly different from negative control at P ≤0.01. ............. 138
Figure 3-20: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx1
after induction with different concentrations of H2O2. Data represent mean
± standard deviation of three repetitions (n=3). ‘*’: significantly different
from negative control at P ≤ 0.05 and ‘**’: significantly different from
negative control at P ≤0.01. ................................................................... 140
Figure 3-21: (A) Total GPx enzymatic activities and (B) gene expression levels of GPx
in RBE pre-treated H9c2(2-1) cells after induction with 125µM of H2O2.
Data represent mean ± standard deviation of three repetitions (n=3). ‘*’:
significantly different from negative control (P ≤ 0.05); ‘**’: significantly
different from negative control (P ≤0.01) ................................................ 142
Figure 5-1: Total phenolic content of different RBE were expressed in unit of mg GAE/g
dried extracts. Vertical bars and errors bars represent the mean ± standard
deviation of 3 experimental repetitions (n=3). Similar letters on each bar
represent significant differences at P ≤ 0.05 (Tukey’s Test). GAE = Gallic
Acid Equivalent. ...................................................................................... 153
Figure 5-2: Total flavonoid content of different RBE were expressed in unit of mg QE/g
dried extracts. Vertical bars and errors bars represent the mean ± standard
deviation of 3 experimental repetitions (n=3). Different letters on each bar
represent significant differences at P ≤ 0.05 (Tukey’s Test). QE =
Quercetin Equivalent. ............................................................................. 154
Figure 5-3: Total anthocyanin content of different RBE were expressed in unit of mg
C3G/100g dried extracts. Vertical bars and errors bars represent the mean
± standard deviation of 3 experimental repetitions (n=3). The ‘*’ annotation
represents significant difference at P ≤ 0.05 from RBE of Bajong (Tukey’s
Test). ...................................................................................................... 155
Figure 5-4: Total γ-oryzanol content of different crude rice bran extracts were
expressed in unit of mg/kg dried extracts. Vertical bars and errors bars
represent the mean ± standard deviation of 3 experimental repetitions
(n=3). Different letters on each bar represent significant differences at P ≤
0.05 (Tukey’s Test). ................................................................................ 156
Figure 5-5: Inhibitory concentration (IC50) of different RBE for DPPH free radical
scavenging assay. Tocomin50 was used as the positive control. The data
represent mean ± standard deviation of three repetitions (n=3). Different
letters on each bar represent significant differences at P ≤ 0.05 (Tukey’s
Test). ...................................................................................................... 157
![Page 15: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/15.jpg)
XV
Figure 5-6: The correlation graphs of 1/DPPH (IC50) from RBE with (A) total phenolic
content, (B) total flavonoid content, (C) total anthocyanin content, (D) total
γ-oryzanol content, (E) total vitamin E content, (F) δ-tocotrienol content, (G)
γ-tocotrienol content, (H) α-tocotrienol content, and (I) tocopherol (α-
tocopherol) content. ................................................................................ 159
Figure 5-7: Trolox Equivalent Antioxidant Capacity (TEAC) assay of different RBE.
Trolox was used as the positive control. Antioxidant capacities of different
RBE were expressed in trolox equivalence (nmol/g trolox). The data
represent mean ± standard deviation of three repetitions (n=3). Different
letters on each bar represent significant differences at P ≤ 0.05 (Tukey’s
Test). ...................................................................................................... 160
Figure 5-8: The correlation graphs of TEAC of RBE with (1) total phenolic content, (2)
total flavonoid content, (3) total anthocyanin content, (4) total γ-oryzanol
content, (5) total vitamin E content, (6) δ-tocotrienol content, (7) γ-
tocotrienol content, (8) α-tocotrienol content, and (9) tocopherol (α-
tocopherol) content. ................................................................................ 162
Figure 5-9: Cell viability curves of H9c2(2-1) cells treated with different concentrations
of Bajong LN extracts over 24, 48 and 72 hours of incubation period
respectively. The insets showed the inhibition concentration (IC50) of
Bajong LN RBE on H9c2(2-1) cells determined via GraphPad Prism
(GraphPad Software, Inc. USA). Best fit curves were plotted using excel for
visual purpose. ....................................................................................... 163
Figure 5-10: Cell viability curves of H9c2(2-1) cells treated with different concentrations
of MR219 extracts over 24, 48 and 72 hours of incubation period
respectively. The insets showed the inhibition concentration (IC50) of
MR219 RBE on H9c2(2-1) cells determined via GraphPad Prism
(GraphPad Software, Inc. USA). Best fit curves were plotted using excel for
visual purpose. ....................................................................................... 164
Figure 5-11: IC50 of H2O2 for H9c2(2-1) cells pre-treated with different concentrations of
RBE. Data represent mean ± standard deviation for 3 repetitions (n=3).
IC50 values were determined via GraphPad Prism (GraphPad Software, Inc.
USA).............................................................................................................
2. Tables
Table 2-1: General chemical structures of different sub-groups of polyphenols
(Navindra 2010) .......................................................................................... 17
Table 2-2: Sample images (showing whole rice grain and de-husked rice grain) of
different rice samples. ................................................................................. 32
Table 2-3: Total phenolic contents of RBE. Values expressed represent mean ±
standard deviation of 3 concecutive repetitions (n=3). Different letters within
the same column denote significant difference at P ≤ 0.05 (Tukey’s Test).
GAE = Gallic Acid Equivalent. Graphical representation for the following data
is presented in Figure 5-1 (Appendix Section). ........................................... 40
Table 2-4: Average total phenolic contents in different rice varieties ........................... 42
![Page 16: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/16.jpg)
XVI
Table 2-5: Total flavonoid contents of RBE. Values expressed represent mean ±
standard deviation of 3 concecutive repetitions (n=3). Different letters within
the same column denote significant differences at P ≤ 0.05 (Tukey’s Test).
QE = Quercetin Equivalent. Graphical representation for the following data is
presented in Figure 5-2 (Appendix section)................................................. 44
Table 2-6: Total anthocyanin contents of different RBE were expressed in unit of mg
cyanidin-3-glucoside equivalent/100g dried extracts. Results were expressed
in mean ± standard deviation of three consecutive experimental repetitions
(n=3). Graphical representation for the following data is presented in Figure
5-3 (Appendix section). ............................................................................... 46
Table 2-7: Total γ-oryzanol content of RBE. Values expressed represent mean ±
standard deviation of 3 concecutive repetitions (n=3). Different letters within
the same column denote significant differences at P ≤ 0.05 (Tukey’s Test).
Graphical representation for the following data is presented in Figure 5-4
(Appendix section). ..................................................................................... 48
Table 2-8: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in different RBE
were expressed in units of mg/kg. The data represented mean ± standard
deviation of three repetitions (n=3). Different letters within the same column
denote significant difference at P ≤ 0.05. T3 = tocotrienols; T = tocopherol.
................................................................................................................... 51
Table 3-1: Oligonucleotide primer sequences ............................................................. 84
Table 3-2: qRT-PCR Reaction Cycle Condition (Qiagen 2011) ................................... 85
Table 3-3: Inhibitory concentration (IC50) of different RBE for DPPH free radical
scavenging assay. Values represents mean ± standard deviation of 3
concecutive repetitions (n=3). Different letters within the same column
denote significant differences at P ≤ 0.05 (Tukey’s Test). Graphical
representation for the following data is presented in Figure 5-5 (Appendix
section). ...................................................................................................... 86
Table 3-4: Regression and correlation analyses of 1/DPPH (IC50) with total phenolic,
total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-
tocotrienol, γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE.
Correlation graphs for the following data were depicted in Figure 5-6
(Appendix section). ..................................................................................... 92
Table 3-5: Trolox equivalent antioxidant capacity (TEAC) of different RBE. Values
expressed represent mean ± standard deviation of 3 concecutive repetitions
(n=3). Different letters within the same column denote significant differences
at P ≤ 0.05 (Tukey’s Test). Graphical representation of the data was
depicted in Figure 5-7 (Appendix section) ................................................... 94
Table 3-6: Regression and correlation analyses of trolox equivalent antioxidant
capacity (TEAC) of RBE with total phenolic, total flavonoid, total anthocyanin,
total γ-oryzanol, total vitamin E, δ-tocotrienol, γ-tocotrienol, α-tocotrienol, and
α-tocopherol. Correlation graphs were depicted in Figure 5-8 (Appendix
section) ....................................................................................................... 95
![Page 17: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/17.jpg)
XVII
Table 3-7: Cell viability of H9c2(2-1) after inductions with different concentrations of
Bajong LN RBE for 24, 48 and 72 hours respectively. Data presented were
the mean ± standard deviation of three replicates (n=3). ‘*’ on each column
denotes significant differences at P ≤ 0.05 as compared to negative control.
................................................................................................................. 104
Table 3-8: Inhibitory concentration (IC50) of Bajong LN RBE over 24, 48 and 72 hours
of incubation time. The IC50 values were determined from respective cell
viability curves via GraphPad Prism (GraphPad Software, Inc. USA). Data
represents mean ± standard deviation of 3 consecutive repetition (n=3).
Graphical representations of data were depicted in Figure 5-9 (Appendix
section). .................................................................................................... 105
Table 3-9: Cell viability of H9c2(2-1) after inductions with different concentrations of
MR219 RBE for 24, 48 and 72 hours respectively. Data presented were the
mean ± standard deviation of three replicates (n=3). ‘*’ on each column
denotes significant differences at P ≤ 0.05 as compared to negative control.
................................................................................................................. 106
Table 3-10: Inhibitory concentration (IC50) of MR219 RBE over 24, 48 and 72 hours of
incubation time. The IC50 values were determined from respective cell
viability curves via GraphPad Prism (GraphPad Software, Inc. USA). Data
represents mean ± standard deviation of 3 consecutive repetition (n=3).
Graphical representations of data were depicted in Figure 5-10 (Appendix
section). .................................................................................................... 107
Table 3-11: Cell viability of H9c2(2-1) after inductions with different concentrations of
hydrogen peroxide (H2O2). Data presented were the mean ± standard
deviation of three replicates (n=3). ‘*’ on each column denotes significant
differences at P ≤ 0.05 as compared to negative control. ......................... 110
Table 3-12: IC50 of H2O2 on H9c2(2-1) cell. The IC50 value was determined from
respective cell viability curves (Figure 3-11) via GraphPad Prism (GraphPad
Software, Inc. USA). Data represents mean ± standard deviation of 3
consecutive repetition (n=3). ..................................................................... 111
Table 3-13: Cell viability of H9c2(2-1) after inductions with different concentrations of
H2O2. Cells were pre-treated with different concentrations of Bajong LN and
MR219 RBE before H2O2-induction. Data represent mean ± standard
deviation of three replicates (n=3). ‘*’ on each column denotes significant
differences at P ≤ 0.05 as compared to negative control (non-treated cells).
................................................................................................................. 113
Table 3-14: Average IC50 of H2O2 for H9c2(2-1) cells. The IC50 value was determined
from respective cell viability curves (Figure 5-11) via GraphPad Prism
(GraphPad Software, Inc. USA). Data represent mean ± standard deviation
of 3 (n=3). ‘*’ denotes significantly different from negative control treated with
media + 1% EtOH at P ≤ 0.05. Graphical representations of data were
depicted in Figure 5-11 (Appendix section) ............................................... 115
Table 5-1: Extraction yields of RBE .......................................................................... 166
1.
![Page 18: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/18.jpg)
1
2. Chapter 1: Introduction
2.1. Research Background
Recent years of extensive research has disclosed the fact that majority
of diseases originated from the dysregulation of multiple genes, as a
consequence of oxidative stress. The origin of oxidative stress has been
strongly correlated with high concentration of free radicals, whereby it occurs
when the balance between the production rates of free radicals and the rates of
their removals are being disturbed (Wang et al. 2011). Primary targets of free
radicals include important biological components such as DNA, lipids, sugars,
proteins and fatty acids (Dröge & Schipper 2007; Esiri 2007; Fleury, Mignotte &
Vayssiere 2002). Under oxidative stress conditions, these essential biological
components will undergo oxidative modifications which disrupt their normal
functions. This consequently triggered the occurrence of chronic diseases such
as cardiovascular diseases, cancers and various degenerative diseases
(Magalhaes et al. 2009).
Endogenous antioxidants are produced by the body as a defensive
mechanism to maintain redox homeostasis within the biological system
(Rodrigo & Gil-Becerra 2014). Although these endogenous antioxidants are
capable of neutralizing free radicals, they remain incomplete in the absence of
exogenous antioxidants. Both components act synergistically to maintain low
levels of free radicals within the biological systems (Bouayed & Bohn 2010;
Pietta 2000). For instance, the rejuvenation of oxidized glutathione (GSSG) to
its reduced form (GSH) requires vitamin E as one of the precursors (Valko et al.
2007). Besides that, vitamin E also detoxifies lipid peroxyl radicals (LOO-)
(Bouayed & Bohn 2010) concomitantly with endogenous antioxidant enzyme,
glutathione peroxidase (GPx) to terminate free radical chain reactions (Lip &
Hall 2007).
![Page 19: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/19.jpg)
2
Exogenous antioxidants often come from dietary sources and can be
categorized under two different types, namely synthetic exogenous antioxidants
and natural exogenous antioxidants. As the safety of synthetic exogenous
antioxidants remains as a major concern, there has been a great attention
centred on natural antioxidants derived from bioactive compounds present
naturally in both fruits and vegetables (Magalhaes et al. 2009).
In Malaysia, Sarawak state is known as the treasure trove for many
different local rice varieties. These include Bario (Figure 2-1), Biris, Bajong,
Rotan, Boria, Udang Halus and other less-known rice varieties. Overall, there
are more than 100 different rice varieties in Sarawak and majority of them are
sold in local markets (Teo 2000). Rice is usually consumed in the form of
polished and refined white grains. Through the rice milling process, rice brans
are often removed as part of the raw rice component. The removal of brans
from the grains has resulted in significant loss of numerous nutritive
components (Borresen & Ryan 2014).
Figure 2-1: An example of Sarawak local rice varieties, ‘Padi Bario’ (also known
as Bario rice.
![Page 20: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/20.jpg)
3
Rice bran extracts derived from various extraction methods have shown
a mixture of antioxidant-rich bioactive compounds. These include anthocyanins,
gamma-oryzanol (γ-oryzanol), phenolic acids and vitamin E (tocopherols and
tocotrienols). It has been proven epidemiologically that consumption of bran
portion of rice significantly reduces the prevalence and occurrence rates of
chronic diseases such as cardiovascular diseases, type 2 diabetes, various
degenerative diseases and cancers (de Munter et al. 2007; Jariwalla 2001;
Most et al. 2005).
Studies on rice bran and health related research have been performed to
evaluate rice bran antioxidants in health and wellness. With more than 100,000
different varieties of rice grown worldwide, it opens up research opportunities to
evaluate specific traits and health significance that come in association with the
brans (Borresen & Ryan 2014). Presently, research on different varieties of rice
is being conducted actively by researchers from different regions of rice-
producing countries. The nutritional compositions of the rice are being assessed
and the dietary supplementation of the rice extract was found to possess
numerous health benefits, generally attributed to the presence of antioxidant
compounds (Hu et al. 2003).
Cardiovascular disease (CVD) still remains as one of the largest leading
cause of global mortality. The World Health Organization (WHO) has estimated
a total number of 17.5 million deaths from CVD in the year 2012, accounted for
one-third of the global mortality (WHO 2015). The total numbers of annual
fatalities are expected to increase to 20 million of death cases by 2020, and
further increase to 24 million by 2030 (WHO 2004). Hence, there is an urgent
need for global attention to alleviate mortality rate of CVD. One of the initiating
causes of CVD was characterized as oxidative modification (Goldstein et al.
1979; Steinberg et al. 1989). Oxidative modification induces a series of signal
transduction cascade events that lead to the progression of CVD. Therefore,
strategies of using antioxidant to attenuate CVD via inhibition of inadvertent
cellular oxidative damage or signalling pathway may have important
implications to both prevention and treatment of CVD (Lönn, Dennis & Stocker
2012).
![Page 21: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/21.jpg)
4
Research on nutraceutical compounds from various agricultural crops
has become one of the emerging fields of study in the recent years. Various
efforts have been devoted to enhance the value of these agricultural crops. A
well-thought-out approach that thoroughly assesses the content and
bioactivities of natural antioxidants present in various Sarawak local rice
varieties is likely to bring social and economic benefits. Hence, it is worthwhile
to carry out further investigation on the bioactivities of antioxidants derived from
rice bran. This would significantly broaden the knowledge base on the
antioxidant protective effects of rice bran extracts (RBE). The outcomes can be
applied to further nutraceuticals research and also for more in-depth study of
plant-based food product development.
The present research was designed to extract and assess the content of
natural antioxidants from RBE of different Sarawak local rice varieties. This
thesis comprises of two different sections. The first section emphasizes on the
extraction of natural antioxidants from rice bran of different Sarawak local rice
varieties via solvent extraction method and followed by the determination of
antioxidants content in the RBE. The second section focuses on the bioactivity
studies of RBE. Two different in vitro systems: (i) in vitro chemical-based
system and (ii) in vitro mammalian cell culture-based system were used to
evaluate the antioxidant activities of RBE. For the in vitro chemical-based
system, 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging assay
and Trolox Equivalent Antioxidant Capacity (TEAC) assay were both used to
assess the antioxidant capacity of different RBE. As for the in vitro mammalian
cell culture-based system, a neonatal cardiomyocytes (H9c2) derived from
Rattus novergicus was used as the mammalian cell culture model to study the
antioxidant and cardioprotective potential of RBE via inductions of endogenous
cellular antioxidant enzymes. All these sections constitute the main objectives
of this research work.
![Page 22: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/22.jpg)
5
2.2. Research Aims and Objectives
The overall research design embarked on two main aims.
Aim 1 of this work was to extract and assess natural antioxidant contents from
rice bran of selected Sarawak local rice varieties. In order to achieve the aim,
experimental works were designed to fulfil the following objectives:
a. Extraction of natural antioxidant compounds from rice bran of
different Sarawak local rice varieties via solvent extraction
method.
b. Assessment of the contents of antioxidant compounds derived
from RBE of different Sarawak local rice varieties.
c. Quantitative analyses of antioxidant compounds derived from
RBE via UV-Visible Spectrophotometer (UV-Vis) and High
Performance Liquid Chromatography (HPLC).
Aim 2 of this work was to assess the bioactivity of RBE by studying their
antioxidant capacities via in vitro antioxidant assays. In order to achieve the aim,
experimental works were designed to fulfil the following objectives:
a. Study of antioxidant activity of RBE based on in vitro chemical-
based systems.
b. Study of antioxidant activity of RBE based on in vitro
mammalian cell culture-based system.
c. Determination of the optimal and safe dosage of RBE that is
appropriate for its maximal antioxidant activity in in vitro
mammalian cell culture-based system.
d. Assessment of RBE on the induction of endogenous cellular
antioxidants in in vitro mammalian cell culture-based system.
![Page 23: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/23.jpg)
6
2.3. Research Contributions and Impact to Society
The outcomes of this research work are expected to:
Promote research on health-improving bioactive compounds derived from
rice bran.
Promote value-added processing possibilities of rice industries in Sarawak,
specifically the management of by-products from rice production,
supporting local industry and using natural biodiversity to its full advantage
Identify Sarawak local rice varieties that have the highest antioxidant
contents.
Promote germplasm expansion (for planting) and breeding of new non-
genetically modified rice varieties that are nutritious in natural antioxidants.
Enhance international knowledge base on the antioxidant properties of
RBE in terms of correlation between the concentration of RBE and other
factors such as induction of endogenous cellular antioxidants and the
effectiveness of their respective antioxidant activity.
Establish supporting data for further investigation in carefully planned
animal model studies and clinical trials.
Ideally, the latter may lead to identification and expansion of local
inexpensive rice varieties as potential nutraceuticals for cardioprotection.
Additionally, it also offers opportunity for development and manufacture of new
plant-based drug and nutraceuticals products. The safe and low post-treatment
side effect of these natural bioactive compounds can be a potential candidate to
replace chemically synthesised drugs used for treatment of cardiovascular
diseases. Such approaches will have high socio-economic impact on the
nation’s populations in conjunction with the efforts to reduce the nation’s
mortality rate caused by cardiovascular diseases annually.
![Page 24: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/24.jpg)
7
2. Chapter 2: Extraction of Natural Antioxidant
from Rice Bran
2.1 Executive Summary
Health concerns over the use of synthetic antioxidants as food additives
in processed food products have led to an increase in research interests
targeting on natural antioxidants. Plant materials such as vegetables, nuts and
fruits are good sources of natural antioxidants. Due to the biological diversity of
these plant materials, each and every one of them contains different types and
amount of antioxidants. Hence, there have been many research works targeting
on qualification, elucidation and quantification of bioactive compounds present
in plant materials. Rice bran, by products of rice milling process, is known for
having high contents of essential proteins, vitamins and various natural
antioxidants. Despite its high nutritional value, it remains underutilized as health
food. In Malaysia, Sarawak is known as the treasure trove for different local rice
varieties. However, the health and nutritional of these local rice varieties remain
underexplored. There is very little fundamental information on the distribution
and quantification of bioactive compounds/natural antioxidants present in these
local rice samples. Hence, the following work was conducted to extract and
thoroughly assess the content of natural antioxidants from rice bran of different
Sarawak local rice varieties.
In this chapter of the thesis, it provides a comprehensive literature review
relevant to the field of study. In addition, summary of experimental approaches
and presentation of results for the first section of the overall research work are
also included in this chapter.
![Page 25: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/25.jpg)
8
2.2 Literature Review
2.2.1 Rice and Rice Brans
Rice is a staple food and remains as the utmost important agricultural
commodities in many Asian countries (Van Hoed et al. 2006). It provides
sources of calories and nourishments for majority of the Asian population’s
nutritional requirement (Schramm et al. 2007). In addition, rice continues to play
a significant role in sustaining global food security systems and establish a
continual capacity to feed the increasing world populations (Swaminathan &
Rao 2008).
Presently, rice is being cultivated in more than 100 countries with an
estimated 475 million tonnes of production capacity annually (Borresen & Ryan
2014). In Malaysia, Sarawak state is known as the treasure trove for many
different varieties of aromatic rice. Some of these include Bario, Biris, Bajong,
Rotan, Boria, Udang Halus and other less-known rice varieties (Figure 2-1).
Overall, there are more than 100 different rice varieties in Sarawak and majority
of them are sold in local markets (Teo 2000).
Figure 2-1: Local rice varieties of Sarawak
![Page 26: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/26.jpg)
9
Rice is primarily consumed in the form of white polished grains (also
known as white rice). Its non-milled rice form, otherwise known as brown rice is
less popular due to its poor texture and undesirable quality after cooking. The
whole rice grain consists of 3 major parts: husk, bran and endosperm. In the
rice milling industries, the milling process typically begins with the dehulling of
rice grains to remove the husk layer. This later reveals the bran layer which
shields the endosperm. Further removal of bran layer yields the endosperm,
commonly known as the white rice which is ready-to-cook (Elaine et al. 2004;
Ha et al. 2006).
The whole rice grain is known for containing rich contents of vitamins,
lipids, minerals, proteins, fibres and numerous antioxidants (Singh &
Chakraverty 2014) which may aid in disease control (Talwinder 2009). Major
composition of these bioactive compounds is found in the bran of rice grain.
However, the removal of bran from rice has resulted in the loss of
approximately 70% of the essential nutrients present in rice (Elaine et al. 2004).
Despite having high content of nutritious components and commercial value,
rice bran remains as an underutilized agricultural by-product. Most of them are
used as animal feed while only a small portion is used in the production of rice
bran oil for human consumption (Sirikul, Moongngarm & Khaengkhan 2009).
Several research works have been focusing on the health attributes of
rice bran in the prevention and treatment of chronic diseases. The outcomes
from the studies revealed positive correlation between the consumption of rice
bran (also inclusive of brown rice) and risk reductions in chronic diseases such
as cardiovascular disease (Ausman, Rong & Nicolosi 2005; Justo et al. 2013;
Wilson et al. 2002), cancers (Bang et al. 2010; Henderson et al. 2012), type 2
diabetes (de Munter et al. 2007), hypertension and hyperlipidaemia (Most et al.
2005).
Through the emerging knowledge of rice bran in health and wellness, its
consumption begins to gain popularity in recent years (Elaine et al. 2004). The
current research trend on rice bran revolves around its innovation in food
system that aims to alleviate issues of malnutrition and chronic diseases. In
addition, emphasis is also put on the genetic, geographic, nutritional diversities
![Page 27: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/27.jpg)
10
of different rice varieties and their associated health attributes (Borresen &
Ryan 2014). Hence, by addressing all these research statements, it will provide
global health prospects for proper and innovative utilization of rice bran in the
management of chronic diseases.
2.2.2 Extraction and Analysis of Antioxidants
The extraction of bioactive compounds from plant materials is the start-
up procedure for preparation of natural nutraceuticals or dietary supplements.
Depending on the nature of the raw materials, natural antioxidants can be
extracted from fresh, frozen, freeze-dried or dried plant samples. These plant
materials are usually pre-treated by milling, grinding or homogenization which
may later be preceded by air-drying or freeze drying for sample preservation
and storage (Dai & Mumper 2010). There are various methods available for the
extraction of antioxidants from plant materials. These methods are categorized
under three different categories, namely physical methods (Moreno et al. 2003),
chemical methods (Romero-Pérez et al. 2000), and enzymatic methods (Meyer
& Meyer 2005).
Among all the extraction methods, solvent extraction (a chemical
extraction method) is the most commonly used extraction methodology to
extract favourable compounds from plant materials. The stand-out points for
such extraction methodology are being easy to perform, efficient and its wide
applicability. Solvents such as methanol, ethanol, acetone, ethyl acetate, and
water are commonly used in the extraction of bioactive compounds from plant
materials (Eloff 1998). Due to the variation in composition of phytochemicals,
selection of suitable solvent to be used for extraction is dependent on the
nature of targeted sample and bioactive compounds (Gupta, Naraniwal &
Kothari 2012). Hence, there is no standardized extraction protocol made
available for extraction of bioactive compounds from plant materials.
![Page 28: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/28.jpg)
11
Polar and short carbon-chain alcohol such as methanol has been used
widely in the extraction of bioactive compounds from rice bran. Targeted
bioactive compounds such as phenolic acids, flavonoids, anthocyanins (Chen et
al. 2012; Gunaratne et al. 2013; Rao et al. 2010), vitamin E: tocotrienols (Chen
& Bergman 2005; Renuka Devi & Arumughan 2007) and, gamma oryzanol (γ-
oryzanol) (Jeng et al. 2012; Miller & Engel 2006) have been successfully
extracted from rice bran by using methanol as the main solvent system.
Depending on the compound of interest, other solvents such as acetone
(Gunaratne et al. 2013), hexane (Xu, Hua & Godber 2001), ethanol , and
isopropanol (Chen & Bergman 2005) have also been used to extract these
antioxidants from rice bran.
Aside from the choice of solvent system, extraction yields of each
different types of bioactive compounds also varies and dependent on other
extraction parameters such as extraction temperature, extraction duration,
solvent concentration, and type of instrument used (Goufo et al. 2014b;
Pellegrini et al. 2006). However, extraction temperature appears to be the major
factor among all. Different bioactive compounds have variable susceptibilities to
thermal degradation (Goufo & Trindade 2014; Stratil, Klejdus & Kubáň 2007).
For instance, high extraction temperature (>70°C) is able to degrade
anthocyanin rapidly (Havlíková & Míková 1985). In addition, rapid degradation
of flavonoids have also been reported at high extraction temperatures beyond
130°C (Rostagno & Prado 2013).
Over the past few years, many different analytical methods have been
developed to quantify and determine the contents of phenolic acids, flavonoids,
anthocyanins, vitamin E: tocotrienols and γ-oryzanol. Most of these methods
utilize instrumentation-based analyses involving the use of equipment such as
UV-Visible spectrophotometer, high performance liquid chromatography (HPLC),
gas chromatography (GC), mass spectrometric (MS) detection, liquid
chromatography-mass spectrometry (LC-MS).
![Page 29: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/29.jpg)
12
Total phenolic content in plant materials is commonly determined via
Folin Ciocalteu’s assay method. The method was initially established by Folin
and Ciocalteu (1927) and was then altered by Singleton and Rossi (1965). It is
a colorimetric assay based on the reduction of Folin Ciocalteu’s reagent, a
yellow phosphomolybdic phosphotungstic acid reagent through the transfer of
electron from phenolic compounds under alkaline condition (Lester et al. 2012;
Singleton & Rossi 1965). Gallic acid, a type of phenolic acid is commonly used
as the reference standard in this assay. The reaction yields blue colour product
which can be analysed spectrophotometrically via UV-Visible
spectrophotometer at 750nm (Vázquez et al. 2015).
The aluminium complexation-based spectrophotometric assay is a
commonly used approach to evaluate the total flavonoid content in plant
materials. The method was initially proposed by Christ and Müller (1960) and
was fine-tuned several times. Typical concentration of 2% to 10% (weight per
volume, w/v) of aluminium chloride (AlCl3) is used in this assay. The
complexation of aluminium chloride can take place in either acidic or alkaline
condition. Upon the addition of aluminium chloride, a yellow complex solution is
formed and it turns red after the addition of sodium hydroxide (NaOH). The
absorbance of the final red product is then evaluated spectrophotometrically at
510 nm (Malta & Liu 2014; Pękal & Pyrzynska 2014). Flavonoid reference
standards such as quercetin, quercitrin, and galangin are commonly used in the
assay.
There are several methods to determine the total anthocyanin contents
of plant samples. Methods such as direct spectrophotometric approach via
HPLC (Sompong et al. 2011) and spectrophotometric pH differential method
(Fuleki & Francis 1968; Giusti & Wrolstad 2001) have been used to determine
total anthocyanin content. Among the two methods, the rapid and simple
spectrophotometric pH differential approach is often used to determine total
anthocyanin content. The method determines total content of monomeric
anthocyanin via changes in absorbance of anthocyanin chromophore at pH 1.0
and pH 4.5 respectively. Under different pH environment, monomeric
anthocyanins exist in different forms by going through a reversible structural
transformation. The coloured oxonium form of monomeric anthocyanin
![Page 30: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/30.jpg)
13
predominates at pH 1.0 while the colourless hemiketal form predominates at pH
4.5. The total anthocyanin content is often expressed as the equivalents of a
commonly found monomeric anthocyanin, cyanidin-3-glucoside (Lee 2005).
Vitamin E isomers can be analysed via high performance liquid
chromatography (HPLC). The separation of different vitamin E isomers can be
performed via both normal-phase HPLC (Kamal-Eldi et al. 2000; Panfili,
Fratianni & Irano 2003) and reverse-phase HPLC (Chen & Bergman 2005;
Grebenstein & Frank 2012). Various combinations of solvents have been used
as the mobile phase of HPLC and detection of the compounds can be done with
either ultraviolet (UV) detector or a fluorescence detector. Due to the high
sensitivity and selectivity of fluorescence detector as compared to UV detector,
it is more commonly used in the analysis of vitamin E isomers (Cunha et al.
2006). Under normal phase HPLC chromatographic method, proper separation
of all 8 different isomers of vitamin E can be performed easily. Contrarily, a
reversed phase HPLC chromatographic method fails to separate β- and γ-
isomers of tocopherol (T) and tocotrienols (T3) (Finocchiaro et al. 2007).
Analysis of γ-oryzanol can be performed via UV-spectrophotometry
(Bucci et al. 2003), normal phase and reversed phased HPLC (Yoshie et al.
2009), and gas chromatography (Miller et al. 2003). Simultaneous analysis of
tocopherols, tocotrienols and γ-oryzanol from rice can be performed via a
modified mobile phase in gradient mode (Chen & Bergman 2005). UV
spectrophotometric analytical approach of γ-oryzanol has reported higher
content of total γ-oryzanol content (by 2-folds) as compared to HPLC approach
(Bucci et al. 2003). Two factors were known for causing the difference: (1) the
use of oil-based solvent system and (2) low concentration of γ-oryzanol in
sample (Bucci et al. 2003). Significant difference in total γ-oryzanol content
between the two analytical approaches was observed with samples suspended
in n-heptane and those with low concentration of γ-oryzanol. This is due to the
fact that UV spectrophotometer tends to pick up non-negligible interference
from the oil-matrix at absorbance wavelength of 315nm and hence causing
inaccuracies in the reported results. Based on the findings of Bucci et al. (2003),
they reported dose-dependent interactions between the concentration of
γ-oryzanol in different rice bran oils and the detection accuracy of γ-oryzanol
![Page 31: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/31.jpg)
14
via UV spectrophotometer. UV spectrophotometer detected relatively higher
total content of γ-oryzanol in samples containing low concentration of solute
than those detected via HPLC (0.82mg/g of γ-oryzanol versus 0.40mg/g of γ-
oryzanol respectively). As of those samples with higher concentrations of γ-
oryzanol, the results of both detection methods were comparable. UV
spectrophotometry detected total amount of 10.9mg/g of γ-oryzanol while HPLC
detected total amount of 9.8mg/g of γ-oryzanol (Bucci et al. 2003).
Depending on the solvent system of the test compound, maximum
absorption wavelength of γ-oryzanol varies between the ranges of 315nm to
327nm. Alcohol-based solvent system (max λ = 327nm) has more accurate
results when γ-oryzanol is detected via UV spectrophotometric approach with
negligible interferences from oil-matrix. For oil-based solvent system (max λ =
315nm), a second derivative analysis can be performed to eliminate the
interferences from oil matrix (Bucci et al. 2003). As for HPLC approaches,
depending on the choice and alteration in the composition of solvent system,
different γ-oryzanol derivatives can be separated. However, quantification of
individual γ-oryzanol components remain as a challenge due to lack of
commercially available pure reference standards (Goufo & Trindade 2014).
![Page 32: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/32.jpg)
15
2.2.3 Rice Antioxidants
Controversies over the safety of synthetic antioxidants in processed
foods and their use as food additives have sparked the concerns of many
health-conscious consumers. Butylated hydroxyanisole (BHA) and butylated
hydroxytoluene (BHT) are the commonly used synthetic antioxidants for
preservation of fatty food (Addis 1986). However, long term exposures to these
synthetic antioxidants have been reported capable of promote tumour formation
and develop carcinogenic effects in organs such as liver, forestomach, and
glandular stomach (Hirose et al. 1998; Ito et al. 1983; Ito, Fukushima & Tsuda
1985; Williams 1986; Williams & Iatropoulos 1996). This has led to an increase
in research interests that target on natural antioxidants (Islam et al. 2014).
Natural antioxidants are defined as phenolic or polyphenolic compounds
derived from plant materials. Fruits, vegetables and nuts are common sources
of natural antioxidants. Although these foods contain significant amount of
natural occurring antioxidants, types and amount of antioxidants present in
these foods differ from one another. Some of these natural antioxidants include
polyphenols, flavonoids, anthocyanins, vitamins, and resveratrol (Tsuda et al.
2002a).
Numerous scientific evidences have shown that frequent dietary intake of
antioxidant-rich food are commonly linked with low incidence of oxidative stress
associated diseases (Tsuda et al. 2002a). Research on natural antioxidants
have shown positive health effects towards cardioprotection, inflammation, anti-
infection, liver protection, anti-diabetic, anti-obesity and neurodegenerative
processes (Aedín, José & Peter 2012; Anne & Barrie 2008; Biasutto, Mattarei &
Zoratti 2012; Cesar & Patricia 2012; Chang et al. 2009; Mireia et al. 2012).
These naturally occurring bioactive constituents provide a defence system to
the body by eliminating free radicals and protect the body against oxidative
injuries. They prevent the initial stage of free radicals formation and hinder the
progression of oxidative chain reaction that may subsequently lead to
production of secondary radical species (Mukhopadhyay 2000).
There have been a lot of research works focusing on the identification
and elucidation of action mechanisms of rice antioxidants. Such research efforts
![Page 33: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/33.jpg)
16
remain on-going and have gained considerable interest since the establishment
of positive correlation between rice consumption and low incidence of
cardiovascular diseases and cancers among Asian populations (Hudson et al.
2000). In the following, general descriptions on some of the different types of
antioxidants present in rice will be highlighted and discussed. These include
phenolic acids, flavonoids and anthocyanins which are collectively categorized
under the group of polyphenols, and other antioxidants such as γ-oryzanol and
vitamin E.
2.2.3.1 Polyphenols
Polyphenols exist abundantly in the diet. They are known as the dietary
antioxidants, accounted for approximately 1g/d of the total dietary intake and
considerably much higher than other classes of phytochemicals. Primary
sources of polyphenols include fruits, vegetables and legumes (Scalbert,
Johnson & Saltmarsh 2005). They are the secondary metabolites produced by
plants to protect themselves against aggression by external factors such as
ultraviolet radiation and pathogens. Aside from protecting the plants, health
effects of polyphenols have come to the attention of food nutrition researchers
with research evidences of their credible effects in prevention and treatment of
oxidative stress associated diseases (Manach et al. 2004).
Figure 2-2: Chemical structure of phenol functional group.
All polyphenols have characteristic phenol functional groups, each
consisting of a hydroxyl group (-OH) attached to an aromatic ring (Figure 2-2).
There are thousands of polyphenols that have been identified to-date. The
![Page 34: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/34.jpg)
17
limitless arrangement of polyphenolic structures have accounted for the
diversity and complexity of different polyphenols. They are differentiated by the
number of phenol group and other structural elements (arrangement of carbon
atoms) that link each and every one of the rings. Despite the vast array of
structural complexity, polyphenols can still be categorized into two main groups:
flavonoid polyphenols and non-flavonoid polyphenols (Navindra 2010). Each
group is further sub-divided into smaller groups. Sub-groups of flavonoid
polyphenols include flavonols, flavones, isoflavones, flavanones, flavanols, and
anthocyanins. As for non-flavonoid polyphenols group of compounds, it consists
of phenolic acids, stilbenoids, and lignans (Navindra 2010). The following
illustrates the general structures of different types of polyphenols (Table 2-1):
Table 2-1: General chemical structures of different sub-groups of
polyphenols (Navindra 2010)
Flavonoid Polyphenols
Flavonol
Flavone
Isoflavone
Flavanone
![Page 35: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/35.jpg)
18
Flavanol
Anthocyanin
Non-Flavonoid Polyphenols
Phenolic Acid
Stilbenoid
Lignans
![Page 36: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/36.jpg)
19
In the following literature reviews, three major sub-groups of polyphenols
present in rice will be briefly discussed. The three major sub-groups of
polyphenols include: phenolic acids, flavonoids and anthocyanins.
2.2.3.1.1 Phenolic Acids in Rice
Phenolic acids have a general structure consisting of a phenolic ring and
a carboxyl functional group (Goufo et al. 2014b) (general chemical structure of
phenolic acid is depicted in Table 2-1). Sinapic acid, gallic acid, ferulic acid, and
p-coumaric acid are some of the common types of phenolic acids (Navindra
2010). Antioxidant properties of phenolic acid are attributed to the presence of
phenolic ring that neutralize unpaired electrons.
The strength of phenolic acid’s antioxidant capacity corresponds to both
number and position of hydroxyl (-OH) group on the phenolic ring (Heuberger et
al. 2010). To date, a total of twelve different types of phenolic acids have been
identified and their respective contents varies among different rice varieties as
well as in different parts of the rice. In general, ferulic acid accounted for the
most abundant type of phenolic acid in the endosperms, whole grains and bran
of the rice (Goufo & Trindade 2014). P-Coumaric acid comes in second and
later followed by other phenolic acids such as sinapic acid and gallic acid
respectively. There are also additional phenolic acids that have been identified
in rice but still need to be further validated (Chen et al. 2012; Fujita et al. 2010;
Vichapong et al. 2010).
2.2.3.1.2 Flavonoids in Rice
Flavonoids have a general chemical structure, consisting of two 6-carbon
aromatic rings and interlinked by carbon chain made of three carbons.
Flavonoids are sub-divided into different groups, namely flavonols, flavanols,
flavanonols, flavones, isoflavones and anthocyanins (Navindra 2010). As an
antioxidant, flavonoids scavenge free radicals by donating electrons to
neutralize and stop the chain reactions caused by radical species. Such
![Page 37: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/37.jpg)
20
activities are credited to the presence of hydroxyl (-OH) groups on the 3’- and
4’- carbon of the three carbons chain (Figure 2-3) (Cho et al. 2013; Kim et al.
2010).
Figure 2-3: Basic structural configurations of different flavone and flavonol
derivatives [image source: (Tanaka & Takahashi 2013)]
To date, there are seven types of flavonoids in rice that have been
reported. These flavonoids include quercetin, myricetin, isorhamnetin, luteolin,
kaempferol, apigenin, and tricin which accounted for the major types of
flavonoids found in rice (Goufo & Trindade 2014).
![Page 38: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/38.jpg)
21
2.2.3.1.3 Anthocyanins in Rice
Anthocyanins are a group of compounds that is categorized under the
flavonoids family. The compounds are the glycosylated and stabilized forms of
anthocyanidins (Yonekura-Sakakibara et al. 2009). Anthocyanins are commonly
found in plant tissues. They are pigmented and soluble in water, and are
responsible for imparting colours to plant materials (Navindra 2010). The free
radical scavenging activities of anthocyanins are generally attributed to the
chemical structure of the compounds. The compound basically exists in the
form of acylglycosides and O-glycosides (in either mono-, di- or tri-
configuration) of anthocyanidins in which the sugar functional group can be
replaced by hydroxycinnamic, aliphatic or hydroxybenzoic acids (Goufo &
Trindade 2014). There are a total of eighteen different types of anthocyanins
that have been identified in rice. Among the eighteen, only four types of
anthocyanins were quantified (Goufo & Trindade 2014), namely peonidin-3-O-
glucosides, cyanidin-3-O-galactoside, cyanidin-3-O-glucoside and cyanidin-3-O-
rutinoside. Among the four types of anthocyanins, both cyanidin-3-O-glucoside
and peonidin-3-O-glucoside predominate and is then followed by both cyanidin-
3-O-rutinoside, and cyanidin-3-O-galactoside (Hou et al. 2013; Shao et al.
2014).
2.2.3.1.4 Heath Benefits of Polyphenols
Health benefits of polyphenols are largely associated with their
prominent antioxidative potency. As antioxidants, polyphenols protect cells from
oxidative injuries by scavenging free radicals or trigger the endogenous defence
systems. The phenolic functional groups of polyphenols are able to disrupt the
oxidative chain reactions in cellular components by accepting free electron and
form stable phenoxyl radicals. Thus, this limits the formation of reactive oxygen
species (Scalbert et al. 2005). In addition to antioxidant properties of
polyphenols, other health protective benefits of polyphenols in prevention of
degenerative diseases such as cardiovascular diseases, neurodegenerative
diseases and cancers have been widely studied and are evidently supported by
positive outcomes in various animals and cell line study models (Scalbert et al.
![Page 39: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/39.jpg)
22
2005). An overview of the health benefits and molecular targets of polyphenols
is depicted in the following figure (Figure 2-4).
![Page 40: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/40.jpg)
23
Anti-diabetic
Prevent uptake of glucose in the gut and peripheral tissues (Matsui et al. 2002)
Regulate transport of glucose from stomach to small intestine (Dembinska-Kiec et al. 2008)
Modulate sirtuin-1 (SIRT1) to improve glucose homeostasis and insulin sensitivity (Milne et al. 2007)
Antioxidant
Increase plasma antioxidant capacity (Pandey & Rizvi 2009)
Absorb pro-oxidative food components (eg. Iron) (Scalbert et al. 2005)
Scavenge free radicals (Pandey & Rizvi 2009)
Reduce oxidative damage (Luqman & Rizvi 2006)
Reduce risk of oxidative stress associated degenerative diseases (Pandey & Rizvi 2010)
Neuro-protection
Polyphenols
Inhibit nuclear factor kappa-β signaling to prevent microglia-dependent β-amyloid toxicity (Markus & Morris 2008)
Scavenge free radical to prevent oxidative damage on brain macromolecules (Pandey & Rizvi 2009)
Reduce risk of Parkinson’s disease (Rossi et al. 2008)
Scavenge neurotoxin, N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) and MPTP mediated radicals (Rossi et al. 2008)
Activate MAP kinases for cell survival (Rossi et al. 2008)
Figure 2-4: General pharmacological properties and biological mechanism/molecular targets of polyphenols
Anti-cancer
Cardiovascular Protection
Inhibit oxidation of low density lipoprotein (LDL) cholesterol (Aviram et al. 2000)
Prevent disruption of atherosclerotic plaques (Garcia-Lafuente et al. 2009)
Improve high density lipoprotein (HDL) cholesterol level (Garcia-Lafuente et al. 2009)
Regulates endothelial function that via vasoconstriction and vasodilation (Pirola & Frojdo 2008)
Induce cell cycle arrest and cell apoptosis (Garcia-Lafuente et al. 2009)
Regulate host immunity system (Sharma & Rao 2009)
Inhibit proliferation of cancerous cells (Pandey & Rizvi 2009)
Halt the conversion of pro-carcinogens into their active forms (Pandey & Rizvi 2009)
Quench cancer-causing free radicals (Kamaraj et al. 2007)
![Page 41: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/41.jpg)
24
2.2.3.2 Gamma-Oryzanol
Steryl ferulates (also known as γ-Oryzanol) are mixtures of ferulate
esters with sterols or triterpenes. There are four main components of steryl
ferulates, namely campesteryl ferulates, cycloartenyl ferulates,
24-methylenecycloartenyl ferulates and β-sitosteryl ferulates (Figure 2-5)
(Kozuka et al. 2012). These are the phenolic compounds that can be found in
cereal grains such as rice, corn, wheat, barley and rye (Kiing et al. 2009).
Among all of them, rice has the highest content of steryl ferulates.
γ-Oryzanol was first being isolated from rice bran oil by Kaneko and
Tsuchiya (1954) while other constituents of γ-Oryzanol and its derivatives were
later discovered by Xu and Godber (1999), and Fang, Yu and Badger (2003).
Ever since the discovery of γ-oryzanol, numerous works have been conducted
to thoroughly assess the therapeutic properties of the compound.
2.2.3.2.1 Health benefits of γ-Oryzanol
The antioxidant activity of γ-Oryzanol significantly contributes to overall
health benefits of the compound. It has phenol and ferulic acid functional
groups that are able to quench free radicals. The phenol moiety of the
compound is able to accept free radicals to form stable phenoxyl radicals while
the ferulic acid functional group donates electrons to disrupt the actions of free
radicals (Lemus et al. 2014).
γ-Oryzanol was found to have strong and superoxide dimutase-alike
antioxidant properties as reported from several in vitro systems, animal models
and human subjects’ studies (Gerhardt & Gallo 1998; Hundemer et al. 1991;
Vissers et al. 2000). The compound has been proposed as a natural antioxidant
additive to food, cosmetic and pharmaceutical products (Kim & Godber 2001;
Nanua, McGregor & Godber 2000). In addition to that, γ-Oryzanol has been
reported to possess cholesterol-lowering, anti-inflammatory, anticancer and
anti-diabetic properties as shown in several animal and cell-line models (Islam
et al. 2008; Jin Son et al. 2010; Son et al. 2011). The pharmacological activities
and biology actions of γ-Oryzanol are summarized in Figure 2-6.
![Page 42: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/42.jpg)
25
Figure 2-5: Chemical structure of four major constituents of γ-oryzanol: (A)
cycloartenyl ferulate; (B) campesteryl ferulate; (C) 24-
methlenecycloartenyl ferulate; (D) β-sitosteryl ferulate.
(B)
(C)
(D)
(A)
![Page 43: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/43.jpg)
26
Antioxidant
Anti-cancer
Cardioprotection
Anti-diabetic
γ-Oryzanol
Inhibit tumor mass and growth (Kim
et al. 2012)
Promote cytolytic activity of natural
killer (NK) cells (Kim et al. 2012)
Reduce number of blood vessels in
tumor (Kim et al. 2012)
Reduce expression and release of
pro-angiogenic biomarkers (Kim et
al. 2012)
Inhibit cancer cell proliferation and
alter cancer cell cycle (Henderson
et al. 2012)
Quench organic radicals and prevent
lipid peroxidation (Juliano et al. 2005)
Enhance activities of cellular antioxidant
enzymes in high fat-induced oxidative
stress (Jin Son et al. 2010)
Improve radical scavenging activities of
cellular antioxidant enzyme, glutathione
reductase (Jin Son et al. 2010)
Stimulate pancreatic release of glucose-
stimulate insulin (Kozuka et al. 2013)
Relieve endoplasmic recticulum for
proper regulation of glucose-stimulated
insulin (Kozuka et al. 2013)
Possess hypoglycemic effect (Ghatak &
Panchal 2012)
Regulate pancreatic enzymes involved
in glucose production (Ghatak &
Panchal 2012)
Inhibit lipid peroxidation (Juliano
et al. 2005)
Lower plasma cholesterol and
low density lipoprotein (LDL)
cholesterol level (Seetharamaiah
& Chandrasekhara 1989)
Prevent arterial inflammation by
regulating inflammatory
cytokines and mediators (Islam
et al. 2008)
Increase level of high density
lipoprotein (HDL) cholesterol
(Seetharamaiah &
Chandrasekhara 1989)
Reduce formation of aortic fatty
streak (Rong, Ausman &
Nicolosi 1997)
Figure 2-6: General pharmacological properties and biological mechanism/molecular targets of γ-oryzanol
![Page 44: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/44.jpg)
27
2.2.3.3 Vitamin E
In the human diet, vitamin E is a crucial nutrient and is widely known for
its strong antioxidant properties (Wong & Radhakrishnan 2012). Ever since the
discovery of vitamin E in 1922, many studies have been focusing on the health
and pharmaceutical benefits of the two major forms of vitamin E, namely
tocopherol and tocotrienol (Wolf 2005) (Figure 2-7). All derivatives have a
hydroxyl functional group (-OH) attached to chromanol rings. Each group
consists of four different isomeric forms distinguished by the degree of
substitution of methyl groups (-CH3) in the chromanol head (Liva 2008) and.
The α-isoform consists of three methyl groups, while both of the γ- and β-
isoforms have two methyl groups, and the δ- isoform with only one methyl
group (Vasanthi, Parameswari & Das 2012). The key structural difference
between tocopherol and tocotrienol lies within their carbon side chains.
Tocopherol has a long saturated carbon side-chain (also known as the phytyl
tail) while tocotrienol has a short unsaturated carbon side-chain (the farnesyl tail)
(Drotleff & Ternes 2001).
Figure 2-7: General chemical Structures of (A) tocopherol and (B) tocotrienol.
[Image source: (Wolf 2005)]
R1 R2
Alpha derivative – -CH3 -CH3
Beta derivative – -CH3 -H
Gamma derivative – -H -CH3
Delta derivative – -H -H
(A)
(B)
![Page 45: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/45.jpg)
28
In rice, major portion of the vitamin E content consists of tocotrienols
(Goufo & Trindade 2014). Among the four different derivatives of tocotrienols, γ-
tocotrienol accounted for the highest content to the total tocotrienols content in
rice and later followed the remaining derivatives such as α-tocotrienols, δ-
tocotrienols, and β-tocotrienols (Min, McClung & Chen 2011; Yu et al. 2007). In
addition to the four tocotrienols derivatives, two additional novel tocotrienols
derivatives were isolated from rice bran and they were characterized as
desmethyl tocotrienol and didesmethyl tocotrienol respectively (Qureshi et al.
2000).
2.2.3.3.1 Health Benefits of Vitamin E (Tocotrienols)
Nonetheless, α-tocopherol was once the most widely studied vitamin and
little emphasis was placed on tocotrienols. It was only discovered in the 1980s
and 1990s that tocotrienol is 40 to 60 folds more potent antioxidant than
tocopherol. Besides that, it has cholesterol lowering properties which are absent
in tocopherol (Qureshi et al. 1995; Sen, Khanna & Roy 2006; Tan 2005). Since
then, tocotrienols began to draw attention for studies of their health-related
biological significance. Evidence suggests that biological actions of tocotrienol
are more potent than tocopherol. Such properties are generally attributed to the
short carbon side chain of tocotrienol, which allows the compound to have
better intra- and inter- cellular mobility between the lipid membranes (Suzuki et
al. 1993; Yoshida, Niki & Noguchi 2003). Contrarily, the long carbon side chain
of tocopherol has a higher tendency of anchorage into the phospholipids
membranes and hence restricts its mobility (Yoshida, Niki & Noguchi 2003). As
such, this could possibly justify the stronger antioxidant properties of
tocotrienols compared to those of tocopherols (Serbinova et al. 1991).
In addition, among the different isomers of tocotrienols, the potency of
biological actions is arranged as follows: δ- > γ- > α- > β- derivatives. This is
attributed to degree of substitution and location of methyl group at the
chromanol ring of each derivatives (Anne & Barrie 2008). It is suggested that
the tocotrienol isoform that has fewer substitutions of the methyl group and
![Page 46: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/46.jpg)
29
absence of methyl group at the C5 position of its chromanol ring has higher
bioactivity. Among the four isomers, only γ- and δ- tocotrienols do not have a
methyl group at the C5 position (Tan 2005).
The pharmacological effect of tocotrienols is widely linked to its strong
antioxidant properties which generally attributed to the presence of redox active
hydroxyl group (-OH) in the chromanol ring (Litwack 2007). It was found to
regulate various anti-oxidizing enzymes to actively scavenge free radicals,
which are among the primary sources for causing various chronic diseases
(Hsieh & Wu 2008; Lee, Mar & Ng 2009; Newaz & Nawal 1999). In addition,
anti-cancer properties of tocotrienols in growth suppression and anti-
proliferation of cancer cells have also been described in recent research
publications. Other pharmacological properties such as anti-cholestrolemic,
anti-hypertensive, anti-diabetic, cardioprotective and neuro-protective have also
been reported from in vitro and in vivo study models (Figure 2-8) (Alexander
2008).
![Page 47: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/47.jpg)
30
Antioxidant Anticholesterol and
Cardioprotection Anti-inflammatory
Neuroprotective and Anti-diabetic
Anti-cancer
Figure 2-8: General pharmacological properties and biological mechanism/molecular targets of tocotrienol
Inhibits the biosynthesis of
cholesterol (Qureshi et al. 1986)
Prevents arterial inflammation
(Aggarwal et al. 2010; Henryk 2008)
Reduces concentration of plasma
cholesterol and low-density
lipoprotein (LDL) cholesterol
(Qureshi et al. 1991)
Activates a range of antioxidant
enzymes (Adam et al. 1996; Hsieh
& Wu 2008; Lee, Mar & Ng 2009;
Newaz & Nawal 1999)
Removes the reactive oxygen
species (ROS) (Renuka Devi &
Arumughan 2007)
Reduces oxidative stresses
(Renuka Devi & Arumughan 2007)
Regulates transcription factors of NF-kappaB (Ahn et al. 2007)
Suppresses inflammatory mediators (Ahmad et al. 2005)
Suppresses COX-2 activity and inducible nitric oxide synthases (Wu & Ng 2010a)
Induces tumour growth suppression
(Agarwal et al. 2004)
Induces cell apoptosis (cell death)
(Kashiwagi et al. 2008)
Regulates various growth factors that are
responsible for tumour formation and
tumour suppression (Agarwal et al. 2004;
Weng-Yew et al. 2009; Wu & Ng 2010b)
Prevents glutamate induced neuronal cell
death (Sen, Khanna & Roy 2004; Sen et
al. 2000)
Attenuates diabetic neuropathy (Kuhad &
Chopra 2009)
Regulates biochemical changes linked to
diabetes (Kuhad & Chopra 2009)
Tocotrienols
Antioxidant
![Page 48: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/48.jpg)
31
2.3 Research Aims and Objectives
The main aim for this part of the research work was to extract natural
antioxidants from rice bran of different Sarawak local rice varieties. In order to
achieve the aforementioned objective, experimental works were designed to
fulfil the following objectives:
a. Extraction of natural antioxidant compounds from rice bran of different
Sarawak local rice varieties via simple solvent extraction method.
b. Assessment of the contents of antioxidant compounds derived from RBE
of different Sarawak local rice varieties.
c. Quantitative analyses of antioxidant compounds derived from RBE via
UV-Visible Spectrophotometer (UV-Vis) and High Performance Liquid
Chromatography (HPLC).
2.4 Experimental Design
2.4.1 Materials and Chemicals
2.4.1.1 Rice Samples
A total of nine different Sarawak local rice samples were used in this
study. The whole rice grain samples were provided by Department of
Agriculture Sarawak, Malaysia, sourced from local rice plantation sites that are
based in Sri Aman and Bario (for ‘Padi Bario’), in Sarawak, Malaysia. The local
names for the nine rice samples are ‘Padi Bubuk’, ‘Padi Bajong’, ‘Padi Bajong
LN’, ‘Padi Wangi Mamut’, ‘Padi Bali’, ‘Padi Bario’, ‘Padi Biris’, ‘Padi Pandan’,
and MR219, which is a commercially grown rice variety. Among all the test
samples, Bajong LN, Bali and Wangi Mamut are pigmented rice. The images of
the rice grains are summarized in the table (Table 2-2) as follow:
![Page 49: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/49.jpg)
32
Table 2-2: Sample images (showing whole rice grain and de-husked rice grain) of
different rice samples.
Sarawak Local Rice Varieties
Local Name:
‘Padi Bubuk’
Local Name:
‘Padi Bajong’
Local Name:
‘Padi Bajong LN’
Local Name:
‘Padi Wangi Mamut’
Local Name:
‘Padi Bali’
Local Name:
‘Padi Bario’
![Page 50: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/50.jpg)
33
Local Name:
‘Padi Biris’
Local Name:
‘Padi Pandan’
Name:
MR219*
*(Commercially cultivated rice grains)
2.4.1.2 Chemicals
Analytical grade methanol (MetOH) (EMSURE®), HPLC grade methanol
(MetOH), hydrochloric acid (HCl) and Folin-Ciocalteu’s reagent were purchased
from Merck (Darmstadt, Germany). Absolute ethanol (EtOH) was purchased
from Fisher Scientific (Malaysia). Glacial acetic acid (CH3COOH) was
purchased from J.T Baker (Thailand). Potassium chloride (KCl) and sodium
acetate (NaOAc) were purchased from R&M (Malaysia). Sodium carbonate
(Na2CO3) and sodium hydroxide (NaOH) were purchased from Unichem
(Malaysia). Sodium nitrite (NaNO2) was purchased from Bendosen (Malaysia).
Aluminium trichloride (AlCl3) was purchased from Acros Organics. Gallic acid
was purchased from NextGene. Quercetin was purchased from Sigma Aldrich.
Tocomin50 (Carotech, Malaysia) standard was a gift in kind given by Prof. Yuen
Kah Hay and Dr. Sherlyn Lim from Universiti Sains Malaysia (USM).
![Page 51: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/51.jpg)
34
2.4.2 Rice Sample Treatment and Preparation of Rice Bran Sample
All immature and diseased whole rice grains were first removed manually
via hand pick from the healthy grains. Then, all the healthy whole rice grains
were pre-dried in forced air drying oven (TFAC-136 Drying Oven, Tuff)
overnight at 70ᵒC to remove moisture and to minimize deterioration in milling
quality of rice grains (Ondier, Siebenmorgen & Mauromoustakos 2012). The
dried whole rice grains were then stored in air tight bags and kept in -22ᵒC
freezer until further use.
For preparation of rice bran sample, rice milling machine (N6.0II, Saint
Donkey) was used to separate the husk layer, bran layer and rice of the whole
grains. The collected brans were immediately filtered through sieves to remove
residual husk layers that were carried over during the milling process. The
filtered brans were then stored in air tight bags and kept in -22ᵒC freezer until
further use. Storing rice bran at cold temperature helps to stabilize the bran
from becoming rancid as a result of oxidation mediated by enzymatic reaction of
lipases (Nagendra Prasad et al. 2011; Randall et al. 1985).
![Page 52: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/52.jpg)
35
2.4.3 Methodology
Figure 2-9 summarises the overview of experimental approaches
applied for extraction and analysis of antioxidants derived from rice bran
samples of different Sarawak local rice varieties.
Figure 2-9: Overview of experimental approaches applied for extraction of
antioxidants from rice bran samples and determination of the
contents of antioxidants in the extracts.
.
2.4.3.1 Simple Solvent Extraction
Extraction of antioxidants from rice brans was carried out at a sample
mass to solvent ratio of 1:10 [weight (g)/volume (mL)], using 3g of rice bran and
30mL of analytical grade methanol. The mixture was stirred continuously on a
stirring hot plate (Stirring Hot Plate HS0707V2, Favorit) for 30 minutes, at room
temperature. After 30 minutes, the RBE were centrifuged (Centrifuge 5702,
Eppendorf) for 10 minutes at 1,000 RPM. The supernatants were collected and
extraction of the residual bran samples were repeated twice more and all the
supernatants were combined.
Extracts with known
concentration in (µg/mL)
RBE
Rice Bran
High Performance
Liquid Chromatography
Extraction with Methanol (MetOH)
Extract
Lyophilization
Reconstituted
Extract
Total Phenolic Content
Total Flavonoid Content
Total Anthocyanin Content
Total γ-Oryzanol Content
Vitamin E (Tocotrienols)
UV-Visible
Spectrophotometry
![Page 53: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/53.jpg)
36
The solvent in the collected extracts were then evaporated using rotary
evaporator at 35°C (RE300, Yamato) and were further concentrated using
vacuum concentrator (7810037, Labconco) until the extracts were fully
lyophilized. The lyophilized extracts were then weighed and kept in -22ᵒC
freezer until further use. For the analysis of rice bran antioxidants, a known
concentration stock solution of crude extract was prepared by dissolving the
lyophilized extract samples in absolute ethanol. The prepared stocks were then
used to prepare a series of diluted samples.
2.4.3.2 Determination of Total Phenolic Content
Total phenolic contents of RBE were determined as per method of
Singleton and Rossi (1965) with slight modification. Briefly, 10µL of RBE were
aliquoted onto a 96-wells plate. Then 40µL of 7.5% (w/v) sodium carbonate
(Na2CO3) was added into each well and later followed by the addition of 50µL of
Folin-Ciocalteu reagent (diluted 10 folds). The solutions were allowed to stand
in the dark and at room temperature for 60 minutes. Then, the absorbance of
the solutions was measured using a microplate reader (Synergy HT, Biotek) at
765nm. Different concentrations of gallic acid (10-100mg/mL) were used to
prepare a standard curve and the total phenolic contents of extracts were
expressed in mg of gallic acid equivalents (GAE) per gram of dried extract.
2.4.3.3 Determination of Total Flavonoid Content
Total flavonoid content of RBE were determined via the aluminium
trichloride method as per method of Jia, Tang and Wu (1999) and Herald,
Gadgil and Tilley (2012) with slight modification. Briefly, 250µL of RBE were
mixed with 1mL of ultra-pure water (Milipore) and 75µL of 5% (w/v) of sodium
nitrite (NaNO2). The mixtures were vortexed (Maxi Mix II, Barnstead
International) thoroughly for 5 minutes. Then, 150µL of 10% (w/v) aluminium
trichloride (AlCl3) was added into all the mixtures respectively and were allowed
to incubate for 6 minutes at room temperature. Later, 500µL of 1M sodium
![Page 54: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/54.jpg)
37
hydroxide (NaOH) and 500µL of ultra-pure water were added into the mixtures.
The mixtures were then centrifuged at 3,000 RPM for 5 minutes to eliminate the
precipitates. Finally, the absorbances of the collected supernatants were
measured via UV-Visible Spectrophotometer (Cary 50 Conc UV-Visible
Spectrophotometer, Varian). Different concentrations of quercetin
(0.008-1.000mg/mL) were used to prepare standard curve and the total
flavonoid contents of RBE were expressed in the unit of mg of quercetin (QE)
equivalents per gram of dried extract.
2.4.3.4 Determination of Total Anthocyanin Content
Total anthocyanin content of RBE were assessed via pH differential
method as per method of Giusti and Wrolstad (2001). Briefly, 25µL of RBE were
mixed with 175µL of 0.024M potassium chloride (KCl) buffer (pH 1.00) onto a
96-wells microplate. The mixtures were left aside for 15 minutes before
absorbance was measured via microplate reader (Synergy HT, Biotek) at
510nm and 700nm respectively. Another 96-wells microplate was set up,
consisting of mixtures of 25µL of RBE and 175µL of 0.025M sodium acetate
(NaOAc) buffer (pH 4.5). The mixtures were also left aside for 15 minutes
incubation at room temperature before their respective absorbances were read
at 510nm and 700nm respectively. The following equations were used to
calculate the total anthocyanin content of RBE:
Equation 1: Absorbance = (A510nm – A700nm)pH 1.0 – (A510nm – A700nm)pH 4.5
Equation 2: Total Anthocyanin Content = 𝐀 𝐱 𝐌𝐖 𝐱 𝐃𝐅 𝐱 𝟏𝟎𝟎𝟎
𝐌𝐀 𝐱 𝟏
*Equation 1 determines the variation in absorbance between two pH buffer
systems.
*Equation 2 determines the total anthocyanin content of sample in the unit of
mg cyanidin-3-glucoside equivalent per mass of sample, in which:
![Page 55: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/55.jpg)
38
A = Difference in Absorbance from Equation 1
MW = Molecular weight of cyanidin-3-glucoside (C3G) (449.2g/mol)
DF = Sample dilution factor
MA = Molar absorptivity (equivalent to 26900)
2.4.3.5 Determination of Total Gamma Oryzanol (γ-Oryzanol) Content
Total γ-oryzanol contents of RBE were determined
spectrophotometrically as per method of Bucci et al. (2003) with slight
modification by using a UV-Visible Spectrophotometer (Cary 50 Conc UV-
Visible Spectrophotometer, Varian). Briefly, the analysis was performed at the
wavelength in the range between 250nm to 800nm. Maximum absorption
spectrum of γ-Oryzanol was determined at 327nm. Different concentrations of
γ-oryzanol reference standards were used to create a standard calibration
curve and the total γ-oryzanol content of RBE were expressed in unit of mg of
γ-oryzanol per kg of sample.
![Page 56: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/56.jpg)
39
2.4.3.6 Determination of Vitamin E Content
Vitamin E contents of RBE were determined via a reversed phase High
Performance Liquid Chromatography (HPLC) system (Agilent 1260 Infinity LC,
Agilent Technologies) coupled with a fluorescence detector (Agilent 1260
Infinity Fluorescence Detector, Agilent Technologies). Briefly, stock RBE of
each rice varieties was diluted 40 times with HPLC grade methanol. All samples
were filtered through 0.45µm PTFE filter prior to sample injection into HPLC. A
solvent system consisting of 100% HPLC grade methanol was delivered to a
4.6 x 250mm, 5µm C-18 column (Zorbax SB-C18, Agilent Technologies).
Separation of vitamin E isomers was performed in isocratic elution mode at a
flow rate of 1.0mL/min and column temperature was kept at 25ᵒC. A sample
injection volume of 25µL was injected into the HPLC and the vitamin E
derivatives were detected at the excitation wavelength of 296nm and emission
wavelength of 330nm. Tocomin50, a mixture of tocotrienols and tocopherol
derived from palm oil was used as reference standard.
2.4.3.7 Statistical Analysis
All results data were presented as mean and standard deviation of three
consecutive experimental repetitions on similar sample. Statistical tool,
GraphPad Prism (GraphPad Software, Inc. USA) was used to analyse the data
via one-way analysis of variance (ANOVA). The differences among test
samples were determined via Tukey’s multiple comparison test with significance
and confidence level set at P ≤ 0.05.
![Page 57: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/57.jpg)
40
2.4.4 Results and Discussion
2.4.4.1 Determination of Total Phenolic Content
In the following study, total phenolic contents of nine different types of
rice brans from local rice varieties were analysed. The total phenolic contents of
rice brans were determined via a modified Folin Ciocalteu’s assay method. The
total content was expressed in unit of gallic acid equivalent (in mg) per g of
dried extract. As summarized in Table 2-3, only total phenolic contents in RBE
of Bajong, Bajong LN, Bali and Pandan varied significantly (P ≤ 0.05) while no
significant difference was determined between the remaining RBE samples.
Based on the result, the total phenolic contents of all the RBE ranged between
1.34mg GAE/g and 46.80mg GAE/g dried extract.
Table 2-3: Total phenolic contents of RBE. Values expressed represent mean ±
standard deviation of 3 concecutive repetitions (n=3). Different letters
within the same column denote significant difference at
P ≤ 0.05 (Tukey’s Test). GAE = Gallic Acid Equivalent. Graphical
representation for the following data is presented in Figure 5-1
(Appendix Section).
RBE of Different Rice Varieties
Total Polyphenol Content
(mg GAE/g dried extracts)
Bajong LN 46.80 ± 2.80a
Bali 18.66 ± 2.09b
Pandan 10.99 ± 0.17b
Wangi Mamut 5.89 ± 0.64c
Bajong 3.60 ± 0.43cd
MR219 3.59 ± 0.38cde
Bario 2.04 ± 0.35def
Biris 1.73 ± 0.18defg
Bubuk 1.34 ± 0.29deg
![Page 58: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/58.jpg)
41
In the present study, three out of nine samples are pigmented rice
varieties. The three pigmented rice varieties are Bajong LN, Bali and Wangi
Mamut. RBE derived from Bajong LN, Bali and Wangi Mamut generally showed
a higher total phenolic content as compared to non-pigmented varieties. Such
trend is concurrent with reports from several researchers in which pigmented
rice varieties were found to contain more phenolic compounds as compared to
none pigmented rice varieties (Huang & Ng 2012; Mohanlal et al. 2013; Seo et
al. 2013; Yawadioa, Tanimorib & Moritta 2007). Among the three pigmented
rice varieties, RBE of Bajong LN had the highest total phenolic content, and
then followed by Bali and lastly Wangi Mamut. Their respective contents were
significantly different from one another (P ≤ 0.05).
However, in the present work, it was discovered that the RBE of non-
pigmented rice varieties, Pandan showed a higher total phenolic content when
compared Wangi Mamut and the difference was significant (P ≤ 0.05). Based
on the present result, it is more likely that RBE of Pandan contains more
phenolic compounds than RBE of Wangi Mamut. It was suggested that factors
such as variation in plant genetic diversities and growth environment factors
influence the difference in total phenolic contents of the two rice varieties (Britz
et al. 2007; Huang & Ng 2012).
To the best of author’s knowledge, most of the selected Sarawak local
rice varieties in the present study remain underexplored. There is a lack of
reference data to be used for comparison with the presently obtained results.
There was a study on the total phenolic content of MR219 rice variety by
Fasahat et al. (2012). However, direct comparison cannot be performed as their
main focus was not emphasized on the phenolic content in rice bran but on the
polished rice grain (0.32mg GAE/g) instead (Fasahat et al. 2012).
The present study reported average total phenolic contents of 388mg
GAE/100g and 2378mg GAE/100g for non-pigmented (white bran) and
pigmented (purple bran) rice respectively. Table 2-4 summarizes the total
phenolic contents of rice varieties from different locations. As per review of
Goufo and Trindade (2014), the present data were comparable to pooled data
of total phenolic contents detected in more than 50 different types of rice
![Page 59: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/59.jpg)
42
varieties cultivated in different countries (inclusive of China, Taiwan, Brazil,
Thailand, India). They were 294.1mg GAE/100g and 2297.4mg GAE/100g for
non-pigmented and pigmented rice respectively. The average total phenolic
contents for non-pigmented rice bran reported in this study (338mg GAE/100g)
were slightly higher than those reported in Taiwan (196.1mg GAE/100g) (Huang
& Ng 2012) and Iran (256.6mg GAE/100g) (Ghasemzadeh et al. 2015)
respectively. As of the selected pigmented rice bran in this study, the average
total phenolic contents reported was 2378mg GAE/100g which was higher than
those detected in Taiwan (949.0mg GAE/100g) (Huang & Ng 2012) and
Thailand (1091.0mg GAE/100g) (Muntana & Prasong 2010).
Table 2-4: Average total phenolic contents in different rice varieties
n.a – not available
Contrarily, the average total phenolic contents reported in this study were
slightly lower than those detected in commercial rice varieties cultivated in
China (Zhang et al. 2010) and India (Parvathy et al. 2014). The average total
phenolic contents detected in non-pigmented and pigmented rice varieties
cultivated in China and India were 485mg GAE/100g and 3906.5mg GAE/100g,
and 650mg GAE/100g and 3935mg GAE/100g respectively. The differences in
total phenolic contents among different rice varieties cultivated in various parts
Average Total Phenolic Content (mg GAE/100g)
Location of Rice Varieties Non-Pigmented Rice Pigmented Rice
Malaysia (Sarawak) 338.0 2378.0
China, Taiwan, Brazil, Thailand,
India (Pooled Data) (Goufo &
Trindade 2014)
294.1 2297.4
Taiwan (Huang & Ng 2012) 196.1 949.0
China (Zhang et al. 2010) 485.0 3906.5
Thailand (Muntana & Prasong
2010) 940.8 1091.0
Iran (Ghasemzadeh et al. 2015) 256.6 n.a
India (Parvathy et al. 2014) 650.0 3935.0
![Page 60: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/60.jpg)
43
of the world could be due to variations in genetic diversity and environmental
factors (Huang & Ng 2012). The effect of bran colour on the phenolic acid
composition in rice is one of the most significant factors. Strong correlation
between the colour of rice bran and its total phenolic content has been well
documented. It has been reported that black rice varieties generally have the
highest total phenolic content and followed by red, purple and white rice
varieties (Shen et al. 2009; Zhang et al. 2006). In general, rice bran and husk
have the highest phenolic content and then followed by polished rice grain (also
known as ‘white rice’) (Goufo et al. 2014a).
![Page 61: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/61.jpg)
44
2.4.4.2 Determination of Total Flavonoid Content
Total flavonoid contents of different RBE were determined via aluminium
complexation-based spectrophotometric assay. Quercetin (QE), a type of
flavonoid was used as the reference standard for the assay and results were
expressed in mg QE/g dried extract. The flavonoid contents for all test samples
are summarized in Table 2-5. Based on the results, total flavonoid contents in
crude extracts of different rice bran varied significantly (P ≤ 0.05). The
determined total flavonoid contents in crude extracts of different rice brans were
in the range of 1.80 to 16.30mg QE/g dried extracts.
Table 2-5: Total flavonoid contents of RBE. Values expressed represent mean ±
standard deviation of 3 concecutive repetitions (n=3). Different letters
within the same column denote significant differences at P ≤ 0.05
(Tukey’s Test). QE = Quercetin Equivalent. Graphical representation
for the following data is presented in Figure 5-2 (Appendix section).
The highest total flavonoid content was determined from the crude
extract of Bajong LN rice bran (16.30mg QE/g dried extract) while the lowest
total flavonoid content was detected in RBE of Biris (1.80mg QE/g dried extract).
RBE of Different Rice Varieties
Total Flavonoid Content
(mg QE/g dried extracts)
Bajong LN 16.30 ± 0.11a
Pandan 10.28 ± 0.09b
Bali 7.97 ± 0.03c
Bajong 5.00 ± 0.05d
Bubuk 3.21 ± 0.07e
Wangi Mamut 3.19 ± 0.03e
MR219 2.30 ± 0.06f
Bario 1.88 ± 0.06g
Biris 1.80 ± 0.01g
![Page 62: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/62.jpg)
45
The total flavonoid content detected in rice varieties selected for this
study in range of 1.80 to 16.30mg QE/g dried extracts. The range was slightly
higher than those reported from rice varieties cultivated in India which was in
the range of 1.68mg QE/g to 8.51mg QE/g (Rao et al. 2010). The present study
reported average total flavonoid contents of 2.72 mg QE/g and 9.15mg QE/g for
non-pigmented and pigmented rice respectively. Similar to the total phenolic
content, total flavonoid content is evidently higher in pigmented rice when
compared to non-pigmented rice (Goufo & Trindade 2014). Based on the
pooled data reviewed by Goufo and Trindade (2014), average total flavonoid
contents detected in non-pigmented and pigmented rice were 4.09mg catechin
equivalent (CE)/g and 11.07mg CE/g respectively. Although different reference
standard was used in the studies reviewed, it still showed the trend of
pigmented rice having higher total flavonoid content as compared to those non-
pigmented rice.
Among the three pigmented rice, RBE of Bajong LN reported the highest
total flavonoid content, then followed by Bali and lastly Wangi Mamut. Their
respective total flavonoid contents were significantly different from one another
(P ≤ 0.05). However, RBE of Pandan reported a significantly higher (P ≤ 0.05)
total flavonoid content as compared Bali extract, and the flavonoid content in
Bajong extract was also significantly higher (P ≤ 0.05) than the latter in Wangi
Mamut extract. Based on the present result, it was deduced that the RBE of
Pandan (non-pigmented rice) contain more flavonoids as compared to both
RBE of Bali and Wangi Mamut (pigmented rice). However, it was suggested
that factors such as variation in plant genetic diversities, growth environment
factors, and extraction method do influence the total flavonoid contents in
different rice varieties (Britz et al. 2007; Huang & Ng 2012).
![Page 63: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/63.jpg)
46
2.4.4.3 Determination of Total Anthocyanin Content
Total anthocyanin contents of different RBE were determined via pH
differential method. The results are depicted in Table 2-6. Cyanidin-3-glucoside,
a type of monomeric anthocyanin was used as reference standard. The data
were all expressed in unit mg cyanidin-3-glucoside equivalent/100g of dried
extract. Based on the results, only the total anthocyanin contents in RBE of Bali
(11.94mg/100g), Bario (12.40mg/100g), and MR219 (11.91mg/100g) were
significantly different from Bajong (10.80mg/100g) at P ≤ 0.05.
Table 2-6: Total anthocyanin contents of different RBE were expressed in unit of
mg cyanidin-3-glucoside equivalent/100g dried extracts. Results were
expressed in mean ± standard deviation of three consecutive
experimental repetitions (n=3). Graphical representation for the
following data is presented in Figure 5-3 (Appendix section).
n.a – not available
*Significantly different from Bajong at P ≤ 0.05 (Tukey’s Test)
The highest total anthocyanin content was determined in the RBE of
Bario (12.40mg cyanidin-3-O-glucoside equivalent /100g) while the lowest total
anthocyanin content was determined in the RBE of Biris (8.84mg cyanidin-3-O-
glucoside equivalent /100g).
RBE of Different Rice Varieties
Total Anthocyanin Content
(mg cyanidin-3-O-glucoside/100g dried extracts)
Bario 12.40 ± 0.16*
Pandan 12.08 ± 0.2
Bali 11.94 ± n.a*
MR219 11.90 ± 0.06*
Bajong LN 11.66 ± 0.68
Wangi Mamut 10.84 ± 0.55
Bajong 10.80 ± 0.06
Bubuk 9.77 ± 0.51
Biris 8.84 ± 0.88
![Page 64: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/64.jpg)
47
Cyanidin-3-glucoside is the predominant form of anthocyanins present in
rice. Its content accounted for 51-84% of the total anthocyanin content in rice,
particularly on the bran layer of rice (Goufo & Trindade 2014). Most the
literature reported a higher total anthocyanin content in pigmented rice as
compared to non-pigmented rice. The average total anthocyanin contents in
pigmented rice (440mg cyanidin-3-O-glucoside equivalent/ 100g) were
approximately 10 folds much higher than those in non-pigmented rice (4.34mg
cyanidin-3-O-glucoside equivalent/ 100g). Within the group of pigmented rice,
purple rice has the highest total anthocyanin content, then followed by black
rice, red rice, and brown rice respectively (Goufo & Trindade 2014). It has been
revealed that black rice contains mainly anthocyanins (Zhang et al. 2010) while
the red rice are mainly composed of proanthocyanidins (Min, McClung & Chen
2011). As for purple rice, it contains both anthocyanins and proanthocyanidins
(Goufo & Trindade 2014).
The present result did not follow the trend of pigmented rice having
higher total anthocyanin content as compared to the non-pigmented rice
varieties. The total anthocyanin contents of pigmented rice varieties: Bali,
Bajong LN, and Wangi Mamut were 11.94, 11.66 and 10.94mg cyanidin-3-O-
glucoside equivalent/ 100g respectively. These reported values were lower than
some of the non-pigmented rice varieties studied which include Bario (12.40mg
cyanidin-3-O-glucoside equivalent/ 100g), Pandan (12.08mg cyanidin-3-O-
glucoside equivalent/ 100g), and MR219 (11.90mg cyanidin-3-O-glucoside
equivalent/ 100g). Such discrepancies could be due to the degradation of
anthocyanin compounds over the course of sample storage. Various factors
such as pH, temperature, light exposure, compound structure, and storage
concentration are known to alter the stability of anthocyanins (He et al. 2012).
Anthocyanins are generally more stable in acidified media (lower pH) as
compared to the higher pH alkaline media. Different pH will have an effect on
the compound structure of anthocyanins (Bordignon-Luiz et al. 2007; Morais et
al. 2002). Temperature wise, anthocyanins are more stable at lower
temperature (4˚C) and usually stored in powder or concentrated forms. These
factors have been shown to alter the stability and half-life of anthocyanins
(Bordignon-Luiz et al. 2007).
![Page 65: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/65.jpg)
48
2.4.4.4 Determination of Total Gamma Oryzanol (γ-Oryzanol) Content
Total γ-oryzanol content in RBE of different rice varieties were analysed
via a fixed wavelength spectrophotometric method (Bucci et al. 2003).
γ-Oryzanol was used as reference standard to establish a standard curve for
determination of total γ-oryzanol content in all test samples. The total γ-oryzanol
contents of RBE were depicted in Table 2-7. Based on the obtained results,
total γ-oryzanol contents in RBE of different rice varieties were significantly
different (P ≤ 0.05) from one another. The highest total γ-oryzanol was
determined in RBE of Bajong LN (7523.96mg/kg dried extracts) while the lowest
total γ-oryzanol was determined in RBE of Bario (1234.11mg/kg dried extracts).
Table 2-7: Total γ-oryzanol content of RBE. Values expressed represent mean ±
standard deviation of 3 concecutive repetitions (n=3). Different letters
within the same column denote significant differences at P ≤ 0.05
(Tukey’s Test). Graphical representation for the following data is
presented in Figure 5-4 (Appendix section).
RBE of Different Rice Varieties
Total γ-Oryzanol Content
(mg/kg dried extracts)
Bajong LN 7523.96 ± 27.16a
Pandan 4092.06 ± 4.76b
Bali 3883.53 ± 5.36c
Bajong 2507.66 ± 14.36d
Bubuk 2095.73 ± 6.02e
Wangi Mamut 1954.93 ± 3.04f
Biris 1612.76 ± 4.69g
MR219 1393.10 ± 8.59h
Bario 1234.11 ± 7.01i
![Page 66: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/66.jpg)
49
In this study, the total γ-oryzanol contents detected in non-pigmented
and pigmented rice were in the range of 1234.11mg/kg to 4092.06mg/kg and
1954.93mg/kg to 7523.96mg/kg respectively. The obtained data were slightly
different from data pooled and summarized by Goufo and Trindade (2014)
which were in the range of 1030-8864mg/kg and 1122-9120mg/kg γ-oryzanol
for non-pigmented and pigmented rice respectively. Aside from that, Min,
McClung and Chen (2011) also reported a different range of total γ-oryzanol
content (3861.93mg/kg to 5911.12mg/kg) detected in different types of rice bran.
γ-Oryzanol is a mixture of ferulate esters with sterols or triterpenes.
There are four main components of steryl ferulates, namely campesteryl
ferulates, cycloartenyl ferulates, 24-methylenecycloartenyl ferulates and β-
sitosteryl ferulates. Among all different types of cereal grains, rice has the
highest content of γ-oryzanol (Kozuka et al. 2012). Variation in plant genotypes
could be one of the factors causing variation in total γ-oryzanol content among
different rice varieties. In addition to that, it has been discovered that
environmental factor, such as growth temperature also influence the total γ-
oryzanol content in rice (Britz et al. 2007). Other than that, the yield of γ-
oryzanol is also highly dependent on the extraction method and solvent used for
the extraction (Chen & Bergman 2005).
The effects of bran colour on the total γ-oryzanol composition of rice
were not apparent. The colour of rice generally does not stipulate the levels of
total γ-oryzanol content as there is no significant correlation between the two
variables (Huang & Ng 2012). However, the distribution of γ-oryzanol in rice
predominantly exists in the bran portion of rice, followed by the whole rice grain,
husk and finally the endosperm (Kozuka et al. 2012). This gives an indication
that γ-oryzanol is mostly concentrated in the pericarp than the endosperm
portion of the rice.
![Page 67: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/67.jpg)
50
2.4.4.5 Determination of Vitamin E Content
Total vitamin E contents of different RBE were determined via high
performance liquid chromatography (HPLC) method. Tocomin50, a tocotrienols
rich fraction derived from palm oil was used as the reference standard for the
analysis. A total of 50% of the content in tocomin50 is constituted of delta (δ-)
tocotrienols (5.30%), gamma (λ-) tocotrienols (20.60%), alpha (α-) tocotrienols
(12.30%) and tocopherol (mainly α-tocopherol: 11.80%) while the remaining
50% of the components are consisting of phytosterols, co-enzyme Q10 and
carotenoids. Figure 2-10 depicts the HPLC chromatograms of Tocomin50
standard [Figure 2-10(a)] and RBE sample [Figure 2-10(b)] respectively.
Figure 2-10: HPLC chromatograms of (a) Tocomin50 and (b) RBE of Bajong LN.
Delta T3: δ-tocotrienols; Gamma T3: γ-tocotrienols; Alpha T3: α-
tocotrienols; Tocopherol: mainly α-tocopherol
(a)
(b)
![Page 68: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/68.jpg)
51
Due to the nature of tocomin50, only δ-T3, γ-T3, α-T3 and tocopherol
(mainly α-tocopherol) were determined in different RBE via HPLC. Contents of
different vitamin E derivatives were expressed in units of mg/kg sample. Based
on the result as shown in Table 2-8, the contents of γ-T3, α-T3 and tocopherol
(mainly α-tocopherol) differed significantly (P ≤ 0.05) among different RBE. The
δ-T3 contents of different RBE were in the range of 3.18 to 15.41mg/kg. As for
γ-T3, they were in the range of 126.89 to 353.53mg/kg; α-T3 was in the range
of 1.46 to 87.12mg/kg; tocopherols (mainly α-T) were in the range of 54.62 to
231.04mg/kg.
Table 2-8: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in different
RBE were expressed in units of mg/kg. The data represented mean
± standard deviation of three repetitions (n=3). Different letters within
the same column denote significant difference at P ≤ 0.05. T3 =
tocotrienols; T = tocopherol.
Vitamin E Content (mg/kg)
Rice Varieties δ-T3 γ-T3 α-T3 T
Bajong 9.51±0.24a 154.64±5.64a 36.86±0.41a 122.04±0.52a
Bajong LN 15.41±1.72a 353.53±5.15b 68.02±2.34b 231.04±6.32b
Bali 3.18±0.15b 347.27±4.61b 13.72±1.31c 55.09±1.27c
Bario 9.36±0.23a 282.22±1.96c 11.57±0.06c 61.32±1.47cd
Biris 6.81±0.21c 209.16±1.15d 87.12±32.17d 198.97±7.82e
Bubuk 7.88±0.22a 243.29±0.67e 24.47±0.73e 103.07±0.67f
MR219 6.79±0.20a 307.85±4.40f 1.46±0.042f 54.62±1.58cd
Pandan 6.33±0.08a 126.89± 4.82g 28.19±2.99ae 119.96±3.02g
Wangi Mamut 7.94±0.13a 196.65±1.23h 49.28±1.10g 143.14±3.75h
![Page 69: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/69.jpg)
52
The obtained results varied slightly from the contents of different vitamin
E derivatives detected in rice varieties grown in Taiwan (Huang & Ng 2012).
Higher contents of vitamin E derivatives were detected in Sarawak local rice as
compared to those detected in Taiwan’s rice varieties. The δ-T3 contents of
different Taiwan rice varieties were in the range of 1.34 to 3.53mg/kg. As for γ-
T3, they were in the range of 68.52 to 151.09mg/kg; α-T3 were in the range of
8.44 to 67.01mg/kg; tocopherols (mainly α-T) were in the range of 23.27 to
107.73mg/kg (Huang & Ng 2012). Such variations could have been caused the
differences in plant genotypes, environmental condition, harvesting method and
extraction method. Regardless of the type of rice, γ-T3 appeared to be the
predominant form of vitamin E that is present in the rice bran. The second most
abundant vitamin E derivative in rice bran is tocopherol, then followed by α-T3
and lastly, δ-T3 which only exist in trace amount (Huang & Ng 2012). Moreover,
in addition to the four tocotrienol derivatives, two additional novel tocotrienols
derivatives were isolated from rice bran and they were characterized as
desmethyl tocotrienol and didesmethyl tocotrienol respectively (Qureshi et al.
2000).
As depicted in Figure 2-11, the compositional percentage of different
vitamin E derivatives in different RBE varied from one another. In general, the
content of γ-T3 was the highest among other vitamin E derivatives determined,
accounting for 41.67% - 83.04% of the total vitamin E content. Tocopherol was
the second most abundant vitamin E derivatives determined, accounting for
13.14% - 42.65% of the total vitamin E content. As for δ-T3 and α-T3, both
vitamin E derivatives only existed in trace amount, with content in the ranges of
0.76% - 2.94% and 0.39% - 17.35% of the total vitamin E content determined
respectively.
Based on the present results, there is no significant correlation between
the colour of rice bran and the content of different vitamin E derivatives
(Table 2-8). Similar result trend was also reported by Goufo and Trindade
(2014). It was suggested that plant genotypes and growth environment are
known to be the major factors that contribute to the total contents of vitamin E
derivatives (Goufo & Trindade 2014).
![Page 70: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/70.jpg)
53
Figure 2-11: Tocotrienols (δ-, γ-, α-derivatives) and tocopherol contents in
different RBE were expressed in units of %. The data represented
mean ± standard deviation of three repetitions (n=3). T3 =
Tocotrienols; T = Tocopherol.
0%
20%
40%
60%
80%
100%
Bajong BajongL.N
Bali Bario Biris Bubuk MR219 Pandan WangiMamut
Perc
en
tag
e (
%)
Rice Varieties
Vitamin E Composition Analysis δ-T3
γ-t3
α-t3
T
![Page 71: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/71.jpg)
54
2.4.5 Conclusion
Total contents of phenolic compounds, flavonoids, anthocyanins, γ-
oryzanol and vitamin E (specifically on δ-tocotrienols, α-tocotrienols, γ-
tocotrienols and tocopherol) in different local rice varieties were thoroughly
assessed in this study. The results have demonstrated discrepancies in the
contents of bioactive compounds among different RBE of Sarawak local rice
varieties. By studying the distribution of these bioactive compounds in different
rice sample, it offers useful information for the selection of ideal rice variety as
functional food.
Among all the nine different Sarawak local rice varieties selected for this
part of the study, the RBE of Bajong LN reported the highest contents of
phenolic compounds (46.80mg GAE/g), flavonoids (16.30mg QE/g), and total γ-
oryzanol (7523.96mg/kg) respectively. Based on the obtained result, average
total phenolic contents detected in selected Sarawak local rice varieties were
388mg GAE/100g and 2378mg GAE/100g for non-pigmented and pigmented
rice respectively. The obtained value were slightly higher than the average total
phenolic contents of more than 50 different rice varieties from various locations
in the world (294.1mg GAE/100g and 2297.4mg GAE/100g for non-pigmented
and pigmented rice respectively).
In addition to that, higher total flavonoids contents were also detected in
Sarawak local rice varieties (1.80mg QE/g to 16.30mg QE/g) as compared to
Njavara rice varieties (1.68mg QE/g to 8.51mg QE/g) cultivated in India. Total γ-
oryzanol detected in the selected Sarawak local rice varieties was in the range
of 1234.11mg/kg to 7523.96mg/kg which were comparable to the average
range of total γ-oryzanol (1030mg/kg to 9120mg/kg) detected in various rice
varieties in the world.
As for vitamin E, higher contents of compounds were generally detected
in Sarawak local rice as compared to those detected in Taiwan’s rice varieties.
The δ-T3 contents detected in different Taiwan rice varieties were in the range
of 1.34 to 3.53mg/kg (Sarawak local rice: 3.18 to 15.41mg/kg). As for γ-T3, they
were in the range of 68.52 to 151.09mg/kg (Sarawak local rice: 126.89 to
![Page 72: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/72.jpg)
55
353.53mg/kg); α-T3 were in the range of 8.44 to 67.01mg/kg (Sarawak local
rice: 1.46 to 87.12mg/kg); tocopherols (mainly α-T) were in the range of 23.27
to 107.73mg/kg (Sarawak local rice: 54.62 to 231.04mg/kg). Despite of
discrepancies in vitamin E contents, most rice varieties share the same trend in
their respective vitamin E composition. γ-T3 appeared to be the predominant
form of vitamin E that are present in the rice bran and followed by tocopherol, α-
T3 and lastly, δ-T3 which only exist in trace amount.
Among nine different types of Sarawak local rice varieties studied, three
of them are purple colour pigmented rice varieties (Bajong LN, Bali and Wangi
Mamut) while the others are non-pigmented rice. Based on the obtained results,
pigmented rice varieties generally have higher content of bioactive compounds
when compared to non-pigmented varieties. Such result trend is consistent with
reports from literature. Highest contents of phenolic compounds (46.80mg
GAE/g), flavonoids (16.30 ± 0.11mg QE/g), γ-oryzanol (7523.96 ± 27.16mg/kg),
and vitamin E (15.41 ± 1.72mg/kg δ-tocotrienols; 353.53 ± 5.15mg/kg γ-
tocotrienols; 68.02 ± 2.34mg/kg α-tocotrienols; 231.04 ± 6.32mg/kg tocopherol)
were detected in the RBE of Bajong LN. The contents of bioactive compounds
in Bajong LN were significantly higher than those detected in commercial rice
variety, MR219.
Due to the lack of reference data available for the selected Sarawak local
rice varieties, direct comparison with the presently obtained results cannot be
performed. Discrepancies in contents of bioactive compounds among different
rice varieties could be due to variations in plant genotypes and growth
environment. Both are known to have an effect on the production of bioactive
compounds in plants. These essential compounds are produced by plants for
growth, reproduction, and as part of the defence mechanisms against external
stress factors. Besides that, other factors such as plant growth stage,
harvesting period and method can also contribute to the differences in contents
of bioactive compounds among different rice varieties.
![Page 73: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/73.jpg)
56
In addition, the lack of standardized extraction and analytical methods
might also contribute to variation in the data obtained. Bioactive compounds in
plant material may exist in free form (soluble-free antioxidants) and conjugated
forms (insoluble antioxidants) of glycosides or esters with additional compounds
like sterols, glucosides, flavonoids, fatty acids, proteins, and alcohols. Due to
the use of methanol as the extraction solvent in the present work, most of the
extracted compounds were in the soluble-free forms which generally have low
molecular weight. Contrarily, the high molecular weight insoluble forms of
bioactive compounds tend to trap in food matrix and often present in remains of
organic extraction (Goufo & Trindade 2014). Regardless of the discrepancies in
the contents of bioactive compounds among different RBE, the present result
put forward the potential of rice bran as a good source of essential natural
antioxidants for health and wellness. It is an ideal food source that can be used
in the development of nutraceuticals and functional food ingredients.
![Page 74: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/74.jpg)
57
3. Chapter 3: Bioactivity Studies of Natural
Antioxidants Derived from Rice Bran of Different
Sarawak Local Rice Varieties
3.1 Executive Summary
The existence of reactive oxygen species (ROS) is vital for biological
activities of cells. Low amount of ROS can stimulate cellular physiological
activities. Cells utilized a series of endogenous and exogenous antioxidant
protection systems to regulate and maintain redox homeostasis. However,
when the ROS production escalates and failed to be removed by antioxidants in
the cells, it causes over-accumulation of ROS and eventually leads to oxidative
stress. The presence of oxidative stress has been known to play the central role
in the onset and progression of chronic diseases. Several evidences have
revealed the involvement of oxidative stress in pathogenesis of cardiovascular
diseases (CVD). Oxidative modification of essential biological components
initiates a series of signal transduction cascade that eventually leads to the
progression of CVD. Hence, the rationale of using natural antioxidant to
attenuate the risks of CVD via inhibition of inadvertent cellular oxidative damage
or signalling pathway may have important implications to both prevention and
treatment of CVD.
In the previous chapter (Chapter 2), a preliminary study on the contents
of bioactive compounds in different RBE of Sarawak local rice varieties have
been conducted. The current work focuses on the antioxidant activities of RBE.
Two types of in vitro antioxidant assay systems (in vitro chemical-based and in
vitro cell-based assay systems) have been used to assess the antioxidant
capacity of Sarawak RBE. For the in vitro cell-based antioxidant assay system,
the preliminary study of assessing antioxidant capacity of RBE towards
cardioprotection was conducted by using a cardiac cell culture model.
![Page 75: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/75.jpg)
58
In this chapter of the thesis, it provides a comprehensive literature review
relevant to the field of study. In addition, summary of experimental approaches
and presentation of results for the second section of the overall research work
are also included in this chapter.
3.2 Literature Review
3.2.1 Reactive Oxygen Species (ROS) and Oxidative Stress
The existence of reactive oxygen species (ROS) always has been part of
the physiological cycles of aerobic cells. ROS is referred as a general term for
either free radicals or free radicals generating molecular species (Kunwar &
Priyadarsini 2011). Common source of these reactive radicals include the by-
products both endogenous and exogenous metabolisms of aerobic cells, such
as the superoxide (O2˙-) and nitric oxide (NO˙) radicals while other external
noxious sources such as chemicals, environmental toxins, drugs and radiation
are also contributing to the increment of overall intracellular ROS content
(Helmut 1994).
Under normal cellular condition, cellular processes produce considerable
amount of O2˙- and NO˙ radicals. During mitochondrial respiration and
phagocytosis, cells taken up oxygen and converts it to O2˙- radicals. As for NO˙
radicals, they are the enzymatic product of nitric oxide synthase which acts as
relaxing factor and neurotransmitter for endothelium. Through a series of
complex transformation, these two radicals are converted to stronger radical
species such as the hydroxyl radical (˙OH), peroxyl radicals (ROO˙) and singlet
oxygen (1O2). Certain radical species may further be converted to molecular
radical species such as the peroxynitrite (ONOO-) and hydrogen peroxide (H2O2)
(Kunwar & Priyadarsini 2011). All these reactive radical species are the
sources of ROS in cells.
![Page 76: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/76.jpg)
59
Certain biological functions of cells require low concentration of ROS. In
this case, ROS acts as the stimulant for cellular physiological activities such as
maintaining cellular growth, modulating gene expression, defencing the cell
against infection and acts as secondary messengers for signal transduction
pathways (Droge 2002; Schreck & Baeuerle 1991). However, ROS is relatively
unstable due the possession of one or more unpaired electrons within its own
electron configuration (Aruoma 1998).
At high concentration, ROS are capable of interacting with different
biomolecules in various ways to produce certain types of radicals. For example,
when ROS interacts with crucial biomolecules like DNA, proteins and lipids,
secondary radicals derived from sugar and nitrogenous bases, amino acids and
lipids are produced. Oxidations of protein and DNA by ROS impose structural
changes and fragmentation that disrupt their proper functions, and
consequently result in cell death and mutation. As for cellular membrane,
phospholipids are vulnerable to oxidation by ROS and forms lipid peroxides.
These secondary radicals are capable of causing cascade reactions and affect
the normal physiological functions of cells (Beckman & Ames 1997; Kunwar &
Priyadarsini 2011).
The balance between ROS production rates and the rates of its removal
by various antioxidants is crucial for maintaining intracellular homeostasis of
ROS. In all forms of life, the redox state of cells is mediated by cofactors such
as glutathione (GSH), nicotinamide adenine dinucleotide (NAD), and flavin
adenine dinucleotide (FAD) which are commonly found in cells, tissues and
biological fluids. Cells usually have a more negative redox state under normal
conditions (Kohen & Nyska 2002; Schafer & Buettner 2001). However, when
the ROS production escalates and failed to be removed by antioxidants in the
cells, the redox state of the cells will shift to a less negative state and thereby
increases their oxidation status. Such situation is known as oxidative stress
(Droge 2002).
![Page 77: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/77.jpg)
60
Oxidative stress is known to induce intracellular cell damage and cell
death that affects all critical biomolecules such as DNA, lipids, sugars and
proteins (Dröge & Schipper 2007). For instance, when the level of oxidative
stress in the cell elevates, cellular mitochondrial functions will deteriorate and
cause the depletion of adenosine triphosphate (ATP) (Droge 2002). The
depletion in ATP levels will then triggers cell death via necrosis or apoptosis
(Eguchi, Shimizu & Tsujimoto 1997). Other than ATP levels as the determinant
of cell death, it has been reported that the shifting of cellular redox state from a
more negative to a less negative state also induce apoptosis- or necrosis-
mediated cell death (Schafer & Buettner 2001).
Many different chronic diseases such as atherosclerosis, neurological
diseases, cancer and diabetics have been associated with oxidative stress.
Factors such as molecular targets, mechanism and severity of oxidative stress
define the consequence of oxidative stress injury on cells. In general, the
hallmark of oxidative stress-mediated chronic diseases is widely linked with
involvement of oxidative stress in the signal cascade reaction of inflammation
and the production of chemo-attractants (Aruoma 1998).
3.2.2 Oxidative Stress Related Disease
The progression of chronic diseases such as cardiovascular disease,
neurological disease, pulmonary disease, rheumatoid arthritis, nephropathy,
and ocular disease has been attributed to complex and multifactorial
physiological changes mediated by externally- and internally-driven stimuli
(Pham-Huy, He & Pham-Huy 2008). There have been significant evidences
supporting the involvement of oxidative stress in the progression of these
diseases. Majority of these diseases were originated from the dysregulation of
multiple genes as a consequence of oxidative stress (Aruoma 1998; Wang et al.
2011).
![Page 78: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/78.jpg)
61
Oxidative stress occurs when excess free radicals fail to be removed and
accumulated over time. Excessive accumulation of these free radicals exhibits a
deleterious effect to essential biological components such as DNA, lipids,
sugars, proteins and fatty acids (Dröge & Schipper 2007; Esiri 2007; Fleury,
Mignotte & Vayssiere 2002). Under oxidative stress condition, normal functions
of these essential biological components will undergo progressive oxidative
modifications and consequently disturb their usual functions. The biological
system will attempt to offset and regulate these stresses by initiating their
respective repairing mechanisms. However, if the biological repairing
mechanisms fail to counteract the attacks, oxidative stress will trigger the
occurrence and progression of various chronic diseases through a series of
signal transduction cascade events (Magalhaes et al. 2009).
.
3.2.2.1 Cardiovascular Diseases
Cardiovascular disease (CVD) still remains as one of the largest leading
cause of global mortality. The World Health Organization (WHO) has estimated
a total number of 17.5 million deaths from CVD in the year 2012, accounted for
one-third of the global mortality (WHO 2015). The total numbers of annual
fatalities are expected to increase to 20 million of death cases by 2020, and
further increase to 24 million by 2030 (WHO 2004). In Sarawak, the disease
accounted for the second leading cause of mortality among the local community.
In 2012, there were a total of 26,000 cases reported and the number of cases
continues to upsurge with 24,000 cases reported within the first eight months of
2013 (Ruekeith 2013). There is an urgent need for global attention to alleviate
mortality rate of CVD.
The onset and progression of CVD are known to be multifactorial (Pham-
Huy, He & Pham-Huy 2008). There has been a huge debate over the potential
role of oxidative stress as the primary source for pathogenesis of CVD (Ceriello
2008). Such hypothesis has been supported by evidences (Ceriello 2008;
Chatterjee et al. 2007; Droge 2002) that reveal the involvement of oxidative
stress in several types of CVDs. Coronary artery disease (CAD) is the most
![Page 79: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/79.jpg)
62
common type of CVD that eventually leads to myocardial infarction, a medical
event commonly known as heart attack (Ma et al. 2013). The disease begins
with the narrowing of coronary arteries as a result of atherosclerosis (Forycki
2010). Progressive narrowing of coronary arteries reduces the blood supply to
the heart. If the condition gets worsen, it may cause a blockage in the coronary
artery and completely disrupt the blood flow to heart. In such case, this will
cause extensive damage to heart muscles and tissue whereby the
consequences could be fatal (Chantal et al. 2012).
3.2.2.1.1 Atherosclerosis
Atherosclerosis refers to the hardening of arteries. It is a type of chronic
inflammatory disease (Toh et al. 2014) and it has been known as the primary
cause of CAD (Lönn, Dennis & Stocker 2012). It typically begins prior to
adulthood and progresses slowly. Its slow progression and complicated etiology
limit the detection of early atherogenic events for prevention measures (Lönn,
Dennis & Stocker 2012). Some of the contributors to the development of
atherosclerosis include smoking, unhealthy diet (high fat diet) and the lack of
physical exercises. In addition, medical conditions such as hyperlipidemia, high
blood pressure, and diabetes are also among the risk factors that closely
associate with the development of atherosclerosis (Anand et al. 2008; Toh et al.
2014).
One of the initiating causes of atherosclerosis was characterized as
oxidative modification (Goldstein et al. 1979; Steinberg et al. 1989). Both
oxidative stress and oxidation of low density lipoprotein (LDL) have been
regarded as the key issues in pathogenesis of atherosclerosis (Muid et al.
2013). Excessive reactive oxygen species (ROS) produced from cellular
metabolism add on to the oxidative stress, which in turn promotes various
mechanisms of atherosclerosis, including endothelial dysfunction, migration of
monocytes, LDL peroxidation and proliferation of smooth muscle cells (Berliner
et al. 1995). The latter induce additional events that lead to progression of
atherosclerosis.
![Page 80: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/80.jpg)
63
The progression of atherosclerosis is complicated and multifactorial
throughout different developmental stages. Progression of atherosclerosis was
depicted in Figure 3-1 and the pathogenesis of atherosclerosis was
summarized in Figure 3-2. Briefly, it begins with the entrance of low-density-
lipoproteins (LDLs) into the sub-endothelial region (also known as intima) of the
blood artery (Swirski & Nahrendorf 2013; Toh et al. 2014). Through a series of
biochemical reaction and signal transduction cascade, it progressively leads to
the formation of atherosclerotic plaque and narrowing of blood vessel. Blockage
of blood artery will restrict the blood flow to the heart and consequently increase
the likelihood of ischemia, a condition in which the supplies of oxygen and
nutrients to the heart get disrupted (Lusis 2000). Prolonged condition of
ischemia will induce extensive damage to heart muscles and tissues. Such
event is known myocardial infarction, commonly known as heart attack (Chantal
et al. 2012; Ma et al. 2013; Swirski & Nahrendorf 2013).
![Page 81: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/81.jpg)
64
Figure 3-1: Graphical representation of atherosclerotic plaque formation [Image source:(Quillard & Libby 2012a)]
![Page 82: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/82.jpg)
65
Figure 3-2: Developmental stages of atherosclerosis (Quillard & Libby 2012b;
Toh et al. 2014)
1. Accumulation of low-density-lipoproteins (LDLs) occurs in
intima matrix of the blood vessel. The LDLs undergo oxidation
mediated by ROS produced from metabolic activities of
surrounding cells and promote up-regulation of cell adhesion
molecules to attract circulating monocytes.
2. Monocytes migrate into the intima matrix of blood vessel
and undergo differentiation to form mature macrophages.
Activated macrophages begin to uptake oxidized LDL and
form foam cells (macrophage loaded with lipoproteins).
Foam cells release pro-inflammatory cytokines and initiate
localized inflammatory response and oxidative stress. This
results in the recruitment of more macrophages in the intima
matrix of blood vessel.
3. Foam cells begin to accumulate and form a lipid core (also
known as atherosclerotic plaque) within the intima matrix of
the blood vessel. Smooth muscle cells and collagen matrix
begin to overlie the plaque and form a thin fibrous cap.
Continuous accumulation of foam cells further increase the
size of the plaque and narrow the diameter of the blood
vessel. This begins to restrict the blood flow and potentially
leads to ischemia.
4. Plaque ruptures occur as a result of over-accumulation of
foam cells. It leads to the revelation of pro-thrombic content
which subsequently initiates platelet aggregation and localized
formation of thrombus. Delocalization of thrombus may cause
blockage in the narrowed blood vessel and consequently leads
to the onset of ischemia and myocardial infarction.
Different Stages in Pathogenesis of Atherosclerosis
![Page 83: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/83.jpg)
66
Although the causal role of oxidative stress in pathogenesis of
atherosclerosis has been well documented (Goldstein et al. 1979; Steinberg et
al. 1989), the exact underlying mechanisms for oxidative stress mediated
cardiovascular pathophysiology remain complicated. Various in vivo studies
have revealed ROS contributing to oxidative can be derived from exogenous or
endogenous sources (Singh & Jialal 2006; Stocker & Keaney 2004). Therefore,
a better understanding of the involvement ROS in progression of
atherosclerosis is crucial. This will likely drive future research towards strategies
of using antioxidants to attenuate atherosclerosis via inhibition of inadvertent
cellular oxidative damage or signalling pathway. Ultimately, this may have
important implications to both prevention and treatment of atherosclerosis (Lönn,
Dennis & Stocker 2012).
3.2.2.1.2 Myocardial Infarction (MI) and Myocardial Reperfusion Injury
Myocardial infarction (MI) (Figure 3-3) is the medical terms commonly
referred as an event of a heart attack. It is a type of cardiovascular disease
(CVD) that occur when normal blood flow to heart is obstructed, causing injuries
to the heart muscles and tissues. During such event, cardiac cells experienced
apoptosis or cell death as a result of oxidative stress by ischemia and
reperfusion injuries. Normal heart function begins to deteriorate along with the
extensive cardiac cell apoptosis (Ma et al. 2013).
Common themes for causality of MI are oxidative stress and
inflammation. Both components have been implicated in pathogenesis of MI
and their respective prevalence has strong positive correlation with reactive
oxygen species (ROS) and free radicals. Although the involvement of oxidative
stress and inflammation in progression of cardiac disorders has been evidently
established, a complete picture of the mechanisms involved is still remains
unclear. Through oxidative modification of essential cellular components, ROS
and free radicals are capable of damaging both physical and physiological
properties of cardiac cells or cardiomyocytes. Inflammatory responses triggered
by damaged cells step-in in later stage and subsequently create cycles of
![Page 84: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/84.jpg)
67
chronic damages that are difficult to breakdown. With extensive cardiac cell
death or apoptosis, it ultimately leads to the deterioration of cardiac function (Li
et al. 2013; Ma et al. 2013).
Figure 3-3: Graphical representation of acute myocardial infarction (MI). Normal
blood flow to heart is disrupted at site of arterial blockage and
subsequently damages the heart muscles and tissues. [Image
source: (Antipuesto 2014) ]
Reperfusion of myocardium refers to the condition in which the blood
supply returns to the heart tissue after myocardial ischemia. During the event of
myocardial ischemia, cardiac muscles can endure injuries from the event for up
to 15 minutes, following an immediate myocardial reperfusion before the death
of cardiomyocytes occurs (Verma et al. 2002). However, with the extended
duration and severity of ischemic injuries, the damage to myocardium is
irreversible even after reperfusion and the consequences can be fatal. Such
damage to myocardium is referred as ischemic reperfusion injury (Arslan et al.
2010).
![Page 85: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/85.jpg)
68
At the event of severe reperfusion injury, extensive damages to the
myocardium occur through endothelial injuries and permanent myocytes
apoptosis. Though numerous factors have been known for causing the injuries,
it has been evidently suggested that oxidative stress and ROS play the key
central role in mediating multiple signal transduction mechanisms and signalling
pathways in myocardial reperfusion injury (Hori & Nishida 2009). Substantial
amount of ROS is generated after the event of myocardial reperfusion. The
cellular redox mechanism and enzymes such as nicotinamide adenine
dinucleotide phosphate (NADPH oxidase), mitochrondria and xanthine oxidase
were among the major contributors of ROS (Chen et al. 1998; Wang et al.
1998). Localized accumulation of ROS will eventually leads to the onset of
oxidative stress and cause cell death.
In additional, ROS also mediate signalling pathway that further induce
the expression of inflammatory cytokines such as interleukin-6 (IL-6),
interleukin-1β (IL-1β) and tumour necrosis factor-α (TNF-α) (Irwin et al. 1999).
Overexpression of these inflammatory cytokines can also trigger additional
inflammatory responses that further threaten the survival and death of myocyte
cells (Nian et al. 2004).
Both ROS and inflammatory cytokines are capable of interrupting
mitochondrial energy production and ultimately induce myocyte cell death
(Hausenloy & Yellon 2008). After reperfusion injuries, impairment of intracellular
homeostasis of calcium (Ca2+) ions occurs at cardiomyocytes level. Extensive
production of ROS mediates the overloading of Ca2+ and further enhances the
permeability of cardiomyocytes’ mitochondrial membranes (known as
mitochondrial permeability transition pore, MPT pore) through a series of signal
transduction cascades (Hori & Nishida 2009; Javadov & Karmazyn 2007). The
opening of MPT pore ceases the normal function of mitochondria in ATP
production and halts the energy supports for sustaining the survival of myocyte
cells. Consequently, the cells died of energy depletion (Hausenloy & Yellon
2008).
![Page 86: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/86.jpg)
69
3.2.3 Antioxidants
Cells developed a series of antioxidant protection systems to regulate
and maintain redox homeostasis. The cellular antioxidant protection systems
can be derived from endogenous and exogenous origins (Krishnamurthy &
Wadhwani 2012). These systems work synergistically to maintain the balance
between oxidants and antioxidants within the physiological system. The
prevalence of oxidative stress arises when oxidation-reduction balance in cells
is disrupted. Normal cellular metabolic processes produce small amount of
ROS and free radicals. These radicals are usually scavenged by the cellular
antioxidant defence system which consists of endogenous cellular antioxidant
enzymes such as superoxide dismutase (SOD), catalase (CAT) and glutathione
peroxidase (GPx) (Pham-Huy, He & Pham-Huy 2008). However, in disease
state such as cardiac ischemia and reperfusion injuries, overproduction of ROS
and free radicals substantially deplete the available antioxidants and disrupt the
cellular redox homeostasis. With the elevation of ROS and free radicals status
in cells, it creates oxidative stress environments which promote cell death (Ma
et al. 2013; Noori 2012).
Apart from endogenous cellular antioxidants, natural exogenous
antioxidants are also involved in quenching of ROS and free radicals within the
biological system. These antioxidants are usually derived from food and often
require replenishment via dietary sources. Through years of extensive research
on natural antioxidants, they have been proven to quench free radicals
effectively and improve the antioxidant status of cells and provide protection
against cellular oxidative injuries (Magalhaes et al. 2009). With the fact that
chemistry between oxidants and antioxidants controls various crucial cellular
pathway and metabolism, the simple ‘oxidant-antioxidant imbalance’ theory has
now grown to be incorporated into the progression of various chronic diseases.
Hence, the rationale for strategies of utilizing exogenous natural antioxidants as
therapeutic intervention to attenuate cardiac injury through inhibition of
inadvertent cellular oxidative damage or signalling pathways may have
important implications to both the prevention and treatment of these diseases
(Tsuda et al. 2002b).
![Page 87: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/87.jpg)
70
3.2.3.1 Endogenous antioxidant
Endogenous antioxidants are the antioxidant protection system produced
by the body. They can be sub-categorized into non-enzymatic- and enzymatic
antioxidants (Krishnamurthy & Wadhwani 2012).
Non-enzymatic antioxidants refer to components such as bilirubin,
coenzyme Q10, uric acid, glutathione and cellular redox system, NADPH and
NADH (Krishnamurthy & Wadhwani 2012). Endogenous enzymatic antioxidants
often refers to cellular antioxidant enzymes such as superoxide dismutase
(SOD), catalase (CAT) and glutathione peroxidase (GPx) (Pham-Huy, He &
Pham-Huy 2008). They are the first line of enzyme-based cellular defensive
systems. Each enzyme plays a different role is alleviation of oxidative injury
(Rodrigo et al. 2013). Briefly, SOD involves in the neutralization of superoxide
anions (O2•-) into hydrogen peroxide (H2O2) and oxygen (O2). H2O2 later
becomes the substrate for both CAT and GPX. CAT transforms H2O2 to water
(H2O) and oxygen (O2) molecules while GPx catalyses the reduction of H2O2
and hydroperoxides in the presence of co-substrate, reduced glutathione (GSH)
(Pham-Huy, He & Pham-Huy 2008).
3.2.3.1.1 Superoxide Dismutase (SOD)
To date, four different isoforms of SOD have been identified. Each of
these metalloproteins contains different metal ions: manganese (Mn), Copper-
Zn (Cu/Zn), nickel (Ni) and Iron (Fe) (Meier et al. 1998). Most eukaryotes have
three forms of SOD. They are Mn-SOD, Cu/Zn-SOD, and EC-SOD (known as
extracellular SOD, the secreted form of Cu/Zn-SOD) (Kang & Kang 2013). Mn-
SOD present mostly in mitochrondria while Cu/Zn-SOD occupies areas within
the nucleus, cell cytoplasm, and blood plasma (Krishnamurthy & Wadhwani
2012). Bacteria mostly utilize Fe-SOD or Mn-SOD which localized
predominantly in the mitochondria (Dos Santos et al. 2000). Catalytic reaction
of SOD can be represented in the reaction equation below (Equation 3):
![Page 88: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/88.jpg)
71
Equation 3: 2 O2- + 2 H+
𝐒𝐎𝐃→
H2O2 + O2
The highly reactive superoxide anions (O2•-) are neutralized by SOD to
yield H2O2 and O2. The less reactive H2O2 is further co-ordinately neutralized by
CAT and GPx. The metal ions located at the active site of the enzymes are
responsible for the catalytic conversion of O2•- to H2O2 and O2 through redox
reactions (Meier et al. 1998). Majority of the SODs have affinity towards fluoride
ion (F-) and azide ion (N3-) which are both singly-charged anions. However,
each isoform of SOD has distinctive response towards different anions. It was
noted that F-, N3- and cyanide (CN-) are the competitive inhibitors of Cu/Zn SOD
(Leone et al. 1998; Vance & Miller 1998).
3.2.3.1.2 Catalase (CAT)
CAT enzyme has four porphyrin heme (iron-containing) groups. The
enzyme catalyses the conversion of H2O2 to H2O and O2 in a two-steps reaction
(Equation 4) (Kang & Kang 2013). First step involves the oxidation of heme
group in CAT by a molecule of H2O2. First step of the reaction yields an
oxyferryl heme and a radical of porphyrin cation. Second step of the reaction
involves the reduction of the enzyme back to its ground state and generate one
molecule of H2O and O2 respectively (Krishnamurthy & Wadhwani 2012).
Equation 4: 2 H2O2
𝐂𝐀𝐓→ 2 H2O + O2
ROOH + AH2 H2O + ROH + A
CAT protects intracellular ROS homeostasis by detoxifying H2O2
produced from cellular metabolic activities. The enzyme primarily localized in
peroxisomes of the cells and actively neutralize H2O2 that diffuses into the
peroxisomes (Slater 1984). It is also a highly conserved protein and gets
encoded by a single gene. The presence of CAT is abundant in erythrocytes,
![Page 89: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/89.jpg)
72
kidneys and liver. It has also been reported that its enzymatic activity is the
highest in these components (Kang & Kang 2013; Nishikawa et al. 2002).
3.2.3.1.3 Glutathione Peroxidase (GPx)
GPx is a selenocysteine (Sec)-containing enzyme. The enzyme protects
the cells against low level of oxidative injury by neutralizing H2O2 and organic
hydroperoxides in the presence of its co-substrate, GSH and the cellular
NADPH-NADH redox system. The catalytic reaction involves the oxidation of
GSH to oxidized form of glutathione (GSSG). GSSG is then reduced back to
GSH by glutathione reductase (Equation 5) (Pham-Huy, He & Pham-Huy 2008).
Equation 5: ROOH + 2 GSH
𝐆𝐏𝐱→ ROH + GSSG + H2O
Eight different isoforms of GPx have been detected in mammals. Majority
of the GPx isoforms (GPx1, GPx2, GPx3, GPx4 and GPx6) are selenocysteine-
containing enzymes while the remaining isoforms contain only cysteine at the
active site of the enzymes. Among all the isomeric forms of GPx, only the
functions of GPx1, GPx3 and GPx4 have been characterized to date (Kang &
Kang 2013). Both GPx1 and GPx4 genes encode cytosolic GPx that are mainly
distributed in cytoplasm. GPx1 gene has also involved in encoding
mitochondrial GPx while GPx4 also encodes phospholipid hydroperoxide GPx
that mainly localized in associated membrane. As for GPx3, it encodes
extracellular GPx which is the secreted form of GPx (Esworthy, Ho & Chu 1997;
Imai & Nakagawa 2003; Kang & Kang 2013).
![Page 90: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/90.jpg)
73
3.2.3.2 Exogenous Antioxidants
Exogenous antioxidants are dietary antioxidants that are not produced in
the body. They are usually supplied to the body as food or supplements and
need to be replenish regularly at moderate amount. Examples of exogenous
antioxidants include polyphenols (flavonoids), vitamins (vitamin C and E), beta
carotene, carotenoids, and polyunsaturated fatty acids (omega-3 and omega-6
fatty acids) (Pham-Huy, He & Pham-Huy 2008).
Both vitamin C and E have been widely studied and they are known as
the most important vitamin-based antioxidants in the biological system. Vitamin
C (ascorbic acid) is hydrophilic in nature. Due to its instable and hydrophilic
nature, it is readily excreted from the body and hence it requires constant
replenishment. It is an important ROS scavenger in the extracellular fluids and
essentially required for the biosynthesis of neurotransmitters and collagen (Li &
Schellhorn 2007), Vitamin C has been shown to exhibit antioxidant,
carcinopreventive- and immunomodulatory-properties. Synergistic effect of
vitamin C and E in quenching of free radical has also been reported (Pham-Huy,
He & Pham-Huy 2008). However, overdose (> 2000mg/day) of vitamin C was
found to exhibit the properties of pro-oxidants (Naidu 2003).
Vitamin E is lipophilic in nature. It exists in two major forms: tocopherol
and tocotrienols. Each form is further sub-divided into four different derivatives
(α-, γ-, β-, and δ-isomers) (Wolf 2005). The different isomeric forms of vitamin E
are distinguished by the degree of substitution of methyl groups (-CH3) in the
chromanol head (Liva 2008). The antioxidant activity of vitamin E is largely
attributed to the presence of redox active hydroxyl (-OH) group on its chromanol
ring. It protects fatty acids of the cell membrane from lipid peroxidation (Litwack
2007). Aside from its antioxidant properties, other health attributes of vitamin E
includes, anticancer, anti-cholestrolemic, anti-hypertensive, anti-diabetic,
cardioprotective- and neuroprotective-effects have also been reported from in
vitro and in vivo study models. (Alexander 2008; Hsieh & Wu 2008; Lee, Mar &
Ng 2009; Newaz & Nawal 1999).
![Page 91: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/91.jpg)
74
The research on plant-derived natural antioxidants becomes one of
emerging field of study in the recent years (Islam et al. 2014). These
phytochemicals are natural antioxidants comprise of phenolic or polyphenolic
compounds such as polyphenols, flavonoids, anthocyanins, vitamins, and
resveratrol which are commonly found in fruits, vegetables and nuts (Tsuda et
al. 2002a). It has been revealed that frequent dietary intakes of antioxidant-rich
food are commonly linked with low incidence of oxidative stress associated
diseases. These naturally occurring bioactive constituents provide a defence
system to the body by eliminating free radicals and protect the body against
oxidative injuries (Mukhopadhyay 2000). Research on natural antioxidants have
shown positive health effects towards cardioprotection, inflammation, anti-
infection, liver protection, anti-diabetic, anti-obesity and neurodegenerative
processes (Aedín, José & Peter 2012; Anne & Barrie 2008; Biasutto, Mattarei &
Zoratti 2012; Cesar & Patricia 2012; Chang et al. 2009; Mireia et al. 2012). All
these health benefits are proposed to be attributed to the synergistic antioxidant
protective effects of different phytochemicals present in plant materials (de Kok,
van Breda & Manson 2008).
.
![Page 92: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/92.jpg)
75
3.3 Research Aims and Objectives
The main aim for this part of the research work was to study the
bioactivities of RBE derived from different Sarawak local rice varieties via
selected in vitro antioxidant assays. In order to achieve the aforementioned aim,
experimental works were designed to fulfil the following objectives:
a. Study of antioxidant activity of RBE based on in vitro chemical-based
systems.
b. Study of antioxidant activity of RBE based on in vitro mammalian cell
culture-based system.
c. Determination of the optimal and safe dosage of RBE that is
appropriate for its maximal antioxidant activity in in vitro mammalian
cell culture-based system.
d. Assessment of RBE on the induction of endogenous cellular
antioxidants in in vitro mammalian cell culture-based system.
3.4 Experimental Design
Antioxidant activities of RBE were studied based on two different types of
in vitro systems: chemical-based system and cell culture based system.
3.4.1 Materials and Chemicals
In vitro chemical-based systems: 2,2-diphenyl-1-picrylhydrazyl (DPPH)
and trolox standard were purchased from Sigma Aldrich. Absolute ethanol
(EtOH) was purchased from Fisher Scientific (Malaysia). Tocomin50 (Carotech,
Malaysia) standard was a gift in kind given by Prof. Yuen Kah Hay and Dr.
Sherlyn Lim from Universiti Sains Malaysia (USM).
![Page 93: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/93.jpg)
76
In vitro cell culture-based system: H9c2(2-1) Rattus norvegicus rat’s
cardiomyocytes (ATCC® CRL-1446TM) was purchased from ATCC. CellTiter
96® Aqueous Non-Radioactive Cell Proliferation assay kit was purchased from
Promega, Dulbecco’s Modified Eagle Medium (DMEM) and phosphate buffer
saline (PBS) were purchased from Gibco®. Fetal Bovine Serum (FBS),
Penicillin-Streptomycin (10,000 units), 0.25% Trypsin-EDTA, trypan blue, and
dimethyl sulfoxide (DMSO) were purchased from Sigma Aldrich. Hydrogen
peroxide (30% v/v) was purchased from Bendosen (Malaysia). Absolute ethanol
(EtOH) was purchased from Fisher Scientific (Malaysia). AxyPrep multisource
total RNA miniprep kit was purchased from Axygen. QuantiFast SYBR® Green
RT-PCR kit was purchased from Qiagen. Superoxide dismutase assay kit and
catalase assay kit were purchased from Cayman Chemical. Glutathione
peroxidase activity colorimetric assay kit was purchased from Biovision.
3.4.2 Test Samples
Nine different types of RBE prepared in Chapter 2 were all used to
assess their respective antioxidant activities via in vitro chemical-based
systems. Tocomin50 was used as a positive control for comparison. After the
assessment of antioxidant activities of different RBE via in vitro chemical-based
systems, rice bran extract that gave the high antioxidant activity along with rice
bran extract of commercial rice, MR219 were selected to further assess their
respective antioxidant activities via in vitro cell culture-based system.
3.4.3 Methodology
Two In vitro chemical-based systems (DPPH free radical scavenging
assay and Trolox Equivalent Antioxidant Capacity (TEAC) assay) and in vitro
cell culture-based system were used to determine the antioxidant activities of
different RBE. As depicted in Figure 3-4, it showed the schematic
representation of experimental approaches used to determine the antioxidant
activities of RBE.
![Page 94: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/94.jpg)
77
H9c2(2-1) Cardiomyocyte
Cell Viability
Assay Cellular Antioxidant
Activity Assay
Gene Expression Study of Cellular
Antioxidants
Cell viability
assay via:
Microscopic
Observation
Trypan Blue
Exclusion
MTS Assay
Activity Assay
on:
SOD
enzyme
CAT enzyme
GPx enzyme
Figure 3-4: Overview of experimental approaches applied for bioactivity studies of antioxidants from rice bran extracts
Gene expression
assessment via
qPCR on:
SOD enzyme
CAT enzyme
GPx enzyme
In Vitro Cell Culture-Based System
Rice Bran
Extracts
Hydrogen
Peroxide
In Vitro Chemical-Based System
Tocomin50 (Positive Control)
Antioxidant
Capacity Assays
Rice Bran
Extracts
DPPH Free
Radical
Scavenging
Assay
Trolox Equivalent
Antioxidant
Capacity (TEAC)
Assay
Trolox (Positive Control)
![Page 95: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/95.jpg)
78
3.4.3.1 In Vitro Chemical-Based System
3.4.3.1.1 DPPH Free Radical Scavenging Assay
DPPH free radical scavenging assay was performed as per method of
Herald, Gadgil and Tilley (2012) with minor modifications. Briefly, 0.2mM DPPH
free radical solution was prepared in absolute ethanol. Different serially diluted
(2x) concentrations (156.25µg/mL to 5000µg/mL) of RBE and positive control,
Tocomin50 were serially diluted and 50µL of each serially diluted sample were
aliquoted into 96 wells microplate. Absolute ethanol was used as negative
control and reagent blank. A total volume of 50µL of 0.2mM DPPH free radical
solution was then added to each well and the plate was allowed to incubate for
30 minutes and kept away from light. The absorbance was later measured at
517nm via microplate reader (Synergy HT, Biotek). DPPH free radical
scavenging capacity of different RBE was determined via the following equation
(Equation 6):
Equation 6: DPPH free radical scavenging capacity = (𝑨𝟎−𝑨)
𝑨𝟎 x 100 %
*where A0 = absorbance of control sample; A = absorbance of test sample
3.4.3.1.2 Trolox Equivalent Antioxidant Capacity (TEAC) Assay
TEAC assay was performed based on the DPPH-scavenging capacities
of different RBE. The assay method was performed as per method of Pisoschi,
Cheregi and Danet (2009) with minor modifications. Briefly, different
concentrations of trolox were prepared (n=3) to establish a reference standard
curve. A total volume of 50µL of serially diluted (2x) concentrations
(156.25µg/mL to 5000µg/mL) of RBE (n=3) were aliquoted into 96 wells
microplate and was then followed by the addition of 50µL of the prepared DPPH
free radical solution (0.2mM). The plate was later incubated in the dark for 30
minutes before the absorbance was measured at 517nm via microplate reader
(Synergy HT, Biotek). Equation 6 was used to determine the DPPH free radical
![Page 96: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/96.jpg)
79
scavenging capacity of different RBE and results were expressed in unit of nmol
of Trolox equivalent/100 g dry extract.
3.4.3.1.3 Statistical Analysis
All results data were presented as mean and standard deviation of three
consecutive experimental repetitions on similar sample. Statistical tool,
GraphPad Prism (GraphPad Software, Inc. USA) was used to analyse the data
via one-way analysis of variance (ANOVA) and Student’s t-test. Statistical
significance and confidence level of data were set at P ≤ 0.05.
![Page 97: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/97.jpg)
80
3.4.3.2 In Vitro Cell Culture-Based System
3.4.3.2.1 Cell Culture and Growth Curve Study
H9c2(2-1) Rattus norvegicus rat’s cardiomyocyte was used as the
mammalian cell culture model for in vitro cell culture-based antioxidant assay.
The cells were cultivated in DMEM media supplemented with 10% fetal bovine
serum (FBS) and 100 units/mL of penicillin-streptomycin (final concentration).
Cells were incubated at 37°C and 5% CO2. Sub-cultivation of cells was
performed when cells achieved 70% - 80% confluence. Cells in passage
number 20-25 were used in all experiments and appropriate concentration of
cells was seeded for different experiments accordingly.
Growth curve study: Growth curve study of H9c2(2-1) cardiomyocytes
was performed as per method of Iloki Assanga et al. (2013) with slight
modifications. Briefly, cells were initially plated on 25cm2 cell culture flask at a
density of 6000 cells (initial cell density). The cells were allowed to incubate for
24 hours at 37℃, 5% CO2. The cells were allowed to incubate over a period of 8
days and cell counting was performed at one day interval using the trypan blue
dye exclusion method on a haemocytometer. Microscope cell images were
taken manually through an inverted microscope system (Nikon Eclipse Ti-S).
The growth curve of the cells was presented in the form of non-linear fitting of
polynomial curve. The doubling time (DT) of H9c2(2-1) cardiomyoctes was
determined via the following equation (Equation 7):
Equation 7: DT= T x 𝒍𝒏 (𝟐)
𝐥𝐧 (𝐗𝐞/𝐗𝐛)
In which:
T - Incubation time (in any units).
Xb - Cell number at the initial of the incubation time.
Xe - Cell number at the end of the incubation time.
![Page 98: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/98.jpg)
81
3.4.3.2.2 Cell cytotoxicity Assay
The cell toxicities of selected RBE and hydrogen peroxide were studied
by using a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-
sulfophenyl)-2H-tetrazolium (MTS)-based assay kit (CellTiter 96® Aqueous
Non-Radioactive Cell Proliferation Assay Kit, Promega). Appropriate
concentrations of cells were plated onto 96 wells microplate and pre-incubated
for 24 hours before the cells were further treated with RBE and hydrogen
peroxide.
A. Cell cytotoxicity study of selected RBE
Different concentrations (6.25µg/mL to 500µg/mL) of selected RBE were
prepared by diluting the prepared stocks in two-fold dilutions with serum-free
DMEM. The range of concentration was prepared to identify the inhibition
concentration (IC50) of RBE. The final concentration of ethanol content in each
sample was kept below 1% (v/v) and ethanol (1% v/v) was used as negative
control in the assay. The treated cells were incubated for 24, 48 and 72 hours
respectively. Cell viability was determined via the MTS assay kit (CellTiter 96®
Aqueous Non-Radioactive Cell Proliferation Assay Kit, Promega). Briefly, after
the incubation period, media were discarded and cells were washed and
replaced with fresh serum-free DMEM. MTS reagent was then added to each
well and the microplate was incubated for 4 hours before the absorbance was
measured at 490nm through a microplate reader (Synergy HT, Biotek). IC50 of
rice bran extracts were determined from the cell viability curves.
B. Cell cytotoxicity study of hydrogen peroxide (H2O2)
Different concentrations (15.625µM to 1000µM) of H2O2 were prepared
by diluting the prepared stock in two-fold dilutions with PBS buffer. The range of
concentration was prepared to identify the inhibition concentration (IC50) of H2O2.
Standardisation of H2O2 was performed spectrophotometrically by measuring
the absorbance of prepared samples at 240nm and a molar extinction
coefficient of 43.6M-1cm-1 was used to calculate the actual concentration of
![Page 99: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/99.jpg)
82
hydrogen peroxide prepared. PBS buffer was used as negative control in the
assay. H2O2 treated cells were incubated for 24 hours and cell viability was
determined via the MTS assay kit (CellTiter 96® Aqueous Non-Radioactive Cell
Proliferation Assay Kit, Promega). Briefly, after the incubation period, media
were discarded and cells were washed and replaced with fresh serum-free
DMEM. MTS reagent was then added to each well and the microplate was
incubated for 4 hours before the absorbance was measured at 490nm through a
microplate reader (Synergy HT, Biotek). Inhibition (IC50) of hydrogen peroxide
was determined from the cell viability curve.
3.4.3.2.3 Induction of Oxidative Stress
H9c2(2-1) cells were seeded and incubated at 37°C and 5% CO2 for
24 hours before they were treated with RBE. The cells were treated with specific
concentrations of the selected RBE, and were incubated for 24 hours. After 24
hours incubation, growth media were replaced and oxidative stress was induced
by treating the cells with different concentrations (62.5µM to 1000µM) of
hydrogen peroxide. The treated cells were incubated for another 24 hours
before the cell viability was determined via MTS assay kit (CellTiter 96®
Aqueous Non-Radioactive Cell Proliferation Assay Kit, Promega). MTS reagent
was then added to each well and the microplate was incubated for 4 hours
before the absorbance was measured at 490nm through a microplate reader
(Synergy HT, Biotek).
3.4.3.2.4 Endogenous Antioxidant Enzyme Activity Studies
Superoxide dismutase (SOD), catalase (CAT) and glutathione peroxide
(GPx) were the targeted endogenous antioxidant enzymes in this experiment.
The activities of targeted endogenous antioxidant enzymes were studied by
using commercially available ELISA kits. Samples were prepared as per
protocols stated in the kits’ manual. Briefly, cells were detached by using rubber
![Page 100: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/100.jpg)
83
policeman and collected in ice cold PBS buffer (pH 7.4). Cell lysis was
performed via physical disruption by sonicating the cells in ultrasonic water bath
for 2 minutes. The superoxide dismutase activity was examined via Superoxide
Dismutase Assay kit (Cayman Chemical); catalase activity was examined via
Catalase Assay Kit (Cayman Chemical); glutathione peroxidase activity was
examined via Glutathione Peroxidase Activity Colorimetric Assay Kit (Biovision
Incorporated). The absorbances of reaction mixtures were measured at
respective wavelength defined for each assay kit.
3.4.3.2.5 Endogenous Antioxidant Enzyme Gene Expression Studies
Superoxide dismutase 2 (SOD2), catalase (CAT) and glutathione
peroxide 1 (GPx1) were the targeted endogenous antioxidant enzymes in this
experiment. The effects of RBE and hydrogen peroxide inductions on the gene
expression of targeted endogenous antioxidant enzymes were assessed
through quantitative Real Time Polymerase Chain Reaction (qRT-PCR)
approach.
Cell cultivation: H9c2(2-1) cells were seeded and incubated at 37°C and
5% CO2 on 6-wells plates for 24 hours before they were treated with RBE and
hydrogen peroxide respectively.
Total RNA extraction: Extraction of RNA from H9c2(2-1) cardiomyocytes
was performed through AxyPrep Multisource Total RNA Miniprep kit (Axygen
Biosciences). Prior to RNA extraction, supernatants were discarded and cells
were washed twice with ice cold PBS buffer (pH 7.4). Then, the extraction of
RNA from cells was performed as per method described in the kit protocol.
RNase-free water was used to elute the purified total RNA. RNA samples were
kept on ice when they are in used or stored in -80℃ until further use.
Nucleic acid quantitation and qualification: The concentration and purity
of extracted RNA were assessed spectrophotometrically through a microplate
reader (Synergy HT, Biotek) by using Take3 Micro-Volume Plates. The pre-set
settings for nucleic acid quantitation and qualification were selected, and the
![Page 101: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/101.jpg)
84
absorbances of samples were measured at the wavelengths of 230nm, 260nm,
280nm, and 320nm (background check) respectively. RNase-free water was
used as blank reagent. The absorbance ratios of 260/280 and 260/230 were
used to determine the purity of RNA samples. The acceptable absorbance ratio
for 260/280 as pure RNA is ≥ 2.0 while the acceptable range of absorbance
ratio for 260/230 as pure RNA is between 2.0 to 2.2.
Relative quantitation of gene expression: Gene expression studies of
targeted endogenous cellular antioxidant enzymes were performed through
qRT-PCR approach. A one-step qRT-PCR kit (Quantifast SYBR® Green RT-
PCR kit, Qiagen) was used to quantify the RNA targets. A total 20ng of RNA
sample (final amount per reaction tube = 2ng) was mixed with reagent kits and
oligonucleotide primers sets as per manufacturer’s instructions. The sequences
of oligonucleotide primers used in this experiment are as follow (Table 3-1):
Table 3-1: Oligonucleotide primer sequences
Primer Set Primer Sequence
Superoxide Dismutase 2 (SOD2)
Forward Primer:
5'-GTGTCTGTGGGAGTCCAAGG-3'
Reverse Primer:
5'-TGATTAGAGCAGGCGGCAAT-3'
Catalase (CAT)
Forward Primer:
5'-CGCCTGTGTGAGAACATTGC-3'
Reverse Primer:
5'-TAGTCAGGGTGGACGTCAGT-3'
Glutathione Peroxidase 1 (GPx1)
Forward Primer:
5'- CTCGGTTTCCCGTGCAATCA -3'
Reverse Primer:
5'-ACCGGGTCGGACATACTTGA-3'
Glyceraldehyde 3-phosphate dehydrogenase (GADPH)
Forward Primer:
5’- CAG GGC TGC CTT CTC TTG TG -3’
Reverse Primer:
5’- CTT GCC GTG GGT AGA GTC AT -3’
![Page 102: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/102.jpg)
85
Amplification reactions of RNA targets were performed via Rotor-Gene Q
2plex HRM Platform (Qiagen). Settings for reaction cycles were configured as
per method specified in the kit manual (Table 3-2).
Table 3-2: qRT-PCR Reaction Cycle Condition (Qiagen 2011)
Step Time Temperature
Reverse Transcription 10 minutes 50 ℃
PCR Initial Activation Step 5 minutes 95 ℃
Two-Step Cycling 40 cycles
Denaturation 10 seconds 95 ℃
Annealing/Extension 30 seconds 60 ℃
Melt Curve 90 seconds Ramp from 72 ℃ to 95 ℃
5 seconds 95 ℃
All amplification reactions were normalized to mRNA expression of
housekeeping gene, Glyceraldehyde 3-phosphate dehydrogenase (GADPH) for
Rattus norvegicus. All samples were prepared in triplicates and relative gene
expression levels of RNA targets were normalized to that of negative control
cells.
3.4.3.2.6 Statistical Analysis
All results data were presented as mean and standard deviation of three
consecutive experimental repetitions on similar sample. Statistical tool,
GraphPad Prism (GraphPad Software, Inc. USA) was used to analyse the data
via one-way analysis of variance (ANOVA) and Student’s t test. Statistical
significance and confidence level of data were set at P ≤ 0.05.
![Page 103: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/103.jpg)
86
3.4.4 Results and Discussions
3.4.4.1 In Vitro Chemical-Based System
3.4.4.1.1 DPPH Free Radical Scavenging Assay
The DPPH free radical scavenging assay was used to assess the
antioxidant capacities of different RBE. The inhibitory concentrations (IC50) of
RBE represent the concentration of extract required to scavenge the initial
concentration of DPPH free radicals by 50%. The lower the IC50 value of extract,
the stronger the efficacy of extract in DPPH free radical scavenging activity.
Table 3-3: Inhibitory concentration (IC50) of different RBE for DPPH free radical
scavenging assay. Values represents mean ± standard deviation of 3
concecutive repetitions (n=3). Different letters within the same column
denote significant differences at P ≤ 0.05 (Tukey’s Test). Graphical
representation for the following data is presented in Figure 5-5
(Appendix section).
Sample
Inhibitory Concentration (IC50)
for DPPH Free Radical Scavenging Assay
(µg/mL)
Tocomin50 (Positive control) 78.81 ± 1.29a
Bajong LN 188.46 ± 10.95b
Bali 222.63 ± 4.36b
Pandan 749.19 ± 20.61c
Bajong 1063.78 ± 20.08d
Wangi Mamut 1124.07 ± 21.24de
MR219 1130.65 ± 9.14de
Bubuk 1295.25 ± 17.11def
Biris 1534.43 ± 44.97def
Bario 2279.41 ± 25.9g
![Page 104: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/104.jpg)
87
Table 3-3 shows the (IC50) of different RBE for DPPH free radicals
scavenging assay. Based on the obtained data, the IC50 values of different RBE
were significantly different from one another (P ≤ 0.05). The values were in the
range of 188.46µg/mL to 2279.41µg/mL respectively. The RBE of Bajong LN
showed the lowest IC50 value (188.46µg/mL) among all the RBE while the
highest IC50 value was determined in the RBE of Bario (2279.41µg/mL).
DPPH free radical, also known as 2,2-diphenylpicrylhydrazyl assay is one
of the commonly used chemical assays for antioxidant activity (Pyrzynska &
Pekal 2013). DPPH is a stable free radical that lacks of one hydrogen atom. It
can be neutralized via transfer of electron or hydrogen atom and form
corresponding hydrazine, DPPH2. When the DPPH free radical is neutralized to
form DPPH2, the initial colour of the chemical changes from purple to yellow
(Sharma & Bhat 2009). As a result of the nature of the chemical, it is suitable for
antioxidant activity studies. The DPPH free radical scavenging activities of
different concentrations of RBE were depicted in Figure 3-5. Based on the
results, the DPPH free radical scavenging activities of RBE were proportional to
their respective concentrations.
In this experiment, the effects of different concentrations of various RBE
on DPPH free radical scavenging were studied. A significant decrease in DPPH
concentration was determined with higher concentration of RBE used in the
assay. In addition, the DPPH free radical scavenging activities of RBE also
varied among different RBE. Such discrepancies were attributed to the
differences in the contents of bioactive compounds among different RBE. The
efficacies of different RBE in DPPH free radical scavenging were expressed by
identifying the concentration of test sample required to neutralize 50% of the
initial concentration of DPPH, also known as the inhibition concentration (IC50).
A low IC50 value indicates a relatively strong antioxidant activity of the extract
samples and vice versa (Sirikul, Moongngarm & Khaengkhan 2009).
![Page 105: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/105.jpg)
88
1.12
0%
20%
40%
60%
80%
100%
0 2 4
DP
PH
Rad
ical
Scav
en
gin
g
Acti
vit
y (
%)
Concentration (x103 µg/mL)
Wangi Mamut
WangiMamut
IC50
1.30
0%
20%
40%
60%
80%
100%
0 2 4
DP
PH
Rad
ical
Scav
en
gin
g
Acti
vit
y (
%)
Concentration (x103 µg/mL)
Bubuk
Bubuk
IC50
2.28
0%
20%
40%
60%
80%
100%
0 2 4
DP
PH
Rad
ical
Scav
en
gin
g
Acti
vit
y (
%)
Concentration (x103 µg/mL)
Bario
Bario
IC50
1.53
0%
20%
40%
60%
80%
100%
0 2 4
DP
PH
Rad
ical
Scav
en
gin
g
Acti
vit
y (
%)
Concentration (x103 µg/mL)
Biris
Biris
IC50
0.19
0%
20%
40%
60%
80%
100%
0 1 2
DP
PH
Rad
ical
Scav
en
gin
g
Acti
vit
y (
%)
Concentration (x103 µg/mL)
Bajong LN
Bajong LN
IC50
0.75
0%
20%
40%
60%
80%
100%
0 2 4
DP
PH
Rad
ical
Scav
en
gin
g
Acti
vit
y (
%)
Concentration (x103 µg/mL)
Pandan
Pandan
IC50
*[Figure continues on to next page]
![Page 106: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/106.jpg)
89
Figure 3-5: DPPH free radical scavenging activities of different concentrations of different crude RBE. The data represented mean ±
standard deviation of three repetitions (n=3).
1.13
0%
20%
40%
60%
80%
100%
0 2 4
DP
PH
Rad
ical
Scav
en
gin
g
Acti
vit
y
(%)
Concentration (x103 µg/mL)
MR219
MR219
IC50
0.22
0%
20%
40%
60%
80%
100%
0 1 2
DP
PH
Rad
ical
Scav
en
gin
g
Acti
vit
y (
%)
Concentration (x103 µg/mL)
Bali
Bali
IC50
1.06
0%
20%
40%
60%
80%
100%
0 2 4
DP
PH
Rad
ical
Scav
en
gin
g
Acti
vit
y (
%)
Concentration (x103 µg/mL)
Bajong
Bajong
IC50
![Page 107: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/107.jpg)
90
The lowest IC50 value was detected from RBE of pigmented rice variety,
Bajong LN (188.46µg/mL). The obtained data was comparable to some of
reports from the literature, IC50 values from 15 different pigmented rice varieties
were in the range of 117µg/mL and 121µg/mL (Goufo & Trindade 2014). Rao et
al. (2010) conducted a similar study on some Indian medicinal rice varieties.
Contrarily, they reported IC50 values in the range of 30.85 to 87.72µg/mL which
is lower than the results obtained in this study. In addition, another study on
defatted rice bran of Thai rice varieties also reported a relatively low range of
IC50 values (9.19 to 19.73µg/mL) (Sirikul, Moongngarm & Khaengkhan 2009).
The relatively low IC50 values reported from both Indian medicinal and
Thai rice varieties indicate stronger antioxidant activities and higher efficacies of
the extracts in DPPH free radical scavenging as compared to the extracts of
Sarawak local rice varieties in the present study. It was suggested that variation
in plant genotypes could be one of the factors causing the difference in IC50
values between the presently obtained data and those reported from the
literature. Other factors such as environmental factor (Britz et al. 2007) and
extraction method (Chen & Bergman 2005) also significantly influence the total
content of natural antioxidants present in the extracts. Therefore, direct
comparison cannot be made unless experimental protocols are standardized
among all samples. Nevertheless, the present data have demonstrated the free
radical scavenging capabilities of RBE derived from different Sarawak rice
varieties. This was observed through successive dose-dependent free radical
scavenging effects of RBE in comparison to negative control.
Regression and correlation analyses of 1/DPPH (IC50) with total phenolic,
total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol,
γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE were represented in
Table 3-4. Strong positive (R ≥ 0.8) and significant (P ≤ 0.05) correlations
were observed in DPPH free radical scavenging activity against total phenolic
content, total flavonoid content, and total γ-oryzanol content respectively. Such
observations suggest the contributions of phenolic compounds, flavonoids, and
γ-oryzanol from RBE in DPPH free radical scavenging; indicating the
significance of phenolic compounds, flavonoids, and γ-oryzanol as the potential
![Page 108: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/108.jpg)
91
sources of natural antioxidants contributing to the efficacy of total antioxidant
activities in RBE.
Among the three, the highest correlation value of 1/DPPH (IC50) was
observed with the total phenolic content in RBE (R = 0.9425), followed by γ-
oryzanol (R = 0.8917) and flavonoids (R = 0.8455) respectively. It was
discovered that sample’s total phenolic and flavonoid contents have more
profound effects on DPPH free radical scavenging (Goufo & Trindade 2014).
Rao et al. (2010) also reported the significant contribution of phenolic
compounds as the potential source of natural antioxidants responsible for the
total antioxidant activities in RBE.
Poor correlations between 1/DPPH (IC50) and vitamin E derivatives
(tocotrienols and tocopherol) were reported, with R values ranged from 0.1919
to 0.7105. The poor correlations were due to the lipophilic nature of vitamin E
derivatives (Cederberg, Siman & Eriksson 2001). DPPH assay was conducted
with aqueous alcohol (absolute ethanol) which is favourable for hydrophilic
antioxidants (Kedare & Singh 2011). In the absence of solubilizing agent,
factors such as solvent properties and nature of targeted compounds have
been shown to hinder the reactions between antioxidants and DPPH radicals
(Yu 2008).
Several reports from literature have highlighted on the radical-
scavenging activity of γ-oryzanol. The compound is known to exhibit higher
activity in DPPH free radical scavenging as compared to different derivatives of
vitamin E (Chotimarkorn & Silalai 2008). As of different derivatives of vitamin E,
correlation analysis between 1/DPPH (IC50) and total vitamin E content in RBE
reported a statistically significant (P ≤ 0.05) R value of 0.7105. Among the
different targeted vitamin E derivatives, the highest R value was observed in γ-
tocotrienol content (R = 0.6534), then followed by δ-tocotrienol (R = 0.3453), α-
tocopherol (R = 0.3380), and α-tocotrienol (R = 0.1919). Such observations
suggest that γ-tocotrienol as the potential vitamin E derivative that contribute
more to the overall antioxidant activity of RBE while the remaining vitamin E
derivatives reported a weak correlation with DPPH free radical scavenging
activity.
![Page 109: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/109.jpg)
92
Table 3-4: Regression and correlation analyses of 1/DPPH (IC50) with total
phenolic, total flavonoid, total anthocyanin, total γ-oryzanol, total
vitamin E, δ-tocotrienol, γ-tocotrienol, α-tocotrienol, and α-
tocopherol from RBE. Correlation graphs for the following data were
depicted in Figure 5-6 (Appendix section).
1/DPPH (IC50)
vs Total
Phenolic
Content
1/DPPH (IC50)
vs Total
Flavonoid
Content
1/DPPH (IC50)
vs Total
Anthocyanin
Content
1/DPPH (IC50)
vs Total γ-
Oryzanol
Content
R value 0.9425 0.8455 -0.5384 0.8917
R2 0.8884 0.7148 0.2899 0.7951
P value 0.001303 0.001183 0.001154 0.05790
Slope 0.0001239 0.0003331 -0.0002505 0.0000008604
1/DPPH (IC50)
vs Total
Vitamin E
Content
1/DPPH (IC50)
vs δ-
Tocotrienol
Content
1/DPPH (IC50)
vs γ-
Tocotrienol
Content
1/DPPH (IC50)
vs α-
Tocotrienol
Content
R value 0.7105 0.3453 0.6534 0.1919
R2 0.5048 0.1192 0.4269 0.0368
P value 0.02381 0.001158 0.006591 0.001431
Slope 0.00001206 0.0002017 0.00001549 0.00001324
1/DPPH (IC50)
vs Tocopherol
(α-Tocopherol)
Content
R value 0.3380
R2 0.1143
P value 0.002796
Slope 0.00001045
Remarks: Number of observations in all experiments was 3 (n=3). Positive
correlation (R value) represents a positive fit while negative R value represents a
negative fit. P value less than 0.05 (P ≤ 0.05) represents statistically significant
between two test variables (paired T-test). The R2 value represents the coefficient of
determination for a fitted regression line.
![Page 110: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/110.jpg)
93
3.4.4.1.2 Trolox Equivalent Antioxidant Capacity (TEAC) Assay
Trolox equivalent antioxidant capacity (TEAC) assay was conducted
based on the DPPH free radical scavenging assay. Trolox (6-hydroxy-2, 5, 7, 8-
tetramethylchroman-2-carboxylic acid), a water soluble analogue of vitamin E
(Sagach et al. 2002) was used as the positive control in this assay. The results
were expressed in trolox equivalent (nmol).
Table 3-5 shows trolox equivalent antioxidant capacities (TEAC) of
different RBE for TEAC assay. High TEAC value of RBE is proportional to its
antioxidant capacity, indicating its efficacy in free radical scavenging.
Based on the obtained data, the TEAC values of different RBE were
significantly different from one another (P ≤ 0.05). The values were in the range
of 12.79nmol/100g to 61.49nmol/100g respectively. The RBE of Bajong LN
showed the highest TEAC value (61.49nmol/100g) among all the RBE while the
lowest TEAC value was determined in the RBE of Bario (12.79nmol/100g).
The DPPH free radical was used as the radical source for TEAC assay.
The neutralization of the radical occurs through electron or hydrogen transfer in
which it causes decolouration of DPPH solution from purple colour to yellow
colour. The antioxidant efficacy of test sample is proportional to the degree of
conversion of DPPH to corresponding hydrazine, DPPH2 which is yellow in
colour (Sharma & Bhat 2009).
In this study, significant discrepancies in TEAC values were observed
among different RBE. Factors such as plant genotypes, environmental factors
(Britz et al. 2007) and extraction method (Chen & Bergman 2005) of bioactive
compounds from samples were known to collectively affect the total content of
natural antioxidants and the total antioxidant activities of the extracts.
![Page 111: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/111.jpg)
94
Table 3-5: Trolox equivalent antioxidant capacity (TEAC) of different RBE. Values
expressed represent mean ± standard deviation of 3 concecutive
repetitions (n=3). Different letters within the same column denote
significant differences at P ≤ 0.05 (Tukey’s Test). Graphical
representation of the data was depicted in Figure 5-7 (Appendix
section)
Sample Trolox Equivalent Antioxidant Capacity
(TEAC) (nmol/100g)
Bajong LN 61.49 ± 1.13a
Bali 35.09 ± 0.46b
Pandan 34.56 ± 0.78b
Bajong 25.81 ± 1.14c
Wangi Mamut 22.97 ± 2.26cd
Bubuk 22.23 ± 0.67cd
Biris 15.02 ± 1.29e
MR219 15.72 ± 0.29ef
Bario 12.79 ± 0.25ef
Table 3-6 shows the regression and correlation analyses of TEAC value
with total phenolic, total flavonoid, total anthocyanin, total γ-oryzanol, total
vitamin E, δ-tocotrienol, γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE.
Based on the obtained results, strong positive (R ≥ 0.8) and significant (P ≤
0.05) correlations were observed in TEAC value against total phenolic content,
total flavonoid content, and total γ-oryzanol content respectively. Such
observations suggest the contributions of phenolic compounds, flavonoids, and
γ-oryzanol from RBE as potential sources natural antioxidants that involve in
DPPH free radical scavenging. All these potential sources of natural
antioxidants collectively contributed to the efficacy of total antioxidant activities
in RBE.
![Page 112: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/112.jpg)
95
Table 3-6: Regression and correlation analyses of trolox equivalent antioxidant
capacity (TEAC) of RBE with total phenolic, total flavonoid, total
anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol, γ-
tocotrienol, α-tocotrienol, and α-tocopherol. Correlation graphs were
depicted in Figure 5-8 (Appendix section)
TEAC vs Total
Phenolic
Content
TEAC vs Total
Flavonoid
Content
TEAC vs Total
Anthocyanin
Content
TEAC vs Total
γ-Oryzanol
Content
R value 0.9533 0.9789 -0.4910 0.9932
R2 0.9089 0.9582 0.2411 0.9865
P value 0.000004 0.000247 0.047 0.002
Slope 0.9780 3.0103 -1.7836 0.0075
TEAC vs
Total Vitamin
E Content
TEAC vs δ-
Tocotrienol
Content
TEAC vs γ-
Tocotrienol
Content
TEAC vs α-
Tocotrienol
Content
R value 0.6020 0.5275 0.3221 0.2926
R2 0.3624 0.2782 0.1037 0.0856
P value 0.000004 0.003 0.000030 0.39
Slope 0.0797 2.4055 0.0596 0.1575
TEAC vs
Tocopherol (α-
Tocopherol)
Content
R value 0.5177
R2 0.2680
P value 0.0011
Slope 0.1250
Remarks: Number of observations in all experiments was 3 (n=3). Positive
correlation (R value) represents a positive fit while negative R value represents a
negative fit. P value less than 0.05 (P ≤ 0.05) represents statistically significant
between two test variables (paired T-test). The R2 value represents the coefficient
of determination for a fitted regression line.
![Page 113: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/113.jpg)
96
Total γ-oryzanol content in RBE reported the highest correlation value
with TEAC value (R= 0.9932), followed by total flavonoid content (R= 0.9789),
and total phenolic content (R = 0.9533). Goufo and Trindade (2014) reported
the significant effects of phenolic and flavonoid compounds on DPPH free
radical scavenging. Rao et al. (2010) also reported the similar significant
contribution of phenolic compounds as the potential source of natural
antioxidants responsible for the total antioxidant activities in RBE.
All the reports were concurrent with the presently obtained data and
hence indicating the significant contribution of phenolic compounds to the
overall antioxidant activity of RBE. In addition, it was also reported that the
antioxidant efficacy of phenolic compounds outrun those of anthocyanins (Chen
et al. 2012; Min, McClung & Chen 2011) and α-tocopherol (Goffman & Bergman
2004).
As of different derivatives of vitamin E, poor correlations between TEAC
and vitamin E derivatives (tocotrienols and tocopherol) were reported, with R
values ranged from 0.2926 to 0.6020. The poor correlations were due to the
lipophilic nature of vitamin E derivatives (Cederberg, Siman & Eriksson 2001).
TEAC assay was conducted with aqueous alcohol (absolute ethanol) which is
favourable for hydrophilic antioxidants (Kedare & Singh 2011). DPPH was used
as the radical source for TEAC assay. In the absence of solubilizing agent,
factors such as solvent properties and nature of targeted compounds are known
to affect the reactions between antioxidants and the radical source (Yu 2008).
It has been reported that the antioxidant activity of γ-oryzanol in rice is
approximately 10 times stronger than those of vitamin E, particularly α-
tocopherol (Xu, Hua & Godber 2001). The statement is in agreement with the
presently obtained data. The TEAC value showed a stronger correlation value
to γ-oryzanol content (R = 0.9932) in RBE than that of α-tocopherol
(R = 0.5177). When compared to α-tocopherol and the remaining vitamin E
derivatives, the presently obtained data suggest the significant role of γ-
oryzanol as the potential source of natural antioxidant that contribute to the total
antioxidant activity of RBE. The abilities to quench radicals and prevent lipid
peroxidation (Juliano et al. 2005), to enhance endogenous cellular antioxidant
![Page 114: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/114.jpg)
97
enzymes in high fat-induced oxidative stress (Jin Son et al. 2010), and to
improve the radical scavenging activities of glutathione reductase (Jin Son et al.
2010) are among the antioxidant properties of γ-oryzanol reported from the
literature.
![Page 115: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/115.jpg)
98
3.4.4.2 In Vitro Cell Culture-Based System
3.4.4.2.1 Morphology and Growth of H9c2(2-1) Cardiomyocytes
Figure 3-6: Cell image of healthy H9c2(2-1) cardiomyocytes taken through an
inverted light microscope (Magnification: 200x)
Morphological characteristics of healthy H9c2(2-1) cardiomyocytes were
depicted in Figure 3-6. Under normal and healthy condition, H9c2(2-1)
cardiomyocytes have thin and elongated morphologies. In addition, the cells
appeared to be multinucleated (having multiple nuclei in a cell). The cells were
attached cells and grow in monolayer.
Figure 3-7 shows the growth curve of H9c2(2-1) cardiomyocytes over a
growth period of 8 days. Three different stages of growth curve were observed.
The cells were in the lag phase within the first 24 hours of incubation period. As
the cells were still adapting to the new environment in the first 24 hours, cell
division was minimal and thus there was no apparent increment in cell number
(Sigma-Aldrich 2010). At day 2 to day 5, a rapid increment in cell population
was observed; indicating the exponential phase of cell growth. At this growth
![Page 116: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/116.jpg)
99
stage, cells were at their optimal condition and divide at a rapid rate until the
maximum cell number is achieved (Sigma-Aldrich 2010). Beyond day 5, the
cells began to enter the stationary phase in which cell population begin to
confluent. Cell growth was compromised by the depletion of essential nutrient
and built up of toxic wastes. Based on the calculation, the doubling time of
H9c2(2-1) cardiomyocytes was between day 2 to day 3 (~2.73 days).
Figure 3-7: Growth curve of H9c2(2-1) cardiomyocytes over 8 days of incubation
period. Each alphabet represents different growth phases of the cells.
(a): Log phase; (b): Exponential phase; (c): Stationary phase; (d):
Doubling time (~2.73 days)
The growth curve of H9c2(2-1) cardiomyocytes was depicted in
Figure 3-8 shows the microscope (40x magnification) images of H9c2(2-1) cells
over a growth period of 8 days. There was no apparent growth in cell population
in the first 48 hours of incubation period indicating the lag phase of H9c2(2-1)
cell growth. After 48 hours (2 days) of growth period, H9c2(2-1) cells began to
proliferate actively. A significant growth in cell population was observed in
between Day 2 and Day 6. At Day 6, the cell population achieved ~90 %
confluence and achieved 100% confluence at Day 7 and Day 8.
6
60
0 1 2 3 4 5 6 7 8
Cell
Nu
mb
er
(x1
03 C
ell
s/c
m2)
Incubation Period (Day)
Growth Curve of H9c2(2-1)
(a)
(b) (c)
(d)
![Page 117: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/117.jpg)
100
Figure 3-8: Microscope (40x magnification) images of H9c2(2-1) cardiomyocytes at different time points (1st to 8th day).
Day 1
1
Day 2
1
Day 3
1
Day 4
1
Day 5
1
Day 6
1
Day 8
1
Day 7
1
![Page 118: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/118.jpg)
101
3.4.4.2.2 Cell Cytotoxicity Assay (RBE)
Figure 3-9: Cell images of (a) healthy H9c2(2-1) cardiomyocytes (negative
control) and (b) H9c2(2-1) cells induced with lethal dosage of
Bajong LN extract (500 µg/mL). Red oval inset in (b) showed
apoptotic H9c2(2-1) cells. *Magnification: 40x
(a)
(b)
![Page 119: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/119.jpg)
102
Based on the screening outcomes of total antioxidant activities from
different RBE, the highest antioxidant activity in free radical scavenging was
detected in Bajong LN rice bran extract. The Bajong LN extract was then
selected for in vitro cell culture-based system to further assess the antioxidant
capacity of the extract. RBE of commercial rice variety, MR219 was selected for
comparative study.
Figure 3-9 shows the cell images of normal cells of H9c2(2-1)
cardiomyocytes (negative control) and cells that were induced with lethal dose
(500µg/mL) of Bajong LN RBE. In this experiment, it was discovered that 1%
final concentration of ethanol in media did not induce cell death [data not
shown]. Therefore, all concentrations of RBE were adjusted to less than 1%
while negative control cells were treated with 1% final concentration of ethanol
in media. Based on the cell image in Figure 3-9(a), the negative control
H9c2(2-1) cardiomyocytes treated with 1% ethanol were healthy and appeared
to have multiple nuclei, thin and elongated morphologies.
Contrarily, cells treated with 500 µg/mL of Bajong LN RBE showed signs
of cell apoptosis, as shown in Figure 3-9(b). Disintegration of cell membrane
and nucleus were observed in the culture with cellular debris spread across the
surface area of the tissue culture flask. Such observation indicates dosage of
Bajong LN RBE at 500µg/mL is cytotoxic to H9c2(2-1) cells with cell viability
significantly dropped to only 18.58% (P < 0.01).
H9c2(2-1) cardiomyocytes were induced with different concentrations of
RBE to identify their respective safe dose range. Cell toxicities of selected RBE
were examined via 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-
(4-sulfophenyl)-2H-tetrazolium (MTS)-based assay kit. The assay measures the
metabolic rate of mitochondrial activities through conversion of MTS to
formazan by viable cells (Wang, Henning & Heber 2010). Figure 3-10 shows
the cell viability curves of H9c2(2-1) cells treated with different concentrations of
RBE over 24, 48 and 72 hours respectively. Data were presented in terms of
relative cell viability versus log of extract dosage. Based on the results, dose-
dependent cytotoxicity effects were observed in cells treated with RBE of
Bajong LN and MR219 respectively.
![Page 120: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/120.jpg)
103
Figure 3-10: Cell viability curves of H9c2(2-1) cardiomyocytes treated with
different concentrations (6.25µg/mL to 500µg/mL) of (A) Bajong LN
and (B) MR219 RBE over 24, 48 and 72 hours of incubation time
respectively. Best fit curves were drawn by using excel for visual
purposes.
0%
20%
40%
60%
80%
100%
120%
0 1 2 3
Ce
ll V
iab
ilit
y (
%)
Log [Bajong LN], µg/mL
Bajong LN
Bajong LN Day 1
Bajong LN Day 2
Bajong LN Day 3
0%
20%
40%
60%
80%
100%
120%
140%
0 1 2 3
Ce
ll V
iab
ilit
y (
%)
Log [MR219], µg/mL
MR219
MR219 (Day 1)
MR219 (Day 2)
MR219 (Day 3)
(A)
(B)
![Page 121: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/121.jpg)
104
The concentrations of extracts used for the induction were in the range of
6.25µg/mL to 500µg/mL (2-fold). For RBE of Bajong LN, extract concentrations
beyond 75µg/mL induced critical cell death with cell viabilities dropped below 32%
(Table 3-7). Cell viabilities dropped below 20% after 48 hours and 72 hours of
incubation time respectively. Contrarily, viabilities of H9c2(2-1) cells treated with
Bajong LN extract in the concentration ranges of 6.25µg/mL to 50µg/mL were
beyond 70% throughout the 24, 48 and 72 hours of incubation time. Therefore,
it gave an indication that the safe working concentration range of Bajong LN
extract were in the approximate range of 6.25µg/mL to 50µg/mL.
Table 3-7: Cell viability of H9c2(2-1) after inductions with different concentrations
of Bajong LN RBE for 24, 48 and 72 hours respectively. Data presented
were the mean ± standard deviation of three replicates (n=3). ‘*’ on
each column denotes significant differences at P ≤ 0.05 as compared
to negative control.
Bajong LN-Cell Viability (%)
Log
(Dose)
Dose
(µg/mL)
Day 1
(24 hours)
Day 2
(48 hours)
Day 3
(72 hours)
0.80 6.25 83.76 ± 5.18 84.47 ± 1.45* 91.96 ± 2.70*
1.10 12.5 70.33 ± 5.95* 92.55 ± 2.38* 98.93 ± 2.75
1.40 25 74.42 ± 5.79* 87.51 ± 5.77 102.32 ± 7.60
1.70 50 81.19 ± 5.86* 77.23 ± 3.02 95.71 ± 2.75
1.88 75 31.37 ± 4.83* 8.81 ± 0.00* 12.50 ± 1.12*
2.00 100 12.44 ± 0.74* 11.23 ± 0.48* 15.14 ± 1.29*
2.40 250 11.68 ± 1.61* 10.49 ± 0.66* 18.33 ± 1.09*
2.70 500 18.57 ± 0.61* 10.70 ± 0.94* 17.68 ± 0.00*
![Page 122: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/122.jpg)
105
Table 3-8 shows the inhibitory concentration (IC50) of Bajong LN RBE on
H9c2(2-1) cells. The IC50 value referred to the concentration of Bajong LN RBE
that will kill half (50%) of the original population of the cells. Based on the
obtained results, the IC50 values of Bajong LN RBE were in the range of
61.67µg/mL to 63.10µg/mL over 24, 48 and 72 hours of incubation time
respectively.
Table 3-8: Inhibitory concentration (IC50) of Bajong LN RBE over 24, 48 and 72
hours of incubation time. The IC50 values were determined from
respective cell viability curves via GraphPad Prism (GraphPad
Software, Inc. USA). Data represents mean ± standard deviation of 3
consecutive repetition (n=3). Graphical representations of data were
depicted in Figure 5-9 (Appendix section).
For RBE of MR219, extract concentrations beyond 250 g/mL induced
critical cell death with cell viabilities dropped below 13% (Table 3-9). Cell
viabilities further dropped below 12% with 500µg/mL after 24, 48 and 72 hours
of incubation time respectively. Contrarily, viabilities of H9c2(2-1) cells treated
with MR219 extract in the concentration ranges of 6.25µg/mL to 75µg/mL were
beyond 70% throughout the 24, 48 and 72 hours of incubation time. Therefore,
it gave an indication that the safe working concentration ranges of MR219
extract were in the range of 6.25µg/mL to 75µg/mL.
Bajong LN (IC50) – (µg/mL)
Dose (µg/mL) Log (Dose)
Day 1
(24 hours) 64.57 ± 0.91 1.81 ± 0.01
Day 2
(48 hours) 61.67 ± 0.32 1.79 ± 0.002
Day 3
(72 hours) 63.10 ± 4.99 1.80 ± 0.04
![Page 123: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/123.jpg)
106
Table 3-9: Cell viability of H9c2(2-1) after inductions with different concentrations
of MR219 RBE for 24, 48 and 72 hours respectively. Data presented
were the mean ± standard deviation of three replicates (n=3). ‘*’ on
each column denotes significant differences at P ≤ 0.05 as compared
to negative control.
MR219-Cell Viability (%)
Log
(Dose)
Dose
(µg/mL)
Day 1
(24 hours)
Day 2
(48 hours)
Day 3
(72 hours)
0.80 6.25 108.88 ± 4.76 93.34 ± 8.97 111.70 ± 5.63
1.10 12.5 97.78 ± 1.21 99.48 ± 5.67 119.73 ± 5.63*
1.40 25 102.22 ± 3.44 101.05 ± 1.44 118.93 ± 1.61*
1.70 50 118.93 ± 1.42* 107.03 ± 3.41 122.50 ± 3.65*
1.88 75 84.99 ± 3.68* 76.08 ± 1.27* 86.61 ± 2.64*
2.00 100 52.57 ± 3.21* 65.79 ± 2.38* 75.54 ± 3.21*
2.40 250 8.41 ± 0.61* 8.18 ± 0.55* 12.50 ± 1.12*
2.70 500 10.63 ± 1.13* 6.30 ± 1.09* 11.79 ± 1.86*
![Page 124: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/124.jpg)
107
Table 3-10 shows the inhibitory concentration (IC50) of MR219 RBE on
H9c2(2-1) cells. Based on the obtained results, the IC50 values of MR219 RBE
were in the range of 95.44µg/mL to 111.50µg/mL over 24, 48 and 72 hours of
incubation time respectively.
Table 3-10: Inhibitory concentration (IC50) of MR219 RBE over 24, 48 and 72
hours of incubation time. The IC50 values were determined from
respective cell viability curves via GraphPad Prism (GraphPad
Software, Inc. USA). Data represents mean ± standard deviation of 3
consecutive repetition (n=3). Graphical representations of data were
depicted in Figure 5-10 (Appendix section).
The present study showed the dose-dependent cytotoxic effects of
Bajong LN and MR219 extracts on H9c2(2-1) cardiomyocytes. In general, cell
viabilities dropped below 20% when high doses (>250µg/mL) of RBE were used
for induction. Contrarily, positive time-dependent induction effects were
observed in cells treated with safe dose range of extracts (Bajong LN: 6.25 to
50µg/mL; MR219: 6.25 to 75µg/mL).
Induction of cells with RBE within the range of safe dosage showed
improvements in cell viabilities with longer incubation period. Possible
deductions for such observation could be due to the potential cell proliferation
induction effects from the extracts or activation cellular protective response that
counteract the stress for adaptation and survival (Fulda et al. 2010). However,
further studies are needed to support the statement.
MR219 (IC50) – (µg/mL)
Dose (µg/mL) Log (Dose)
Day 1
(24 hours) 95.44 ± 1.02 1.98 ± 0.01
Day 2
(48 hours) 111.50 ± 1.07 2.05 ± 0.03
Day 3
(72 hours) 107.20 ± 1.05 2.03 ± 0.02
![Page 125: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/125.jpg)
108
The IC50 of Bajong LN and MR219 extracts on H9c2(2-1) cardiomyocytes
were calculated by using GraphPad Prism (GraphPad Software, Inc. USA).
The present data revealed that the range of IC50 values of Bajong LN and
MR219 RBE differed from one another. To recap, the IC50 values of Bajong LN
and MR219 were in the range of 61.67µg/mL to 63.10µg/mL and 95.44µg/mL to
111.50µg/mL respectively. The discrepancy in IC50 values between the two
RBE could be due to the difference in their respective total antioxidant contents.
According to the results obtained from previous study (Chapter 2), RBE of
Bajong LN has significantly higher contents of antioxidants (total phenolic, total
flavonoid, total γ-oryzanol, and total vitamin E contents) as compared to MR219
extract. Therefore, the extract of Bajong LN may require a lower concentration
to achieve similar antioxidant activities as of the MR219 extract.
Cytoprotective effects of natural antioxidants derived from plant food
have been highlighted in several in vitro cell studies. Cells treated with these
exogenous natural antioxidants were protected from oxidative stress mediated
cell death (Heo et al. 2008; Romier et al. 2008). However, it was discovered that
‘too much’ antioxidants did not further improve the overall antioxidant activity of
the exogenous natural antioxidants in cytoprotection. In this experiment, viability
of H9c2(2-1) cells dropped when high doses of extracts were used and hence
suggesting the dose-dependent cytotoxic effects of the extracts. There have
been several reports on cell cytotoxicity of polyphenols when high doses of the
antioxidants were used. Counter effects can arise from these natural
antioxidants at high doses, in which they act as prooxidants that threaten
survival and viability of cells (Azam et al. 2004; Decker 1997; Watjen et al.
2005). In addition, it was also reported that antioxidant activities of
endogeneous cellular antioxidant enzymes such as superoxide dismutase
(SOD), catalase (CAT), and gluthatione S-transferase can be affected when
cells were induced with high concentrations of exogenous antioxidants
(Robaszkiewicz, Balcerczyk & Bartosz 2007). This could be arising from the
production of radicals by polyphenols through autoxidation and redox cycling
processes (Gaspar et al. 1994; Hodnick et al. 1986; Metodiewa et al. 1999).
![Page 126: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/126.jpg)
109
3.4.4.2.3 Cell Cytoxicity Assay (Hydrogen Peroxide)
H9c2(2-1) cardiomyocytes were induced with different concentrations of
hydrogen peroxide (H2O2) to identify the suitable range of working
concentrations that do not induce cell death. Figure 3-11 shows the cell viability
curve of H9c2(2-1) cells treated with different concentrations of H2O2. Data were
presented in terms of relative cell viability versus log of extract dosage. Based
on the results, a dose-dependent cytotoxicity effect was observed in cells
treated with different concentrations of H2O2. The range of H2O2 concentration
between 15.63µM to 250µM did not decrease the viability of H9c2(2-1) cells.
Therefore, H2O2 in the range of these concentrations were considered as the
safe dose range of H2O2.
Figure 3-11: Cell viability curves of H9c2(2-1) cells treated with different
concentrations of hydrogen peroxide (H2O2). The insets showed the
inhibition concentration (IC50) of H2O2 on H9c2(2-1) cells
determined via GraphPad Prism (GraphPad Software, Inc. USA).
Best fit curve were drawn using excel for visual purpose.
2.76
0%
20%
40%
60%
80%
100%
120%
140%
0 1 2 3
Cell
via
bilit
y (
%)
Log [H2O2], µM
H2O2 Induction
IC50
![Page 127: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/127.jpg)
110
Table 3-11: Cell viability of H9c2(2-1) after inductions with different
concentrations of hydrogen peroxide (H2O2). Data presented were
the mean ± standard deviation of three replicates (n=3). ‘*’ on
each column denotes significant differences at P ≤ 0.05 as
compared to negative control.
Cell viabilities were more than 87% after treatment with H2O2 within the
aforementioned concentration range of H2O2. Contrarily, the cell viability
significantly decreased (Table 3-11) after cells were treated with H2O2 at
concentration beyond 250µM. Cell viability was less than 5% for H9c2(2-1) cells
that were treated with 500µM H2O2. In addition, the inhibitory concentration
(IC50) of H2O2 on H9c2(2-1) cells was detected at 572.10µM (refer to Table
3-12).
Under normal cellular metabolic activities, low concentrations of H2O2 are
produced as the by-product that is relatively harmless and rather beneficial to
most cells. Cells utilize the H2O2 for processes such as oxidative biosynthesis
and host defence. In addition, there are also evidences showing the potential of
H2O2 as signalling messenger in cellular signal transduction pathways (Stone &
Yang 2006). However, over accumulation of H2O2 in cells can be deleterious. It
will lead to the onset of oxidative stress and subsequently induce oxidative
stress mediated diseases over time (Nindl et al. 2004).
H2O2 Induction on H9c2(2-1) Cardiomyocytes
Log (Dose),
µM Dose (µM) Cell Viability (%)
1.19 15.63 119.47 ± 3.39*
1.49 31.25 115.27 ± 5.48*
1.80 62.50 109.29 ± 2.07*
2.10 125.00 101.29 ± 3.57
2.40 250.00 87.56 ± 2.49*
2.70 500.00 47.68 ± 3.34*
3.00 1000.00 3.43 ± 1.00*
![Page 128: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/128.jpg)
111
Table 3-12: IC50 of H2O2 on H9c2(2-1) cell. The IC50 value was determined from
respective cell viability curves (Figure 3-11) via GraphPad Prism
(GraphPad Software, Inc. USA). Data represents mean ± standard
deviation of 3 consecutive repetition (n=3).
Based on the results, H9c2(2-1) cells induced with low concentrations of
H2O2 (15.63µM and 31.25µM) showed proliferative effect. The cell viabilities
were more than 100% in relation to the negative control. Such observation
suggests the potential of low concentration of H2O2 in stimulating cell growth of
H9c2(2-1). Low concentration of H2O2 has been reported capable of stimulating
cell proliferation (Burdon & Rice-Evans 1989). In addition, the present data were
in agreement with the general response trend of proliferating mammalian cells
to H2O2 (Babich et al. 1996; Davies 1999; Wiese, Pacifici & Davies 1995). It was
reported that low concentration of H2O2 in range of 3 to 15µM has the potential
of inducing growth stimulation while the higher concentration range, 120 to
150µM can cause growth arrest temporarily. Growth arrest may occur
permanently when cells were induced with H2O2 in the concentration range
between 250µM and 400µM while concentration of H2O2 beyond 1000µM will
induce cell necrosis (Babich et al. 1996; Davies 1999; Wiese, Pacifici & Davies
1995). Therefore, variation in cellular responses towards different
concentrations of H2O2 could be the potential deduction for dose-dependent
cytotoxicity effect of H2O2 on H9c2(2-1) cells. However, further studies are
needed to support the statement.
IC50 of H2O2 on H9c2(2-1) cell
Dose ( µM ) Log (Dose), µM
Hydrogen Peroxide (IC50) – (µM) 572.10 ± 1.23 2.76 ± 0.09
![Page 129: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/129.jpg)
112
3.4.4.2.4 Cell Viability Assay (Rice Bran Extract + Hydrogen Peroxide)
There have been several reports of H2O2-mediated cell cytotoxicity and
apoptosis in H9c2(2-1) cells after gaining exposure to H2O2 (Cheng et al. 2009;
Sheng et al. 2010; Zhang et al. 2011). In this study, the potential of RBE to
alleviate oxidative stress in H9c2(2-1) cells mediated by H2O2 was investigated.
H9c2(2-1) cells were pre-treated with different concentrations of each Bajong
LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL) extracts
respectively before they were induced with various concentrations of H2O2.
Negative control cells were pre-treated with media + 1% EtOH before induction
with different concentrations of H2O2. The effects of H2O2-inductions on the cell
viability of H9c2(2-1) cardiomyocytes pre-treated with different RBE were shown
in Table 3-13 and Figure 3-12 (cell viability curves) respectively.
Based on the results, H2O2-induction of H9c2(2-1) cells pre-treated with
different concentrations of RBE revealed their respective dose-dependent
cytoprotective effects. Such observations suggest the potential protective
effects of RBE against H2O2-induced cell cytotoxicity. In general, cells pre-
treated with lower concentrations of RBE (Bajong LN: 25µg/mL; MR219:
50µg/mL) revealed their potential cytoprotective role in alleviating H2O2-induced
cell cytotoxicity. These were observed through right shifts in cell viability curve
of H9c2(2-1) cells pre-treated with the low concentration of both extracts
(Appendix: Figure 5-11).
IC50 values of H2O2 (inhibitory concentration of H2O2 that decreases cell
viability to 50%) have also increased significantly (P ≤ 0.05) for cells that were
pre-treated with the low concentration of extracts (as compared to negative
control cells). As presented in Table 3-14, IC50 values of H2O2 for H9c2(2-1)
cells pre-treated with Bajong LN (25µg/mL) and MR219 (50µg/mL) before H2O2
induction were 645.65µM and 320.63µM respectively as compared to that of
negative control, 316.23µM.
![Page 130: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/130.jpg)
113
Table 3-13: Cell viability of H9c2(2-1) after inductions with different
concentrations of H2O2. Cells were pre-treated with different
concentrations of Bajong LN and MR219 RBE before H2O2-
induction. Data represent mean ± standard deviation of three
replicates (n=3). ‘*’ on each column denotes significant
differences at P ≤ 0.05 as compared to negative control (non-
treated cells).
Cell viability (%)
Log [H2O2],
µM
H2O2
(µM)
Negative
Control
(media + 1%
EtOH)
Bajong LN
(25µg/mL)
Bajong LN
(50µg/mL)
1.80 62.5 92.61± 7.62 116.67 ± 4.83* 62.80 ± 5.55*
2.10 125 65.31 ± 3.75* 99.09 ± 6.12 36.95 ± 2.09*
2.40 250 55.70 ± 1.27* 83.05 ± 1.61* 25.04 ± 3.22*
2.70 500 41.65 ± 2.20* 67.87 ± 1.77* 19.62 ± 2.90*
3.00 1000 3.67 ± 2.52* 9.55 ± 2.48* 2.18 ± 0.32*
Log [H2O2],
µM
H2O2
(µM)
Negative
Control
(media + 1%
EtOH)
MR219
(50µg/mL)
MR219
(100µg/mL)
1.80 62.5 92.61± 7.62 117.30 ± 8.43 76.93 ± 8.30*
2.10 125 65.31 ± 3.75* 105.91 ± 6.24 67.93 ± 2.96*
2.40 250 55.70 ± 1.27* 63.50 ± 0.97* 16.86 ± 2.88*
2.70 500 41.65 ± 2.20* 35.15 ± 3.62* 6.56 ± 4.99*
3.00 1000 3.67 ± 2.52* 4.15 ± 0.32* -12.66 ± 4.56*
![Page 131: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/131.jpg)
114
Figure 3-12: Effects of H2O2 inductions on cell viabilities of H9c2(2-1)
cardiomyocytes pre-treated with different concentrations of Bajong
LN RBE (25µg/mL and 50µg/mL) and MR219 RBE (50µg/mL and
100µg/mL)
![Page 132: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/132.jpg)
115
Table 3-14: Average IC50 of H2O2 for H9c2(2-1) cells. The IC50 value was
determined from respective cell viability curves (Figure 5-11) via
GraphPad Prism (GraphPad Software, Inc. USA). Data represent
mean ± standard deviation of 3 (n=3). ‘*’ denotes significantly
different from negative control treated with media + 1% EtOH at P
≤ 0.05. Graphical representations of data were depicted in Figure
5-11 (Appendix section)
The efficiencies of potential cytoprotective effects of Bajong LN
(25µg/mL) and MR219 (50µg/mL) also differed from one another. Pre-
incubation of H9c2(2-1) cells with Bajong LN (25µg/mL) extract increased the
IC50 of H2O2 by approximately two fold. Contrarily, the efficiency of MR219
(50µg/mL) extract was not on par with that of Bajong LN (25µg/mL) extract, only
a slight increment in IC50 of H2O2 was detected in cells pre-treated with MR219
(50µg/mL) extract (approximately 1.4%). The differences in efficiency of
cytoprotective effects of both extracts could be attributed to the difference in
their respective total antioxidant contents.
The high concentrations of Bajong LN (50µg/mL) and MR219
(100µg/mL) extracts tested in the present study did not result in cytoprotection
of cells towards H2O2-induced cell cytotoxicity. Left shifts in cell viability curves
were observed in H9c2(2-1) cells pre-incubated with higher concentrations of
Bajong LN (50µg/mL) and MR219 (100µg/mL) extracts respectively. These
were followed by a decrease in IC50 values of H2O2 along with the high
Average IC50 of H2O2 – (µM)
H2O2 (µM) Log [H2O2], µM
Negative Control
(media + 1% EtOH) 316.23 ± 1.02 2.50 ± 0.01
RBE H2O2 (µM) Log [H2O2], µM
Bajong LN (25 µg/mL) 645.65 ± 1.10* 2.81 ± 0.04*
Bajong LN (50 µg/mL) 92.90 ± 1.17* 1.97 ± 0.07*
MR219 (50 µg/mL) 320.63 ± 1.14* 2.55 ± 0.06*
MR219 (100 µg/mL) 171.79 ± 1.13* 2.24 ± 0.05*
![Page 133: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/133.jpg)
116
concentrations RBE used. The IC50 values of H2O2 for H9c2(2-1) cells pre-
treated with Bajong LN (50µg/mL) and MR219 (100µg/mL) extracts were
92.90µM and 171.79µM respectively as opposed to that of low concentration of
Bajong LN (25µg/mL) and MR219 (50µg/mL) extracts (645.65µM and 320.63µM
respectively).
High concentrations of Bajong LN and MR219 extracts selected for this
study were near the range of IC50 for both extracts (IC50 of Bajong LN:
52.18µg/mL to 73.09µg/mL; IC50 of MR219: 95.44µg/mL to 111.50µg/mL). It
was deduced that H9c2(2-1) cells could have experienced cytotoxic stress from
high concentrations of crude rice brans and H2O2 respectively. As overdoses of
natural antioxidants have been reported to exhibit prooxidant-like characteristics
that potentially threaten cell survival and viability (Azam et al. 2004; Decker
1997; Watjen et al. 2005), additional cytotoxic stress derived from H2O2 could
have further decrease the viability of H9c2(2-1) after treatment with extract and
and H2O2 respectively.
Pre-treatment of cells with Bajong LN (25µg/mL and 50µg/mL) and
MR219 (50µg/mL and 100µg/mL) extracts did not result in protection of cells
against H2O2-induced cell cytotoxicity at 1000µM of H2O2 (Table 3-13). Viability
of H9c2(2-1) cells significantly decreased to less than 10%. This could be due
to over accumulation of H2O2 in cells which threaten the cell viability. Besides,
induction of cells with high concentration may have induced cell necrosis and
apoptosis (Babich et al. 1996; Davies 1999; Wiese, Pacifici & Davies 1995).
Various chronic diseases such as cardiovascular diseases, cancer and
diabetics are closely associated with oxidative stress. Factors such as
molecular targets, mechanism and severity of oxidative stress define the
consequence of oxidative stress injury on cells. This may further initiates signal
transduction cascade reactions that lead to the onset and progression of
chronic diseases (Aruoma 1998; Magalhaes et al. 2009). The present
preliminary results have revealed the potential of RBE as a source of natural
antioxidants to alleviate oxidative stress mediated cytotoxicity. Coupled with
further carefully planned investigations, RBE could be considered for further
![Page 134: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/134.jpg)
117
application as nutraceuticals for protection against chronic diseases mediated
by oxidative stress, such as cardiovascular diseases.
![Page 135: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/135.jpg)
118
3.4.4.2.5 Effects of Different Treatments on Activities and Gene Expression
of Endogenous Cellular Antioxidant Enzymes in H9c2(2-1) Cells
Cells develop a series of endogenous cellular antioxidant enzymes as
the first line defensive mechanism for regulation and maintenance of cellular
redox homeostasis (Krishnamurthy & Wadhwani 2012). Superoxide dismutase
(SOD), catalase (CAT) and glutathione peroxidase (GPx) are among the first
line endogenous antioxidant protective mechanisms of cells. These protective
mechanisms work synergistically with exogenous antioxidants to maintain the
balance between oxidants and antioxidants within the physiological systems
(Pham-Huy, He & Pham-Huy 2008).
Oxidative stress has been implicated as one of the multifactorial
etiologies of cardiovascular disease (CVD) (Ceriello 2008; Chatterjee et al.
2007; Droge 2002). Hence, strategies of using antioxidant to attenuate CVD via
inhibition of inadvertent cellular oxidative damage or signalling pathway may
have important implications to both prevention and treatment of CVD (Lönn,
Dennis & Stocker 2012)
Previous studies (Chapter 2) on the antioxidant activities of RBE of
Sarawak local rice varieties have shown their potential antioxidant activities as
free radical scavengers in several in vitro chemical-based antioxidant assays.
Therefore, this part of the study was conducted at preliminary stage to assess
the potential cytoprotective and antioxidant protective effects of these RBE by
using an in vitro cardiomyocyte cell culture model.
The focus of this part of study was centred on the potential induction
effects of RBE on the regulations of endogenous cellular antioxidant enzymes
(SOD, CAT and GPx). The cells were pre-treated with different concentrations
of RBE and hydrogen peroxide (H2O2) respectively. The effects of different
treatments were assessed by studying the respective activities and gene
expression of targeted endogenous cellular antioxidant enzymes in induced
H9c2(2-1) cardiomyocytes.
![Page 136: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/136.jpg)
119
(A) Superoxide Dismutase (SOD)
SOD involves in the neutralization of superoxide anions (O2•-) into
hydrogen peroxide (H2O2) and oxygen (O2). It mainly exist in three different
forms: Cu/Zn-SOD, Mn-SOD and EC-SOD respectively (Meier et al. 1998).
Each of them is distributed in different parts of the cells, Mn-SOD present
mostly in mitochrondria while Cu/Zn-SOD occupies areas within the nucleus,
cell cytoplasm, and blood plasma (Krishnamurthy & Wadhwani 2012). As for
EC-SOD, it is the secreted form of Cu/Zn-SOD distributed in the extracellular
space. Enzymatic activities of SOD were examined by using the commercially
available detection assay kit (Cayman Chemicals). The assay kit measures the
total enzymatic activities of Cu/Zn-SOD, Mn-SOD and Fe-SOD (Cayman
Chemical 2014). The isoenzyme of SOD, SOD2 was the targeted gene for gene
expression study in this part of the project. SOD2 is responsible for encoding
Mn-SOD. They are mostly distributed in cellular mitochondria and protect the
organelles from oxidative damage (Kang & Kang 2013; Kokoszka et al. 2001).
This part of the study aimed to investigate the respective induction effects of
RBE and H2O2 on the enzymatic activities and gene expression of SOD in
H9c2(2-1) cardiomyocytes.
(i) Effects of RBE on total SOD enzymatic activity and gene expression
of SOD2 in H9c2(2-1) Cells
The effects of pre-treating H9c2(2-1) cells with different concentrations of
RBE on their respective enzymatic activities and gene expression levels of SOD
were depicted in Figure 3-13. Based on the results, pre-treatment of H9c2(2-1)
cells with RBE after 24 hours significantly increased the total activities of SOD
[Figure 3-13(A)]. The highest SOD activity was detected in H9c2(2-1) cells pre-
treated with 50µg/mL of Bajong LN extract. The total SOD activity was
increased by 2 folds as compared to negative control while cellular induction
with 25µg/mL of Bajong LN, 50µg/mL and 100µg/mL of MR219 extracts
elevated the total SOD activity by approximately 1.4 times in relation to negative
control.
![Page 137: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/137.jpg)
120
Figure 3-13: (A) Total SOD enzymatic activities and (B) gene expression levels of
SOD2 in H9c2(2-1) cells pre-treated with RBE. Data represent mean
± standard deviation of three repetitions (n=3). ‘*’: significantly
different from negative control at P ≤0.05 and ‘**’: significantly
different from negative control at P ≤0.01.
![Page 138: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/138.jpg)
121
The induction effects of different concentrations of RBE on the
expression of SOD2 were depicted in Figure 3-13(B). After 24 hours of
incubation with RBE, expression of SOD2 was significantly down regulated by
RBE of Bajong LN (50µg/mL) and MR219 (50µg/mL and 100µg/mL)
respectively. No significant difference in expression of SOD2 was observed
between negative control and 25µg/mL of Bajong LN treated sample. Contrarily
to the lower concentration Bajong LN extract, 50µg/mL of Bajong LN induced a
weak down-regulation in expression of SOD2 by approximately 10% in relation
to negative control. Distinctive down-regulations of SOD2 were observed with
50µg/mL and 100µg/mL of MR219 extracts. Both extracts have down-regulated
the expression of SOD2 by approximately 45%.
(ii) Effects of H2O2 on total SOD enzymatic activity and gene expression
of SOD2 in H9c2(2-1) Cells
In this part of the study, H2O2 was used to induce oxidative injuries to
H9c2(2-1) cardiomocytes. H9c2 cells were treated with three different
concentrations of H2O2 and incubated for 24 hours. The effects of H2O2
inductions on total enzymatic activity of SOD and expression levels of SOD2 in
H9c2(2-1) cells were depicted in Figure 3-14. Based on the results, cellular
induction with different concentrations of H2O2 showed dose-dependent effects
on the enzymatic activities and expression of SOD.
Briefly, incubation of H9c2(2-1) cells with 125µM, 250µM and 500µM
H2O2 have elevated the total SOD activities of H9c2(2-1) cells [Figure 3-14(A)].
Total SOD activities were significantly elevated with increasing dose of H2O2
from 125µM to 250µM. Cellular inductions with 125µM and 250µM of H2O2 were
found to increase total SOD activity by ~19% and ~43% in relation to negative
control respectively. Contrarily, cellular induction with 500µM of H2O2 resulted in
approximately 33% decrement in total SOD activity as compared to that with
250µM of H2O2.
![Page 139: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/139.jpg)
122
Figure 3-14: (A) Total SOD enzymatic activities and (B) gene expression levels of
SOD2 in H9c2(2-1) cells after induction with different concentrations
of H2O2. Data represent mean ± standard deviation of three
repetitions (n=3). ‘*’: significantly different from negative control at
P≤0.05 and ‘**’: significantly different from negative control at
P≤0.01.
![Page 140: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/140.jpg)
123
The effects of H2O2 induction on the expression levels of SOD2 were
depicted in Figure 3-14(B). A significant up-regulation of SOD2 expression was
observed with 250µM of H2O2; the expression level of SOD2 was up-regulated
by 2 folds (relative to negative control) with 250µM of H2O2. Contrarily, the
expression level of SOD2 was significantly down-regulated by 32% (relative to
negative control) with 500µM of H2O2. There was no significant difference in
expression level of SOD2 between negative control and 125µM of H2O2.
(iii) Effects of H2O2 on total SOD enzymatic activity and gene expression
of SOD2 in H9c2(2-1) cells pre-treated with RBE
In this part of the study, H9c2(2-1) cells were pre-treated with different
concentration of RBE before they were subjected to oxidative injuries with H2O2.
Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL)
extracts were among the different concentrations of RBE selected for the study.
After 24 hours of incubation with RBE, the cells were induced with 125µM H2O2.
The concentration of H2O2 was selected based on the lowest the concentration
that would substantially decrease cell viability to approximately 50% (Figure
3-12 and Table 3-13). The effects of the treatment on total SOD enzymatic
activities and gene expression of SOD2 in H9c2(2-1) cells were depicted in
Figure 3-15.
Post H2O2 induction (with 125µM of H2O2) effects of H9c2(2-1)
cardiomyocytes pre-treated with different concentrations of RBE generally have
resulted in a slight decrease in total SOD activities in relation to negative control
[Figure 3-15(A)]. Only significant increase (approximately 36% in relation to
negative control) in total SOD activities was detected in cells pre-treated with
25µg/mL of Bajong LN extract. Total SOD activities significantly decreased by
~23.3% and ~13.6% in cells pre-treated with 50µg/mL of Bajong LN and
50µg/mL of MR219 extracts respectively. In addition, there was no significant
difference in total SOD activity between negative control and 100µg/mL of
MR219 treated cells.
![Page 141: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/141.jpg)
124
Figure 3-15: (A) Total SOD enzymatic activities and (B) gene expression levels of
SOD2 in RBE pre-treated H9c2(2-1) cells after induction with 125µM of
H2O2. Data represent mean ± standard deviation of three repetitions
(n=3). ‘*’: significantly different from negative control (P ≤0.05); ‘**’:
significantly different from negative control (P ≤0.01)
![Page 142: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/142.jpg)
125
Down-regulations in expression levels of SOD2 were generally observed
across H9c2(2-1) cells pre-treated with different concentrations of RBE except
for H9c2(2-1) cells pre-treated with 100µg/mL of MR219 extract
[Figure 3-15(B)]. There was no significant difference in SOD2 expression
between negative control and H9c2(2-1) cardiomyocytes pre-treated with
100µg/mL of MR219 extract. Pre-treatment of H9c2(2-1) cells with RBE of
Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL) extract induced
down-regulation in expression of SOD2 by ~38%, ~22%, and ~48% in relation
to negative control respectively [Figure 3-15(B)]. In addition, dose-dependent
interactions of RBE with the expression level of SOD2 were also observed.
Cellular induction with low concentrations (25µg/mL of Bajong LN and 50µg/mL
of MR219) of both RBE has significantly down-regulated the expression of
SOD2 by ~38% to ~48% respectively. However, a weaker down-regulation in
expression of SOD2 was reported with higher concentration of RBE (50µg/mL
of Bajong LN and 100µg/mL of MR219 extracts) as compared to the lower
concentration RBE (25µg/mL of Bajong LN and 50µg/mL of MR219 extracts).
Based on the current findings, induction of H9c2(2-1) cardiomyocytes
with different concentrations of RBE and H2O2 has revealed their respective and
distinctive effects in regulating the total SOD enzymatic activities and gene
expression of SOD2. Inductions of H9c2(2-1) cells with different concentrations
of RBE have significantly increased the total SOD enzymatic activity. Several in
vivo and in vitro studies targeting on the antioxidative effects of RBE have also
reported similar increment in enzyme activity of SOD after induction with RBE
(Ling et al. 2001; Surarit et al. 2015; Wang et al. 2014). This reveals the
potential of RBE in enhancing the enzymatic activity of SOD.
The positive induction effects of RBE on the total SOD activity of
H9c2(2-1) cells could be attributed to its polyphenol contents. Several reports
have described the potential of polyphenols exhibiting prooxidant effects.
Oxidation polyphenols is able to generate significant amount of potentially
cytotoxic prooxidants such as O2•-, H2O2, semiquinones and quinones (Awad et
al. 2001; Lambert & Elias 2010). It was proposed that these prooxidants may
have mildly triggered oxidative stress and subsequently induced the cellular
![Page 143: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/143.jpg)
126
antioxidant defences which ultimately lead to cellular cytoprotection (Fahey &
Kensler 2007; Halliwell 2009)
The present data revealed that the expression of SOD2 gene was
significantly down-regulated after induction of RBE. The effects were relatively
more distinctive with higher concentrations of RBE. The exact mechanisms
involved in the down-regulation of SOD2 gene remains unknown and require
further investigation.
Inductions of H9c2(2-1) cardiomyocytes with different concentrations of
H2O2 have shown dose-dependent interactions with both total SOD enzymatic
activity and the gene expression of SOD2. The present data revealed that
cellular induction with 250µM of H2O2 significantly elevated the total SOD
activity and expression level of SOD2. It was proposed that such observation
could be attributed to the the accumulation of O2•- which subsequently initiate
the protective mechanism of SOD in detoxification of O2•-. Such mechanism is
crucial for maintaining cellular redox homeostasis (Pham-Huy, He & Pham-Huy
2008). However, the underlying mechanism that leads to the accumulation of
O2•- remains unknown. It was deduced that the source of O2
•- could potentially
be deriving from normal cellular metabolic activities.
During normal cell proliferation cycles, mitochondrial oxidative
phosphorylation, the ATP energy production pathway of mitochondrial produces
ROS such as superoxide (O2•-) and hydroxyl (OH•-) radicals and H2O2 (Hoffman
& Brookes 2009; Lee et al. 2011). Positive correlation between mitochondrial
ROS and Mn-SOD has been reported in proliferating cells (Chung et al. 2009;
Lee et al. 2011). In order to maintain the intercellular mitochondrial redox
homeostasis, Mn-SOD localized in mitochondrial matrix are up-regulated to aid
in the detoxification of O2•- to O2 and H2O2 (Zelko, Mariani & Folz 2002). Similar
observation was reported in the present study. The expression of SOD2 was
significantly up-regulated by 2.4 folds in relation to negative control. Such
observation may suggest the activation of Mn-SOD to counteract potential
oxidative injury mediated by exogenous H2O2.
In contrast to the induction effect with 250µM of H2O2, cellular induction
with 500µM of H2O2 weakly up-regulated the total SOD activity in H9c2(2-1)
![Page 144: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/144.jpg)
127
cells by approximately 8.6% while the expression of SOD2 was significantly
down-regulated. As the expression of SOD2 directly correlate to the levels of
Mn-SOD (Drane et al. 2001), the present observation on down-regulation of
SOD2 expression with 500µM of H2O2 could suggest the decrease in Mn-SOD
level. In the condition of absence or little existence of Mn-SOD, both cytosolic
Cu/Zn-SOD and EC-SOD could have involved in the detoxification of
superoxide ions in the cells (Papa et al. 2014). Previous study on viability of
H9c2(2-1) cells with different concentrations of H2O2 (Figure 3-11) have
revealed a significant drop in cell viability to approximately 48% after 24 hours
of treatment with 500µM H2O2.
It was presumed that 500µM H2O2 could have induced substantial
oxidative injuries to H9c2(2-1) cardiomyocytes and consequently led to
mitochondrial dysfunction. Both Mn-SOD and Cu/Zn-SOD are involving in the
detoxification of O2•- that leads to intracellular accumulation of H2O2 and O2
(Meier et al. 1998). It was discovered that SOD (Mn-SOD and Cu/Zn-SOD) and
high concentration of H2O2 synergistically induced the degradation of nitric
oxide (NO) and concomitantly increased the formation of ONOO- (McBride,
Borutaite & Brown 1999). Intracellular accumulation of these ONOO- has been
associated with pathologies of various oxidative stress-related chronic diseases.
These radicals are capable of inducing mitochondrial cytotoxicity by inhibition of
mitochondrial electron transport chain (McBride, Borutaite & Brown 1999; Radi
et al. 1994). This consequently leads to ATP depletion which threatens cell
survival and normal functions of mitochondria (Lieberthal, Menza & Levine
1998).
Based on the present result, the H2O2-induction of RBE pre-treated
H9c2(2-1) cells generally did not result in any significant improvement over the
total SOD enzymatic activity and expression levels of SOD2. Interestingly, only
H9c2(2-1) cells that was pre-treated with 25µg/mL of Bajong LN RBE resulted
in significant improvement of total SOD activity by 33% (relative to negative
control) after being induced with 125µM of H2O2 for 24 hours (Figure 3-15).
Contrarily, tthe total SOD activity of H9c2(2-1) cells pre-treated with 25µg/mL of
Bajong LN RBE only (Figure 3-13) reported a significant increment of total SOD
![Page 145: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/145.jpg)
128
activity by 44% in relation to negative control. This translates into a difference of
11% in the total SOD activity of H9c2(2-1) cells pre-treated with 25µg/mL of
Bajong LN RBE, before and after H2O2-induction . The mechanisms involved in
relation to the present observations await further investigation. It was
speculated that the decrease in total SOD activity of RBE (25µg/mL of Bajong
LN) pre-treated H9c2(2-1) after being induced with 125µM of H2O2 could be
linked to the oxidation of SOD enzyme mediated by H2O2 (Jewett et al. 1999).
Polyphenols are capable of exerting characteristics of prooxidants.
Through oxidation process, the oxidized polyphenols can generate prooxidants
such as O2•-, H2O2, semiquinones and quinones (Awad et al. 2001; Lambert &
Elias 2010). Accumulation of these endogenous H2O2 along with those
introduced exogenously could have initiated the inactivation of SOD enzyme.
Jewett et al. (1999) has highlighted the potential of H2O2 in mediating oxidation
of Cu/Zn-SOD. The loss of copper ion, fragmentation of active-site peptides and
the production of 2-oxo-histidine were among the characteristics of oxidized
Cu/Zn-SOD which consequently leads to the enzyme inactivation (Jewett et al.
1999).
![Page 146: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/146.jpg)
129
(B) Catalase (CAT)
CAT enzyme involves in the catalytic conversion of H2O2 to H2O and O2
in a two-steps reaction (Kang & Kang 2013). It actively involves in detoxification
of H2O2 produced from the enzymatic reaction of SOD and cellular metabolic
activities (Pham-Huy, He & Pham-Huy 2008). The enzyme maintains
intracellular ROS homeostasis by neutralizing the toxic effects of H2O2
produced from cellular metabolic activities. The enzyme primarily localized in
peroxisomes of the cells and actively neutralize H2O2 that diffuses into the
peroxisomes (Slater 1984). It is also a highly conserved protein and is encoded
by a single gene (Kang & Kang 2013; Nishikawa et al. 2002).
(i) Effects of RBE on total enzymatic activity and gene expression of
CAT in H9c2(2-1) cells
The effects of inducing H9c2(2-1) cells with different concentrations of
RBE on their respective enzymatic activity and gene expression of CAT were
depicted in Figure 3-16. Based on the results, cellular induction with Bajong LN
(50µg/mL) and MR219 (50µg/mL and 100µg/mL) RBE have elevated cellular
CAT activity respectively while no significant improvement in CAT activity was
observed with 25µg/mL of Bajong LN [Figure 3-16(A)].
Among the two different concentrations of extracts selected in this study,
higher concentrations of extracts were found to induce higher cellular CAT
activities as compared to the lower extract concentrations. Briefly, cellular CAT
activity had increased by ~39% and ~103% in relation to negative control with
50µg/mL of Bajong LN extract and 100µg/mL of MR219 extract respectively. As
for the 50µg/mL of MR219 extract, it weakly elevated the cellular CAT activity
by ~16%. In additional, significantly higher CAT activities were also observed in
MR219 extracts when compared to Bajong LN extracts.
![Page 147: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/147.jpg)
130
Figure 3-16: (A) Total enzymatic activities and (B) gene expression levels of CAT
after treated with RBE. Data represent mean ± standard deviation of
three repetitions (n=3). ‘*’: significantly different from negative
control at P ≤0.05 and ‘**’: significantly different from negative
control at P ≤0.01.
![Page 148: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/148.jpg)
131
Figure 3-16(B) showed the effects of cellular induction with different
concentrations of RBE on the expression levels of cellular CAT. Based on the
result, the expression levels of CAT were significantly up-regulated with all the
concentrations of extracts tested. The increments were in the range of ~18% to
~40%. In addition, it was discovered that Bajong LN extracts expressed higher
levels of CAT (relative to negative control) as compared to MR219 extracts.
There was no significant difference in expression of CAT between the two
different concentrations of each extract selected for this part of the study.
(ii) Effects of Hydrogen peroxide (H2O2) on total enzymatic activity and
gene expression of CAT in H9c2(2-1) cells
Effects of H2O2 inductions on the enzymatic activity and expression
levels of CAT in H9c2(2-1) cells were depicted in Figure 3-17. H9c2(2-1) cells
were incubated with three different concentrations of H2O2 for 24 hours. The
present results revealed that cellular induction with 250µM of H2O2 significantly
increased the CAT activity by ~20%. Contrarily to the induction effect with
250µM of H2O2, no significant difference in CAT activity was reported with
125µM and 500µM of H2O2 respectively [Figure 3-17(A)]. Induction of H9c2(2-1)
cardiomyocytes with different concentrations of H2O2 significantly elevated the
expression levels of CAT [Figure 3-17(B)]. The up-regulation of CAT
expression was in the range of ~80% to ~380% in comparison to negative
control. Among the three different concentrations of H2O2 studied (125µM,
250µM and 500µM), the highest up-regulation in expression level of CAT was
with 250µM H2O2 (4.8 folds over negative control) then followed 125µM H2O2
(3.2 folds over negative control), and with 500µM H2O2 (1.8 folds over negative
control).
![Page 149: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/149.jpg)
132
Figure 3-17: (A) Total enzymatic activities and (B) gene expression levels of CAT
after induction with different concentrations of H2O2. Data represent
mean ± standard deviation of three repetitions (n=3). ‘*’:
significantly different from negative control at P ≤0.05 and ‘**’:
significantly different from negative control at P ≤0.01.
![Page 150: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/150.jpg)
133
(iii) Effects of H2O2 on total enzymatic activity and gene expression of
CAT in H9c2(2-1) cells pre-treated with RBE
H9c2(2-1) cells were pre-treated with different concentration of RBE:
Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL) for
24 hours before they were induced with oxidative injuries with 125µM of H2O2.
Figure 3-18 showed the effects of the treatment on enzymatic activities and
gene expression of CAT. Briefly, CAT activities of cells pre-treated with RBE
were significantly increased after being induced with 125µM of H2O2
[Figure 3-18(A)]. The changes in increment of CAT activities were in the range
of 3 to 8 folds as compared to negative control. Sample group pre-treated with
100µg/mL of MR219 extract reported the highest fold change (~8 folds) in CAT
activity when compared to control group, then followed by 50µg/mL of MR219
extract (~5 folds); 25µg/mL of Bajong LN extract (~4.5 folds) and 50µg/mL of
Bajong LN extract (~3.3 folds).
Figure 3-18(B) depicted the gene expression of CAT after pre-treatment
with different concentrations of RBE and followed by induction with 125µM of
H2O2. Based on the results, both 25µg/mL Bajong LN extract and MR219
(50µg/mL) extract significantly up-regulated the expression levels of CAT by 13%
and 33% respectively in relation to negative control. A slight down-regulation in
expression of CAT (~7%) was observed with cells pre-treated with 25µg/mL of
Bajong LN extract. No significant difference in expression of CAT was reported
between negative control and 100µg/mL of MR219 treated cells.
Based on the current research findings, induction of H9c2(2-1)
cardiomyocytes with different concentrations of RBE and H2O2 has revealed
their respective and distinctive effects in regulating the total enzymatic activities
and gene expression levels of CAT. Briefly, CAT activities of H9c2(2-1) cells
pre-treated with different concentrations of RBE were significantly improved in
relation to negative control. Similar observations have also been reported in
several in vitro and in vivo study models in which CAT activities of the study
models were significantly improved by the induction of RBE (Lee et al. 2014;
Surarit et al. 2015; Wang et al. 2014). All these evidences would suggest
![Page 151: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/151.jpg)
134
potential of RBE as mediators for increasing cellular CAT activity and thereby
improve the total antioxidant status of induced cells.
Positive induction effects of RBE in elevating the activity of CAT were
further evidently supported by up-regulation in gene expression of CAT. It is
presumed that the positive induction effects of RBE on both enzymatic activity
and gene expression CAT were generally attributed to the contents of
polyphenols in those extracts. Polyphenols are capable of exerting
characteristics of prooxidants. Through oxidation process, the oxidized
polyphenols can generate prooxidants such as O2•-, H2O2, semiquinones and
quinones (Awad et al. 2001; Lambert & Elias 2010). Accumulation of these
prooxidants would trigger oxidative stress that ultimately leads to activation of
cellular antioxidant protective- and cytoprotective-mechanisms (Fahey &
Kensler 2007; Halliwell 2009).
Hydrogen peroxide (H2O2) is known as one of the inducers of oxidative
stress. It can easily be converted to reactive hydroxyl radicals and are able to
migrate freely between cells and tissues (Jiang et al. 2014). CAT actively
involved in the detoxification of H2O2 produced from the enzymatic reaction of
SOD and cellular metabolic activities (Pham-Huy, He & Pham-Huy 2008). It
catalyses the conversion of H2O2 to H2O and O2 in a two-steps reaction (Kang &
Kang 2013). CAT naturally has high Michaelis constants (Km) for H2O2, hence it
is capable of neutralizing high concentration of H2O2 (Kohen & Nyska 2002).
In the presence of different concentrations of exogenous H2O2,
activities and gene expression of CAT in H9c2(2-1) cardiomyocytes induced
with different concentrations of H2O2 were significantly up-regulated in a dose-
dependent manner. An increase in activity and expression levels of CAT was
reported with 125µM and 250µM of H2O2 respectively and followed by a
decrease in activity and gene expression CAT when cells were induced with
500µM H2O2.
![Page 152: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/152.jpg)
135
Figure 3-18: (A) Total enzymatic activities and (B) gene expression levels of CAT
in RBE pre-treated H9c2(2-1) cells after induction with 125µM of
H2O2. Data represent mean ± standard deviation of three repetitions
(n=3). ‘*’: significantly different from negative control (P≤0.05); ‘**’:
significantly different from negative control (P ≤0.01)
![Page 153: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/153.jpg)
136
Previous study on viability of H9c2(2-1) cells with different
concentrations of H2O2 (Figure 3-11) have revealed a significant drop in cell
viability to approximately 48% after 24 hours of treatment with 500µM H2O2. It
was presumed that 500µM H2O2 could have induced substantial oxidative
injuries to H9c2(2-1) cardiomyocytes and consequently resulting in progressive
cell death. During such event, normal functions of cellular biological systems
could have been disrupted (Trachootham et al. 2008).
The present data revealed that pre-treating H9c2(2-1) cells with RBE
before H2O2 induction (with 125µM H2O2) resulted in significant improvement on
the enzymatic activity of CAT. Based on such observation, it was proposed that
RBE could have protected H9c2(2-1) cells from oxidative injuries mediated by
H2O2 via up-regulation of CAT activity.
![Page 154: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/154.jpg)
137
(C) Glutathione Peroxidase (GPx)
GPx is a selenocysteine (Sec)-containing enzyme. The enzyme involves
in the catalytic conversion of H2O2 to H2O and organic hydroperoxides to their
respective alcohols (Rodrigo et al. 2013). The enzyme is sensitive to low levels
of oxidative injuries and capable of neutralizing low levels of H2O2 (Kohen &
Nyska 2002), GPx decomposes H2O2 and organic hydroperoxides by utilizing
its co-substrate, glutathione (GSH) and NADPH-NADH redox system (Pham-
Huy, He & Pham-Huy 2008).
Selenocysteine-containing GPx has 5 different isoforms: GPx1, GPx2,
GPx3, GPx4 and GPx6. Each isoform has different structural form and is
localized in different part of the physiological system (Kang & Kang 2013) . Both
GPx1 and GPx4 genes encode cytosolic GPx that are mainly distributed in
cytoplasm. GPx1 gene has also involved in encoding mitochondrial GPx while
GPx4 also encodes phospholipid hydroperoxide GPx that mainly localized in
associated membrane (Esworthy, Ho & Chu 1997; Imai & Nakagawa 2003;
Kang & Kang 2013).
(i) Effects of RBE on total GPx enzymatic activity and gene expression
of GPx1 in H9c2(2-1) cells
The effects of pre-treating H9c2(2-1) cells with different concentrations of
RBE : Bajong LN (25µg/mL and 50µg/mL) and MR219 (50µg/mL and 100µg/mL)
on their respective total GPx enzymatic activities and expression of GPX1 were
depicted in Figure 3-19. Cellular induction with different concentrations of RBE
significantly elevated the total GPx activities in H9c2(2-1) cells by 1.3 to 1.5
folds in comparison to that of negative control [Figure 3-19(A)]. However, GPx
activity was weekly elevated with 100µg/mL of MR219 extract. In addition,
among the two different RBE, no significant difference was observed between
the two in their respective induction effects on GPx activities.
![Page 155: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/155.jpg)
138
Figure 3-19: (A) Total GPx enzymatic activities and (B) gene expression levels of
GPx1 after treated with RBE. Data represent mean ± standard
deviation of three repetitions (n=3). ‘*’: significantly different from
negative control at P ≤ 0.05 and ‘**’: significantly different from
negative control at P ≤0.01.
![Page 156: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/156.jpg)
139
Figure 3-19 (B) depicted the effects of cellular induction with different
concentrations of RBE on the expression of targeted GPx gene, GPx1. GPx1
gene was selected for this part of the study as the gene is responsible for
encoding cytosolic and mitochrondrial GPx (Esworthy, Ho & Chu 1997). Based
on the results, cellular induction with different concentrations of RBE showed a
dose-dependent effect in the regulation of GPx1 gene. A significant up-
regulation in GPx1 gene (by 1.4 folds) was observed with 25µg/mL of Bajong
LN extract. Contrarily, significant down-regulations in the expression of GPx1
gene were reported with 50µg/mL of Bajong LN, 50µg/mL and 100µg/mL of
MR219 extracts respectively. The expression of GPx1 was down-regulated by
0.4 to 0.6 folds.
(ii) Effects of Hydrogen peroxide (H2O2) on total GPx enzymatic activity
and gene expression of GPx1 in H9c2(2-1) cells
Effects of H2O2 inductions on the enzymatic activity and expression
levels of GPx in H9c2(2-1) cells were depicted in Figure 3-20. H9c2(2-1) cells
were incubated with three different concentrations of H2O2 for 24 hours. The
present results revealed that cellular induction with 125µM and 250µM of H2O2
significantly increased the GPx activities by ~34% and ~20% (relative to
negative control) respectively. No significant difference in GPx activity was
reported with 500µM of H2O2 [Figure 3-20(A)].
Induction of H9c2(2-1) cardiomyocytes with 125µM and 250µM of H2O2
significantly elevated the expression levels of GPx by 1.3 and 1.2 folds
respectively [Figure 3-20(B)]. Among the three different concentrations of H2O2
studied (125µM and 250µM), the highest up-regulation in expression level of
GPx1 was with 125µM of H2O2 (1.3 folds over negative control) and then
followed 250µM of H2O2 (1.2 folds over negative control). As for the effect of
induction with 500µM of H2O2, the expression of GPx1 was significantly down-
regulated by 37% as compared to negative control.
![Page 157: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/157.jpg)
140
Figure 3-20: (A) Total GPx enzymatic activities and (B) gene expression levels of
GPx1 after induction with different concentrations of H2O2. Data
represent mean ± standard deviation of three repetitions (n=3). ‘*’:
significantly different from negative control at P ≤0.05 and ‘**’:
significantly different from negative control at P ≤0.01.
![Page 158: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/158.jpg)
141
(iii) Effects of H2O2 on total GPx enzymatic activity and gene expression
of GPx1 in H9c2(2-1) cells pre-treated with RBE
Different concentration of RBE: Bajong LN (25µg/mL and 50µg/mL) and
MR219 (50µg/mL and 100µg/mL) were used to induce H9c2(2-1)
cardiomyocytes for 24 hours before 125µM of H2O2 was introduced to the cells
to induce oxidative injuries. The effects of pre-treating cells with different
concentrations of RBE on their respective enzymatic activities and gene
expression levels of GPx were depicted in Figure 3-21.
H9c2(2-1) cells that have been pre-treated with 50µg/mL Bajong LN,
50µg/mL and 100µg/mL of MR219 extracts showed significant decrement in
total GPx activities after induction with 125µM of H2O2 [Figure 3-21(A)]. Total
GPx activities were decreased by ~27% to ~53% as compared to negative
control. There was no significant difference in total GPx activity between
negative control and 25µg/mL of Bajong LN pre-treated cells. In addition, the
total GPx activity also showed dose-dependent interaction. The present data
showed that GPx activity significantly decreased with increasing concentration
of RBE.
Figure 3-21(B) showed the post H2O2 induction effects of H9c2(2-1)
cells pre-treated with different concentration of RBE on their respective
expression of GPx1. Based on the results, GPx1 expression showed dose-
dependent interaction. The expressions of GPx1 were weakly up-regulated with
both 25µg/mL of Bajong LN (7% increment)) and 50µg/mL of MR219 (10%
increment) extracts. Contrarily, GPx1 expressions were down-regulated when
the cells were induced with higher concentrations of RBE. However, the down-
regulation effects were relatively weak. The expression of GPx1 was down-
regulated by ~14% with 25µg/mL of Bajong LN extract. There was no significant
difference in expression of GPx1 between negative control and 100µg/mL of
MR219 extracts.
![Page 159: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/159.jpg)
142
Figure 3-21: (A) Total GPx enzymatic activities and (B) gene expression levels of
GPx in RBE pre-treated H9c2(2-1) cells after induction with 125µM of
H2O2. Data represent mean ± standard deviation of three repetitions
(n=3). ‘*’: significantly different from negative control (P ≤0.05); ‘**’:
significantly different from negative control (P ≤0.01)
![Page 160: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/160.jpg)
143
The present data showed that the induction of H9c2(2-1) cardiomyocytes
with different concentrations of RBE and H2O2 has revealed their respective and
distinctive effects in regulating the total enzymatic activities and gene
expression levels of GPx. The activity of GPx was significantly improved
through inductions with different concentration of RBE. Such observation
suggested the potential of RBE as prospective enhancer for enzymatic activity
of GPx. Similar positive induction effects of RBE have also been reported in
several in vitro and in vivo study models (Noaman et al. 2008; Wang et al.
2014). As mentioned previously, the positive induction effects of RBE could be
attributed to the content of polyphenols in the extracts. Oxidation of polyphenols
can lead to production of cytotoxic prooxidants such as O2•-, H2O2,
semiquinones and quinones (Awad et al. 2001; Lambert & Elias 2010). These
prooxidants could trigger mild oxidative stress which further induced the
expression of cellular antioxidant and cytoprotective-mechanisms.
Similar to CAT, GPx also involve in the catalytic conversion of H2O2 to
H2O, in addition to its ability of neutralizing organic hydroperoxides to their
respective alcohols (Rodrigo et al. 2013). In this part of the study, GPx1 was
selected as the molecular target for gene expression study. The gene is
responsible for encoding mitochondrial and cytosolic GPx (Esworthy, Ho & Chu
1997; Imai & Nakagawa 2003; Kang & Kang 2013). Based on the present result,
only the expression of GPx1 was significantly up-regulated by 25µg/mL Bajong
LN extract. Cellular inductions with the remaining RBE have resulted in
significant down-regulation of GPx1 expressions. However, the exact
mechanisms involved in the down-regulation of GPx1 gene by RBE remain
unknown and require further investigation.
Dose-dependent interactions of H2O2 with the activity and gene
expression of GPx were reported in the present study. A gradual decrease in
activity and gene expression of GPx was observed along with increasing
concentration of H2O2. Unlike CAT, GPx has higher affinity for H2O2 when the
substrate is present in low concentration (lower Km as compared to CAT)
(Makino et al. 1994; Sheffield & Hilfer 2012). Hence, higher GPx activity was
reported from low concentration of H2O2 (125µM) to which the activity
progressively decreases along with increasing concentrations of H2O2.
![Page 161: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/161.jpg)
144
The present data revealed that pre-treating H9c2(2-1) cells with RBE
before H2O2 induction (with 125µM H2O2) did not result in any significant
improvement on the enzymatic activity of GPx. Cellular GPx activities were
generally significantly lower than that of negative control. In additional, the
present data also revealed a dose-dependent interaction of RBE on the activity
of GPX. Cellular induction with higher concentrations of RBE resulted in lower
GPx activity as compared to the lower concentrations of RBE.
Contrarily to the trend of cellular GPx activity, Expression of GPx1 was
significantly up-regulated with low concentrations of Bajong LN and MR219
extracts. Despite of the significant up-regulations, the positive induction effects
on the expression of GPx1 by low concentrations of both extracts were rather
weak. The gene expression of GPx1 was weakly down-regulated by 50µg/mL
Bajong LN extract while no significant difference in expression of GPx1
between negative control and cells that were pre-treated with 100µg/mL MR219
extract. Based on the current observation, it was proposed that the GPx could
have been mainly involved in catalytic conversion of low concentration of H2O2.
GPx naturally has low Km and hence it has high affinity towards low
concentration of H2O2 (Sheffield & Hilfer 2012).
Since both CAT and GPx are actively involved in the detoxification of
H2O2, it was presumed that CAT could have predominantly involved in the
disposal of H2O2. The present data revealed that cellular CAT activities of
H9c2(2-1) cells that have been pre-treated with RBE were significantly higher
than that of negative control. However, such result trend was not observed in
GPx activities of H9c2(2-1) cells. A kinetic study on the H2O2 detoxification role
of both erythrocytes-derived CAT and GPx has revealed that CAT
predominantly catalyses the disposal of H2O2. The results showed that CAT
catalysed the disposal of H2O2 at a rate that was significantly higher than that of
GPx. Simultaneous detoxification of H2O2 by CAT and GPx has revealed that
the disposal of H2O2 by GPx only occurred at a rate of 17% in relation to the
concurrent activity of CAT (Gaetani et al. 1996).
![Page 162: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/162.jpg)
145
3.4.5 Conclusion
In the present study, the antioxidant activities of different Sarawak RBE
have been studied via in vitro chemical-based and in vitro cell-based antioxidant
assay systems. The results have demonstrated the potential of RBE as sources
of naturally-derived antioxidants.
In vitro chemical-based antioxidant assays have revealed the free-radical
scavenging capabilities of different RBE. Dose-dependent interactions of RBE
with their respective free radical scavenging activities were reported in this
study. Although the free radical scavenging activities of RBE were lower than
positive controls: tocomin50 and trolox, RBE of different Sarawak rice varieties
still possess substantial efficacies in free radical scavenging activities. This
indicated the potential of RBE as natural sources of antioxidants for free radical
scavenging activities.
The inhibitory concentrations (IC50) of different RBE for DPPH free
radicals scavenging assay were in the range between 188.46µg/mL and
2279.41µg/mL. Among the different RBE studied, Bajong LN exhibited the
highest efficacy in DPPH free radical scavenging. The extract had the lowest
IC50 value required to scavenge 50% of the initial concentration of DPPH as
compared to RBE of other rice varieties.
Regression and correlation analyses of 1/DPPH (IC50) with total phenolic,
total flavonoid, total anthocyanin, total γ-oryzanol, total vitamin E, δ-tocotrienol,
γ-tocotrienol, α-tocotrienol, and α-tocopherol from RBE have been conducted to
study the correlation between the antioxidant activities of RBE and their
respective contents of bioactive compounds. Strong positive (R ≥ 0.8) and
significant (P ≤ 0.05) correlations were observed in DPPH free radical
scavenging activity against total phenolic content in RBE (R = 0.9425), total γ-
oryzanol content (R = 0.8917), and total flavonoid contents (R = 0.8455)
respectively.
The free radical scavenging activities of RBE were compared to positive
control, trolox in Trolox Equivalent Antioxidant Capacity (TEAC) assay. The
TEAC values of different RBE were in the range of 12.79nmol/100g to
61.49nmol/100g respectively. Similar to the result trend in DPPH assay, highest
![Page 163: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/163.jpg)
146
TEAC value (61.49nmol/100g) was detected in Bajong LN RBE. In addition,
strong positive (R ≥ 0.8) and significant (P ≤ 0.05) correlations were also
observed in TEAC value against total phenolic content (R = 0.9533), total
flavonoid content (R = 0.9789), and total γ-oryzanol content (R = 0.9932)
respectively.
Both DPPH and TEAC assays showed similar trend in regression and
correlation analysis between different contents of bioactive compounds in RBE
and their respective free radical scavenging activities. Hence, the present data
revealed the potential contributions of these groups of bioactive compounds to
the efficacy of total antioxidant activities in RBE. The present observations were
also concurrent with several reports from literature highlighting on the significant
contributions of phenolic compounds and flavonoids to the total antioxidant
activities of RBE.
Based on the screening of total antioxidant activities from different RBE,
the highest antioxidant activity in free radical scavenging was detected in
Bajong LN rice bran extract. Hence the extract was selected for in vitro cell
culture-based system to further assess the antioxidant capacity of the extract.
RBE of commercial rice variety, MR219 was selected for comparative study.
H9c2(2-1) cardiomyoytes were used as the cell culture study model for this part
of the study. The cells were induced with different concentrations of RBE and
hydrogen peroxide (H2O2) to assess the potential cytoprotection and antioxidant
protective effects of RBE against oxidative injuries mediated by H2O2.
The induction of cells with different concentrations of RBE showed dose-
dependent interactions on the viabilities of H9c2 cells. Both Bajong LN and
MR219 extracts differed distinctively in their respective safe dose ranges and
lethal concentrations (IC50). Bajong LN extract generally has a lower safe dose
range and lethal concentration as compared to MR219 extracts. The
discrepancy in safe dose range and lethal concentration between the two RBE
could be due to the difference in their respective total antioxidant contents. RBE
of Bajong LN was found to have significantly higher contents of antioxidants
(total phenolic, total flavonoid, total γ-oryzanol, and total vitamin E contents) as
compared to MR219 extract. There have been several reports highlighting on
![Page 164: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/164.jpg)
147
the correlation between cell cytotoxicity and high doses of antioxidant. It was
proposed that high dose of antioxidants; particularly polyphenols can exhibit
characteristics of prooxidants that threaten survival and viability of cells.
Induction of H9c2(2-1) cardiomyocytes with H2O2 also revealed a dose-
dependent interaction. Low concentrations of H2O2 generally did not decrease
the viability of H9c2(2-1) cells but induced proliferation in H9c2 cells. However,
viability of H9c2(2-1) gradually decreased when higher concentrations of H2O2
beyond 125µM were used. Pre-treatment of H9c2(2-1) cells with 25µg/mL
Bajong LN and 50µg/mL MR219 before induction with different concentrations
of H2O2 have revealed the potential of RBE in alleviating H2O2 mediated
cytotoxicity. Pre-incubation of H9c2(2-1) cells with Bajong LN (25 µg/mL)
extract increased the IC50 of H2O2 by approximately two fold in relation to
negative control. Contrarily, the efficiency of 50µg/mL MR219 extract was not
on par with that of 25µg/mL Bajong LN extract, only a slight increment in IC50 of
H2O2 was detected in cells pre-treated with 50µg/mL MR219 extract
(approximately 1.4% in relation to negative control).
The preliminary study on the induction effects of RBE on endogenous
cellular antioxidant enzymes has revealed the potential of RBE as mediators for
improving the enzymatic activities of SOD, CAT and GPx in H9c2(2-1) cells.
Cellular induction with RBE significantly improved the enzymatic activities of
SOD, CAT and GPx in H9c2(2-1) cells. H2O2-induction of H9c2(2-1) cells
pre-treated with RBE further revealed significant up-regulation in enzymatic
activity and expression level of CAT. Through this preliminary study, it has
demonstrated the potential antioxidant protective effects of RBE in alleviating
H2O2-mediated oxidative injuries via up-regulation in enzymatic activities and
expression levels of CAT.
As a summary, the antioxidant capacities of different RBE of Sarawak
have been assessed via two different types of in vitro antioxidant assays: in
vitro chemical-based antioxidant assay and in vitro mammalian cell culture-
based antioxidant assay. Preliminary outcomes from these assays have shown
the potential of RBE as free radical scavengers and protect H9c2(2-1)
cardiomyocytes from oxidative injuries mediated by H2O2 via regulation of
![Page 165: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/165.jpg)
148
endogenous antioxidant enzymes. Regardless of the discrepancies in
antioxidant activities of different RBE, the present findings revealed the
potential of RBE as an exogenous source of antioxidants for improving the total
antioxidant status in physiological systems and provide protection against
oxidative stress. Hence, strategies of using RBE to attenuate CVD via inhibition
of inadvertent cellular oxidative damage or signaling pathway may have
important implications to both prevention and treatment of CVD.
![Page 166: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/166.jpg)
149
4. Chapter 4: Research Limitations and Future
Work
4.1 Project Limitations
The overall research design were intended to achieve two main
objectives, which are to (1) extract and assess natural antioxidant contents from
rice bran of selected Sarawak local rice varieties; (2) assess the bioactivity of
RBE by studying their antioxidant capacities via in vitro antioxidant assays. The
objectives of the research have been achieved. Throughout the study some
limitations have been recognized due to time and resource constraints. The
following provides an overview of the known limitations for the present work.
Objective 1: Extraction of natural antioxidants from rice bran
Standardization of sample collection
Rice varieties selected for the present work were collected by officers
from Agriculture Department of Sarawak at different time point
throughout the study. As rice samples were pre-harvested by farmers,
the author has limitations over the controls of time and methods of
harvesting the samples and also the mode of sample storage to
maintain the freshness of samples.
Detailed compositional analysis of rice bran antioxidants
The total contents of phenolics, flavonoids, anthocyanins, and γ-
oryzanol compounds in RBE were studied via assay methods that
estimate the total contents of the aforementioned bioactive compounds.
Due to the diversity of compounds and the lacking of available reference
standards, detailed compositional analyses of each group of compounds
were limited. Hence qualitative and quantitative analyses of specific
compounds were restricted.
![Page 167: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/167.jpg)
150
Standardization of extraction methods
Due to the nature of different compounds, different extraction methods
are required for different compound to fully isolate them from plant
materials. The present work utilized only methanol as the solvent
system for extraction. The lack of optimization in extraction method
could affect the final extraction yield of the compounds.
Objective 2: Bioactivity studies of natural antioxidants derived from rice
bran of Sarawak local rice varieties
Radical Source for In Vitro Chemical-Based Antioxidant Assays
DPPH free radical source was used in the present study to assess the
antioxidant capacities of RBE in in vitro chemical-based antioxidant
assays. Although significant antioxidant activities of RBE towards DPPH
were reported in the present work, the potential effectiveness of
antioxidant activities of RBE towards alternative electron- or radical-
based sources still remains unknown.
Accumulation of Intracellular Reactive Oxygen Species (ROS)
The accumulation of intracellular ROS in H9c2(2-1) cardiomyocytes was
not investigated in the present work. Hence, differences in the amount
of accumulated intracellular ROS before and after induction with
different treatments were unable to be determined.
Molecular and Integrative Cell Signaling Factors of Cells
Present work was a preliminary study that only focused on the potential
of RBE in mediating the cell viability, activities and expression levels of
endogenous antioxidant enzymes in H9c2(2-1) cells. It is still remains
unknown that how will RBE affect the signal transductions involved in
the regulation of cell viability, proliferation, senescence, apoptotic- and
necrotic-pathways.
![Page 168: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/168.jpg)
151
Activities and gene expression studies of SOD and GPx
Both SOD and GPx have different isomeric forms. Each isomer has
different functions and is distributed in different location or region in the
cells. Present work only focused on the total enzymatic activities of both
endogenous antioxidant enzymes and the expression levels of their
respective single isomeric form (SOD2 and GPx1). Hence, it remains
unknown of how RBE treatments regulate the enzymatic activities and
expression levels of different SOD and GPx isomers.
![Page 169: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/169.jpg)
152
4.2 Future Work
In order to address the limitations from the present research, some of the
potential areas that can be considered to further pursue the present objectives
are as follow:
Objective 1: Extraction of natural antioxidants from rice bran
Effects of different extraction parameters such as solvent system,
temperature, and extraction duration on the extraction yield of natural
antioxidants derived from RBE.
Detailed study on the compositions and structural elucidations of natural
antioxidants present in RBE.
Studies on proteins and fatty acids contents in RBE.
Isolation and purification of compound of interest for further research
and application.
Objective 2: Bioactivity studies of natural antioxidants derived from rice
bran of Sarawak local rice varieties
Bioactivity studies of RBE via alternative electron- or radical-associated
antioxidant assays.
Assessment on the contents of intracellular reactive oxygen species
(ROS) before and after induction with RBE.
Molecular and integrative cell signaling study of cells induced with RBE.
Detailed study on activities and gene expressions of alternative isomers
of SOD and GPx.
Bioactivity studies of RBE using animal models.
![Page 170: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/170.jpg)
153
5. Appendices
5.1 Graphical representation
5.1.1 Total Phenolic Content of RBE of Different Sarawak Local Rice
Varieties
Figure 5-1: Total phenolic content of different RBE were expressed in unit of mg
GAE/g dried extracts. Vertical bars and errors bars represent the
mean ± standard deviation of 3 experimental repetitions (n=3). Similar
letters on each bar represent significant differences at P ≤ 0.05
(Tukey’s Test). GAE = Gallic Acid Equivalent.
a
b
b
c cd cde
def defg deg
0
10
20
30
40
50
60
BajongLN
Bali Pandan WangiMamut
Bajong MR219 Bario Biris Bubuk
mg
GA
E/g
dri
ed
ex
trac
t
RBE
Total Phenolic Content
Bajong LN
Bali
Pandan
Wangi Mamut
Bajong
MR219
Bario
Biris
Bubuk
![Page 171: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/171.jpg)
154
5.1.2 Total Flavonoid Content of RBE of Different Sarawak Local Rice
Varieties
Figure 5-2: Total flavonoid content of different RBE were expressed in unit of mg
QE/g dried extracts. Vertical bars and errors bars represent the mean
± standard deviation of 3 experimental repetitions (n=3). Different
letters on each bar represent significant differences at P ≤ 0.05
(Tukey’s Test). QE = Quercetin Equivalent.
a
b
c
d
e e
f g g
0
2
4
6
8
10
12
14
16
18
BajongLN
Pandan Bali Bajong Bubuk WangiMamut
MR219 Bario Biris
mg
QE/
g d
ried
ext
ract
RBE
Total Flavonoid Content
Bajong LN
Pandan
Bali
Bajong
Bubuk
Wangi Mamut
MR219
Bario
Biris
![Page 172: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/172.jpg)
155
5.1.3 Total Anthocyanin Content of RBE of Different Sarawak Local Rice
Varieties
Figure 5-3: Total anthocyanin content of different RBE were expressed in unit of
mg C3G/100g dried extracts. Vertical bars and errors bars represent
the mean ± standard deviation of 3 experimental repetitions (n=3).
The ‘*’ annotation represents significant difference at P ≤ 0.05 from
RBE of Bajong (Tukey’s Test).
* * *
0
4
8
12
16
Bario Pandan Bali MR219 BajongLN
WangiMamut
Bajong Bubuk Biris
mg
C3
G e
qu
iva
len
t/1
00
g s
am
ple
RBE
Total Anthocyanin Content
Bario Pandan
Bali MR219
Bajong LN Wangi Mamut
Bajong Bubuk
Biris
![Page 173: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/173.jpg)
156
5.1.4 Total γ-Oryzanol Content of RBE of Different Sarawak Local Rice
Varieties
Figure 5-4: Total γ-oryzanol content of different crude rice bran extracts were
expressed in unit of mg/kg dried extracts. Vertical bars and errors
bars represent the mean ± standard deviation of 3 experimental
repetitions (n=3). Different letters on each bar represent significant
differences at P ≤ 0.05 (Tukey’s Test).
a
b c
d
e f
g h
i
0
1
2
3
4
5
6
7
8
BajongLN
Pandan Bali Bajong Bubuk WangiMamut
Biris MR219 Bario
x1
03 m
g/k
g
RBE
Total γ-Oryzanol Content
Bajong LN
Pandan
Bali
Bajong
Bubuk
Wangi Mamut
Biris
MR219
Bario
![Page 174: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/174.jpg)
157
5.1.5 IC50 of RBE of Different Sarawak Local Rice Varieties for DPPH Free
Radical Scavenging Assay
Figure 5-5: Inhibitory concentration (IC50) of different RBE for DPPH free radical
scavenging assay. Tocomin50 was used as the positive control. The
data represent mean ± standard deviation of three repetitions (n=3).
Different letters on each bar represent significant differences at P ≤
0.05 (Tukey’s Test).
a b
b
c
d de de
def
def
g
0.0
0.5
1.0
1.5
2.0
2.5
Tocomin50 Bajong LN Bali Pandan Bajong WangiMamut
MR219 Bubuk Biris Bario
IC50 (
x1
03 µ
g/m
L)
RBE
DPPH Free Radical Assay
Tocomin50 Bajong LN Bali
Pandan Bajong Wangi Mamut
![Page 175: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/175.jpg)
158
5.1.6 Correlation Graphs of 1/DPPH (IC50) from RBE with The Content of Different Groups of Bioactive Compounds
y = 0.0001x + 0.0005 R² = 0.8884
0
0.002
0.004
0.006
0.008
0 10 20 30 40 50
1/D
PP
H (
IC50)
Total Phenolic Content (mg GAE/g)
(A) DPPH vs Total Phenolic Content
y = 0.0003x - 0.0001 R² = 0.7148
0
0.002
0.004
0.006
0.008
0 6 12 181/D
PP
H (
IC50)
Total Flavonoid Content (mg QE/g)
(B) DPPH vs Total Flavonoid Content
y = -0.0003x + 0.0052 R² = 0.2899
0
0.002
0.004
0.006
0.008
0 10 20
1/D
PP
H (
IC50)
Total Anthocyanin Content (mg C3G/100g)
(C) DPPH vs Total Anthocyanin Content
y = (9x10-7)x - 0.0007 R² = 0.7951
0
0.002
0.004
0.006
0.008
0 2 4 6 8
1/D
PP
H (
IC50)
Total γ-Oryzanol Content (x103 mg/kg)
(D) DPPH vs γ-Oryzanol
y = (1x10-5)x - 0.0032 R² = 0.5048
0
0.002
0.004
0.006
0.008
0 200 400 600
1/D
PP
H (
IC50)
Total Vitamin E Content (mg/kg)
(E) DPPH vs Vitamin E
y = 0.0002x + 0.0002 R² = 0.1192
0
0.002
0.004
0.006
0.008
0 5 10 15 20
1/D
PP
H (
IC50)
Total δ-Tocotrienol Content (mg/kg)
(F) DPPH vs δ-Tocotrienol
*[Figure continue on to next page]
![Page 176: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/176.jpg)
159
Figure 5-6: The correlation graphs of 1/DPPH (IC50) from RBE with (A) total phenolic content, (B) total flavonoid content, (C) total
anthocyanin content, (D) total γ-oryzanol content, (E) total vitamin E content, (F) δ-tocotrienol content, (G) γ-tocotrienol
content, (H) α-tocotrienol content, and (I) tocopherol (α-tocopherol) content.
y = (2x10-5)x - 0.002 R² = 0.4269
0
0.002
0.004
0.006
0.008
0 200 400
1/D
PP
H (
IC50)
Total γ-Tocotrienol Content (mg/kg)
(G) DPPH vs γ-Tocotrienol
y = (1x10-5)x + 0.0013 R² = 0.0368
0
0.002
0.004
0.006
0.008
0 20 40 60 80 100
1/D
PP
H (
IC50)
Total α-Tocotrienol Content (mg/kg)
(H) DPPH vs α-Tocotrienols
y = (1x10-5) x + 0.0005 R² = 0.1143
0
0.002
0.004
0.006
0.008
0 100 200 300
1/D
PP
H (
IC50)
Total Tocopherol (α-Tocopherol) Content (mg/kg)
(I) DPPH vs Tocopherol (α-Tocopherol)
![Page 177: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/177.jpg)
160
5.1.7 Trolox Equivalent Antioxidant Capacity (TEAC) Assay of Different
RBE.
Figure 5-7: Trolox Equivalent Antioxidant Capacity (TEAC) assay of different
RBE. Trolox was used as the positive control. Antioxidant capacities
of different RBE were expressed in trolox equivalence (nmol/g
trolox). The data represent mean ± standard deviation of three
repetitions (n=3). Different letters on each bar represent significant
differences at P ≤ 0.05 (Tukey’s Test).
a
b b
c
cd cd
e ef ef
0
10
20
30
40
50
60
70
BajongLN
Bali Pandan Bajong WangiMamut
Bubuk MR219 Biris Bario
Tro
lox
Eq
uiv
ale
nt
(nm
ol/ 1
00
g)
RBE
TEAC Bajong LN
Bali
Pandan
Bajong
Wangi Mamut
Bubuk
MR219
Biris
Bario
![Page 178: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/178.jpg)
161
5.1.8 Trolox Equivalent Antioxidant Capacity (TEAC) Assay of RBE from Different Sarawak Local Rice Varieties.
y = 0.978x + 17.014 R² = 0.9089
0
20
40
60
80
0 10 20 30 40 50
TE
AC
(n
mo
l/100g
)
Total Phenolic Content (mg GAE/g)
(1) TEAC vs Total Phenolic Content
y = 3.0103x + 9.9305 R² = 0.9582
0
20
40
60
80
0 5 10 15 20T
EA
C (
nm
ol/100g
) Total Flavonoid Content (mg QE/g)
(2) TEAC vs Total Flavonoid Content
y = -1.7836x + 51.548 R² = 0.2411
0
20
40
60
80
0 10 20 30
TE
AC
(n
mo
l/100g
)
Total Anthocyanin Content (mg C3G/100g)
(3) TEAC vs Total Anthocyanin Content
y = 0.0075x + 5.4386 R² = 0.9865
0
20
40
60
80
0 2 4 6 8
TE
AC
(n
mo
l/100g
)
Total γ-Oryzanol Content (x103 mg/kg)
(4) TEAC vs γ-Oryzanol Content
y = 0.0797x - 5.5265 R² = 0.3624
0
20
40
60
80
0 200 400 600 800
TE
AC
(n
mo
l/100g
)
Total Vitamin E Content (mg/kg)
(5) TEAC vs Total Vitamin E Content
y = 2.4055x + 7.7305 R² = 0.2782
0
20
40
60
80
0 5 10 15 20
TE
AC
(n
mo
l/100g
)
Total δ-Tocotrienol Content (mg/kg)
(6) TEAC vs δ-Tocotrienol Content
*[Figure continue on to next page]
![Page 179: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/179.jpg)
162
Figure 5-8: The correlation graphs of TEAC of RBE with (1) total phenolic content, (2) total flavonoid content, (3) total anthocyanin
content, (4) total γ-oryzanol content, (5) total vitamin E content, (6) δ-tocotrienol content, (7) γ-tocotrienol content, (8) α-
tocotrienol content, and (9) tocopherol (α-tocopherol) content.
y = 0.0596x + 12.588 R² = 0.1037
0
20
40
60
80
0 100 200 300 400
TE
AC
(n
mo
l/100g
)
Total γ-Tocotrienol Content (mg/kg)
(7) TEAC vs γ-Tocotrienol Content
y = 0.1575x + 21.685 R² = 0.0856
0
20
40
60
80
0 20 40 60 80 100
TE
AC
(n
mo
l/100g
) Total α-Tocotrienol Content (mg/kg)
(8) TEAC vs α-Tocotrienol Content
y = 0.125x + 12.173 R² = 0.268
0
20
40
60
80
0 100 200 300
TE
AC
(n
mo
l/100g
)
Total Tocopherol (α-Tocopherol) Content (mg/kg)
(9) TEAC vs Tocopherol (α-Tocopherol) Content
![Page 180: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/180.jpg)
163
5.1.9 Dose- and Time-Dependent Interactions of Bajong LN RBE on the
cell viability of H9c2(2-1) cells.
Figure 5-9: Cell viability curves of H9c2(2-1) cells treated with different
concentrations of Bajong LN extracts over 24, 48 and 72 hours of
incubation period respectively. The insets showed the inhibition
concentration (IC50) of Bajong LN RBE on H9c2(2-1) cells
determined via GraphPad Prism (GraphPad Software, Inc. USA).
Best fit curves were plotted using excel for visual purpose.
1.81
0%
20%
40%
60%
80%
100%
120%
0 1 2 3
Cell
Via
bilit
y (
%)
Log [Bajong LN], µg/mL
Bajong LN (Day 1)
Bajong LN Day 1
IC50
1.79
0%
20%
40%
60%
80%
100%
120%
0 1 2 3
Cell
Via
bilit
y (
%)
Log [Bajong LN], µg/mL
Bajong LN (Day 2)
Bajong LN Day 2
IC50
1.80
0%
20%
40%
60%
80%
100%
120%
0 1 2 3
Cell
Via
bilit
y (
%)
Log [Bajong LN], µg/mL
Bajong LN (Day 3)
Bajong LN (Day 3)
IC50
![Page 181: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/181.jpg)
164
5.1.10 Dose- and Time-Dependent Interactions of MR219 RBE on the cell
viability of H9c2(2-1) cells.
Figure 5-10: Cell viability curves of H9c2(2-1) cells treated with different
concentrations of MR219 extracts over 24, 48 and 72 hours of
incubation period respectively. The insets showed the inhibition
concentration (IC50) of MR219 RBE on H9c2(2-1) cells determined
via GraphPad Prism (GraphPad Software, Inc. USA). Best fit
curves were plotted using excel for visual purpose.
1.98
0%
20%
40%
60%
80%
100%
120%
140%
0 1 2 3
Cell
Via
bilit
y (
%)
Log [MR219], µg/mL
MR219 (Day 1)
MR219 (Day 1)
IC50
2.05
0%
20%
40%
60%
80%
100%
120%
0 1 2 3
Cell
Via
bilit
y (
%)
Log [MR219], µg/mL
MR219 (Day 2)
MR219 (Day 2)
IC50
2.03
0%
20%
40%
60%
80%
100%
120%
140%
0 1 2 3
Cell
Via
bilit
y (
%)
Log [MR219], µg/mL
MR219 (Day 3)
MR219 (Day 3)
IC50
![Page 182: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/182.jpg)
165
5.1.11 Dose-Dependent Interactions of H2O2 on the cell viability of H9c2(2-1) cells pre-treated with different concentrations
of Bajong LN RBE and MR219 RBE.
Figure 5-11: IC50 of H2O2 for H9c2(2-1) cells pre-treated with different concentrations of RBE. Data represent mean ± standard
deviation for 3 repetitions (n=3). IC50 values were determined via GraphPad Prism (GraphPad Software, Inc. USA).
![Page 183: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/183.jpg)
166
5.2 Tabulation of Data
Table 5-1: Extraction yields of RBE
Extraction Yield
Rice
Varieties
Mass of
Starting
Material
(g Dry Weight)
Volume
of Solvent,
MetOH
(mL)
Mass of Extract
(g Dry Weight)
mg/g
Dry Weight
% mg/g Dry
Weight
mg/100g
Dry Weight
Bajong LN 3.0459 30 0.0531 0.0174 1.74 1.74
Bali 3.0171 30 0.102 0.0338 3.38 3.38
Biris 3.0412 30 0.1378 0.0453 4.53 4.53
Bubuk 3.0539 30 0.0991 0.0325 3.25 3.25
Bario 3.0172 30 0.1218 0.0404 4.04 4.04
Wangi Mamut 3.073 30 0.1034 0.0336 3.36 3.36
MR 219 3.0309 30 0.1195 0.0394 3.94 3.94
Bajong 3.0757 30 0.0988 0.0321 3.21 3.21
Pandan 3.0573 30 0.0711 0.0233 2.33 2.33
![Page 184: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/184.jpg)
167
6. References
Adam, A, Marzuki, A, Ngah, WZ & Top, GM 1996, 'Nitrofurantoin-induced hepatic and pulmonary biochemical changes in mice fed different vitamin E doses', Pharmacol Toxicol, vol. 79, no. 6, Dec, pp. 334-9.
Addis, PB 1986, 'Occurrence of lipid oxidation products in foods', Food Chem Toxicol, vol. 24, no. 10-11, Oct-Nov, pp. 1021-30.
Aedín, C, José, P & Peter, H 2012, 'Bioavailability of Isoflavones in Humans', in Flavonoids and Related Compounds, CRC Press.
Agarwal, MK, Agarwal, ML, Athar, M & Gupta, S 2004, 'Tocotrienol-Rich Fraction of Palm Oil Activates p53, Modulates Bax/Bcl2 Ratio and Induces Apoptosis Independent of Cell Cycle Association', Cell Cycle, vol. 3, no. 2, pp. 200-199.
Aggarwal, BB, Sundaram, C, Prasad, S & Kannappan, R 2010, 'Tocotrienols, the vitamin E of the 21st century: its potential against cancer and other chronic diseases', Biochem Pharmacol, vol. 80, no. 11, Dec 1, pp. 1613-31.
Ahmad, NS, Khalid, BA, Luke, DA & Ima Nirwana, S 2005, 'Tocotrienol offers better protection than tocopherol from free radical-induced damage of rat bone', Clin Exp Pharmacol Physiol, vol. 32, no. 9, Sep, pp. 761-70.
Ahn, KS, Sethi, G, Krishnan, K & Aggarwal, BB 2007, 'Gamma-tocotrienol inhibits nuclear factor-kappaB signaling pathway through inhibition of receptor-interacting protein and TAK1 leading to suppression of antiapoptotic gene products and potentiation of apoptosis', J Biol Chem, vol. 282, no. 1, Jan 5, pp. 809-20.
Alexander, GS 2008, 'Tocotrienols', in Tocotrienols, CRC Press, pp. 3-12.
Anand, SS, Islam, S, Rosengren, A, Franzosi, MG, Steyn, K, Yusufali, AH, Keltai, M, Diaz, R, Rangarajan, S & Yusuf, S 2008, Risk factors for myocardial infarction in women and men: insights from the INTERHEART study.
Anne, MM & Barrie, T 2008, 'Tocotrienols in Cardiometabolic Diseases', in Tocotrienols, CRC Press, pp. 257-273.
Antipuesto, DJ 2014, Nursing Crib.
Arslan, F, Keogh, B, McGuirk, P & Parker, AE 2010, 'TLR2 and TLR4 in Ischemia Reperfusion Injury', Mediators of Inflammation, vol. 2010, p. 8.
Aruoma, O 1998, 'Free radicals, oxidative stress, and antioxidants in human health and disease', Journal of the American Oil Chemists' Society, vol. 75, no. 2, 1998/02/01, pp. 199-212.
![Page 185: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/185.jpg)
168
Ausman, LM, Rong, N & Nicolosi, RJ 2005, 'Hypocholesterolemic effect of physically refined rice bran oil: Studies of cholesterol metabolism and early atherosclerosis in hypercholesterolemic hamsters', The Journal of Nutritional Biochemistry, vol. 16, no. 9, 9//, pp. 521-529.
Aviram, M, Dornfeld, L, Rosenblat, M, Volkova, N, Kaplan, M, Coleman, R, Hayek, T, Presser, D & Fuhrman, B 2000, 'Pomegranate juice consumption reduces oxidative stress, atherogenic modifications to LDL, and platelet aggregation: studies in humans and in atherosclerotic apolipoprotein E-deficient mice', Am J Clin Nutr, vol. 71, no. 5, May, pp. 1062-76.
Awad, HM, Boersma, MG, Boeren, S, van Bladeren, PJ, Vervoort, J & Rietjens, IM 2001, 'Structure-activity study on the quinone/quinone methide chemistry of flavonoids', Chem Res Toxicol, vol. 14, no. 4, Apr, pp. 398-408.
Azam, S, Hadi, N, Khan, NU & Hadi, SM 2004, 'Prooxidant property of green tea polyphenols epicatechin and epigallocatechin-3-gallate: implications for anticancer properties', Toxicol In Vitro, vol. 18, no. 5, Oct, pp. 555-61.
Babich, H, Zuckerbraun, HL, Wurzburger, BJ, Rubin, YL, Borenfreund, E & Blau, L 1996, 'Benzoyl peroxide cytotoxicity evaluated in vitro with the human keratinocyte cell line, RHEK-1', Toxicology, vol. 106, no. 1–3, 1/8/, pp. 187-196.
Bang, MH, Van Riep, T, Thinh, NT, Song le, H, Dung, TT, Van Truong, L, Van Don, L, Ky, TD, Pan, D, Shaheen, M & Ghoneum, M 2010, 'Arabinoxylan rice bran (MGN-3) enhances the effects of interventional therapies for the treatment of hepatocellular carcinoma: a three-year randomized clinical trial', Anticancer Res, vol. 30, no. 12, Dec, pp. 5145-51.
Beckman, KB & Ames, BN 1997, 'Oxidative Decay of DNA', Journal of Biological Chemistry, vol. 272, no. 32, August 8, 1997, pp. 19633-19636.
Berliner, JA, Navab, M, Fogelman, AM, Frank, JS, Demer, LL, Edwards, PA, Watson, AD & Lusis, AJ 1995, 'Atherosclerosis: Basic Mechanisms: Oxidation, Inflammation, and Genetics', Circulation, vol. 91, no. 9, May 1, 1995, pp. 2488-2496.
Biasutto, L, Mattarei, A & Zoratti, M 2012, 'Resveratrol and health: the starting point', Chembiochem, vol. 13, no. 9, Jun 18, pp. 1256-9.
Bordignon-Luiz, MT, Gauche, C, Gris, EF & Falcão, LD 2007, 'Colour stability of anthocyanins from Isabel grapes (Vitis labrusca L.) in model systems', LWT - Food Science and Technology, vol. 40, no. 4, 5//, pp. 594-599.
Borresen, EC & Ryan, EP 2014, 'Chapter 22 - Rice Bran: A Food Ingredient with Global Public Health Opportunities', in RRWRP Zibadi (ed.) Wheat and Rice in Disease Prevention and Health, Academic Press, San Diego, pp. 301-310.
![Page 186: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/186.jpg)
169
Bouayed, J & Bohn, T 2010, 'Exogenous antioxidants - Double-edged swords in cellular redox state: Health beneficial effects at physiologic doses versus deleterious effects at high doses', Oxid Med Cell Longev, vol. 3, no. 4, Jul 1, pp. 228-237.
Britz, SJ, Prasad, PV, Moreau, RA, Allen, LH, Jr., Kremer, DF & Boote, KJ 2007, 'Influence of growth temperature on the amounts of tocopherols, tocotrienols, and gamma-oryzanol in brown rice', J Agric Food Chem, vol. 55, no. 18, Sep 5, pp. 7559-65.
Bucci, R, Magrì, A, Magrì, A & Marini, F 2003, 'Comparison of three spectrophotometric methods for the determination of γ-oryzanol in rice bran oil', Analytical and Bioanalytical Chemistry, vol. 375, no. 8, 2003/04/01, pp. 1254-1259.
Burdon, RH & Rice-Evans, C 1989, 'Free radicals and the regulation of mammalian cell proliferation', Free Radic Res Commun, vol. 6, no. 6, pp. 345-58.
Cayman Chemical 2014, 'Superoxide dismutase assay kit', Item No. 706002,
Cederberg, J, Siman, CM & Eriksson, UJ 2001, 'Combined Treatment with Vitamin E and Vitamin C Decreases Oxidative Stress and Improves Fetal Outcome in Experimental Diabetic Pregnancy', Pediatr Res, vol. 49, no. 6, 06//print, pp. 755-762.
Ceriello, A 2008, 'Possible Role of Oxidative Stress in the Pathogenesis of Hypertension', Diabetes Care, vol. 31, no. Supplement 2, February 1, 2008, pp. S181-S184.
Cesar, GF & Patricia, IO 2012, 'Interactions of Flavan-3-ols within Cellular Signaling Pathways', in Flavonoids and Related Compounds, CRC Press.
Chang, PN, Yap, WN, Lee, DT, Ling, MT, Wong, YC & Yap, YL 2009, 'Evidence of gamma-tocotrienol as an apoptosis-inducing, invasion-suppressing, and chemotherapy drug-sensitizing agent in human melanoma cells', Nutr Cancer, vol. 61, no. 3, pp. 357-66.
Chantal, MCB, Richelle, SM, Justin, FD, rea, LE, rew, F, Delfin, R-L, Mirna, NC & Grant, NP 2012, 'The Pathophysiology of Coronary Artery Disease', in Functional Foods and Cardiovascular Disease, CRC Press, pp. 1-28.
Chatterjee, M, Saluja, R, Kanneganti, S, Chinta, S & Dikshit, M 2007, 'Biochemical and molecular evaluation of neutrophil NOS in spontaneously hypertensive rats', Cell Mol Biol (Noisy-le-grand), vol. 53, no. 1, pp. 84-93.
Chen, MH & Bergman, CJ 2005, 'A rapid procedure for analysing rice bran tocopherol, tocotrienol and γ-oryzanol contents', Journal of Food Composition and Analysis, vol. 18, no. 2–3, 3//, pp. 139-151.
![Page 187: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/187.jpg)
170
Chen, MH, Choi, SH, Kozukue, N, Kim, HJ & Friedman, M 2012, 'Growth-inhibitory effects of pigmented rice bran extracts and three red bran fractions against human cancer cells: relationships with composition and antioxidative activities', J Agric Food Chem, vol. 60, no. 36, Sep 12, pp. 9151-61.
Chen, Z, Siu, B, Ho, YS, Vincent, R, Chua, CC, Hamdy, RC & Chua, BH 1998, 'Overexpression of MnSOD protects against myocardial ischemia/reperfusion injury in transgenic mice', J Mol Cell Cardiol, vol. 30, no. 11, Nov, pp. 2281-9.
Cheng, Y, Liu, X, Zhang, S, Lin, Y, Yang, J & Zhang, C 2009, 'MicroRNA-21 protects against the H(2)O(2)-induced injury on cardiac myocytes via its target gene PDCD4', J Mol Cell Cardiol, vol. 47, no. 1, Jul, pp. 5-14.
Cho, JG, Song, NY, Nam, TG, Shrestha, S, Park, HJ, Lyu, HN, Kim, DO, Lee, G, Woo, YM, Jeong, TS & Baek, NI 2013, 'Flavonoids from the grains of C1/R-S transgenic rice, the transgenic Oryza sativa spp. japonica, and their radical scavenging activities', J Agric Food Chem, vol. 61, no. 43, Oct 30, pp. 10354-9.
Chotimarkorn, C & Silalai, N 2008, 'Addition of rice bran oil to soybean oil during frying increases the oxidative stability of the fried dough from rice flour during storage', Food Research International, vol. 41, no. 3, //, pp. 308-317.
Christ, B & Müller, KH 1960, 'Zur serienmäßigen Bestimmung des Gehaltes an Flavonol-Derivaten in Drogen', Archiv der Pharmazie, vol. 293, no. 12, pp. 1033-1042.
Chung, JS, Lee, SB, Park, SH, Kang, ST, Na, AR, Chang, TS, Kim, HJ & Yoo, YD 2009, 'Mitochondrial reactive oxygen species originating from Romo1 exert an important role in normal cell cycle progression by regulating p27(Kip1) expression', Free Radic Res, vol. 43, no. 8, Aug, pp. 729-37.
Cunha, SC, Amaral, JS, Fernandes, JO & Oliveira, MB 2006, 'Quantification of tocopherols and tocotrienols in portuguese olive oils using HPLC with three different detection systems', J Agric Food Chem, vol. 54, no. 9, May 3, pp. 3351-6.
Dai, J & Mumper, RJ 2010, 'Plant phenolics: extraction, analysis and their antioxidant and anticancer properties', Molecules, vol. 15, no. 10, pp. 7313-52.
Davies, KJ 1999, 'The broad spectrum of responses to oxidants in proliferating cells: a new paradigm for oxidative stress', IUBMB Life, vol. 48, no. 1, Jul, pp. 41-7.
de Kok, TM, van Breda, SG & Manson, MM 2008, 'Mechanisms of combined action of different chemopreventive dietary compounds: a review', Eur J Nutr, vol. 47 Suppl 2, May, pp. 51-9.
de Munter, JSL, Hu, FB, Spiegelman, D, Franz, M & van Dam, RM 2007, 'Whole Grain, Bran, and Germ Intake and Risk of Type 2 Diabetes: A Prospective Cohort Study and Systematic Review', PLoS Med, vol. 4, no. 8, p. e261.
![Page 188: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/188.jpg)
171
Decker, EA 1997, 'Phenolics: prooxidants or antioxidants?', Nutr Rev, vol. 55, no. 11 Pt 1, Nov, pp. 396-8.
Dembinska-Kiec, A, Mykkanen, O, Kiec-Wilk, B & Mykkanen, H 2008, 'Antioxidant phytochemicals against type 2 diabetes', Br J Nutr, vol. 99 E Suppl 1, May, pp. Es109-17.
Dos Santos, WG, Pacheco, I, Liu, M-Y, Teixeira, M, Xavier, AV & LeGall, J 2000, 'Purification and Characterization of an Iron Superoxide Dismutase and a Catalase from the Sulfate-Reducing Bacterium Desulfovibrio gigas', Journal of Bacteriology, vol. 182, no. 3, 11 April, pp. 796-804.
Drane, P, Bravard, A, Bouvard, V & May, E 2001, 'Reciprocal down-regulation of p53 and SOD2 gene expression-implication in p53 mediated apoptosis', Oncogene, vol. 20, no. 4, pp. 430-439.
Droge, W 2002, 'Free radicals in the physiological control of cell function', Physiol Rev, vol. 82, no. 1, Jan, pp. 47-95.
Dröge, W & Schipper, HM 2007, 'Oxidative stress and aberrant signaling in aging and cognitive decline', Aging cell, vol. 6, no. 3, pp. 361-370.
Drotleff, AM & Ternes, W 2001, 'Determination of RS,E/Z-tocotrienols by HPLC', J Chromatogr A, vol. 909, no. 2, Feb 16, pp. 215-23.
Eguchi, Y, Shimizu, S & Tsujimoto, Y 1997, 'Intracellular ATP Levels Determine Cell Death Fate by Apoptosis or Necrosis', Cancer Research, vol. 57, no. 10, May 15, 1997, pp. 1835-1840.
Elaine, TC, Delilah, FW, Bienvenido, OJ & Donald, BB 2004, 'CHAPTER 4: THE RICE GRAIN AND ITS GROSS COMPOSITION', in RICE: Chemistry and Technology, American Association of Cereal Chemists, Inc., pp. 77-107.
Eloff, JN 1998, 'Which extractant should be used for the screening and isolation of antimicrobial components from plants?', J Ethnopharmacol, vol. 60, no. 1, Feb, pp. 1-8.
Esiri, MM 2007, 'Ageing and the brain', J Pathol, vol. 211, no. 2, Jan, pp. 181-7.
Esworthy, RS, Ho, YS & Chu, FF 1997, 'The Gpx1 gene encodes mitochondrial glutathione peroxidase in the mouse liver', Arch Biochem Biophys, vol. 340, no. 1, Apr 1, pp. 59-63.
Fahey, JW & Kensler, TW 2007, 'Role of Dietary Supplements/Nutraceuticals in Chemoprevention Through Induction of Cytoprotective Enzymes', Chemical research in toxicology, vol. 20, no. 4, 03/16, pp. 572-576.
Fang, N, Yu, S & Badger, TM 2003, 'Characterization of triterpene alcohol and sterol ferulates in rice bran using LC-MS/MS', J Agric Food Chem, vol. 51, no. 11, May 21, pp. 3260-7.
![Page 189: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/189.jpg)
172
Fasahat, P, Abdullah, A, Muhammad, K, Karupaiah, T & Ratnam, W 2012, 'Red pericarp advanced breeding lines derived from Oryza rufipogon × Oryza sativa: physicochemical properties, total antioxidant activity, phenolic compounds and vitamin E content', Advance Journal of Food Science & Technology, vol. 4, no. 3, pp. 155-165.
Finocchiaro, F, Ferrari, B, Gianinetti, A, Dall'asta, C, Galaverna, G, Scazzina, F & Pellegrini, N 2007, 'Characterization of antioxidant compounds of red and white rice and changes in total antioxidant capacity during processing', Mol Nutr Food Res, vol. 51, no. 8, Aug, pp. 1006-19.
Fleury, C, Mignotte, B & Vayssiere, JL 2002, 'Mitochondrial reactive oxygen species in cell death signaling', Biochimie, vol. 84, no. 2-3, Feb-Mar, pp. 131-41.
Folin, O & Ciocalteu, V 1927, 'On tyrosine and tryptophan determinations in proteins', The Journal of Biological Chemistry, vol. 73, pp. 627-650.
Forycki, ZF 2010, 'Dietary Lipids and Coronary Heart Disease', in Chemical, Biological, and Functional Aspects of Food Lipids, Second Edition, CRC Press, pp. 211-226.
Fujita, A, Fujitake, H, Kawakami, K & Nomura, M 2010, 'Antioxidant activity of colored rice bran obtained at different milling yields', J Oleo Sci, vol. 59, no. 10, pp. 563-8.
Fulda, S, Gorman, AM, Hori, O & Samali, A 2010, 'Cellular Stress Responses: Cell Survival and Cell Death', International Journal of Cell Biology, vol. 2010, p. 23.
Fuleki, T & Francis, FJ 1968, 'Quantitative Methods for Anthocyanins', Journal of Food Science, vol. 33, no. 1, pp. 78-83.
Gaetani, GF, Ferraris, AM, Rolfo, M, Mangerini, R, Arena, S & Kirkman, HN 1996, 'Predominant role of catalase in the disposal of hydrogen peroxide within human erythrocytes', Blood, vol. 87, no. 4, Feb 15, pp. 1595-9.
Garcia-Lafuente, A, Guillamon, E, Villares, A, Rostagno, MA & Martinez, JA 2009, 'Flavonoids as anti-inflammatory agents: implications in cancer and cardiovascular disease', Inflamm Res, vol. 58, no. 9, Sep, pp. 537-52.
Gaspar, J, Rodrigues, A, Laires, A, Silva, F, Costa, S, Monteiro, MJ, Monteiro, C & Rueff, J 1994, 'On the mechanisms of genotoxicity and metabolism of quercetin', Mutagenesis, vol. 9, no. 5, Sep, pp. 445-9.
Gerhardt, AL & Gallo, NB 1998, 'Full-fat rice bran and oat bran similarly reduce hypercholesterolemia in humans', J Nutr, vol. 128, no. 5, May, pp. 865-9.
Ghasemzadeh, A, Jaafar, H, Juraimi, A & Tayebi-Meigooni, A 2015, 'Comparative Evaluation of Different Extraction Techniques and Solvents for the Assay of Phytochemicals and Antioxidant Activity of Hashemi Rice Bran', Molecules, vol. 20, no. 6, p. 10822.
![Page 190: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/190.jpg)
173
Ghatak, S & Panchal, S 2012, 'Anti-diabetic activity of oryzanol and its relationship with the anti-oxidant property', International Journal of Diabetes in Developing Countries, vol. 32, no. 4, 2012/12/01, pp. 185-192.
Giusti, MM & Wrolstad, RE 2001, 'Characterization and Measurement of Anthocyanins by UV-Visible Spectroscopy', in Current Protocols in Food Analytical Chemistry, John Wiley & Sons, Inc.
Goffman, F & Bergman, C 2004, 'Rice Kernel phenolic content and its relationship with antiradical efficiency', J Sci Food Agric, vol. 84, pp. 1235 - 1240.
Goldstein, JL, Ho, YK, Basu, SK & Brown, MS 1979, 'Binding site on macrophages that mediates uptake and degradation of acetylated low density lipoprotein, producing massive cholesterol deposition', Proceedings of the National Academy of Sciences, vol. 76, no. 1, January 1, 1979, pp. 333-337.
Goufo, P, Ferreira, LMM, Trindade, H & Rosa, EAS 2014a, 'Distribution of antioxidant compounds in the grain of the Mediterranean rice variety ‘Ariete’', CyTA - Journal of Food, vol. 13, no. 1, 2015/01/02, pp. 140-150.
Goufo, P, Pereira, J, Moutinho-Pereira, J, Correia, CM, Figueiredo, N, Carranca, C, Rosa, EAS & Trindade, H 2014b, 'Rice (Oryza sativa L.) phenolic compounds under elevated carbon dioxide (CO2) concentration', Environmental and Experimental Botany, vol. 99, no. 0, 3//, pp. 28-37.
Goufo, P & Trindade, H 2014, 'Rice antioxidants: phenolic acids, flavonoids, anthocyanins, proanthocyanidins, tocopherols, tocotrienols, gamma-oryzanol, and phytic acid', Food Sci Nutr, vol. 2, no. 2, Mar, pp. 75-104.
Grebenstein, N & Frank, J 2012, 'Rapid baseline-separation of all eight tocopherols and tocotrienols by reversed-phase liquid-chromatography with a solid-core pentafluorophenyl column and their sensitive quantification in plasma and liver', J Chromatogr A, vol. 1243, Jun 22, pp. 39-46.
Gunaratne, A, Wu, K, Li, D, Bentota, A, Corke, H & Cai, Y-Z 2013, 'Antioxidant activity and nutritional quality of traditional red-grained rice varieties containing proanthocyanidins', Food Chemistry, vol. 138, no. 2–3, 6/1/, pp. 1153-1161.
Gupta, A, Naraniwal, M & Kothari, V 2012, 'Modern extraction methods for preparation of bioactive plant extracts', International Academy of Science, Engineering and Technology, vol. 1, no. 1, pp. 8-26.
Ha, T-Y, Ko, S-N, Lee, S-M, Kim, H-R, Chung, S-H, Kim, S-R, Yoon, H-H & Kim, I-H 2006, 'Changes in nutraceutical lipid components of rice at different degrees of milling', European Journal of Lipid Science and Technology, vol. 108, no. 3, pp. 175-181.
Halliwell, B 2009, 'The wanderings of a free radical', Free Radic Biol Med, vol. 46, no. 5, Mar 1, pp. 531-42.
![Page 191: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/191.jpg)
174
Hausenloy, DJ & Yellon, DM 2008, 'Time to take myocardial reperfusion injury seriously', N Engl J Med, vol. 359, no. 5, Jul 31, pp. 518-20.
Havlíková, L & Míková, K 1985, 'Heat Stability of Anthocyanins', Zeitschrift für Lebensmittel-Untersuchung und Forschung, vol. 181, no. 5, 1985/11/01, pp. 427-432.
He, F, Liang, N-N, Mu, L, Pan, Q-H, Wang, J, Reeves, MJ & Duan, C-Q 2012, 'Anthocyanins and Their Variation in Red Wines I. Monomeric Anthocyanins and Their Color Expression', Molecules, vol. 17, no. 2, pp. 1571-1601.
Helmut, S 1994, 'Oxidative Stress', in Trace Elements and Free Radicals in Oxidative Diseases, AOCS Publishing, pp. 1-7.
Henderson, AJ, Ollila, CA, Kumar, A, Borresen, EC, Raina, K, Agarwal, R & Ryan, EP 2012, 'Chemopreventive properties of dietary rice bran: current status and future prospects', Adv Nutr, vol. 3, no. 5, pp. 643-53.
Henryk, Z 2008, 'Tocotrienols', in Tocotrienols, CRC Press, pp. 23-42.
Heo, HJ, Choi, SJ, Choi, SG, Shin, DH, Lee, JM & Lee, CY 2008, 'Effects of banana, orange, and apple on oxidative stress-induced neurotoxicity in PC12 cells', J Food Sci, vol. 73, no. 2, Mar, pp. H28-32.
Herald, TJ, Gadgil, P & Tilley, M 2012, 'High-throughput micro plate assays for screening flavonoid content and DPPH-scavenging activity in sorghum bran and flour', Journal of the Science of Food and Agriculture, vol. 92, no. 11, pp. 2326-2331.
Heuberger, AL, Lewis, MR, Chen, M-H, Brick, MA, Leach, JE & Ryan, EP 2010, 'Metabolomic and Functional Genomic Analyses Reveal Varietal Differences in Bioactive Compounds of Cooked Rice', PLoS ONE, vol. 5, no. 9, p. e12915.
Hirose, M, Takesada, Y, Tanaka, H, Tamano, S, Kato, T & Shirai, T 1998, 'Carcinogenicity of antioxidants BHA, caffeic acid, sesamol, 4-methoxyphenol and catechol at low doses, either alone or in combination, and modulation of their effects in a rat medium-term multi-organ carcinogenesis model', Carcinogenesis, vol. 19, no. 1, Jan, pp. 207-12.
Hodnick, WF, Kung, FS, Roettger, WJ, Bohmont, CW & Pardini, RS 1986, 'Inhibition of mitochondrial respiration and production of toxic oxygen radicals by flavonoids. A structure-activity study', Biochem Pharmacol, vol. 35, no. 14, Jul 15, pp. 2345-57.
Hoffman, DL & Brookes, PS 2009, 'Oxygen sensitivity of mitochondrial reactive oxygen species generation depends on metabolic conditions', J Biol Chem, vol. 284, no. 24, Jun 12, pp. 16236-45.
Hori, M & Nishida, K 2009, Oxidative stress and left ventricular remodelling after myocardial infarction.
![Page 192: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/192.jpg)
175
Hou, Z, Qin, P, Zhang, Y, Cui, S & Ren, G 2013, 'Identification of anthocyanins isolated from black rice (Oryza sativa L.) and their degradation kinetics', Food Research International, vol. 50, no. 2, 3//, pp. 691-697.
Hsieh, TC & Wu, JM 2008, 'Suppression of cell proliferation and gene expression by combinatorial synergy of EGCG, resveratrol and gamma-tocotrienol in estrogen receptor-positive MCF-7 breast cancer cells', Int J Oncol, vol. 33, no. 4, Oct, pp. 851-9.
Hu, C, Zawistowski, J, Ling, W & Kitts, DD 2003, 'Black rice (Oryza sativa L. indica) pigmented fraction suppresses both reactive oxygen species and nitric oxide in chemical and biological model systems', J Agric Food Chem, vol. 51, no. 18, Aug 27, pp. 5271-7.
Huang, S-H & Ng, L-T 2012, 'Quantification of polyphenolic content and bioactive constituents of some commercial rice varieties in Taiwan', Journal of Food Composition and Analysis, vol. 26, no. 1–2, 5//, pp. 122-127.
Hudson, EA, Dinh, PA, Kokubun, T, Simmonds, MSJ & Gescher, A 2000, 'Characterization of Potentially Chemopreventive Phenols in Extracts of Brown Rice That Inhibit the Growth of Human Breast and Colon Cancer Cells', Cancer Epidemiology Biomarkers & Prevention, vol. 9, no. 11, November 1, 2000, pp. 1163-1170.
Hundemer, JK, Nabar, SP, Shriver, BJ & Forman, LP 1991, 'Dietary fiber sources lower blood cholesterol in C57BL/6 mice', J Nutr, vol. 121, no. 9, Sep, pp. 1360-5.
Iloki Assanga, SB, Gil-Salido, AA, Lewis Luján, LM, Rosas-Durazo, A, Acosta-Silva, AL, Rivera-Castañeda, EG & Rubio-Pino, JL 2013, 'Cell growth curves for different cell lines and their relationship with biological activities', International Journal of Biotechnology and Molecular Biology Research, vol. 4, no. 4, pp. 60-70.
Imai, H & Nakagawa, Y 2003, 'Biological significance of phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4) in mammalian cells', Free Radic Biol Med, vol. 34, no. 2, Jan 15, pp. 145-69.
Irwin, MW, Mak, S, Mann, DL, Qu, R, Penninger, JM, Yan, A, Dawood, F, Wen, WH, Shou, Z & Liu, P 1999, 'Tissue expression and immunolocalization of tumor necrosis factor-alpha in postinfarction dysfunctional myocardium', Circulation, vol. 99, no. 11, Mar 23, pp. 1492-8.
Islam, MS, Matsuki, N, Nagasaka, R, Ohara, K, Takamitsu, H, Ozaki, H, Ushio, H & Hori, M 2014, 'Chapter 34 - Rice Bran Antioxidants in Health and Wellness', in RRWRP Zibadi (ed.) Wheat and Rice in Disease Prevention and Health, Academic Press, San Diego, pp. 443-451.
![Page 193: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/193.jpg)
176
Islam, MS, Murata, T, Fujisawa, M, Nagasaka, R, Ushio, H, Bari, AM, Hori, M & Ozaki, H 2008, 'Anti-inflammatory effects of phytosteryl ferulates in colitis induced by dextran sulphate sodium in mice', Br J Pharmacol, vol. 154, no. 4, Jun, pp. 812-24.
Ito, N, Fukushima, S, Hagiwara, A, Shibata, M & Ogiso, T 1983, 'Carcinogenicity of butylated hydroxyanisole in F344 rats', J Natl Cancer Inst, vol. 70, no. 2, Feb, pp. 343-52.
Ito, N, Fukushima, S & Tsuda, H 1985, 'Carcinogenicity and modification of the carcinogenic response by BHA, BHT, and other antioxidants', Crit Rev Toxicol, vol. 15, no. 2, pp. 109-50.
Jariwalla, RJ 2001, 'Rice-bran products: phytonutrients with potential applications in preventive and clinical medicine', Drugs Exp Clin Res, vol. 27, no. 1, pp. 17-26.
Javadov, S & Karmazyn, M 2007, 'Mitochondrial permeability transition pore opening as an endpoint to initiate cell death and as a putative target for cardioprotection', Cell Physiol Biochem, vol. 20, no. 1-4, pp. 1-22.
Jeng, TL, Shih, YJ, Ho, PT, Lai, CC, Lin, YW, Wang, CS & Sung, JM 2012, 'gamma-Oryzanol, tocol and mineral compositions in different grain fractions of giant embryo rice mutants', J Sci Food Agric, vol. 92, no. 7, May, pp. 1468-74.
Jewett, SL, Rocklin, AM, Ghanevati, M, Abel, JM & Marach, JA 1999, 'A new look at a time-worn system: oxidation of CuZn-SOD by H2O2', Free Radic Biol Med, vol. 26, no. 7-8, Apr, pp. 905-18.
Jia, Z, Tang, M & Wu, J 1999, 'The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals', Food Chemistry, vol. 64, no. 4, 3//, pp. 555-559.
Jiang, J, Yu, S, Jiang, Z, Liang, C, Yu, W, Li, J, Du, X, Wang, H, Gao, X & Wang, X 2014, 'N-Acetyl-Serotonin Protects HepG2 Cells from Oxidative Stress Injury Induced by Hydrogen Peroxide', Oxidative Medicine and Cellular Longevity, vol. 2014, p. 15.
Jin Son, M, W. Rico, C, Hyun Nam, S & Young Kang, M 2010, 'Influence of Oryzanol and Ferulic Acid on the Lipid Metabolism and Antioxidative Status in High Fat-Fed Mice', Journal of Clinical Biochemistry and Nutrition, vol. 46, no. 2, pp. 150-156.
Juliano, C, Cossu, M, Alamanni, MC & Piu, L 2005, 'Antioxidant activity of gamma-oryzanol: mechanism of action and its effect on oxidative stability of pharmaceutical oils', Int J Pharm, vol. 299, no. 1-2, Aug 11, pp. 146-54.
![Page 194: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/194.jpg)
177
Justo, ML, Candiracci, M, Dantas, AP, de Sotomayor, MA, Parrado, J, Vila, E, Herrera, MD & Rodriguez-Rodriguez, R 2013, 'Rice bran enzymatic extract restores endothelial function and vascular contractility in obese rats by reducing vascular inflammation and oxidative stress', The Journal of Nutritional Biochemistry, vol. 24, no. 8, 8//, pp. 1453-1461.
Kamal-Eldi, A, Gorgen, S, Pettersson, J & Lampi, AM 2000, 'Normal-phase high-performance liquid chromatography of tocopherols and tocotrienols. Comparison of different chromatographic columns', J Chromatogr A, vol. 881, no. 1-2, Jun 9, pp. 217-27.
Kamaraj, S, Vinodhkumar, R, Anandakumar, P, Jagan, S, Ramakrishnan, G & Devaki, T 2007, 'The effects of quercetin on antioxidant status and tumor markers in the lung and serum of mice treated with benzo(a)pyrene', Biol Pharm Bull, vol. 30, no. 12, Dec, pp. 2268-73.
Kaneko, R & Tsuchiya, T 1954, 'New compound in rice bran and germ oils', Journal of Chemistry Society of Japan, vol. 57, p. 526.
Kang, DH & Kang, SW 2013, 'Targeting Cellular Antioxidant Enzymes for Treating Atherosclerotic Vascular Disease', Biomolecules & Therapeutics, vol. 21, no. 2, 3 December, pp. 89-96.
Kashiwagi, K, Harada, K, Yano, Y, Kumadaki, I, Hagiwara, K, Takebayashi, J, Kido, W, Virgona, N & Yano, T 2008, 'A redox-silent analogue of tocotrienol inhibits hypoxic adaptation of lung cancer cells', Biochemical and Biophysical Research Communications, vol. 365, no. 4, pp. 875-881.
Kedare, SB & Singh, RP 2011, 'Genesis and development of DPPH method of antioxidant assay', Journal of food science and technology, vol. 48, no. 4, pp. 412-422.
Kiing, SC, Yiu, PH, Rajan, A & Wong, SC 2009, 'Effect of germination on γ-oryzanol content of selected Sarawak rice cultivars', American Journal of Applied Science, vol. 6, no. 9, pp. 1658-1661.
Kim, J-S & Godber, JS 2001, 'Oxidative stability and vitamin E levels increased in restructed beef roasts with added rice bran oil ', Journal of Food Quality, vol. 24, no. 1, pp. 17-26.
Kim, JK, Lee, SY, Chu, SM, Lim, SH, Suh, SC, Lee, YT, Cho, HS & Ha, SH 2010, 'Variation and correlation analysis of flavonoids and carotenoids in Korean pigmented rice (Oryza sativa L.) cultivars', J Agric Food Chem, vol. 58, no. 24, Dec 22, pp. 12804-9.
Kim, SP, Kang, MY, Nam, SH & Friedman, M 2012, 'Dietary rice bran component gamma-oryzanol inhibits tumor growth in tumor-bearing mice', Mol Nutr Food Res, vol. 56, no. 6, Jun, pp. 935-44.
![Page 195: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/195.jpg)
178
Kohen, R & Nyska, A 2002, 'Oxidation of biological systems: oxidative stress phenomena, antioxidants, redox reactions, and methods for their quantification', Toxicol Pathol, vol. 30, no. 6, Nov-Dec, pp. 620-50.
Kokoszka, JE, Coskun, P, Esposito, LA & Wallace, DC 2001, 'Increased mitochondrial oxidative stress in the Sod2 (1y2) mouse results in the age-related decline of mitochondrial function culminating in increased apoptosis', Proceedings of the National Academy of Sciences, vol. 98, no. 5, pp. 2278-2283.
Kozuka, C, Yabiku, K, Sunagawa, S, Ueda, R, Taira, S, Ohshiro, H, Ikema, T, Yamakawa, K, Higa, M, Tanaka, H, Takayama, C, Matsushita, M, Oyadomari, S, Shimabukuro, M & Masuzaki, H 2012, 'Brown rice and its component, gamma-oryzanol, attenuate the preference for high-fat diet by decreasing hypothalamic endoplasmic reticulum stress in mice', Diabetes, vol. 61, no. 12, Dec, pp. 3084-93.
Kozuka, C, Yabiku, K, Takayama, C, Matsushita, M, Shimabukuro, M & Masuzaki, H 2013, 'Natural food science based novel approach toward prevention and treatment of obesity and type 2 diabetes: Recent studies on brown rice and γ-oryzanol', Obesity Research & Clinical Practice, vol. 7, no. 3, 5//, pp. e165-e172.
Krishnamurthy, P & Wadhwani, A 2012, in Antioxidant Enzymes and Human Health(ed MA El-Missiry) InTech, Croatia.
Kuhad, A & Chopra, K 2009, 'Attenuation of diabetic nephropathy by tocotrienol: Involvement of NFkB signaling pathway', Life Sciences, vol. 84, no. 9–10, pp. 296-301.
Kunwar, A & Priyadarsini, KI 2011, 'Free radicals, oxidative stress and importance of antioxidants in human health', Journal of Medical and Allied Sciences, vol. 1, no. 2, pp. 53-60.
Lambert, JD & Elias, RJ 2010, 'The antioxidant and pro-oxidant activities of green tea polyphenols: a role in cancer prevention', Arch Biochem Biophys, vol. 501, no. 1, Sep 1, pp. 65-72.
Lee, JM 2005, 'Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: collaborative study', Journal of AOAC International, vol. 88, no. 5, pp. 1269-1278.
Lee, S-M, Choi, Y, Sung, J, Kim, Y, Jeong, H-S & Lee, J 2014, 'Protective Effects of Black Rice Extracts on Oxidative Stress Induced by tert-Butyl Hydroperoxide in HepG2 Cells', Preventive Nutrition and Food Science, vol. 19, no. 4, 31 October, pp. 348-352.
![Page 196: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/196.jpg)
179
Lee, S-P, Mar, G-Y & Ng, L-T 2009, 'Effects of tocotrienol-rich fraction on exercise endurance capacity and oxidative stress in forced swimming rats', European Journal of Applied Physiology, vol. 107, no. 5, 2009/11/01, pp. 587-595.
Lee, S, Tak, E, Lee, J, Rashid, MA, Murphy, MP, Ha, J & Kim, SS 2011, 'Mitochondrial H(2)O(2) generated from electron transport chain complex I stimulates muscle differentiation', Cell Research, vol. 21, no. 5, 20 October, pp. 817-834.
Lemus, C, Angelis, A, Halabalaki, M & Skaltsounis, AL 2014, 'Chapter 32 - γ-Oryzanol: An Attractive Bioactive Component from Rice Bran', in RR Watson, VR Preedy and S Zibadi (eds), Wheat and Rice in Disease Prevention and Health, Academic Press, San Diego, pp. 409-430.
Leone, M, Cupane, A, Militello, V, Stroppolo, ME & Desideri, A 1998, 'Fourier Transform Infrared Analysis of the Interaction of Azide with the Active Site of Oxidized and Reduced Bovine Cu,Zn Superoxide Dismutase', Biochemistry, vol. 37, no. 13, 1998/03/01, pp. 4459-4464.
Lester, GE, Lewers, KS, Medina, MB & Saftner, RA 2012, 'Comparative analysis of strawberry total phenolics via Fast Blue BB vs. Folin–Ciocalteu: Assay interference by ascorbic acid', Journal of Food Composition and Analysis, vol. 27, no. 1, 8//, pp. 102-107.
Li, H, Deng, Z, Liu, R, Loewen, S & Tsao, R 2013, 'Carotenoid compositions of coloured tomato cultivars and contribution to antioxidant activities and protection against H2O2-induced cell death in H9c2', Food Chemistry, vol. 136, no. 2, 1/15/, pp. 878-888.
Li, Y & Schellhorn, HE 2007, 'New developments and novel therapeutic perspectives for vitamin C', J Nutr, vol. 137, no. 10, Oct, pp. 2171-84.
Lieberthal, W, Menza, SA & Levine, JS 1998, 'Graded ATP depletion can cause necrosis or apoptosis of cultured mouse proximal tubular cells', Am J Physiol, vol. 274, no. 2 Pt 2, Feb, pp. F315-27.
Ling, WH, Cheng, QX, Ma, J & Wang, T 2001, 'Red and Black Rice Decrease Atherosclerotic Plaque Formation and Increase Antioxidant Status in Rabbits', The Journal of Nutrition, vol. 131, no. 5, May 1, 2001, pp. 1421-1426.
Lip, GYH & Hall, JE 2007, Comprehensive Hypertension, Elsevier Health Sciences.
Litwack, G 2007, Vitamin E, Elsevier Science.
Liva, H 2008, 'Tocotrienols in Plants', in Tocotrienols, CRC Press, pp. 43-60.
Lönn, ME, Dennis, JM & Stocker, R 2012, 'Actions of “antioxidants” in the protection against atherosclerosis', Free Radical Biology and Medicine, vol. 53, no. 4, pp. 863-884.
![Page 197: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/197.jpg)
180
Luqman, S & Rizvi, SI 2006, 'Protection of lipid peroxidation and carbonyl formation in proteins by capsaicin in human erythrocytes subjected to oxidative stress', Phytother Res, vol. 20, no. 4, Apr, pp. 303-6.
Lusis, AJ 2000, 'Atherosclerosis', Nature, vol. 407, no. 6801, 09/14/print, pp. 233-241.
Ma, X, Zhang, K, Li, H, Han, S, Ma, Z & Tu, P 2013, 'Extracts from Astragalus membranaceus limit myocardial cell death and improve cardiac function in a rat model of myocardial ischemia', Journal of Ethnopharmacology, vol. 149, no. 3, 10/7/, pp. 720-728.
Magalhaes, AS, Silva, BM, Pereira, JA, Andrade, PB, Valentao, P & Carvalho, M 2009, 'Protective effect of quince (Cydonia oblonga Miller) fruit against oxidative hemolysis of human erythrocytes', Food Chem Toxicol, vol. 47, no. 6, Jun, pp. 1372-7.
Makino, N, Mochizuki, Y, Bannai, S & Sugita, Y 1994, 'Kinetic studies on the removal of extracellular hydrogen peroxide by cultured fibroblasts', Journal of Biological Chemistry, vol. 269, no. 2, January 14, 1994, pp. 1020-5.
Malta, LG & Liu, RH 2014, 'Analyses of Total Phenolics, Total Flavonoids, and Total Antioxidant Activities in Foods and Dietary Supplements', in NKV Alfen (ed.) Encyclopedia of Agriculture and Food Systems, Academic Press, Oxford, pp. 305-314.
Manach, C, Scalbert, A, Morand, C, Rémésy, C & Jiménez, L 2004, 'Polyphenols: food sources and bioavailability', The American Journal of Clinical Nutrition, vol. 79, no. 5, May 1, 2004, pp. 727-747.
Markus, MA & Morris, BJ 2008, 'Resveratrol in prevention and treatment of common clinical conditions of aging', Clin Interv Aging, vol. 3, no. 2, pp. 331-9.
Matsui, T, Ebuchi, S, Kobayashi, M, Fukui, K, Sugita, K, Terahara, N & Matsumoto, K 2002, 'Anti-hyperglycemic effect of diacylated anthocyanin derived from Ipomoea batatas cultivar Ayamurasaki can be achieved through the alpha-glucosidase inhibitory action', J Agric Food Chem, vol. 50, no. 25, Dec 4, pp. 7244-8.
McBride, AG, Borutaite, V & Brown, GC 1999, 'Superoxide dismutase and hydrogen peroxide cause rapid nitric oxide breakdown, peroxynitrite production and subsequent cell death', Biochim Biophys Acta, vol. 1454, no. 3, Aug 30, pp. 275-88.
Meier, B, Scherk, C, Schmidt, M & Parak, F 1998, 'pH-dependent inhibition by azide and fluoride of the iron superoxide dismutase from Propionibacterium shermanii', Biochemical Journal, vol. 331, pp. 403-407.
![Page 198: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/198.jpg)
181
Metodiewa, D, Jaiswal, AK, Cenas, N, Dickancaite, E & Segura-Aguilar, J 1999, 'Quercetin may act as a cytotoxic prooxidant after its metabolic activation to semiquinone and quinoidal product', Free Radic Biol Med, vol. 26, no. 1-2, Jan, pp. 107-16.
Meyer, ABS & Meyer, ABS 2005, 'Enzymatic upgrading of antioxidant phenolics in berry juice and in press residues', Fruit Processing, vol. 6, pp. 382-387.
Miller, A & Engel, KH 2006, 'Content of gamma-oryzanol and composition of steryl ferulates in brown rice (Oryza sativa L.) of European origin', J Agric Food Chem, vol. 54, no. 21, Oct 18, pp. 8127-33.
Miller, A, Frenzel, T, Schmarr, HG & Engel, KH 2003, 'Coupled liquid chromatography-gas chromatography for the rapid analysis of gamma-oryzanol in rice lipids', J Chromatogr A, vol. 985, no. 1-2, Jan 24, pp. 403-10.
Milne, JC, Lambert, PD, Schenk, S, Carney, DP, Smith, JJ, Gagne, DJ, Jin, L, Boss, O, Perni, RB, Vu, CB, Bemis, JE, Xie, R, Disch, JS, Ng, PY, Nunes, JJ, Lynch, AV, Yang, H, Galonek, H, Israelian, K, Choy, W, Iffland, A, Lavu, S, Medvedik, O, Sinclair, DA, Olefsky, JM, Jirousek, MR, Elliott, PJ & Westphal, CH 2007, 'Small molecule activators of SIRT1 as therapeutics for the treatment of type 2 diabetes', Nature, vol. 450, no. 7170, Nov 29, pp. 712-6.
Min, B, McClung, AM & Chen, MH 2011, 'Phytochemicals and antioxidant capacities in rice brans of different color', J Food Sci, vol. 76, no. 1, Jan-Feb, pp. C117-26.
Mireia, U-S, Joseph, R, Christine, M & Claudine, M 2012, 'Bioavailability of Flavanones', in Flavonoids and Related Compounds, CRC Press.
Mohanlal, S, Parvathy, R, Shalini, V, Mohanan, R, Helen, A & Jayalekshmy, A 2013, 'Chemical indices, antioxidant activity and anti-inflammatory effect of extracts of the medicinal rice "Njavara" and staple varieties: a comparative study ', Journal of Food Biochemistry, vol. 37, no. 3, pp. 369-380.
Morais, H, Ramos, C, Forgasc, E, Cserháti, T, Matos, N, Almeida, V & Oliveira, J 2002, 'Stability of anthocyanins extracted from grape skins', Chromatographia, vol. 56, no. 1, 2002/01/01, pp. S173-S175.
Moreno, AO, Dorantes, L, Galindez, J & Guzman, RI 2003, 'Effect of different extraction methods on fatty acids, volatile compounds, and physical and chemical properties of avocado (Persea americana Mill.) oil', J Agric Food Chem, vol. 51, no. 8, Apr 9, pp. 2216-21.
Most, MM, Tulley, R, Morales, S & Lefevre, M 2005, 'Rice bran oil, not fiber, lowers cholesterol in humans', Am J Clin Nutr, vol. 81, no. 1, Jan, pp. 64-8.
Muid, S, Ali, AM, Yusoff, K & Nawawi, H 2013, 'Optimal antioxidant activity with moderate concentrations of tocotrienol rich fraction (TRF) in in vitro assays', International Food Research Journal, vol. 20, no. 2, pp. 687-694.
![Page 199: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/199.jpg)
182
Mukhopadhyay, M 2000, 'Natural Antioxidants', in Natural Extracts Using Supercritical Carbon Dioxide, CRC Press, pp. 225-248.
Muntana, N & Prasong, S 2010, 'Study on total phenolic contents and their antioxidant activities of Thai white, red and black rice bran extracts', Pak J Biol Sci, vol. 13, no. 4, Feb 15, pp. 170-4.
Nagendra Prasad, M, Sanjay, K, Shravya Khatokar, M, Vismaya, M & Nanjunda Swamy, S 2011, 'Health Benefits of Rice Bran - A Review', Journal of Nutrition & Food Sciences, 2011 Sep 22
Naidu, KA 2003, 'Vitamin C in human health and disease is still a mystery? An overview', Nutr J, vol. 2, Aug 21, p. 7.
Nanua, JN, McGregor, JU & Godber, JS 2000, 'Influence of high-oryzanol rice bran oil on the oxidative stability of whole milk powder', J Dairy Sci, vol. 83, no. 11, Nov, pp. 2426-31.
Navindra, PS 2010, 'Polyphenols Overview', in Encyclopedia of Dietary Supplements, Second Edition, CRC Press, pp. 632-634.
Newaz, MA & Nawal, NN 1999, 'Effect of gamma-tocotrienol on blood pressure, lipid peroxidation and total antioxidant status in spontaneously hypertensive rats (SHR)', Clin Exp Hypertens, vol. 21, no. 8, Nov, pp. 1297-313.
Nian, M, Lee, P, Khaper, N & Liu, P 2004, 'Inflammatory cytokines and postmyocardial infarction remodeling', Circ Res, vol. 94, no. 12, Jun 25, pp. 1543-53.
Nindl, G, Peterson, NR, Hughes, EF, Waite, LR & Johnson, MT 2004, 'Effect of hydrogen peroxide on proliferation, apoptosis and interleukin-2 production of Jurkat T cells', Biomed Sci Instrum, vol. 40, pp. 123-8.
Nishikawa, M, Tamada, A, Kumai, H, Yamashita, F & Hashida, M 2002, 'Inhibition of experimental pulmonary metastasis by controlling biodistribution of catalase in mice', Int J Cancer, vol. 99, no. 3, May 20, pp. 474-9.
Noaman, E, Badr El-Din, NK, Bibars, MA, Abou Mossallam, AA & Ghoneum, M 2008, 'Antioxidant potential by arabinoxylan rice bran, MGN-3/biobran, represents a mechanism for its oncostatic effect against murine solid Ehrlich carcinoma', Cancer Lett, vol. 268, no. 2, Sep 18, pp. 348-59.
Noori, S 2012, 'An overview of oxidative stress and antioxidant defensive system', Open Access Scientific Reports, vol. 1, no. 8
Ondier, GO, Siebenmorgen, T & Mauromoustakos, A 2012, 'Drying Characteristics and Milling Quality of Rough Rice Dried in a Single Pass Incorporating Glass Transition Principles', Drying Technology, vol. 30, no. 16, 2012/12/15, pp. 1821-1830.
![Page 200: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/200.jpg)
183
Pandey, KB & Rizvi, SI 2009, 'Plant polyphenols as dietary antioxidants in human health and disease', Oxid Med Cell Longev, vol. 2, no. 5, Nov-Dec, pp. 270-8.
Pandey, KB & Rizvi, SI 2010, 'Protective effect of resveratrol on markers of oxidative stress in human erythrocytes subjected to in vitro oxidative insult', Phytother Res, vol. 24 Suppl 1, Jan, pp. S11-4.
Panfili, G, Fratianni, A & Irano, M 2003, 'Normal phase high-performance liquid chromatography method for the determination of tocopherols and tocotrienols in cereals', J Agric Food Chem, vol. 51, no. 14, Jul 2, pp. 3940-4.
Papa, L, Hahn, M, Marsh, EL, Evans, BS & Germain, D 2014, 'SOD2 to SOD1 switch in breast cancer', Journal of Biological Chemistry, January 21, 2014
Parvathy, R, Mohanlal, S, Pushpan, C, Helen, A & Jayalekshmy, A 2014, 'Antioxidant properties, anti-inflammatory effects, and bioactive constituents of the Indian medicinal rice Njavara yellow compared with staple varieties', Food Science and Biotechnology, vol. 23, no. 5, 2014/10/01, pp. 1379-1388.
Pękal, A & Pyrzynska, K 2014, 'Evaluation of Aluminium Complexation Reaction for Flavonoid Content Assay', Food Analytical Methods, vol. 7, no. 9, 2014/10/01, pp. 1776-1782.
Pellegrini, N, Serafini, M, Salvatore, S, Del Rio, D, Bianchi, M & Brighenti, F 2006, 'Total antioxidant capacity of spices, dried fruits, nuts, pulses, cereals and sweets consumed in Italy assessed by three different in vitro assays', Mol Nutr Food Res, vol. 50, no. 11, Nov, pp. 1030-8.
Pham-Huy, LA, He, H & Pham-Huy, C 2008, 'Free Radicals, Antioxidants in Disease and Health', International Journal of Biomedical Science : IJBS, vol. 4, no. 2, 5 May, pp. 89-96.
Pietta, P-G 2000, 'Flavonoids as Antioxidants', Journal of Natural Products, vol. 63, no. 7, 2000/07/01, pp. 1035-1042.
Pirola, L & Frojdo, S 2008, 'Resveratrol: one molecule, many targets', IUBMB Life, vol. 60, no. 5, May, pp. 323-32.
Pisoschi, AM, Cheregi, MC & Danet, AF 2009, 'Total antioxidant capacity of some commercial fruit juices: electrochemical and spectrophotometrical approaches', Molecules, vol. 14, no. 1, pp. 480-93.
Pyrzynska, K & Pekal, A 2013, 'Application of free radical diphenylpicrylhydrazyl (DPPH) to estimate the antioxidant capacity of food samples', Analytical Methods, vol. 5, no. 17, pp. 4288-4295.
Qiagen 2011, 'QuantiFast® SYBR® Green RT-PCR Handbook ', For fast, quantitative, real-time, one-step RT-PCR using SYBR Green I
![Page 201: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/201.jpg)
184
Quillard, T & Libby, P 2012a, 'Molecular imaging of atherosclerosis for improving diagnostic and therapeutic development' National Center for Biotechnology Information, U.S. National Library of Medicine, viewed 21 April 2015, <http://circres.ahajournals.org/content/111/2/231.long>.
Quillard, T & Libby, P 2012b, 'Molecular Imaging of Atherosclerosis for Improving Diagnostic and Therapeutic Development', Circulation Research, vol. 111, no. 2, July 6, 2012, pp. 231-244.
Qureshi, AA, Bradlow, BA, Brace, L, Manganello, J, Peterson, DM, Pearce, BC, Wright, JJ, Gapor, A & Elson, CE 1995, 'Response of hypercholesterolemic subjects to administration of tocotrienols', Lipids, vol. 30, no. 12, Dec, pp. 1171-7.
Qureshi, AA, Burger, WC, Peterson, DM & Elson, CE 1986, 'The structure of an inhibitor of cholesterol biosynthesis isolated from barley', J Biol Chem, vol. 261, no. 23, Aug 15, pp. 10544-50.
Qureshi, AA, Mo, H, Packer, L & Peterson, DM 2000, 'Isolation and identification of novel tocotrienols from rice bran with hypocholesterolemic, antioxidant, and antitumor properties', J Agric Food Chem, vol. 48, no. 8, Aug, pp. 3130-40.
Qureshi, AA, Qureshi, N, Hasler-Rapacz, JO, Weber, FE, Chaudhary, V, Crenshaw, TD, Gapor, A, Ong, AS, Chong, YH & Peterson, D 1991, 'Dietary tocotrienols reduce concentrations of plasma cholesterol, apolipoprotein B, thromboxane B2, and platelet factor 4 in pigs with inherited hyperlipidemias', The American Journal of Clinical Nutrition, vol. 53, no. 4, April 1, 1991, pp. 1042S-1046S.
Radi, R, Rodriguez, M, Castro, L & Telleri, R 1994, 'Inhibition of mitochondrial electron transport by peroxynitrite', Arch Biochem Biophys, vol. 308, no. 1, Jan, pp. 89-95.
Randall, JM, Sayre, RN, Schultz, WG, Fong, RY, Mossman, AP, Tribelhorn, RE & Saunders, RM 1985, 'Rice Bran Stabilization by Extrusion Cooking for Extraction of Edible Oil', Journal of Food Science, vol. 50, no. 2, pp. 361-364.
Rao, A, Reddy, S, Babu, P & Reddy, A 2010, 'The antioxidant and antiproliferative activities of methanolic extracts from Njavara rice bran', BMC Complementary and Alternative Medicine, vol. 10, no. 1, p. 4.
Renuka Devi, R & Arumughan, C 2007, 'Antiradical efficacy of phytochemical extracts from defatted rice bran', Food Chem Toxicol, vol. 45, no. 10, Oct, pp. 2014-21.
Robaszkiewicz, A, Balcerczyk, A & Bartosz, G 2007, 'Antioxidative and prooxidative effects of quercetin on A549 cells', Cell Biol Int, vol. 31, no. 10, Oct, pp. 1245-50.
![Page 202: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/202.jpg)
185
Rodrigo, R & Gil-Becerra, D 2014, 'Chapter 17 - Implications of Polyphenols on Endogenous Antioxidant Defense Systems in Human Diseases', in RR Watson, VR Preedy and S Zibadi (eds), Polyphenols in Human Health and Disease, Academic Press, San Diego, pp. 201-217.
Rodrigo, R, Libuy, M, Feliu, F & Hasson, D 2013, 'Oxidative stress-related biomarkers in essential hypertension and ischemia-reperfusion myocardial damage', Dis Markers, vol. 35, no. 6, pp. 773-90.
Romero-Pérez, AI, Lamuela-Raventós, RM, Andrés-Lacueva, C & de la Torre-Boronat, MC 2000, 'Method for the Quantitative Extraction of Resveratrol and Piceid Isomers in Grape Berry Skins. Effect of Powdery Mildew on the Stilbene Content', Journal of Agricultural and Food Chemistry, vol. 49, no. 1, 2001/01/01, pp. 210-215.
Romier, B, Van De Walle, J, During, A, Larondelle, Y & Schneider, YJ 2008, 'Modulation of signalling nuclear factor-kappaB activation pathway by polyphenols in human intestinal Caco-2 cells', Br J Nutr, vol. 100, no. 3, Sep, pp. 542-51.
Rong, N, Ausman, LM & Nicolosi, RJ 1997, 'Oryzanol decreases cholesterol absorption and aortic fatty streaks in hamsters', Lipids, vol. 32, no. 3, Mar, pp. 303-9.
Rossi, L, Mazzitelli, S, Arciello, M, Capo, CR & Rotilio, G 2008, 'Benefits from dietary polyphenols for brain aging and Alzheimer's disease', Neurochem Res, vol. 33, no. 12, Dec, pp. 2390-400.
Rostagno, MA & Prado, JM 2013, Natural Product Extraction: Principles and Applications, Royal Society of Chemistry.
Ruekeith, GO 2013, 'Worrying statistics on heart diseases', The Borneo Post,
Sagach, VF, Scrosati, M, Fielding, J, Rossoni, G, Galli, C & Visioli, F 2002, 'The water-soluble vitamin E analogue Trolox protects against ischaemia/reperfusion damage in vitro and ex vivo. A comparison with vitamin E', Pharmacol Res, vol. 45, no. 6, Jun, pp. 435-9.
Scalbert, A, Johnson, IT & Saltmarsh, M 2005, 'Polyphenols: antioxidants and beyond', The American Journal of Clinical Nutrition, vol. 81, no. 1, January 1, 2005, pp. 215S-217S.
Scalbert, A, Manach, C, Morand, C, Remesy, C & Jimenez, L 2005, 'Dietary polyphenols and the prevention of diseases', Crit Rev Food Sci Nutr, vol. 45, no. 4, pp. 287-306.
Schafer, FQ & Buettner, GR 2001, 'Redox environment of the cell as viewed through the redox state of the glutathione disulfide/glutathione couple', Free Radic Biol Med, vol. 30, no. 11, Jun 1, pp. 1191-212.
![Page 203: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/203.jpg)
186
Schramm, R, Abadie, A, Hua, N, Xu, Z & Lima, M 2007, 'Fractionation of the rice bran layer and quantification of vitamin E, oryzanol, protein, and rice bran saccharide', Journal of Biological Engineering, vol. 1, 28 December, pp. 9-9.
Schreck, R & Baeuerle, PA 1991, 'A role for oxygen radicals as second messengers', Trends in Cell Biology, vol. 1, no. 2–3, 8//, pp. 39-42.
Seetharamaiah, GS & Chandrasekhara, N 1989, 'Studies on hypocholesterolemic activity of rice bran oil', Atherosclerosis, vol. 78, no. 2-3, Aug, pp. 219-23.
Sen, CK, Khanna, S & Roy, S 2004, 'Tocotrienol: The Natural Vitamin E to Defend the Nervous System?', Annals of the New York Academy of Sciences, vol. 1031, no. 1, pp. 127-142.
Sen, CK, Khanna, S & Roy, S 2006, 'Tocotrienols: Vitamin E beyond tocopherols', Life Sciences, vol. 78, no. 18, pp. 2088-2098.
Sen, CK, Khanna, S, Roy, S & Packer, L 2000, 'Molecular Basis of Vitamin E Action: Tocotrienol potentialy inhibits glutamate-induced pp60c-Src kinase activation and death of HT4 neuronal cells', Journal of Biological Chemistry, vol. 275, no. 17, April 28, 2000, pp. 13049-13055.
Seo, W, Kim, J, Song, Y-C, Cho, J-H, Jang, K, Han, S-I, Ra, J-E, Oh, S-H, Kang, H-J, Kim, B-J, Baek, N-I, Jeong, R-H & Nam, M 2013, 'Comparative analysis of physicochemicals and antioxidative properties in new red rice (Oryza sativa L. cv. Gunganghongmi)', Journal of Crop Science and Biotechnology, vol. 16, no. 1, 2013/03/01, pp. 63-68.
Serbinova, E, Kagan, V, Han, D & Packer, L 1991, 'Free radical recycling and intramembrane mobility in the antioxidant properties of alpha-tocopherol and alpha-tocotrienol', Free Radic Biol Med, vol. 10, no. 5, pp. 263-75.
Shao, Y, Xu, F, Sun, X, Bao, J & Beta, T 2014, 'Identification and quantification of phenolic acids and anthocyanins as antioxidants in bran, embryo and endosperm of white, red and black rice kernels (Oryza sativa L.)', Journal of Cereal Science, vol. 59, no. 2, 3//, pp. 211-218.
Sharma, OP & Bhat, TK 2009, 'DPPH antioxidant assay revisited', Food Chemistry, vol. 113, no. 4, 4/15/, pp. 1202-1205.
Sharma, V & Rao, LJ 2009, 'A thought on the biological activities of black tea', Crit Rev Food Sci Nutr, vol. 49, no. 5, May, pp. 379-404.
Sheffield, JB & Hilfer, SR 2012, The Microenvironment and Vision, Springer New York.
Shen, Y, Jin, L, Xiao, P, Lu, Y & Bao, J 2009, 'Total phenolics, flavonoids, antioxidant capacity in rice grain and their relations to grain color, size and weight', Journal of Cereal Science, vol. 49, no. 1, 1//, pp. 106-111.
![Page 204: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/204.jpg)
187
Sheng, R, Gu, ZL, Xie, ML, Zhou, WX & Guo, CY 2010, 'Epigallocatechin gallate protects H9c2 cardiomyoblasts against hydrogen dioxides- induced apoptosis and telomere attrition', Eur J Pharmacol, vol. 641, no. 2-3, Sep 1, pp. 199-206.
Sigma-Aldrich 2010, Fundamental Techniques in Cell Culture Laboratory Handbook, 2nd edn, Sigma-Aldrich
Singh, RP & Chakraverty, A 2014, 'Rice Bran', in Postharvest Technology and Food Process Engineering, CRC Press.
Singh, U & Jialal, I 2006, 'Oxidative stress and atherosclerosis', Pathophysiology, vol. 13, no. 3, 8//, pp. 129-142.
Singleton, VL & Rossi, JA 1965, 'Colorimetry of Total Phenolics with Phosphomolybdic-Phosphotungstic Acid Reagents', American Journal of Enology and Viticulture, vol. 16, no. 3, January 1, 1965, pp. 144-158.
Sirikul, A, Moongngarm, A & Khaengkhan, P 2009, 'Comparison of proximate composition, bioactive compounds and antioxidant activity of rice bran and defatted rice bran from organic rice and conventional rice ', Asian Journal of Food and Agro-Industry, vol. 2, no. 4, pp. 731-743.
Slater, TF 1984, 'Free-radical mechanisms in tissue injury', Biochemical Journal, vol. 222, no. 1, pp. 1-15.
Sompong, R, Siebenhandl-Ehn, S, Linsberger-Martin, G & Berghofer, E 2011, 'Physicochemical and antioxidative properties of red and black rice varieties from Thailand, China and Sri Lanka', Food Chemistry, vol. 124, no. 1, 1/1/, pp. 132-140.
Son, MJ, Rico, CW, Nam, SH & Kang, MY 2011, 'Effect of oryzanol and ferulic acid on the glucose metabolism of mice fed with a high-fat diet', J Food Sci, vol. 76, no. 1, Jan-Feb, pp. H7-h10.
Steinberg, D, Parthasarathy, S, Carew, TE, Khoo, JC & Witztum, JL 1989, 'Beyond Cholesterol', New England Journal of Medicine, vol. 320, no. 14, pp. 915-924.
Stocker, R & Keaney, JF, Jr. 2004, 'Role of oxidative modifications in atherosclerosis', Physiol Rev, vol. 84, no. 4, Oct, pp. 1381-478.
Stone, JR & Yang, S 2006, 'Hydrogen peroxide: a signaling messenger', Antioxid Redox Signal, vol. 8, no. 3-4, Mar-Apr, pp. 243-70.
Stratil, P, Klejdus, B & Kubáň, V 2007, 'Determination of phenolic compounds and their antioxidant activity in fruits and cereals', Talanta, vol. 71, no. 4, 3/15/, pp. 1741-1751.
![Page 205: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/205.jpg)
188
Surarit, W, Jansom, C, Lerdvuthisopon, N, Kongkham, S & Hansakul, P 2015, 'Evaluation of antioxidant activities and phenolic subtype contents of ethanolic bran extracts of Thai pigmented rice varieties through chemical and cellular assays', International Journal of Food Science & Technology, vol. 50, no. 4, pp. 990-998.
Suzuki, YJ, Tsuchiya, M, Wassall, SR, Choo, YM, Govil, G, Kagan, VE & Packer, L 1993, 'Structural and dynamic membrane properties of .alpha.-tocopherol and .alpha.-tocotrienol: Implication to the molecular mechanism of their antioxidant potency', Biochemistry, vol. 32, no. 40, 1993/10/01, pp. 10692-10699.
Swaminathan, MS & Rao, SA 2008, 'Rice for Sustainable Food and Nutritions Security', in Rice Improvement in the Genomics Era, CRC Press, pp. 375-415.
Swirski, FK & Nahrendorf, M 2013, 'Leukocyte Behavior in Atherosclerosis, Myocardial Infarction, and Heart Failure', Science, vol. 339, no. 6116, January 11, 2013, pp. 161-166.
Talwinder, SK 2009, 'Rice Bran', in Fiber Ingredients, CRC Press.
Tan, B 2005, 'Appropriate spectrum vitamin E and new perspectives on desmethyl tocopherols and tocotrienols', Journal of American Nutraceutical Association, vol. 8, pp. 35-42.
Tanaka, T & Takahashi, R 2013, 'Flavonoids and Asthma', Nutrients, vol. 5, no. 6, pp. 2128-2143.
Teo, GK 2000, 'Rice biodiversity of Sarawak,' Internationational Biodiversity Conference, 1-3.
Toh, B-H, Kyaw, T, Tipping, P & Bobik, A 2014, 'Chapter 71 - Atherosclerosis', in NRRR Mackay (ed.) The Autoimmune Diseases (Fifth Edition), Academic Press, Boston, pp. 1049-1066.
Trachootham, D, Lu, W, Ogasawara, MA, Valle, NR-D & Huang, P 2008, 'Redox Regulation of Cell Survival', Antioxidants & Redox Signaling, vol. 10, no. 8, 6 February, pp. 1343-1374.
Tsuda, T, Horio, F, Kato, Y & Osawa, T 2002a, 'Cyanidin 3-O-beta-D-glucoside attenuates the hepatic ischemia-reperfusion injury through a decrease in the neutrophil chemoattractant production in rats', J Nutr Sci Vitaminol (Tokyo), vol. 48, no. 2, Apr, pp. 134-41.
Tsuda, T, Horio, F, Kato, Y & Osawa, T 2002b, 'Cyanidin 3-O-beta-D-glucoside attenuates the hepatic ischemia-reperfusion injury through a decrease in the neutrophil chemoattractant production in rats', J Nutr Sci Vitaminol (Tokyo), vol. 48, no. 2, pp. 134-141.
Valko, M, Leibfritz, D, Moncol, J, Cronin, MT, Mazur, M & Telser, J 2007, 'Free radicals and antioxidants in normal physiological functions and human disease', Int J Biochem Cell Biol, vol. 39, no. 1, pp. 44-84.
![Page 206: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/206.jpg)
189
Van Hoed, V, Depaemelaere, G, Ayala, JV, Santiwattana, P, Verhe, R & De Greyt, W 2006, 'Influence of chemical refining on the major and minor components of rice brain oil', Journal of the American Oil Chemists' Society, vol. 83, no. 4, 2006/04/01, pp. 315-321.
Vance, CK & Miller, A-F 1998, 'Spectroscopic Comparisons of the pH Dependencies of Fe-Substituted (Mn)Superoxide Dismutase and Fe-Superoxide Dismutase', Biochemistry, vol. 37, no. 16, 1998/04/01, pp. 5518-5527.
Vasanthi, HR, Parameswari, RP & Das, DK 2012, 'Multifaceted role of tocotrienols in cardioprotection supports their structure: function relation', Genes Nutr, vol. 7, no. 1, Jan, pp. 19-28.
Vázquez, CV, Rojas, MGV, Ramírez, CA, Chávez-Servín, JL, García-Gasca, T, Ferriz Martínez, RA, García, OP, Rosado, JL, López-Sabater, CM, Castellote, AI, Montemayor, HMA & de la Torre Carbot, K 2015, 'Total phenolic compounds in milk from different species. Design of an extraction technique for quantification using the Folin–Ciocalteu method', Food Chemistry, vol. 176, no. 0, 6/1/, pp. 480-486.
Verma, S, Fedak, PWM, Weisel, RD, Butany, J, Rao, V, Maitland, A, Li, R-K, Dhillon, B & Yau, TM 2002, 'Fundamentals of Reperfusion Injury for the Clinical Cardiologist', Circulation, vol. 105, no. 20, May 21, 2002, pp. 2332-2336.
Vichapong, J, Sookserm, M, Srijesdaruk, V, Swatsitang, P & Srijaranai, S 2010, 'High performance liquid chromatographic analysis of phenolic compounds and their antioxidant activities in rice varieties', LWT - Food Science and Technology, vol. 43, no. 9, 11//, pp. 1325-1330.
Vissers, MN, Zock, PL, Meijer, GW & Katan, MB 2000, 'Effect of plant sterols from rice bran oil and triterpene alcohols from sheanut oil on serum lipoprotein concentrations in humans', Am J Clin Nutr, vol. 72, no. 6, Dec, pp. 1510-5.
Wang, P, Chen, H, Qin, H, Sankarapandi, S, Becher, MW, Wong, PC & Zweier, JL 1998, 'Overexpression of human copper, zinc-superoxide dismutase (SOD1) prevents postischemic injury', Proc Natl Acad Sci U S A, vol. 95, no. 8, Apr 14, pp. 4556-60.
Wang, P, Henning, SM & Heber, D 2010, 'Limitations of MTT and MTS-Based Assays for Measurement of Antiproliferative Activity of Green Tea Polyphenols', PLoS ONE, vol. 5, no. 4, p. e10202.
Wang, S, Melnyk, JP, Tsao, R & Marcone, MF 2011, 'How natural dietary antioxidants in fruits, vegetables and legumes promote vascular health', Food Research International, vol. 44, no. 1, 1//, pp. 14-22.
Wang, Y-X, Li, Y, Sun, A-M, Wang, F-J & Yu, G-P 2014, 'Hypolipidemic and Antioxidative Effects of Aqueous Enzymatic Extract from Rice Bran in Rats Fed a High-Fat and -Cholesterol Diet', Nutrients, vol. 6, no. 9, 27 August, pp. 3696-3710.
![Page 207: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/207.jpg)
190
Watjen, W, Michels, G, Steffan, B, Niering, P, Chovolou, Y, Kampkotter, A, Tran-Thi, QH, Proksch, P & Kahl, R 2005, 'Low concentrations of flavonoids are protective in rat H4IIE cells whereas high concentrations cause DNA damage and apoptosis', J Nutr, vol. 135, no. 3, Mar, pp. 525-31.
Weng-Yew, W, Selvaduray, KR, Ming, CH & Nesaretnam, K 2009, 'Suppression of Tumor Growth by Palm Tocotrienols Via the Attenuation of Angiogenesis', Nutrition and Cancer, vol. 61, no. 3, 2009/05/07, pp. 367-373.
WHO 2004, WHO publishes definitive atlas on global heart disease and stroke epidemic, World Health Organization, viewed 20 March, <http://www.who.int/mediacentre/news/releases/2004/pr68/en/>.
WHO 2015, Cardiovascular diseases (CVDs), World Health Organization, viewed 16 July 2013,
Wiese, AG, Pacifici, RE & Davies, KJ 1995, 'Transient adaptation of oxidative stress in mammalian cells', Arch Biochem Biophys, vol. 318, no. 1, Apr 1, pp. 231-40.
Williams, GM 1986, 'Epigenetic promoting effects of butylated hydroxyanisole', Food Chem Toxicol, vol. 24, no. 10-11, Oct-Nov, pp. 1163-6.
Williams, GM & Iatropoulos, MJ 1996, 'Inhibition of the hepatocarcinogenicity of aflatoxin B1 in rats by low levels of the phenolic antioxidants butylated hydroxyanisole and butylated hydroxytoluene', Cancer Lett, vol. 104, no. 1, Jun 24, pp. 49-53.
Wilson, TA, Idreis, HM, Taylor, CM & Nicolosi, RJ 2002, 'Whole fat rice bran reduces the development of early aortic atherosclerosis in hypercholesterolemic hamsters compared with wheat bran', Nutrition Research, vol. 22, no. 11, 11//, pp. 1319-1332.
Wolf, G 2005, 'The Discovery of the Antioxidant Function of Vitamin E: the contribution of Henry A. Mattill', The Journal of Nutrition, vol. 135, no. 3, March 1, 2005, pp. 363-366.
Wong, RSY & Radhakrishnan, AK 2012, 'Tocotrienol research: past into present', Nutrition Reviews, vol. 70, no. 9, pp. 483-490.
Wu, S-J & Ng, L-T 2010a, 'Tocotrienols Inhibited Growth and Induced Apoptosis in Human HeLa Cells Through the Cell Cycle Signaling Pathway', Integrative Cancer Therapies, vol. 9, no. 1, March 1, 2010, pp. 66-72.
Wu, SJ & Ng, LT 2010b, 'Tocotrienols inhibited growth and induced apoptosis in human HeLa cells through the cell cycle signaling pathway', Integr Cancer Ther, vol. 9, no. 1, Mar, pp. 66-72.
Xu, Z & Godber, JS 1999, 'Purification and identification of components of gamma-oryzanol in rice bran Oil', J Agric Food Chem, vol. 47, no. 7, Jul, pp. 2724-8.
![Page 208: Xian Wen Tan Thesis - Swinburne Research Bank | openEQUELLA](https://reader030.vdocuments.us/reader030/viewer/2022012407/616a1f0411a7b741a34f0877/html5/thumbnails/208.jpg)
191
Xu, Z, Hua, N & Godber, JS 2001, 'Antioxidant activity of tocopherols, tocotrienols, and gamma-oryzanol components from rice bran against cholesterol oxidation accelerated by 2,2'-azobis(2-methylpropionamidine) dihydrochloride', J Agric Food Chem, vol. 49, no. 4, Apr, pp. 2077-81.
Yawadioa, R, Tanimorib, S & Moritta, N 2007, 'Identification of phenolic compounds isolated from pigmented rices and their aldose reductase inhibitory activities ', Food Chemistry, vol. 102, pp. 1616-1625.
Yonekura-Sakakibara, K, Nakayama, T, Yamazaki, M & Saito, K 2009, 'Modification and Stabilization of Anthocyanins', in C Winefield, K Davies and K Gould (eds), Anthocyanins, Springer New York, pp. 169-190.
Yoshida, Y, Niki, E & Noguchi, N 2003, 'Comparative study on the action of tocopherols and tocotrienols as antioxidant: chemical and physical effects', Chem Phys Lipids, vol. 123, no. 1, Mar, pp. 63-75.
Yoshie, A, Kanda, A, Nakamura, T, Igusa, H & Hara, S 2009, 'Comparison of gamma-oryzanol contents in crude rice bran oils from different sources by various determination methods', J Oleo Sci, vol. 58, no. 10, pp. 511-8.
Yu, LL 2008, Wheat Antioxidants, Wiley.
Yu, S, Nehus, ZT, Badger, TM & Fang, N 2007, 'Quantification of vitamin E and gamma-oryzanol components in rice germ and bran', J Agric Food Chem, vol. 55, no. 18, Sep 5, pp. 7308-13.
Zelko, IN, Mariani, TJ & Folz, RJ 2002, 'Superoxide dismutase multigene family: a comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression', Free Radic Biol Med, vol. 33, no. 3, Aug 1, pp. 337-49.
Zhang, L, Jiang, H, Gao, X, Zou, Y, Liu, M, Liang, Y, Yu, Y, Zhu, W, Chen, H & Ge, J 2011, 'Heat shock transcription factor-1 inhibits H2O2-induced apoptosis via down-regulation of reactive oxygen species in cardiac myocytes', Mol Cell Biochem, vol. 347, no. 1-2, Jan, pp. 21-8.
Zhang, M-w, Guo, B-j, Zhang, R-f, Chi, J-w, Wei, Z-c, Xu, Z-h, Zhang, Y & Tang, X-j 2006, 'Separation, Purification and Identification of Antioxidant Compositions in Black Rice', Agricultural Sciences in China, vol. 5, no. 6, 6//, pp. 431-440.
Zhang, MW, Zhang, RF, Zhang, FX & Liu, RH 2010, 'Phenolic profiles and antioxidant activity of black rice bran of different commercially available varieties', J Agric Food Chem, vol. 58, no. 13, Jul 14, pp. 7580-7.