world cotton research conference - 5 .session_2

Cotton Protection

Survival of Helicoverpa armigera on Bt Cotton Hybrids in India—Can We Buy the Interpretations

A. Prabhuraj1, Y.B. Srinivasa2 and K. Muralimohan3 1Department of Agricultural Entomology, College of Agriculture,

University of Agricultural Sciences, Raichur 584 101, India 2Institute of Wood Science and Technology, PO Malleswaram, Bangalore–560003, India

3Krishi Vigyan Kendra (University of Agricultural Sciences, Bangalore), Magadi, Ramanagara District–562120 India E-mail: [email protected]

Abstract—A couple of years since commercialization of transgenic Bt cotton in India, reports on survival of bollworms have appeared from different parts of the country. The first came in 2004 from Central India claiming a mere 50% reduction in bollworm population. Upto 9% damage was reported on some of the hybrids in Guntur region of Andhra Pradesh in 2009. Sizeable populations of pink bollworm were recorded on Bollgard-II® from Gujarat in 2010. In the same year, field survival of Helicoverpa armigera and ~9% boll damage was recorded from Raichur belt of Karnataka on both Bollgard® and Bollgard-II®. The latter study further demonstrated survival and reproduction of the pest insect for two complete generations on Bt cotton hybrids. This study created considerable national debate over the credibility of the technology as such. Here, we put forth two prominent public views expressed on the results of the study and the many interpretations. Interpreting field survival and completion of two generations as ˜development of resistance’ in the population has been mooted prominently. The arguments arise because the study per se does not quantify resistance among the surviving individuals. One side of the argument is that the results of the study, in addition to development of resistance, be attributed to a situation where plants produce less-than-lethal levels of toxins. The other side dismisses the low-toxin argument as the hybrids have been demonstrated, during their approval for commercialization, that the concentration of the toxins is lethal despite variations across plant parts. Opinions such as disparity in environment leading to low toxin production are unsubstantiated and may be rejected. The second point of contest is related to survival of the second generation of the insect on Bt plants. As the F1 was the result of mating between individuals bred on Bt plants, it has been argued that it does not reflect the assumed reality where individuals from Bt plants mate with those from non-Bt plants. Therefore the experiment may not gel with the concept of refugia. On the contrary, this argument fails to reason out considerable survival recorded among the first generation population, whose parents had ample opportunities to mate with partners from non-Bt plants. Additionally, as the results of the study show that survival of the individuals bred on Bt plants in their F1 generation was equal to that of the control, it has been expressed that the surviving individuals were considerably resistant.

INTRODUCTION

The cotton plant has been genetically modified for protection against insect pests, particularly from boll feeding caterpillars. It happened through the introgression of Cry genes derived from the soil bacterium, Bacillus thuringiensis, which code for insecticidal proteins in plant tissues (commonly referred as ‘Bt cotton’). Today, several hundred hybrids of Bt cotton are present in India that contain either one or two bacterial genes in their chromosomes (APCoAB, 2009).

This new war between man and insects is being observed with a lot of interest. One of the reasons being the anticipated development of resistance in bollworms to Bt toxins. Developing resistance is not uncommon to species like Helicoverpa armigera, the American bollworm; assays have proved its resistance against most of the conventional insecticides and protein toxins of Bt (Armes et al., 1992; Saad et al., 2005). Resistance has been a foregone conclusion, and strategies were applied for delaying the development of resistance, not preventing it, from the time of introducing Bt cotton for commercial cultivation; for example, implementation of the concept of refugia. Nevertheless, reports claiming survival of the pest on Bt cotton started trickling from different parts of India within the first couple of years of commercialization. The first was published in 2004 from Central India; it declared a mere 50% reduction in bollworm population (Bambawale et al., 2004). Up to 9% damage by bollworms was reported on some of the hybrids in Guntur region of Andhra Pradesh in 2009 (Prasad, 2009). During

27

162 World Cotton Research Conference on Technologies for Prosperity

2010 field survival of H. armigera with ~9% boll damage was reported from Raichur on Bt hybrids with single and double genes. This brings us to the question that what should society gather from these reports? Are the evidences sufficient to show that the pest is able to overcome Bt toxins, or outsmart current technology? The interpretations are numerous. In this paper we have summarized the interpretations and communicated our take on them.

A list of publications reporting the occurrence/survival of H. armigera on Bt cotton is provided under Table 1. It lists reports on the occurrence of H. armigera on various Bt cotton hybrids in different parts of India. Most incidences are reported from experimental fields laid exclusively for evaluation of Bt cotton hybrids against bollworms, while some are reported from demonstration plots in farmers’ fields. With the exception of one, all others report incidence on hybrids carrying single gene; Ranjith et al., (2010) report natural populations of H. armigera on cotton hybrids containing two genes (Cry 1Ac and Cry 2Ab). In all, boll damage ranged from 0.00 to 17.3%. It is important to note that the listed studies merely record occurrences of caterpillars of H. armigera; none investigate either the reasons for their occurrences or confirm the fate of the population. Recently, Ranjith et al. (2010) sampled naturally surviving population of H. armigera on Bt cotton hybrids and established that these populations were capable of completing the generation and producing viable progeny able to survive on Bt cotton. At the outset, there remains little doubt over the current ability of H. armigera to survive and breed on commercial Bt cotton containing one and two Cry genes.

Interpretations provided for the recorded survival of H. armigera can be categorized into those related to 1) expression of Bt toxin and 2) pest biology. Expression of Bt toxins is known to vary with age, pedigree and part of the plant (Kranti et al., 2005). The expression is inversely proportional to age, suggesting that the probability for survival of H. armigera increases with plant age. Given that H. armigera attacks mid to late-age cotton plants, it appears that the technology can be greatly compromised. However, this can also be taken care by over expressing the gene such that the concentration of the toxin in the plant tissue is never below the levels required to kill bollworms. In addition, second generation Bt hybrids with two Cry genes have been commercially introduced in 2006. The second gene is expected to support the existing gene in terms of delaying the development of resistance. However, proof of the ability to survive on both types of hybrids (Ranjith et al., 2010) clearly suggests that variation in toxin expression with respect to plant age may not have been sufficiently taken care to quell the pest.

Toxin expression is also influenced by genetic stock of the hybrid (John et al., 2001; Kranthi et al., 2005). Not all the hybrids exhibit the same level of Bt toxin in a given situation leading to claims that survival of the pest may be due to poor pedigree of the hybrid. If this is one of the reasons for under-performance of any Bt cotton hybrid, then utmost care should be taken during the release of hybrids for commercialization, as this could jeopardise the interest of the farmer as well as the technology. However, data on expression levels are provided for each hybrid before commercial approval, which should take care of the potential problem. This is important because several hundreds of new hybrids have entered the market during the last four years.

Toxin expression in different plant parts is known to be different, which is another reason given for survival of pest population (Kranthi et al., 2005; Gore et al., 2001; Gore et al.,2003). Among plant parts, the expression is highest in leaves followed by flowers, squares and bolls. Hence, it is suggested that chances for survival of H. armigera increases as it mainly feeds on squares and bolls. However this may not be accurate as 1) young caterpillars feed on tender leaves and flowers before shifting to bolls, thus exposing themselves to high concentration of toxins, and 2) Ranjith et al (2010) have reared caterpillars of all developmental stages on leaves of Bt hybrids before obtaining survival. Although this reason may suit survival of species like the pink bollworm that feeds exclusively within bolls, it fails to explain survival of H. armigera.

Expression of Bt toxin in the plant is claimed to vary with planting dates, and agronomic practices like irrigation and soil nutrition (Yang et al., 2005; John et al., 2001; ). Bt expression decreases with

Survival of Helicoverpa armigera on Bt cotton Hybrids in India—Can We Buy the Interpretations 163

advancement in date of planting. This is directly related to the performance of the plant itself, which declines when planting dates are delayed. This automatically translates to insufficient expression of the toxin and promoting pest survival. Further, moisture and soil nutrition play a major role in plant health (John et al., 2001). All hybrids respond positively to application of inorganic fertilizers and regular irrigation, which is further expected to encourage toxin expression (Hallikeri et al., 2009). Therefore incidence of H. armigera should decrease when crops are managed well. As mentioned earlier, the listed reports (Table 1) on survival of H. armigera are from either experimental plots of established research stations or demonstration fields which are obviously managed well. Therefore, we believe that scope for faulty agronomic practices that encourage pest survival is minimal.

H. armigera has been one of the prominent pests of cotton since the last few decades. The capability of this pest to attain the notoriety is mainly attributed to its wide host range, high fecundity, several overlapping generations in a year and its ability to develop resistance to majority of insecticides including Bt. In fact populations from different regions of India have exhibited varied levels of tolerance to Bt toxins. Therefore, it may be obvious that some of the populations might have been able to quickly develop tolerance to Bt toxin and survive on Bt hybrids.

Many of the interpretations provided for survival of H. armigera tend to focus on conditions that might promote low toxin concentration in plant tissues. However, one has to carefully consider them as data on toxin concentration provided during approval of each hybrid shows more-than-enough levels throughout the crop period. There are no data on the extent of variation in toxin concentration for each hybrid with respect to the factors discussed earlier. Therefore, at present, there are only two options that remain for interpreting survival of H. armigera on Bt cotton – 1) pest population developing tolerance to the toxins, or 2) vulnerability of the current technology to variations in agronomic and other natural factors.

TABLE 1: REPORTS OF THE OCCURRENCE OF HELICOVERPA ARMIGERA ON VARIOUS BT COTTON HYBRIDS IN INDIA SINCE ITS COMMERCIALIZATION

Sl. No

Year of Incidence

Hybrids States Square/boll Damage (%)

Reference

1 2002 MECH-162 Andhra Pradesh 50 Bambawale et al, 2003 2 2002-03 RCH2, RCH 20 Maharashtra Unimodel Vennila et al, 2004 3 2002-03 MECH-162 Karnataka 0-4.3 Kengegowda et al, 2005 4 2002-04 MECH-12, MECH-162 and MECH-184 Andhra Pradesh 5.4-17.3 Sharma & Pampapathy et al,2006 5 MECH-162 Andhra Pradesh 9 Prasad et al, 2009 6 2002-03 RCH2, RCH20, RCH144 Andhra Pradesh 0-8.88 Prasad, 2009 7 2003-05 MECH-184 Maharashtra & Karnataka 0.8-2.8 Bambawale et al, 2010 8 2009 MRC 6918, NCS-145 BGII, MRC-7918BGII Karnataka 4.3-8.6 Ranjith et al, 2010

REFERENCES [1] Armes, N. T., Jadhar, D.R. Bond. G.S. and King, A.B.S. (1992) - Insecticide resistance in Helicoverpa armigera in South

India - Pesticide Science. 34: 335-364. [2] Asia-Pacific Consortium on Agricultural Biotechnology (APCoAB) and Asia-Pacific Association of Agricultural Research

Institutions (APAARI), 2009, Bt cotton in India: A status Report, 2nd Edn. p 1-49. [3] Bambawale, O. M., Tanwar, R. K., Sharma, O. P., Bhosle, B. B., Lavekar, R. C., Patil, S. B., Dhandapani, A., Trivedi, T.

P., Jeyakumar, P., Garg, D. K., Jafri, A. A. and Meena, B. L. (2010) - Impact of refugia and integrated pest management on the performance of transgenic (Bacillus thuringiensis) cotton (Gossypium hirsutum). Indian Journal of Agricultural Sciences. 80: 8, 730-736.

[4] Bambawale, O. M. et al., (2003) - Performance of Bt-cotton (MECH-162) under irrigated pest management in farmers’ participatory field trial in Nanded district, Central India. Current Science. 86: 1628-1633.

[5] Gore J., Leonard, B. R., Adamczyk, J. J. (2001) - Bollworm (Lepidoptera:Noctuidae) survival on Bollgard and Bollgard II cotton flower bud and flower components. J. Econ. Entomol. 94 (6):1445-1451.

[6] Gore J., Leonard BR., Gable RH. (2003) - Distribution of bollworm, Helicoverpa zea (Boddie), injured reproductive structures on genetically engineered Bacillus thuringiensis var. kurstaki Berliner cotton. J. Econ. Entomol. 96: 699-705.

[7] Hallikeri S. S., Halemani H. L., Katageri I. S., Patil B. C., Patil V. C. And Palled Y. B. (2009) - Influence of sowing time and moisture regimes on Cry protein concentration and related parameters of Bt cotton. Karnataka Journal of Agricultural Sciences. 22(5): 995-1000.


[8] John J., Adamczyk, Jr. and Douglas V. Sumerford. (2011) - Potential factors impacting season-long expression of Cry1Ac in 13 commercial varieties of Bollgard® cotton. Journal of Insect Science. 1: 1-6. 164 World Cotton Research Conference on Technologies for Prosperity

[9] Kengegowda, N., Patil, B. V. and Bheemanna, M. (2005) - Population dynamics of insect pests on Bt, non-Bt and popular hybrid cotton in Tungabhadra project area of Karnataka State. Karnataka Journal of Agricultural Sciences., 18 (2): 383-388.

[10] Kranthi, K.R., Naidu, S., Dhawad, C.S., Tatwawadi, A., Mate, K., Patil, E., Bharose, A. A., Behere, G.T., Wadaskar, R. M. and Kranthi, S. (2005) - Temporal and intra-plant variability of Cry1Ac expression in Bt-cotton and its influence on the survival of the cotton bollworm, Helicoverpa armigera (Hübner) (Noctuidae: Lepidoptera). Current Science. 89: 291-298.

[11] Prasad N.V.V.S.D., Mallikarajuna Rao. and Hariprasad Rao N., (2009) - Performance of Bt cotton and non-Bt cotton hybrids against pest complex under unprotected condition. Journal of Biopesticides, 2:107-110

[12] Ranjith. M. T., Prabhuraj. A and Srinivasa Y. B. (2010) - Survival and reproduction of Helicoverpa armigera on Bt cotton hybrids in Raichur, India. Current Science. 99 (11):1602-1606.

[13] Ranjithkumar L, Patil, B. V. and N G Vijaykumar. (2011) - Impact of irrigation and fertilizer Levels on Cry1Ac Protein Content in Bt. Cotton. Research Journal of Agricultural Science. 2(1): 33-35.

[14] Saad Mousa, Trilochan Mohapatra and Govind, T. Gujar (2005) - Monitoring of Bacillus thuringiensis Cry1Ac Resistance in Helicoverpa armigera (Hübner) (Noctuidae: Lepidoptera). 6th Asia-Pacific Rim Conference on the Biotechnology of Bacillus thuringiensis and its Environmental Impact, Victoria BC. Côté, J.-C., Otvos, I.S., Schwartz, J.-L. and Vincent, C. (eds): 74-77.

[15] Sharma, H. C. and Pampapathy, G. (2006) - Influence of transgenic cotton on the relative abundance and damage by target and non-target insect pests under different protection regimes in India. Crop Protection, 25: 800-813.

[16] Vennila, Biradar, S., Gadpayle, V. K., Panchbhai, J. G., Ramteke, P. R., Deole, M. S., and Karanjkar, P. P (2004) – Field evaluation of Bt transgenic cotton hybrids against sucking pests and bollworms. Indian Journal of Plant Protection. 32 (1): 1-10

[17] Yang.C. Xu. L and Yang. D. (2005) - Effects of nitrogen fertilizer on the Bt protein content in transgenic cotton and nitrogen metabolism mechanism. Cotton Science. 17 (4): 227-231

Field Performance of F1,-F2 and non-Bt of BG-II (MRC-7017 Bt) and JKCH-1947 Bt Against Bollworms

of Cotton

G.T. Gujar, G.K. Bunker, B.P. Singh and V. Kalia

Division of Entomology, Indian Agricultural Research Institute, New Delhi 110012 E-mail:[email protected]

Abstract—Studies were undertaken to evaluate comparative performance of F1, F2 and non-Bt versions of dual stacked Cry1Ac and Cry2Ab transgenic cotton hybrid, MRC7017Bt and the single stacked Cry1Ac transgenic JKCH1947Bt during kharif season. The results proved that lowest damage of terminal bud, fruiting bodies green boll, open boll; incidence of Earias and Pectinophora gossypiella was recorded on MRC 7017Bt F1, JKCH 1947Bt F1 and MRC7017Bt F2 as against MRC7017 non-Bt, JKCH1947 non-Bt and JKCH1947Bt F2. The highest seed cotton yield (27.00 q/ha) was recorded in MRC7017Bt F1 followed by JKCH1947Bt (23.15 q/ha), MRC7017Bt F2 (22.76 q/ha), JKCH1947Bt F2 (21.08 q/ha), JKCH non-Bt (16.08 q/ha) and MRC non-Bt 7017 (15.91 q/ha). The MRC7017Bt F1 was found to be significantly superior among the entire hybrid tested, whereas, JKCH 1947Bt F1 was statically at par with MRC7017Bt F2 regarding yield, both had significantly more yield than the non-Bt counterparts of JKCH1947Bt and MRC7017Bt. These results are discussed vis-à-vis sustainability of Bt cotton in relation to the threat of resistance evolution to its most important pest, H. armigera.

Keywords: Bt cotton, JKCH1947Bt, MRC7017Bt, bollworms,

INTRODUCTION

Bt cotton expressing Cry1Ac toxin derived from Bacillus thuringiensis was first commercialized in USA in 1996 and later in many other countries. It proved quite successful in controlling lepidopteran pests especially bollworms which are the main constraints in cotton productivity (Perlak et al., 2001). In India, Bt cotton with cry1Ac gene was introduced in 2002 by Mahyco Monsanto Biotech Ltd., Jalna with 3-cotton hybrids viz., MECH-12, MECH-162, MECH-184 grown over an area of about 38, 000 hectares. Bt cotton area later increased rapidly to the present level of about 9.4 million ha in 2010. Concurrent with area increase was the development of Bt cotton hybrids from 3 in 2002 to more than 780 in 2010. The dual stacked Bt cotton expressing Cry1Ac and Cry2Ab were introduced in 2006 to control sporadic key lepidopteran defoliator, Spodoptera litura which is tolerant to Cry1Ac and to contain the threat of resistance evolution in the target bollworms. Presently more than 18 Bt cotton hybrids belonging to Monsanto’s 15985 event of Bollgard II series are being grown; with area under dual stacked Bt cotton being more than the single stacked Bt cotton with Cry1Ac. Cotton production has increased from about 14 million bales in 2002 to about 34 million bales in 2010. Despite increase in the cotton production, cotton productivity of about 560 kg/ha is well below that of world average of about 690 kg/ha. Further, there are quite a wide range of regional differences in cotton productivity from the lowest of 336 kg/ha in Maharashtra to the highest of 774 kg/ha in Gujarat. The productivity differences are attributed to various biotic and abiotic stresses. Further, one of the reasons of relatively low productivity is the use of substandard seeds of Bt cotton hybrids and their F2 and F3 seeds by the farmers in view of seed cost (Jayaraman, 2004; Herring, 2008). Besides, biotic stress due to sucking pests and the emergence of tolerance/resistance in bollworms pose the threat to the sustainability of Bt cotton.

The bollworm complex is considered as the major constraint for the low level of productivity for non-Bt cotton (Dhawan et al., 1988, 2004; Patil, 1998) and poses a threat to Bt cotton in view of wide range of insect susceptibility as reported in the cotton bollworm, Helicoverpa armigera (Kranthi et al., 2001; Gujar et al., 2000; 2008). In recent years, other bollworms like spotted and pink bollworms are becoming important pests of non-Bt cotton and the latter is damaging the Bt cotton especially after 120 days wherein farmers are aiming for third picking of cotton by irrigating Bt cotton crop after the main

28


cotton season. The sucking insect pests are also important pests and are estimated to cause loss to the extent of 46.5% (Panchabhavi et al., 1990). In Bt cotton, sucking pests like mealy bug, Phenacoccus solenopsis is becoming a major pest. It has reportedly caused loss of about Rs 1590 millions in 2007-08, the highest ever in the recent times (http://ncipm.org.in/Mealybugs/mealybug.htm). Thus, Bt cotton despite its ability to control bollworm complex needs timely and limited application of insecticides as some time pest complex is above the threshold levels (Bambawale et al., 2004). Thus, the changing pest scenario and threat of Bt resistance looming large in view of wide range of Bt cotton hybrids, legal and illegal, and also F2 seeds are the main concern of sustainable Bt cotton cultivation (Monga 2008). Hence, studies were undertaken to evaluate the comparative performance of Bt cotton, single stacked JKCH1947Bt and dual stacked MRC7017 Bt, with their non-Bt and F2 counterparts and under the selection pressure of H. armigera under cage conditions.

MATERIALS AND METHODS

Field experiment was laid out in randomized block design (RBD) with 6 treatments, and replications during kharif, 2007 at transgenic field, IARI, New Delhi. The seeds of JKCH-1947 Bt-F1, Bt-F2 and Non-Bt were obtained from JK Agri-Genetics Ltd. Hyderabad. Whereas, MRC-7017 Bt-F1 (BG-II), Bt-F2 (BG-II) and Non-Bt were obtained from Mahyco Seeds Ltd. Jalna (Maharashtra).

Seeds were treated with imidacloprid 70 WS (Gaucho®) @ 7 g/kg seed before sowing crop The crop was sown in a plot size of 4.5 x 4.2 sq m. at 75 x 60 cm2 spacing on dated 26.06.2007 and 42 plant were maintained in each plot All the agronomical package and practices was uniform throughout season. Similarly, seed cotton pickings were done thrice in second season on 29.10.2007 (127 DAS), 5.12.2007 (163 DAS) and 10.12.2007 (168 DAS). The observation on the terminal bud damage fruiting damage, green boll damage and loculi damage caused by Earias spp and H. armigera was recorded. The terminal bud damage was recorded by counting damaged number of plants in each plot. Similarly, damaged fruiting bodies were recorded by counting the total number of reproductives fallen down and the number of damaged fruiting bodies in each plot. The damaged green boll in each variety was recorded by counting the total number of green boll and damaged green boll on five plant selected randomly. The population of Earias spp and H. armigera was also recorded by dissecting twenty bolls and counted the locule damage and larval population. The pink boll worm’s damage in each variety was recorded by counting the number of damaged open bolls and total number of open bolls before each picking. The loculi damage was recorded in damaged open boll by counting the total number of damaged open boll on five plants selected randomly. The data were calculated on per cent basis and computed The weight of seed cotton of all pickings was pooled together for each variety separately and yield per hectare was computed.

From each replicate, 5 plants were tagged and caged with nylon net (1.8 m x 1.2 m x 1.65 m size) with support of 4 bamboo sticks and another 5 plants were tagged outside of the cage in the same plot at 50 DAS in 2007.

During 2007 at 91 DAS, late second to early third instar larvae of H. armigera weighing from 10 to 15 mg each, were released @ 5/plant on the same tagged plants under caged and un-caged conditions. H. armigera larval survival (%), fruiting bodies (20 shedding/plot) damage (%) and green boll damage (%) on plant were recorded 12 days after release from caged and un-caged conditions. Two uniform sprays, one of acetamiprid 20 % SP (Pride®) @ 20 g a.i./ha and another of imidacloprid 17.8 % SL (Confidor®) @ 125 ml/ha were made at 25 DAS and 57 DAS, respectively.

RESULTS AND DISCUSSION

The F1, F2 and non-Bt cotton of Bollgard-II MRC-7017 and JKCH1947Bt were included in the field experiment conducted during kharif, 2007, for studying the comparative performance of these hybrids against the major boll worms of cotton. The results of the field investigation during 2007 on different parameters have been presented given below (Table 1 – 4).

Field Performance of F1,-F2 and non-Bt of BG-II (MRC-7017 Bt) and JKCH-1947 Bt Against Bollworms of Cotton 167

TERMINAL BUD DAMAGE (%) AT DIFFERENT DAYS AFTER SOWING (DAS)

The data presented in Table 1, indicated the lowest terminal bud damage was recorded on MRC Bt-F1 cotton (00.00%), followed by JKCH Bt-F1 (0.60%), MRC Bt-F2 (1.20%), and JKCH Bt-F2 cotton (1.88%) and these were found statistically at par to each other at 30 DAS. However, it was significantly highest recorded on MRC non-Bt cotton (20.50%) and JKCH non-Bt cotton (13.95%). Further at 60 DAS, lowest terminal buds damage was recorded on MRC Bt-F1 cotton (0.60%), followed by JK Bt-F1 (1.20%), MRC Bt-F2 (1.80%) and JK Bt-F2 cotton (3.90%) and all these were significantly superior to JK non-Bt (29.39%) and MRC non-Bt cotton (29.31%). The mean terminal bud damage was lowest on MRC Bt-F1 (0.3%), followed by JK Bt-F1 (0.9%), MRC Bt-F2 (1.5%) and JKCHBt-F2 cotton (2.89%), and the highest on MRC non-Bt (24.91%) and JK non-Bt cotton (21.67%).

FRUITING BODIES (SHEDDING) DAMAGE (%) AND EARIAS SP. INCIDENCE AT DIFFERENT DAS

At 65 DAS, MRC Bt-F1 cotton was significantly superior in term of lowest shedding damage (2.50%) as compared to all other hybrids tested. However, MRC Bt-F2 (10%) and JKCH Bt-F1 cotton (10%) were at par to each other, but significantly superior over MRC non-Bt (42.50%) and JK non-Bt cotton (30%) (Table 1). At 95 DAS, minimum shedding damage was recorded on MRC Bt-F1 cotton (7.50%) followed by JKCH Bt-F1 (13.75%), MRC Bt-F2 (20%) and JKCH Bt-F2 (30%) and all these were found superior over MRC non-Bt (47.50%) and JKCH non-Bt cotton (38.75%) except JKCH Bt-F2 cotton.

The mean fruiting body damage was lowest on MRC Bt-F1 cotton (5%) and found significantly superior over all the hybrids used. However, JKCH Bt-F1 (11.87%) and MRC Bt-F2 cotton (15%) were found at par to each other and significantly superior over MRC non-Bt (45%) and JKCH non-Bt cotton (34.38%) (Table1).

TABLE 1: COMPARATIVE PERFORMANCE OF MRC 7017BT AND JKCH 1947BT AGAINST INFESTATION OF EARIAS SPP. AT DIFFERENT DAS DURING KHARIF, 2007

Hybrids

Terminal Bud Damage (%) at DAS* Fruiting Bodies Damage (%) at DAS* Earias sp. Larvae/20 Shedding** 30 60 Mean 65 95 Mean 65 95 Mean

JKCH 1947Bt Non-Bt 13.95

(21.62) 29.39

(32.74) 21.67 30.00

(33.17) 38.75

(38.35) 34.38

(35.85) 1.25

(1.31) 1.50 (1.4)

1.38 (1.37)

Bt-F2 1.88 (7.83)

3.90 (11.18)

2.89 23.75 (28.91)

30.00 (33.02)

26.87 (31.19)

0.50 (0.97)

0.50 (0.97)

0.50 (0.98)

Bt-F1 0.60 (5.27)

1.20 (6.48)

0.9 10.0 (18.14)

13.75 (21.65)

11.87 (19.94)

0.00 (0.71)

0.00 (0.71)

0.00 (0.71)

MRC 7017Bt Non-Bt 20.50

(26.84) 29.31

(32.73) 24.91 42.50

(40.66) 47.50

(43.57) 45.00

(42.12) 1.25

(1.31) 1.50

(1.40) 1.38

(1.36) Bt-F2 1.20

(6.48) 1.80

(7.70) 1.5 10.00

(18.14) 20.00

(26.48) 15.00

(22.64) 0.25

(0.84) 0.25

(0.84) 0.25

(0.85) Bt-F1 0.00

(4.06) 0.60

(5.27) 0.3 2.50

(8.49) 7.50

(15.68) 5.00

(12.71) 0.00

(0.71) 0.00

(0.71) 0.00

(0.71) SEm ± 1.95 1.41 2.98 3.69 1.86 0.14 0.13 0.097

CD at 5% 4.16 3.01 6.36 7.87 3.96 0.29 0.287 0.21 *Figures in parentheses are transformed by arc-sin transformation, **Figures in parentheses are transformed by √ x + 0.5 transformation

At 65 DAS, Earias sp. larval population was none on MRC Bt-F1 and JKCH Bt-F1 cotton; MRC Bt-F2 (0.25 l/plant) and JKCH Bt-F2 cotton (0.50 l/plant), whereas on MRC non-Bt (1.25 l/plant) and JKCH non-Bt cotton had significantly higher (1.25 l/plant) from all Bt cotton hybrids. Similar trend was also recorded at 95 DAS. Mean incidence of Earias sp. larvae was recorded zero on MRC Bt-F1 and JKCH Bt-F1 cotton, while 1.38 l/plant recorded on both MRC non-Bt and JKCH non-Bt cotton.


Green Boll Locule Damage (%) and Bollworm Incidence at Different DAS

Green boll locule damage, Earias sp. and P. gossypiella larval incidence were recorded at 70, 90 and 105 DAS along with mean observations (Table 2).

TABLE 2: COMPARATIVE PERFORMANCE OF MRC7017BT AND JKCH 1947BT AGAINST LOCULE DAMAGE AND BOLLWORMS INCIDENCE AT DIFFERENT DAS DURING 2007

Hybrids

Green Boll Locules Damage (%) at DAS * Earias sp. Larvae/Bolls** P. gossypiella Larvae/ Bolls** 70 90 105 Mean 70 90 105 Mean 70 90 105 Mean

JKCH 1947Bt Non-Bt 13.09

(21.11) 34.47

(35.46) 22.43

(28.15) 17.37

(24.57) 1.50

(1.40) 2.00

(1.56) 2.75

(1.79) 2.09

(1.60) 0.50

(0.97) 2.80

(1.79) 2.75

(1.79) 1.75

(1.49)

Bt-F2 9.33 (17.58)

10.53 (18.88)

17.58 (24.69)

12.48 (20.63)

1.25 (1.31)

1.25 (1.31)

1.25 (1.31)

1.25 (1.32)

0.25 (0.84)

1.25 (1.31)

1.25 (1.31)

1.00 (1.19)

Bt-F1 6.76 (15.014)

2.99 (14.03)

13.03 (20.95)

8.59 (1697)

0.50 (0.97)

0.50 (0.97)

0.25 (0.84)

0.42 (0.94)

0.00 (0.71)

0.25 (0.84)

0.25 (0.84)

0.42 (0.95)

MRC 7017Bt Non-Bt 26.02

(28.95) 34.78

(35.68) 24.88

(29.83) 13.37

(24.58) 1.00

(1.18) 1.75

(1.48) 1.75

(1.48) 1.50

(1.40) 0.25

(0.84) 1.75

(1.48) 1.75

(1.48) 1.09

(1.25) Bt-F2 6.25

(14.10) 7.30

(15.11) 14.20

(22.12) 8.12

(16.53) 0.75

(1.10) 0.50

(0.97) 0.00

(0.71) 0.42

(0.95) 0.25

(0.84) 0.00

(0.71) 0.00

(0.71) 0.49

(0.99) Bt-F1 2.75

(9.02) 4.21

(11.60) 11.41

(19.57) 5.30

(13.27) 0.00

(0.71) 0.25

(0.84) 0.00

(0.71) 0.08

(0.76) 0.00

(0.71) 0.00

(0.71) 0.00

(0.71) 0.08 (0.76

SEm± 5.32 8.35 2.39 1.43 0.18 0.18 0.15 0.14 0.17 0.15 0.15 0.14 C.D. at 5% 11.35 17.79 5.10 3.04 0.39 0.38 0.33 0.29 0.36 0.33 0.33 0.29

*Figures in parentheses are transformed by arc-sin transformation. **Figures in parentheses are transformed by √ x + 0.5 transformation

Green Boll Locule Damage (%)

At 70 DAS, lowest green boll locule damage was recorded on MRC Bt-F1 cotton (2.75%) followed by MRC Bt-F2 (6.25%), JKCH Bt-F1 (6.76%) and JKCH Bt-F2 cotton (9.33%) and significantly high on MRC non-Bt (26.02%) and JKCH non-Bt cotton (13.09%). Almost similar trend was also recorded in term of locule damage at 90 DAS. Similarly, significantly lowest damage was noted on MRC Bt F1 cotton (11.41%) as compared to other hybrid tested at 105 DAS. The locule damage (13.03% and 14.20%) was recorded in JKCH Bt F1 and MRC Bt F2 cotton, respectively, but both were statistically at par regarding locule damage. But, significantly higher locule damage was recorded on MRC non-Bt (24.88%) and JKCH non-Bt cotton (22.43%) compared with all Bt hybrids tested (Table 2).

The lowest locule damage was recorded on MRC Bt-F1 cotton (5.30%) as compared to other treatments. The locule damage (8.12 and 8.59%) was observed in MRC Bt-F2 and JKCH Bt F1 cotton respectively, both were found at par but significantly higher locule damage was recorded on JKCH Bt-F2 (12.48%), MRC non-Bt (13.37%) and JKCH non-Bt (17.37%).

Earias sp. Larval Incidence

The larval population was almost negligible on MRC Bt-F1 cotton (Table 2), while least larval population was recorded on JKCH Bt-F1 cotton (0.50 l/boll) followed by MRC Bt-F2 cotton (0.75 l/20 bolls), at 70 DAS. The highest larvae were recorded on JKCH non-Bt cotton (1.50 l/20 bolls) followed by that of MRC non-Bt cotton (1.00 l/20 bolls)

At 90 DAS, lowest Earias sp. larvae were recorded on MRC Bt-F1 cotton (0.25 l/20 bolls) and found at par with MRC Bt-F2 cotton (0.50 l/boll), JKCH Bt-F1 (0.50 l/boll) and JKCH Bt-F2 cotton (1.25 l/bolls). All Bt cotton hybrids were found significantly superior to JKCH non-Bt and MRC non-Bt cotton with a mean of 2.75 and 1.75 l/20 bolls, respectively.

On the basis of seasonal dynamics of Earias sp., larval population was lowest on MRC Bt-F1 cotton (0.08 l/boll) and at par with MRC Bt-F2 (0.42 l/boll) and JKCH Bt-F1 cotton (0.42 l/boll), whereas, it was found significantly superior to JKCH Bt-F2 cotton (1.25 l/boll), MRC non-Bt (1.50 l/boll) and JKCH non-Bt cotton (2.09 l/boll) (Table 2).


P. gossypiella Larval Incidence

P. gossypiella larval incidence was none on MRC Bt-F1 and JKCH Bt-F1 cotton, while least larval population was recorded in MRC Bt-F2 (0.25 l/20 bolls), JKCH Bt-F2 (0.25 l/20 bolls), MRC non-Bt (0.25 l/20 bolls) and JK non-Bt cotton (0.50 l/20 bolls) and were at par with each other at 70 DAS (Table 2).

At 90 DAS, no P. gossypiella larvae were recorded on MRC Bt-F1 and MRC Bt-F2 cotton but least recorded on JKCH Bt-F1 cotton (0.25 l/boll). Significantly higher larval population was recorded on MRC non-Bt (1.75 l/20 bolls) and JKCH non-Bt cotton (2.80 l/boll) from Bt cotton hybrids tested. Similar trend was also recorded regarding P. gossypiella larval incidence on different Bt and non-Bt cotton hybrids at 105 DAS.

The larval population of P. gossypiella was lowest on MRC Bt-F1 cotton (0.08 l/boll) and was at par with JKCH Bt-F1 cotton (0.42 l/boll) and Bt-F2 (0.49 l/boll). The significantly higher population of P. gossypiella was recorded in MRC Bt F2 and JKCH Bt F2 followed by that of JKCH non-Bt (1.75 l/boll) and MRC non-Bt cotton (1.09 l/boll) (Table-2).

Fruiting Bodies (Shedding) Damage (%), Green Boll Damage and H. Armigera Survival under Caged and Un-caged Conditions During 2007 H. armigera larvae were released under caged and un-caged condition coincided with natural infestation in un-caged plants of different Bt cotton and non-Bt cotton hybrids. To evaluate the performance of F1 and F2 of MRC7017Bt and JKCH1947Bt against H. armigera under high pressure of artificial infestation was recorded in term of fruiting bodies damage (%), green boll damage (%) and H. armigera larval survival (%) at 12 days after larval released (Table 3).

TABLE 3: COMPARATIVE PERFORMANCE OF BGII AND JKCH-1947 UNDER ARTIFICIAL RELEASE OF H. ARMIGERA DURING, KHARIF, 2007

Hybrids

Damage (%) at 12 DAR* H. Armigera Survival (%) at 12 DAR* Shedding Green Bolls Damaged (%)

C UC Mean C UC Mean C UC Mean JKCH 1947Bt

Non-Bt 37.50 (37.71) 36.25 (37.01) 36.87 14.00 (21.71) 10.56 (18.96) 12.26 14.00 (21.71) 9.0 (17.13) 11.50 Bt-F2 16.25 (23.59) 16.25 (23.59) 16.25 7.00 (14.29) 5.21 (13.04) 6.10 7.00 (14.29) 4.0(10.89) 5.50 Bt-F1 6.25(12.33) 6.25 (12.33) 6.25 0.00 (4.06) 1.85 (7.81) 0.92 0.00 (4.06) 0.00(4.06) 0.00

MRC 7017Bt Non-Bt 41.25 (39.94) 40.00 (39.20) 40.62 13.00 (20.88) 12.84 (20.81) 12.92 13.00 (20.88) 6.00(13.72) 9.50 Bt-F2 11.25 (19.52) 6.25 (12.33) 8.75 3.00 (9.67) 1.38 (6.60) 2.19 3.00 (9.67) 3.00(9.67) 3.00 Bt-F1 2.50 (7.65) 2.50 (7.65) 2.50 0.00 (4.05) 0.29 (4.20) 0.15 0.00 (4.06) 0.00(4.06) 0.00 SEm± 4.07 4.44 3.12 1.06 3.12 2.67

CD at 5% 8.67 9.47 6.65 2.26 6.65 5.69 *Figures in parentheses are transformed by arc-sin transformation. **Figures in parentheses are transformed by √ x + 0.5 transformation

Shedding Damage (%)

Under caged conditions, minimum shedding damage due to the artificial release of H. armigera was recorded with a mean of 2.5% in MRC Bt-F1 cotton and JKCH Bt-F1 cotton (6.25 %), respectively, both at par to each other. Similarly medium shedding damage was recorded in MRC Bt-F2 (11.25 %) and JKCH Bt-F2 cotton (16.25%). While significantly higher shedding damage (41.25 and 37.50%) was recorded on MRC non-Bt and JKCH non-Bt cotton, respectively than all the Bt cotton hybrids tested.

Under un-caged condition, significantly least shedding damage was recorded on MRC Bt-F1 cotton (2.5%), as compared to other treatments. Medium shedding damage (6.25%) was recorded in MRC Bt-F2 and JKCH Bt-F1 cotton, while, significantly higher shedding damage was recorded in JKCH Bt-F2 cotton (16.25%) followed by that on JKCH non-Bt cotton (36.25%) and MRC non-Bt (40.62%).


Green Boll Damage (%)

Almost negligible green boll damage (%) was recorded on MRC Bt-F1 and JKCH Bt-F1 cotton under caged conditions but both were found at par with MRC F2 cotton (3%), whereas, these were significantly higher than JKCH Bt-F2 (7.00%), JKCH non-Bt (14%) and MRC non-Bt cotton (13%).

Similarly, lowest green boll damage observed on MRC Bt-F1 cotton (0.29%) followed by that of MRC Bt- F2 (1.38%) and JKCH Bt-F1 cotton (1.85%) under un-caged condition. However, these were found significantly superior in term of green boll damage with the mean of 5.21 10.56 and 12.84% observed in JKCH Bt F2, JKCH non-Bt cotton (10.56%) and MRC non-Bt, respectively.

On the basis of mean of caged and un caged condition minimum green boll damage was recorded on MRC Bt-F1 cotton (0.15%), followed by JKCH Bt-F1 (0.92%), MRC Bt-F2 (2.19%) and JKCH Bt-F2 cotton (6.10%). However, higher green boll damage was recorded on MRC non-Bt (12.92%) and JKCH non-Bt cotton (12.26%).

H. armigera Larval Survival (%) at 12 Days after Release

The larval survival (%) of H. armigera was none on MRC Bt-F1 and JKCH Bt-F1 cotton, under caged conditions, while lowest recorded on MRC Bt-F2 cotton (3%) followed by JKCH Bt-F2 cotton (7%) both were found at par regarding larval survival (%). However, larval survival was observed highest on MRC non-Bt (13%) and JKCH non-Bt cotton (14%).

Under un-caged conditions, H. armigera larval survival (%) was none on MRC Bt-F1 and JKCH Bt-F1 cotton, whereas, lowest recorded on MRC Bt-F2 (3%) followed by JKCH Bt-F2 cotton (4%) However, significantly higher larval survival (%) was recorded on MRC non-Bt (6%) and JKCH non-Bt cotton (9%). Larval survival on JKCH non-Bt cotton was significantly higher from all other hybrids even MRC non-Bt cotton. In contrast the larval survival was higher under caged conditions compared with un-caged conditions.

Mean H. armigera survival was recorded zero on MRC Bt-F1 and JKCH Bt-F1 cotton, whereas, least recorded on MRC Bt-F2 cotton (3%), followed by JKCH Bt-F2 (5.5%), MRC non-Bt (9.5%) and JKCH non-Bt cotton (11.50%). Data revealed that the Bt-F1 cotton hybrids were superior over Bt-F2 and non-Bt cotton hybrids with zero % H. armigera survival. However, Bt-F2 hybrids were found significantly superior over non-Bt hybrids in term of H. armigera survival.

Open Boll Locule Damage (%) and P. gossypiella Larval Incidence at Different DAS

MRC Bt-F1 cotton had minimum open boll damage (4.71%) which was at par with JKCH Bt-F1 cotton (6.12%), and both were found significantly to JKCH Bt-F2 (10.81%) and MRC Bt-F2 cotton (10.83%), JKCH non-Bt cotton (25.36%) and MRC non-Bt (28.37%) at 127 DAS (Table 4).

TABLE 4: COMPARATIVE PERFORMANCE OF MRC 7017BT AND JKCH 1947BT AGAINST INFESTATION AND LARVAL POPULATION OF P. GOSSYPIELLA AND SEED COTTON

Hybrids

Open Boll Locules Damage (%) at DAS* P. gossypiella Larvae/ Open Bolls** Seed Cotton Damage (%)*

Seed Cotton Yield (q/ha) 127 160 Mean 127 160 Mean

JKCH 1947Bt Non-Bt 25.36 (30.06) 27.13 (31.27) 26.25 (30.78) 0.75 (1.09) 1.00 (1.18) 0.87 (1.14) 11.72 (19.88) 16.08 Bt-F2 10.81(18.94) 13.80 (21.61) 12.31 (20.384) 0.50 (0.97) 0.75 (1.09) 0.63 (1.06) 6.38 (14.55) 21.08 Bt-F1 6.12 (14.10) 8.45 (16.79) 7.29 (15.56) 0.00 (0.71) 0.25 (0.84) 0.12 (0.78) 3.72 (11.08) 23.15

MRC 7017Bt Non-Bt 28.37 (32.06) 34.05 (35.63) 31.21 (33.89) 0.75 (1.10) 1.25 (1.31) 1.00 (1.21) 14.52 (22.23) 15.91 Bt-F2 10.83 (19.04) 10.78 (18.96) 10.81(19.04) 0.00 (0.71) 0.50 (0.97) 0.25 (0.85) 3.47 (10.33) 22.76 Bt-F1 4.71(12.37) 9.01(17.40) 6.80 (15.04) 0.00 (0.71) 0.00 (0.71) 0.00(0.71) 2.23 (8.48) 27.00 SEm± 2.20 2.58 1.80 0.14 0.17 0.12 1.91 1.01

CD at 5 % 4.69 5.49 3.85 0.30 0.37 0.26 4.07 2.14 *Figures in parentheses are transformed by arc-sin transformation. **Figures in parentheses are transformed by √ x + 0.5 transformation


The lowest locule damage was recorded on JKCH Bt-F1 cotton (8.45%), followed by MRC Bt-F1 (9.01%) and MRC Bt-F2 (10.78%) and these were found to JKCH Bt-F2 cotton (13.80%), JKCH non-Bt (27.13%) and MRC non-Bt (34.05%) at 160 DAS.

The mean locule damage (6.80 and 7.29%) was lowest on MRC Bt-F1 cotton and JKCH Bt-F1, respectively. Similarly, medium infestation of locule damage (10.81 and 12.31%) was observed on MRC Bt-F2 and JKCH Bt-F2, respectively. However, significantly higher locule damage was recoded on MRC non-Bt (31.21%) and JKCH non-Bt cotton (26.25%) from all the Bt cotton hybrids tested.

There was no single larvae of P. gossypiella was observed on MRC Bt-F1, MRC Bt-F2, JKCH Bt-F1 cotton but, least larval population was recorded on JKCH Bt-F2 cotton (0.50 l/boll) followed by that of MRC non-Bt (0.75 l/boll) and JKCH non-Bt cotton (0.75 l/boll) at 127 DAS and these were found at par to each other in relation to larval population. Almost similar results were obtained at 160 DAS regarding larval population of P. gossypiella but, least population were recorded on MRC Bt- F2 (0.50 l/boll) followed by MRC non-Bt (1.00 l/boll) and JKCH non-Bt (1.25 l/boll).

On the basis of the mean of larval population/bolls, there were no single larvae observed on MRC Bt-F1, and JKCH1947Bt F1, but lowest recorded on MRC Bt-F2 (0.25 l/boll). However, significantly higher larvae were recorded on JKCH Bt-F2 cotton (0.63 l/boll), JKCH non-Bt (0.87 l/boll), MRC non-Bt (1.0 l/boll) (Table 4).

Seed Cotton Damage (%) and Seed Cotton Yield (q/ha)

The data were recorded on seed cotton damage and seed cotton yield (q/ha) for comparative yield performance of different Bt and non-Bt cotton hybrids (Table-4).

The seed cotton damage (2.23, 3.47, 3.77, 16.38, 14.32 and 19.80%) was recorded on MRC Bt-F1 MRC Bt-F2 JKCH Bt-F1 and JKCH Bt-F2, MRC non-Bt and JKCH non-Bt cotton, respectively. The F1, F2 of MRC Bt and JKCH Bt were found significantly superior to non-Bt cotton regarding damaged seed cotton due to bollworms infestation.

The highest seed cotton yield (27.00 q/ha) was recorded in MRC Bt F1 followed by JKCH Bt (23.15 q/ha), MRC Bt F2 (22.76 q /ha, JKCH Bt F2 (21.08 q/ha), JKCH non-Bt (16.08 q/ha) and MRC non-Bt 7017 (15.91 q/ha). The MRC Bt F1 was found to be significantly superior among the entire hybrid tested, whereas, JKCH F1 was statistically at par with MRC Bt F2 regarding yield, both had significantly more yield than the non-Bt of JKCH and MRC (Table 4).

During these studies, less infestation due to bollworms complex like Earias sp., H. armigera and P. gossypiella was observed on MRC Bt- F1 cotton and JKCH Bt F1 and both the hybrid found significantly superior to other treatments. Similarly infestation of bollworms was recoded in terms of terminal bud damage, fruiting bodies damage, green boll locule damage, open boll locule damage; seed cotton % damage was observed less in MRC Bt-F1 cotton as compared to JKCH Bt-F1 cotton. The MRC Bt-F2 cotton showed less bollworms incidence and damage to the cotton plants or different parts than JKCH Bt-F2 and non-Bt of both cotton. The seed cotton yield (27 q/ha) was significantly higher in MRC Bt-F1 than JKCH Bt-F1, whereas seed cotton yield of MRC Bt-F2 cotton was at par with JKCH Bt-F1 and Bt-F2, but higher than those of both non-Bt cotton. These results are in agreement with the findings of Jackson et al. (2003) who reported the effectiveness of Bollgard-II cotton against H. zea incidence regarding less squares and bolls damage. Udikere et al. (2003) showed that the three Bt cotton hybrids, MECH-12Bt, MECH-162Bt and MECH-184 were able to reduce larval populations of H. armigera up to 40%, E. vitella up to 30-40% and P. gossypiella up to 60-80% in south India. The dual gene cotton like MRC 7017Bt with cry1Ac + cry2Ab genes found superior, as compared to Bollgard cotton against bollworms incidence (Adamczyk et al., 2001) and He et al. (2004) reported that Bt cotton SGK-321 with cry1Ac + cpTi genes was most effective against O. furnacalis (in artificial release) than GK2Bt (with cry1Ac gene) and non-Bt counterparts. Bt cotton with dual stacked genes showed better efficacy against pink bollworm and tobacco caterpillar in India (Badiger et al., 2011).


The H. armigera larval survival after artificial release under caged and un-caged conditions was very less on MRC Bt-F1 cotton than JKCH Bt-F1, and Bt-F2 and non-Bt of both the cotton hybrids tested. Halcomb et al. (2000) reported that Bt cotton showed lower fruiting bodies damage and less larval survival of H. virescens and H. zea after 48 hr after infestation, compared with non-Bt-cotton. Parker and Luttrell (1999) reported interplant movement of H. virescens larvae from Bt cotton Event 531 (with cry1Ac) to non-Bt (Coker 312) cotton planted in pure and mixed form and less fruiting bodies damage on Bt cotton than non-Bt cotton..

In the present studies, MRC Bt-F1 cotton was found superior over all the Bt-F1, Bt-F2 and non-Bt cotton hybrids tested with lower bollworms incidence, higher seed cotton yield and least P. gossypiella larvae carry over for next season in the field.

Surulivelu et al. (2004) reported significantly low P. gossypiella incidence (0-0.5 larva/20 green bolls) in RCH2Bt, RCH20Bt, RCH144Bt and MECH162Bt cotton than non-Bt (1.3 to 2.2 l/boll) cotton hybrids and conventional cotton. The Bt cotton lines viz., Coker-312 Bt, -62 Bt, -65 Bt and -82 Bt with cry1Ac gene was found superior with 95% less rosetted blooms and 97-99% less seed damaged than non-Bt (MD51 ne) cotton (Wilson et al., 1992). Liu et al. (2001) reported that Bt cotton with cry1Ac gene was found more effective against susceptible and resistant strains of P. gossypiella. Ameta and Sarangdevot (2007) reported that highest seed cotton yield 30.14 q/ha was recoded in RCH- 134 followed by MRC- (27.96 q /ha), Ankur 09 (26.43 q/ha) and Ankur – 651 (24.65 q/ha) and also observed that among the bollworms, population of Earias spp and H. armigera was very low and they did not inflict damage to square flower and green bolls, but open boll and locule damage was ranged from 4.25 in RCH – 134 to 11.15 % in Ankur 651 Bt. Success of Bt crops in delaying substantial resistance evolution in the target pests could be attributed to many ecological factors and resistance management tactics (Tabashnik et al., 2003; 2009).

Acknowledgements: Authors are grateful to the Director, IARI for providing infrastructure and encouragement for the research work reported herein.

REFERENCES [1] Adamczyk, J.J, Adams, L.C. and Hardee, D.D. (2001). Field efficacy and seasonal expression profiles for terminal leaves of

single and double Bacillus thuringiensis toxin cotton genotypes. J. Econ. Entomol., 94: 1589-1593. [2] Ameta , O.P. and Sarangdevot ,S. S. (2007). Evaluation of Bt cotton Varieties against insect pest of cotton in southeren

Rajasthan. Insect Environment, 12(4): 159-161. [3] Badiger, H.K., Patil, S.B., Udikeri, S.S., Birader, D.P., Chattannavar, S.N., Mallapur, C.P. and [4] Patil, B.R. (2011). Comparative efficacy of interspecific cotton hybrids containing single and stacked Bt genes against pink

bollworm, Pectinophora gossypiella (Saund.) and tobacco caterpillar, Spodoptera litura (Fab.). Karnataka J. Agric. Sci.,24 (3) : (320 - 324) 2011

[5] Bambawale, O.M. Singh,A., Sharma, O.P., Bhosle, B.B., Lavekar, R.C., Dhandapani,A., Kanwar,V., Tanwar, R.K., Rathod, K.S., Patange, N.R. and Pawar, V.M. (2004). Performance of Bt cotton (MECH-162) under Integrated Pest management in farmers participatory field trial in Nanded district, central India. Curr. Sci., 86: 1628-1633.

[6] Dhawan, A. K., Sindhu, A.S. and Simwat, G.S. (1988). Assesment of avoidable losses due sucking pests and boo worms in cotton. Indian J. Agril. Sci., 58: 290-292.

[7] Dhawan, A.K., Sohi, A.S. Sharma, M., Kumar,T. and Brar, K.S. (2004). Insecticides resistance management in cotton. Department of Entomology, PAU, Ludhiana, India.pp 56.

[8] Ghose, P.K. (2001). Genetically modified crop in India with special reference to Bt cotton.IPM Mits, 1: 8-27. [9] Halcomb, J.L., Benedict, J.H., Cook, B. Ring, D.R. and Correa, J.C. (2000). Feeding behaviour of bollworm and tobacco

budworm (Lepidoptera: Noctuidae) larvae in mixed stands of non transgenic and transgenic cotton expressing an insecticidal protein. J. Econ. Entomol., 93: 1300-1307.

[10] He, K., Wang, Z., Bai, S., Zheng, L. and Wang, Y. (2004). Field efficacy of transgenic cotton containing single and double toxin genes against the Asian corn borer (Lepidoptera: Pyralidae). J. Appl. Entomol., 128: 710-715.

[11] Herring, R.J. (2008). Whose numbers count? Probing discrepant evidence on transgenic cotton in the Warangal district of India. Int. J. Multiple Res. Approaches 2: 145-159

[12] Jackson, R.E., Bradley, J.R. and Duyn Van, J.W. (2003). Field performance of transgenic cotton expressing one or two Bacillus thuringiensis endotoxins against Bollworm, Helicoverpa zea (Boddie). J. Cotton. Sci., 7: 57-64.

[13] James, C. (2007). Global status of Commercialized Biotech/ GM crops: 2007. ISAAA Briefs. No.37, ISAAA, Ithaca, NY. pp. 1-120 (http//www.isaaa.org.).

[14] James, C. (2003). Global status of commercialized transgenic crop, 2003.ISAAA Brief No.30. Ithaca, New York. pp. 123.


[15] Jayaraman, K.S. (2004). India produces homegrown GM cotton. Nature Biotechnology 22:255-256 [16] Khadi, B.M., Rao, M.R.K. and Singh, M. (2007). Potential to improve lives of ryots. The HINDU Survey of Indian

Agriculture 2007, pp. 67-70. [17] Kranthi, K.R., Kranthi, S., Wanjari, R.R., 2001. Baseline susceptibility of CryI toxins to Helicoverpa armigera (Hubner)

(Lepidoptera: Noctuidae) in India. Int. J. Pest Manage. 47: 141–145. [18] Liu, Y.B., Tabashnik, B.E., Dennehy, T.J. Patin, A.L., Sims, M.A., Meyer, S.K. and Carrière, Y. 2001. Effects of Bt Cotton

and Cry1Ac Toxin on Survival and Development of Pink Bollworm (Lepidoptera: Gelechiidae). J. Econ. Entomol. 94: 1237-1242.

[19] Luttrell, R.G., Abbas, A., Young, S.Y. and Knighten, K. (1998). Relative activity of commercial formulations of Bacillus thuringiensis against selected noctuid larvae (Lepidoptera: Noctuidae) J. Entomol. Sci., 33: 365-377.

[20] McCaffery, A.R. (1999). Resistance to insecticides in Heliothine, Lepidoptera: a global view. Insecticide Resistance from Mechanisms to Management (ed. by I. Denholm, J.A. Pickett and A.L. Devonshire), CABI and the Royal Society, London, UK, pp 59-74.

[21] Monga, D. (2008). Problems and Prospects of Cultivation of Bt Hybrids in North Indian Cotton [22] Zone. http://www.icac.org/tis/regional_networks/documents/asian/papers/monga.pdf [23] Panchabhavi, K.S., Kulkarani, K.A.,Veeresh, G.L.Hiremata P.C. and Hedge, P.K.1990.Comparative efficacy of techniques

for assessing loss due to insect pest in upland cotton (G, hirsutam). Indian J Agric. Sci., 60: 252-254. [24] Parker, C.D. and Luttrell, R.G. (1999). Interplant movement of Heliothis virescens (Lepidoptera: Noctuidae) larvae in pure

and mixed plantings of cotton with and without expression of the Cry1Ac δ-endotoxin protein of Bacills thuringiensis Berliner. J. Econ. Entomol., 92: 837-845.

[25] Patil, B.V. (1998). Developing IPM Schedule. Proc. Seminar on IPM special issue, ICPA, Mumbai PP. 107-110. [26] Patil, B.V., Bheemanna, M., Hanchinal, S.G. and Kengegowda, N. (2004). Performance and economics of Bt cotton

cultivation in irrigated ecosystem. In: Int. symposium on “strategies for sustainable cotton production-A Global vision” 3. Crop Protection, 23-25 November2004, UAS, Dharwad, Karnataka (India), pp.139-142.

[27] Quam, A. and Sakkhari, K. (2003). Did Bt cotton save farmers in Warangal? A season long impact study of Bt cotton- Kharif 2002 in warangal district of Andhra Pradesh. AP coali tion I defence of diversity and Decan development society, Hyderabad, June 2003.

[28] Surulivelu, T., Sumathi, E., Mathirajan, V.G. and Rajendran, T.P. (2004). Temporal distribution of pink bollworm in Bt cotton hybrids.). In: Int. symposium on “strategies for sustainable cotton production-A Global vision” 3. Crop Protection, 23-25 November 2004, UAS, Dharwad, Karnataka (India), pp.86-88.

[29] Tabashnik, B.E., Carriere, Y., Dennehy, T.J., Morin, S., Sisterson, M.S., Roush, R.T., Shelton, A.M. and Zhao, J.Z. (2003). Insect resistance to transgenic Bt crops: lessons from the laboratory and field. J. Econ. Entomol. 96: 1031-1038.

[30] Tabashnik, B.E., van Rensburg, J.B.J. and Carriere, Y. (2009). Field-evolved insect resistance to Bt crops: Definition, theory, and data. J. Econ. Entomol. 102: 2011-2025.

[31] Udikeri, S.S., Patil, S.B., Nadaf, A.M. and Khadi, B.M. (2003). Performance of Bt-Cotton genotypes under unprotected conditions. In proceedings World Cotton Research Conference-3 (ed. Swane-poel, A.) Agricultural Research Council-II, Cape Town, South Africa, pp.1282-1286.

[32] Wilson, F.D., Flint, H.M., Deaton, W.R., Fischhoff, D.A., Perlak, F.J., Armstrong, T.A., Fuchs, R.L., Berberich, S.A., Parks, N.J. and Stapp, B.R. (1992). Resistance of cotton lines containing a Bacillus thuringiensis toxin to pink bollworm (Lepidoptera: Gelechidae) and other insects. J. Econ. Entomol., 85: 1516-1521.

Intrinsic Rate of Increase and Life Parameters of Cotton Leaf Eating Caterpillar Spodoptera litura

on Bollgard II Hybrids

Golla M.V. Prasada Rao1, T. Sujatha2, G.A.D. Grace3, N.V.V.S.D. Prasad4 and V. Chenga Reddy5

1,4(Entomology), 5Principal Scientist (Cotton)–All India Coordinated Cotton Improvement Project, Regional Agricultural Research Station, Lam, Guntur, Andhra Pradesh–522 034

2,3Department of Entomology, Regional Agricultural Research Station, Lam, Guntur, Andhra Pradesh–522 034

Abstract—The Bt cotton area in India increased from 0.5 lakh ha in 2002-2003 to 11.00 million lakh ha in 2010-11. The Bt technology has been highly effective against major bollworms of cotton. However, Bt cotton hybrids, containing single (Cry 1 Ac) and double (Cry 1 Ac and Cry 2 Ab) genes, are not very effective against Spodoptera litura which is causing damage to Bt cotton. With this background study was conducted during 2010 season to know the intrinsic rate of increase of S. Litura on four popularly grown Bollgard II cotton hybrids and life parameters of the pest were computed in comparison with their counterpart Bollgard and NBt hybrids. The methods suggested by Morris and Miller and Chaudhary and Bhattacharya were used for constructing the life tables. For computing various life parameters a computer programme was developed using MS-Excel. All the life parameters of the pest were significantly and negatively affected on Bollgard II hybrids. Net reproductive rate (Ro) on Bollgard II hybrids ranged from 16.36 to 22.53, whereas it ranged from 43.89 to 61.17 on Bollgard hybrids and it ranged from 86.79 to 108.22 on NBt hybrids. Potential fecundity (Pf) of the pest was also negatively affected and pf ranged from 635 to 880 on Bollgard II hybrids, while it ranged from 906 to 1120 on Bollgard hybrids. Highest Pf was recorded on NBt hybrids (1182 to 1333). Mean generation time was higher on Bollgard II hybrids followed by Bollgard and NBt hybrids. Lowest mean generation time (Tc) of 49.92 days was recorded on Bunny NBt and highest Tc of 57.67 day was recorded in Mallika BG II. The intrinsic rate of increase (rc) ranged from 0.05 to 0.09 females / female / day. Lowest rc was recorded in Bollgard II hybrids and highest rc of 0.09 was recorded in NBt hybrids. In Bollgard hybrids rc ranged from 0.07-0.08. Insect could double its numbers around week days in NBt, nine days in Bollgard and around two weeks in Bollgard II hybrids. Lowest weekly multiplication rate of 1.40 times was recorded in Mallika BGII and highest rate of 1.91 times was recorded in Tulasi NBt. Among the four hybrids tested, the effect of toxins on the growth and development of the pest was highest in Mallika hybrids. The Bollgard II hybrids have significantly negative effect on the growth and development of S. Litura.

Cotton is an important fibre of India and cultivated in an area of 11.00 million ha with a production of 325.50 lakh bales and productivity of 503 kg/ha (AICCIP 2010-11). Introduction of Bt cotton has revolutionized the cotton production in India as the cotton production prior to 2002 suffered huge losses due to its susceptibility to insect pests (CICR, 2009). Transgenics of cotton with Bacillus thuringiensis var. kurstaki genes encoding Cry1Ac proteins have been first introduced with the expectations of reduction in number of pesticide applications, increase in natural enemies, and reduction in farmer’s exposure to pesticides. (Gianessi and Carpenter, 1999). The Cry 1 Ac provides control of the American bollworm Helicoverpa armigera, pink bollworm, Pectinophora gossypiella and spotted bollworm, Earias vitella. However, it is less effective for the control of beet armyworm, Spodoptera exigua and fall armyworm, Spodoptera frugiperda (Macintosch et al., 1990; Adamczyk et al., 1998). Likewise, the tobacco caterpillar Spodoptera litura is also less susceptible to Bollgard cotton containing Cry 1 Ac (Bheemanna et al., 2008, Lakshmi Sowjanya, 2008 and Sivasupramaniam et al., 2008). Bollgard II cotton (Cry 1 Ac and Cry 2 Ab) was commercially released and was found to have superior insecticidal activity compared to bollgard and in particular to augment late season insect control (Akin et al., 2001 and Jackson et al., 2002). The dual gene technology is being considered as an improvised pest management method not just for its enhanced efficacy but also as an efficient resistance management

29

Intrinsic Rate of Increase and Life Parameters of Cotton Leaf Eating Caterpillar Spodoptera litura on Bollgard II Hybrids 175

strategy. The addition of other Cry proteins stacked with Cry 1Ac has improved the efficacy against army worms (Adamczyk et al., 2001; Stewart et al., 2001; Adamczyk & Gore 2004). The present study aims to understand the effect of Bollgard cotton hybrids on the growth and development of S. litura through laboratory life table studies.

MATERIAL AND METHODS

A laboratory culture of S. Litura was maintained on fresh leaves of NBt cotton at 25 ± 2 0 C and 75 ± 3 % relative humidity. The adults were fed a liquid diet containing honey and sugar and paired in separate containers where they were allowed to lay eggs on folded papers. The hatchability of eggs of a cohort laid on a single day was initially determined by counting the number of eggs hatched in three replicates. Hundred larvae that hatched from one cohort of eggs were transferred to freshly plucked leaves of Bollgard, Bollgard II and NBt cotton hybrids viz., Mallika, Bunny, Tulasi and Rasi and maintained in ventilated plastic containers with wet cotton and filter paper to retain the turgidity of leaves. The larvae were maintained in groups of 20 for the initial five days to cater to their gregarious nature. Later, the larvae were maintained individually till death or pupation. Data on mortality were recorded everyday till all the adults died. The methods suggested by Morris and Miller (1954) and Chaudhary and Bhattacharya (1986) were used for constructing the life tables and for computing various life parameters a computer programme developed using MS-Excel was used for processing the data.


Age specific survivorship and mortality of S .litura on different Bollgard II, Bollgard and NBt cotton hybrids are presented in figures 1-12. Survival of early instars was very low when reared on Bollgard II hybrids which dropped sharply by 10th day and ranged from 46 to 62 %. Lowest survival per cent of 46 was recorded on Mallika, followed by in Tulasi (53 %) and highest survival per cent 62% was recorded in Rasi and Bunny hybrids. While, Bollgard and NBt hybrids survival per cent ranged from 70 to 88 and 78 to 94 respectively. Thus, toxin expression in Bollgard II hybrids proved very toxic to the early instar larvae of the test insect. Among the different Bollgard II hybrids tested Mallika BGII is more toxic than Tulasi, Rasi and Bunny. Among different hybrids age specific female survivorship was the highest in NBt hybrids (0.25-0.34) followed by Bollgard (0.17 to 0.26) and Bollgard II (0.07-0.11) indicating very low pupation and adult emergence in Bollgard II hybrids (Fig. 13-24). Lowest survivorship was recorded in Mallika BG II (0.07), followed by in Rasi BG II (0.10) and Tulasi BG II (0.11) and Bunny BG II (0.11).

A comparison of life parameters of S. Litura on Bollgard II, Bollgard and NBt cotton hybrids of Mallika, Tulasi, Rasi and Bunny has been presented in Table 1. The lowest net reproductive rate (R0) of S. Litura was recorded on Bollgard II followed by Bollgard and NBt hybrids. Similar trend was recorded with regard to other life parameters like potential fecundity, intrinsic rate of increase, finite rate of increase, annual rate of increase and weekly multiplication rate. Mean generation time (T) was the longest on Mallika BGII (57.67 days). Insect could double its numbers around week days in NBt, nine days in Bollgard and around two weeks in Bollgard II hybrids. Lowest weekly multiplication rate of 1.40 times was recorded in Mallika BGII and highest rate of 1.91 times was recorded in Tulasi NBt. Though the reaction of the pest to Bollgard II hybrids in terms of life parameters was found to be similar, the effect of toxin expression was stronger in Mallika hybrids compared to other test hybrids viz., Tulasi, Rasi and Bunny.


Fig. 1: Age Specific Survivorship (Ix) and Mortality (dx) of Spopdoptera Litura on Mallika BGII

Fig. 2: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Mallika BG

Fig. 3: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Mallika NBt

Fig. 4: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Tulasi BGII

0

20

40

60

80

100

120

1 3 5 7 9 1113 1517 1921 2325 27 29 31 3335 3739 4143 4547 4951 5355 57 59 61Age in days

Ix

02468101214161820

dx

lx

dx

0

20

40

60

80

100

120

1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59Age in days

Ix

02468101214161820

dx

lxdx

0

20

40

60

80

100

120

1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57Age in days

Ix

02468101214161820

dx

lxdx

p p

0

20

40

60

80

100

120

1 3 5 7 9 11 1315 17 19 21 23 25 27 29 31 3335 37 39 4143 45 4749 51 53 5557 59 61Age in days

Ix

0246810121416

dx

lxdx


Fig. 5: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Tulasi BG

Fig. 6: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Mallika NBt

Fig. 7: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Rasi BGII

Fig. 8: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Rasi BG

Tulasi BG

0

20

40

60

80

100

120

1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61Age in days

Ix

02468101214161820

dx

lxdx

0

20

40

60

80

100

120

1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55Age in days

Ix

02468101214161820

dx

lxdx

0

20

40

60

80

100

120

1 3 5 7 9 1113 15 1719 21 2325 27 29 3133 35 3739 41 4345 47 4951 53 5557 59 61Age in days

Ix

024681012141618

dx

lxdx

0

20

40

60

80

100

120

1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55Age in days

Ix

0

5

10

15

20

dx

lxdx


Fig. 9: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Rasi NBt

Fig. 10: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Bunny BGII

Fig. 11: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Bunny BG

Fig. 12: Age Specific Survivorship (Ix) and Mortality (dx) of Spodoptera Litura on Bunny NBt

on Rasi NBt

0

20

40

60

80

100

120

1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55Age in dyas

Ix

02468101214161820

dx

lxdx

y

0

20

40

60

80

100

120

1 3 5 7 9 11 13 15 1719 2123 2527 29 3133 3537 39 41 4345 4749 5153 55 5759 61Age in days

Ix

0

5

10

15

20

dx

lxdx

0

20

40

60

80

100

120

1 3 5 7 9 11 13 1517 19 21 23 25 27 29 31 33 3537 39 41 43 45 47 49 51 53 55 57 59Age in days

Ix

02468101214161820

dx

lxdx

0

20

40

60

80

100

120

1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55

Age in days

Ix

02468101214161820

dx

lxdx


Fig. 13: Age Specific Female Survivorship and Natality Rate of S. Litura on Mallika BGII

Fig. 14: Age Specific Female Survivorship and Natality Rate of S. Litura on Mallika BG

Fig. 15: Age Specific Female Survivorship and Natality Rate of S. Litura on Mallika NBt

Fig. 16: Age Specific Female Survivorship and Natality Rate of S. Litura on Tulasi BGII

0

0.005

0.01

0.015

0.02

0.025

56.5 57.5 58.5 59.5Pivotal age in days

Ix

0

50

100

150

200

250

300

350

400

mx

Ixmx

00.010.020.030.040.050.060.070.080.09

54.5 55.5 56.5 57.5 58.5Pivotal age in days

Ix

050100150200250300350400450

mx

Ixmx

00.010.020.030.040.050.060.070.080.090.1

51.5 52.5 53.5 54.5 55.5 56.5Pivotal age in days

Ix

050100

150200250300

350400

mx

Ixmx

0

0.01

0.02

0.03

0.04

0.05

0.06

1 2 3 4 5Pivotal age in days

Ix

0

50

100

150

200

250

300

mx

Ixmx


Fig. 17: Age Specific Female Survivorship and Natality rate of S. Litura on Tulasi BG

Fig. 18: Age Specific Female Survivorship and Natality Rate of S. Litura on Tulasi NBt

Fig. 19: Age Specific Female Survivorship and Natality rate of S. Litura on Rasi BGII

Fig. 20: Age Specific Female Survivorship and Natality rate of S. Litura on Rasi BG

0

0.02

0.04

0.06

0.08

0.1

0.12

49.5 50.5 51.5 52.5 53.5 54.5 54.5 54.5Pivotal age in days

Ix

0

50

100

150

200

250

300

350

mx

Ixmx

u as N t

00.020.04

0.060.080.1

0.12

0.140.16


Ix

050100150200250300350400450

mx

Ixmx

0

0.01

0.02

0.03

0.04

0.05

0.06


Ix

0

50

100

150

200

250

300

mx

Ixmx

00.010.020.030.040.050.060.070.080.09


Ix

050100

150200250300

350400

mx

Ixmx


Fig. 21: Age Specific Female Survivorship and Natality Rate of S. Litura on Rasi NBt

Fig. 22: Age Specific Female Survivorship and Natality Rate of S. Litura on Bunny BGII

Fig. 23: Age Specific Female Survivorship and Natality Rate of S. Litura on Bunny BG

Fig. 24: Age Specific Female Survivorship and Natality Rate of S. Litura on Bunny NBt

0

0.02

0.04

0.06

0.08

0.1

0.12

49.5 50.5 51.5 52.5 53.5Pivotal age in days

Ix

050100150200250300350400450500

mx

Ixmx

y

00.0050.01

0.0150.02

0.0250.03

0.0350.04

0.045


Ix

0

50

100

150

200

250

mx

Ixmx

y

0

0.02

0.04

0.06

0.08

0.1

0.12


Ix

0

50

100

150

200

250

300

350

mx

Ixmx

Bunny NBt

0

0.02

0.04

0.06

0.08

0.1

0.12

48.5 49.5 50.5 51.5 52.5 53.5

Pivotal age in days

Ix

050100150200250300350400450

mx

Ixmx


TABLE 1: LIFE TABLE PARAMETERS OF SPODOPTERA LITURA ON DIFFERENT COTTON GENOTYPES

S. No.

Life Parameter Bunny Mallika Rasi Tulasi NBt BG BGII NBt BG BGII NBt BG BGII NBt BG BGII

1 Net Reproductive Rate (R0)

89.43 61.17 18.54 90.55 60.67 16.36 86.79 43.89 22.53 108.22 52.12

20.36

2 Potential Fecundity (Pf) 1263 924 635 1312 1065 880 1333 1120 763 1182 906 737 3 Intrinsic rate of increase

(approximate) - rc 0.09 0.08 0.05 0.09 0.07 0.05 0.09 0.07 0.06 0.09 0.08 0.05

4 Mean Generation time (Tc) in days

49.92 50.45 55.84 52.80 55.57 57.67 50.61 50.76 56.40 50.60 50.55

56.78

5 Finite rate of increase (λ) 1.09 1.08 1.06 1.09 1.08 1.05 1.09 1.08 1.06 1.10 1.08 1.05 6 Doubling time (DT) 7.71 9.51 13.26 8.12 9.41 14.30 7.86 9.30 12.55 7.49 8.86 13.067 Annual rate of increase

(ARI) 1.86X101

4 8.44X101

2 1.9X 108

3.36X 1013

4.81X108

4.81X 107

9.5X 1013

6.4X 1011

5.6X 108

4.74X 1014

2.5X 1012

2.5X 108

8 Weekly multiplication 1.88 1.77 1.44 1.82 1.68 1.40 1.85 1.68 1.47 1.91 1.73 1.45

Adamczyk et al., (1998) and Stewart et al., (2001) reported little effect of Bt on various biological parameters of S. exigua, S. frugiperda and S. littoralis. Yu Yueshu et al., (2004) reported non significant differences between transgenic Bt cotton Kemian 1 and non-transgenic Bt cotton Yumian 1 in the rate of damage to leaves, flowers and buds due to S. Litura. Basavaraj et al ., (2008) also reported non-significant differences between Bt and NBt genotypes at 80, 120 and 140 days of crop age for various biological parameters viz., larval period, larval weight, larval survival, pupal period, pupal weight and Adult emergence. Whereas, Chitkowski et al., (2003) reported that the mortality of both S. frugiperda and S. exigua were significantly greater on Bollgard II plant material than on either Bollgard or conventional cotton. Similarly, Bheemanna et al., (2008), Lakshmi Sowjanya (2008) and Sivasupramaniam et al., (2008) also reported that Bollgard II traits were more efficacious against S. Litura with nil larval population compared to BG and non-Bt cotton traits. Adamczyk et al., (2008) evaluated Bollgard (Cry 1 Ac), Bollgard II (Cry 1 Ac + Cry 2 Ab) and Wide strike (Cry 1 Ac + Cry 1 F) technologies against beet armyworm, S. exigua and fall armyworm S. frugiperda. They reported that both dual gene traits are more efficacious against these armyworm species than Bollgard.

Thus, from the present study it is concluded that Bollgard II hybrids have significant negative effect on the growth and development of S. Litura which could delay the development of resistance to Cry toxins in the near future.

ACKNOWLEDGEMENT

The authors are highly thankful to the Associate Director of Research, Regional Agricultural Research Station, Lam, Guntur, for providing necessary facilities to carry out the research work.

REFERENCES [1] AICCIP, Annual Report (2010-2011) - All India Coordinated Cotton Improvement Project, Coimbatore, Tamil Nadu-641

003. [2] Adamczyk, Jr. J.J., Adams, L. C. and Hardee, D. D. (2001) - Field efficacy and seasonal expression profiles for terminal

leaves of single and double Bacillus thuringiensis toxin cotton Genotypes - J. Econ. Entomol, 94 (6):1589-1593. [3] Adamczyk, Jr. J.J., Mascarenhas, V.J., Church, G.E., Leonard, B.R. and Graves, J. B. (1998) - Susceptibility of

conventional and transgenic cotton bolls expressing the Bacillus thuringiensis Cry 1 Ac – endotoxin to fall armyworm (Lepidoptera: Noctuidae) and beet armyworm (Lepidoptera: Noctuidae) injury- J. Agric. Entomol, 15:163-171.

[4] Adamczyk, Jr., Greenberg, S., Armstrong, J.S and Mullins, W.J. (2008) - Evaluation of Bollgard II and widestrike technologies against beet and fall armyworm larvae (Lepidoptera: Noctuidae) - Florida Entomologist, 91 (4):532-536.

[5] Adamczyk, Jr., J.J and Gore, J. (2004)- Laboratory and field performance of cotton containing Cry 1Ac, Cry 1F, and both Cry 1Ac and Cry 1F (WideStrike) against beet army worm and fall armyworm larvae (Lepidoptera: Noctuidae) -Florida Entomol., 87: 427-432

[6] Akin, D. S., Stewart, S. D and Knighten, K. S. (2001) - Field efficacy of cotton expressing two insecticidal proteins of Bacillus thuringiensis. In: Dugger, P.A., Richter, D. (Eds.) - Proceedings of the Beltwide cotton conference- Vol.2. National Cotton Council, Memphis, USA. 1041-1043.

[7] Basavaraja, H., Chillar, B. S and Ram Singh.(2008)- Impact of transgenic Bt cotton on biological parameters of Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae) - Journal of Entomological Research, 32 (3):183-186.


[8] Bhemanna, M., Patil, B. V., Hosamani, A. C. and Bansi, A. B. (2008) - Comparative performance and economics of BG II Bt cotton under irrigated conditions- J. cotton res. and development, 22 (1): 118-121.

[9] Chaudhary, R. R. P and Bhattacharya, A. K. (1986) - Bioecology of lepidopterous insects on winged bean, Psophocarpus tetragonolobus (Linnaeus) De condole- Memoirs of the Entomological society of India, 11: 130p.

[10] Chitkowski, R. L., Turnipseed, S. G., Sullivan, M. J. and Bridges, W. C. (2003) - Field and Laboratory cultivation of transgenic Cottons expressing one or two Bacillus thuringiensis Var Kurtasaki, Berliner proteins for management of Noctuid pests - J. Economic Entomology, 96 (3):755-762.

[11] CICR (2009) - Cotton Database. Central Institute of Cotton Research, Nagpur. http://www. cicr.org.in. [12] Gianessi, L. P and Carpenter, J. E. (1999) - Agricultural biotechnology: Insect control benefits - Report from National

Centre for Food and Agricultural Policy, Washington: 63. [13] Jackson, R. E., Bradley, J. R., Burd, A. D., Van Duyn, J.W., (2002) - Field and greenhouse performance of bollworm on

Bollgard-II genotypes. In: Dugger, P.A., Richter, D. (Eds.), Proceedings of the Beltwide cotton conference, Vol.2. National Cotton Council, Memphis, USA. 1048-1051.

[14] Lakshmi Sowjanya, P. (2008) - Effect of Bt toxins (Cry1Ac and Cry 1Ac + Cry 2Ab) on the development and management of Bollworm complex with special reference to Pectinophora gossypiella (Saunders) and Spodoptera litura (Fabricius) on cotton - Ph.D (Ag.) Thesis, ANGRAU, Hyderabad.

[15] Macintosch, S.C., Stone, T. B., Sims, S. R., Hunst, P. L., Greenplate, J.T., Marrone, P.G., Perlak, F. J., Fischhoff, D. F. and Fuchs, R. L. (1990) - Specificity and efficacy of purified Bacillus thuringiensis proteins against agronomically important insects - J. Invertebr., Pathol., 56 : 258-266.

[16] Morris, R. F. and Miller, C. A. (1954) The development of life tables for the spruce bud worm - Canadian Journal of Zoology., 32: 283-301.

[17] Sivasupramaniam, S., Moar, W. J., Ruschke, L. G., Osborn, J. A., Jiang, C., Sebaugh, J. L., Brown, G. R., Shappley ,Z. W., Openhuizen, M. E., Mullins, J. W and Greenplate, J, T. (2008) - Toxicity and Characterization of Cotton expressing Bacillus thuringiensis Cry 1Ac and Cry2Ab2 proteins for control of Lepidopteran pests- J. Economic Entomology., 101(2):545-554.

[18] Stewart, S.D., Adamczyk, Jr. J.J., Knighten, K.S. and Davis, F.M. (2001) - Impact of Bt cotton expressing one or two insecticidal proteins of Bacillus thuringiensis Berliner on growth and survival of noctuid (Lepidoptera) larvae - J. Econ. Entomol., 94: 752-760.

[19] Yu Yueshu Kang Xiaoxia Lu Yanhui Liang Jiangya Wang Hong Wu Jieyun Yang Yizhong. (2004)-effects of the transgenic bt cotton on the increase in population of spodoptera litura fabricius - Jiangsu J. Agrl. Sci., 20(3): 169-172.

Field Efficacy of Widestrike™ Bt Cotton, Expressing Cry1Ac and Cry1F Proteins, Against Lepidopteran

Pests in India

Moudgal R.K.1, Chetan Chawda1, Gajendra Baktavachalam1 Sundara Rajan1 and Gary D. Thompson2

1DowAgroSciences India Pvt Ltd, Mumbai, India 2Dow AgroSciences LLC, Indianapolis, USA

E-mail: [email protected]

Abstract—Dow Agro Sciences India Pvt Ltd (DAS) has been developing Wide StrikeTM Bt cotton, a breeding stack of Cry 1F (event 281-24-236) and Cry1Ac (event 3006-210-23) in India since 2005. In this process, DAS has conducted Bio-safety Research Level (BRL) trials since 2008 in South and Central Zones of India with two cotton hybrids expressing the WideStrike traits namely WS103 and WS106. This article reports efficacy of WideStrike Bt cotton against Heliothis armigera and Spodoptera litura observed in the BRL trials. The trials demonstrate that WideStrike cotton provides effective, season-long, whole plant protection from lepidopteran insects leading to increased crop yields and productivity. Upon regulatory approval, introduction of WideStrike cotton in India will diversify the choice of insect protection traits available to the Indian farmers and enable effective management of H. armigera and S. litura in cotton. The availability of additional cotton insect traits will encourage more breeding efforts and contribute to resistance management and the longevity of all cotton insect traits. This product has already been approved for commercial cultivation in USA and Brazil and for feed/food import in Australia, Canada, Japan, Korea and Mexico.

Keywords: WideStrike, Transgenic Insect resistant Cotton, H. armigera, S. litura

INTRODUCTION

Insect resistant transgenic cotton hybrids introduced in India have revolutionized cotton production taking it up from 136 lakh bales in 2002-03 to 325 lakh bales in 2010-11 with lint productivity going up from 302 to 503 kg/Ha during the same period, as per Cotton Corporation of India (http://www.cotcorp.gov.in/statistics.asp#area). Productivity increase is mainly attributed to effective control of bollworms especially H. armigera through wide spread adoption of Bt cotton. Out of the estimated 11 MM Ha of cotton in India in 2010, 86% or 9.5 MM Ha was planted with Bt cotton hybrids which is a remarkably high proportion of Bt cotton in a fairly short period of nine years equivalent to an unprecedented 188-fold increase from 2002 to 2010 (James, 2010). Currently, commercial transgenic cotton in India expresses either one of these Bt proteins: Cry1Ac (MON531), Cry2Ab (MON15985), Truncated Cry1Ac (Event1), Cry1Ab/Cry1Ac (GFM Cry1Ac), Truncated Cry1Ac (Dharwad Event) and Cry1C (MLS9124).

Many surveys and estimates have shown unequivocal tangible economic benefits to farmers who grew Bt cotton and intangible benefits to farmers and society in terms of reduced use of pesticides in the environment and reduced exposure of farmers to pesticides. Subsequent to introduction of Bt cotton in India productivity nearly doubled from 308 kg per hectare in 2001 to 568 kg/ha in 2009. These gains resulted from average yields in Bt cotton hybrids that were approximately 50% higher than conventional cotton. To cite specific examples, Padaria et al (2009) reported that cultivation of Bt cotton in two key cotton states, Punjab and Andhra Pradesh, increased yield by approximately 67%; increased income by 142%, and reduced the frequency of insecticide spray by 62%. Savings from Bt cotton also includes reduced labor cost to produce the crop. At the aggregate level, Bt cotton is estimated to have enhanced Indian farm income by US$ 5.1 billion in the period 2002 to 2008 and by US$ 1.8 billion in 2008 alone (Brookes and Barfoot, 2010). At the individual farmer level, gains from Bt cotton in India have been estimated at US$ 156 per hectare. Additional aggregate benefits are 50% reductions in insecticide sprays and increased regional employment opportunities (Subramanian and Qaim, 2009).

30

Field Efficacy of Widestrike™ Bt Cotton, Expressing Cry1Ac and Cry1F Proteins, Against Lepidopteran Pests in India 185

In India, Dow AgroSciences India Pvt Ltd (DAS) has been developing WideStrike Bt cotton, a breeding stack of Cry1F (event 281-24-236) and Cry1Ac (event 3006-210-23) for controlling lepidopteran insect pests, since 2005. In this process, DAS had conducted Biosafety Research Level (BRL) trials since 2008 in South and Central Zones with two cotton hybrids expressing the WideStrike traits namely WS103 and WS106. This article reports efficacy of WideStrike Bt cotton against the H. armigera and S. litura observed in these BRL trials conducted in India.


Planting Material

The experimental material consisted of two WideStrike cotton hybrids (WS103 and WS106 which express the insecticidal proteins, Cry1Ac and Cry1F), their non-transgenic counterparts namely non-WS103 and non-WS106 along with commercial Bt cotton check, non-Bt hybrid check and non-Bt varietal check recommended for respective regions. Further details on Biosafety Research Level trials (BRLT) are furnished in Table 1.

TABLE: 1: DETAILS OF BIOSAFETY RESEARCH LEVEL TRIALS (BRLT) CONDUCTED BY DOW AGRO SCIENCES INDIA PVT. LTD. IN INDIA SINCE 2008

Details Biosafety Research Level – 1 Trial Biosafety Research Level–2 Trial Aurangabad (Maharashtra)

Vadodara (Gujarat)

Dharwad (Karnataka)

Hyderabad (Andhra Pradesh)

Attur (Tamil Nadu)

Dharwad (Karnataka)

Guntur (Andhra Pradesh)

Year and season

Kharif 2009 and Kharif 2010




Kharif 2010 Kharif 2010 Kharif 2010

Date of Sowing

11.07.2009 and 13.07.2010

07.07.2009 and 16.07.2010

04.07.2008 and 29.07.2009

08.07.2008 and17.07.2009

05.10.2010 04.09.2010 02.09.2010

Transgenic test hybrids

WS103 and WS106

WS103 and WS106

WS103 and WS106

WS103 and WS106

WS103 and WS106

WS103 and WS106

WS103 and WS106

Non-transgenic test hybrids

Non-WS103 and Non-WS106







Bt check Bunny BGI and Bunny BGII

RCH-2 BGI and RCH-2 BGII

Bunny BGI RCH-2 BGI RCH-2 BGI andRCH-2 BGII

Bunny BGI and Bunny BGII

Bunny BGI and Bunny BGII

Non-Bt hybrid check

H-8 and NHH-44

H-8 and H-12 Bunny Non-Bt and DHH-11

Bunny Non-Bt and LAHH-5

RCH-2 Non-Bt Bunny Non-Bt Bunny Non-Bt

Non-Bt varietal check

PKV Rajat G.Cot 16 Sahana Narasimha Surabhi Sahana Narasimha

Spacing 90 X 60 cm 120 X 45 cm 90 X 60 cm 90 X 90 cm 90 x 90 cm 90 x 90 cm 90 x 90 cm Plot size 48.6 sq. mt 64.8 sq. mt 48.6 sq. mt 48.6 sq. mt 335.3 sq. mt. 495.7 sq. mt. 491.3 sq mt. Experimental design

RCBD RCBD RCBD RCBD Non replicated large plots

Non replicated large plots

Non replicated large plots

Replications 3 3 3 3 Not applicable Not applicable Not applicable Row length 9 m 9 m 9 m 9 m 23 m 36 m 34 m Trial condition

Rainfed Irrigated Rainfed Irrigated Irrigated Rainfed Irrigated

Evaluation of Insect Damage

The lepidopteran pest population and damage was recorded from 10 plants per replication in the Biosafety Research Level – 1 (BRL-1) trials and 30 plants per plot in Biosafety Research Level – 2 (BRL-2) trials across different locations during 2008-2010.

American Bollworm

(H. armigera: Larval counts were recorded at weekly intervals from the 8th to 21st week (~ 60 to 150 Days After Sowing).

Fruiting bodies damage: Fruiting bodies damage was recorded starting from the 8th week to the 21st week after sowing.


Open-boll and locule damage: The total and damaged number of open bolls and locules were observed during all pickings.

Tobacco caterpillar (S. litura): Number of larvae per plant was recorded weekly from 60 to 150 Days after Sowing.

DATA ANALYSIS

The Biosafety Research Level–1 (BRL-1) trial data was subjected to Analysis of Variance (ANOVA) using ARM 7.4.0 statistical package. The significance of difference between the treatments was tested by F-test, while the treatment means were compared by Least significance difference (LSD) at p=0.05. However, as the Biosafety Research Level–2 (BRL-2) trials being non-replicated, statistical analysis (ANOVA) could not be done, but, the data was used to calculate the mean and its standard error.

RESULTS

American Bollworm and Tobacco Caterpillar Population and Damage in Biosafety Research Level-1 (BRL-1) Trials Conducted during 2009 and 2010 in Central Zone

The population of American bollworm, H. armigera was widely observed both in 2009 and 2010 BRL-1 trials in the Central Zone. However, when compared to 2010 the population of H. armigera was generally low in 2009 across the season at both the locations (Figure 1 & 2). It also correlated with higher pest damages in 2010 compared to the previous year. Among the locations, bollworm damage was more in Vadodara especially during 2010. During both the years of BRL-1 trials in Central Zone, negligible population of S. litura was observed across the entire observation period, however, the WideStrike hybrids were completely free from S. litura infestation.

Fig. 1: Population of H. Armigera on Non-transgenic Cotton in Aurangabad

Fig. 2: Population of H.armigera on Non-transgenic Cotton in Vadodara

-2

0

2

4

6

8

7-S

ep

14-S

ep

21-S

ep

28-S

ep

5-O

ct

12-O

ct

19-O

ct

26-O

ct

2-N

ov

9-N

ov

16-N

ov

23-N

ov

30-N

ov

7-D

ec

Num

ber/

5 pl

ants

2009 2010

-2

0

2

4

6

8

10

12

14

7-Se

p

14-S

ep

21-S

ep

28-S

ep

5-O

ct

12-O

ct

19-O

ct

26-O

ct

2-N

ov

9-N

ov

16-N

ov

23-N

ov

30-N

ov

7-D

ec

Num

ber/

5 pl

ants

2009 2010


Infestations of American bollworm and the resulting damage were significantly less in WS hybrids compared to their non-transgenic counterpart hybrids across both the locations. In 2009 and 2010 the square damage ranged between 9.06 and 14.63% in non-WS103 and non-WS106 hybrids while the damage in WS hybrids was negligible (0.13 to 0.82%) (Table 2).

TABLE 2: PERCENT SQUARE AND GREEN DAMAGE ACROSS TWO LOCATIONS IN CENTRAL ZONE DURING KHARIF 2009 AND 2010

No. Hybrid/Variety Square Damage (%) Green Boll Damage (%) 2009 2010 2009 2010

1 WS103 0.13* (2.07) ‡ e 0.15 (2.18) c 0.08* (0.94) ‡ d 0.22 (2.69) c 2 Non-WS103 8.87 (17.33) b 14.63 (22.47) ab 5.93 (14.05) b 7.73 (16.10) a 3 WS106 0.82 (5.16) d 0.24 (2.81) c 0.44 (3.65) c 0.25 (2.88) c 4 Non-WS106 9.06 (17.51) b 14.06 (22.02) b 8.91 (17.36) a 6.33 (14.54) ab 5 Bunny Bt/ RCH2 Bt† 0.24 (2.78) e 0.17 (2.39) c 0.06 (1.12) d 0.18 (2.42) c 6 H 8 Non Bt 10.64 (19.03) a 15.31 (23.02) ab 5.39 (13.41) b 5.20 (13.13) b 7 NHH-44/ H12 5.90 (14.01) c 16.23 (23.75) a 5.04 (12.92) b 5.49 (13.54) b 8 PKV Rajat/ G.Cot16 9.90 (18.33) ab 14.58 (22.44) ab 6.15 (14.33) b 8.06 (16.41) a LSD (p=0.05) 1.02 1.31 2.12 2.08 CV 4.82 4.96 12.47 11.62 †Bollgard (Cry1Ac) and Bollgard II (Cry1Ac+Cry2Ab) were used in 2009 and 2010, respectively *Mean of Aurangabad and Vadodara across the season and Means followed by same letter do not significantly differ ‡Figures in parentheses are arc-sin transformed values

Green boll damage was less than 10% during both 2009 and 2010 across different entries. However, significant differences in damage between WS and its non-transgenic counterpart hybrids were clearly observed. The average green boll damage across the season ranged from 5.93 to 8.91% in non-WS hybrids while it was only 0.08 to 0.44% in WS hybrids (Table 2).

Open boll and locule damage was observed during harvest in both 2009 and 2010 seasons. In WideStrike hybrids open boll damage was significantly lower (0.14-0.95%) than in non-WS hybrids (6.22 – 11.41%). Likewise, locule damage in WideStrike hybrids was also significantly less (0–0.40%) compared to their non-transgenic comparators (2.82–6.48%) (Table 3)

TABLE 3: PERCENT OPEN BOLLAND LOCULE DAMAGE ACROSS TWO LOCATIONS IN CENTRAL ZONE DURING KHARIF 2009 AND 2010

No. Hybrid/Variety Open Boll Damage Locule Damage 2009 2010 2009 2010

1 WS103 0.14* (1.72) ‡ c 0.69 (4.73) d 0.00 (0.00) d 0.34 (3.34) c 2 Non-WS103 7.28 (15.65) a 11.41 (19.74) a 2.82 (9.67) a 6.48 (14.72) a 3 WS106 0.14 (1.76) c 0.95 (5.53) d 0.05 (0.99) d 0.40 (3.51) c 4 Non-WS106 6.22 (14.42) a 9.44 (17.75) abc 3.18 (10.25) a 5.26 (13.13) ab 5 Bunny Bt/ RCH2 Bt† 0.05 (0.71) c 0.66 (4.58) d 0.01 (0.33) d 0.43 (3.64) c 6 H 8 Non Bt 4.09 (11.64) b 7.98 (16.37) bc 1.41 (6.80) c 4.66 (12.44) ab 7 NHH-44/ H12 4.16 (11.76) b 6.98 (15.30) c 1.69 (7.48) bc 4.15 (11.75) b 8 PKV Rajat/ G.Cot16 5.55 (13.59) ab 10.03 (18.43) ab 2.41 (8.86) ab 5.85 (13.97) ab LSD (p=0.05) 2.14 2.67 1.39 2.17 CV 13.74 11.88 14.34 12.97 †Bollgard (Cry1Ac) and Bollgard II (Cry1Ac+Cry2Ab) were used in 2009 and 2010, respectively *Mean of Aurangabad and Vadodara across the season and Means followed by same letter do not significantly differ ‡Figures in parentheses are arc-sin transformed values

American Bollworm and Tobacco Caterpillar Population and Damage in Biosafety Research Level-1 (BRL-1) Trials Conducted during 2008 and 2009 in South Zone

The population of H. armigera was widely observed both in 2008 and 2009 BRL-1 trials conducted in South Zone. However, when compared to 2008 the population of H. armigera was generally low across the season in 2009, particularly in Dharwad trial site (Figure 3 & 4). Infestations of H. armigera and the resulting damage were significantly less in WS hybrids compared to their non-transgenic counterpart hybrids. During both the years of BRL-1 trials in South Zone, there was negligible population of S. litura observed across the entire observation period; however, the WideStrike hybrids were completely free from S. litura infestation.


Fig. 3: Population of H. Armigera on Non-transgenic Cotton in Dharwad

Fig. 4: Population of H. Armigera on Non-transgenic Cotton in Hyderabad

Fig. 5: Population of H. Armigera on Non-transgenic Cotton in South Zone during Kharif 2010

Fig. 6: Population of S. Litura on Non-transgenic Cotton in South Zone during Kharif 2010

0.0

0.5

1.0

1.5

2.0

2.5

No.

of l

arva

e/ p

lant Atur Dharwad Guntur

-1.0

0.0

1.0

2.0

3.0

4.0

5.0

No.

of l

arva

e/ p

lant

Attur Dharwad Guntur


Fig. 7: Population of American bollworm (H.armigera) (No./ plant) in South Zone during Kharif 2010

Fig. 8: Population of S. Litura (No./Plant) Across three Locations in South Zone during Kharif 2010

Across both locations, there was significantly higher damage of fruiting bodies on non-WS hybrids when compared with their transgenic counterparts. In Hyderabad, the square damage on non-WS103 hybrid was 8.27 and 12.92% and on non-WS106 it was 5.22 and 12.85% during 2008 and 2009, respectively, while the square damage in WS hybrids was negligible. In Dharwad, WS103 and WS106 recorded very limited square damage while their non-transgenic counterparts recorded a significantly higher damage of 9.17 and 8.00% in 2008 and 2.51 and 2.03% in 2009, respectively (Table 4). This low level of damage in non-transgenics may be due to the low pest incidence at this location coupled with unfavourable climatic conditions.

TABLE 4: PERCENT SQUARE DAMAGE IN SOUTH ZONE DURING KHARIF 2008 AND 2009

No. Hybrid/Variety Hyderabad Dharwad 2008 2009 2008 2009

1 WS103 0.08 (1.33)* c 0.00 (0.00) b 1.33 (6.46) b 0.94 (5.50) b 2 Non-WS103 8.27 (16.69) a 12.92 (20.27) a 9.17 (17.53) a 2.51 (9.04) a 3 WS106 0.05 (1.01) c 0.06 (0.00) b 1.09 (5.89) b 0.52 (4.12) b 4 Non-WS106 5.22 (13.18) b 12.85 (21.41) a 8.00 (16.23) a 2.03 (8.17) a 5 Bunny Bt/ RCH2 Bt 0.13 (2.05) c 0.13 (0.65) b 1.94 (7.82) b 0.88 (5.34) b 6 Bunny Non Bt 7.67 (16.07) a 14.09 (21.73) a 7.30 (15.62) a 1.97 (7.99) a 7 DHH-11/LAHH-5 5.53 (13.59) b 12.60 (21.15) a 8.56 (16.75) a 2.03 (8.12) a 8 Sahana/ Narasimha 7.09 (15.41) a 12.87 (22.76) a 6.39 (14.62) a 2.71 (9.41) a LSD (P=0.05) 1.32 3.01 3.80 2.03

Means followed by same letter do not significantly differ (P=0.05) *Figures in parentheses are arc-sine transformed values.

Green boll damage was significantly lower on WS103 and WS106 during both 2008 and 2009 seasons. In Hyderabad, the green boll damage was high in 2009 compared to 2008. The damage during 2009 in non-transgenic hybrids ranged from 15.55 to 21.65% whereas it was less than 0.5% in WS hybrids exhibiting very good efficacy against bollworms. In Dharwad, the green boll damage was generally low both in 2008 and 2009 (Table 5).

0.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

WS103 Non-WS103 WS106 Non-WS106 Bt Check BGII Check Non-Bt Variety check

Non-Bt Hybrid check

No.

of l

arva

e/ p

lant

Attur Dharwad Guntur

0.0

0.2

0.4

0.6

0.8

1.0

1.2

WS103 Non-WS103 WS106 Non-WS106 Bt Check BGII Check Non-Bt Variety check

Non-Bt Hybrid check

No.

of l

arva

e/ p

lant

Attur

Dharwad

Guntur


TABLE 5: PERCENT GREEN BOLL DAMAGE IN SOUTH ZONE DURING KHARIF 2008 & 2009

No. Hybrid/Variety Hyderabad Dharwad 2008 2009 2008 2009

1 WS103 0.07 (1.26)*c 0.00 (0.00) c 0.22 (2.51) c 0.14 (2.09) d 2 Non-WS103 2.52 (8.96) a 15.55 (23.21) b 2.75 (9.53) ab 2.39 (8.88) ab 3 WS106 0.05 (1.01) c 0.48 (2.30) c 0.19 (2.26) c 0.20 (2.48) d 4 Non-WS106 1.30 (6.54) b 16.22 (23.68) b 1.87 (7.74) ab 2.90 (9.76) a 5 Bunny Bt/ RCH2 Bt 0.12 (1.99) c 0.40 (2.10) c 0.47 (3.62) c 0.32 (3.18) d 6 Bunny Non Bt 1.29 (6.41) b 18.05 (25.11) ab 3.24 (10.03) a 1.92 (7.95) bc 7 DHH-11/LAHH-5 0.95 (5.59) b 21.65 (27.72) a 2.5 (9.05) ab 1.51 (6.97) c 8 Sahana/ Narasimha 1.55 (6.93) b 19.13 (25.88) ab 1.69 (7.46) b 2.08 (8.29) bc LSD (P=0.05) 1.88 3.68 2.48 1.34 Means followed by same letter do not significantly differ (P=0.05) *Figures in parentheses are arc-sine transformed values.

Open boll and locule damage was observed only in 2009. In WideStrike hybrids open boll damage was significantly lower (0.07 - 0.58%) than their non-WS hybrids (2.68 – 5.85%). Likewise, locule damage in WideStrike hybrids was significantly less (0.01 – 0.24%) compared to their non-transgenic comparators (1.01 – 1.83%) (Table 6)

TABLE 6: PERCENT OPEN BOLL AND LOCULE DAMAGE IN SOUTH ZONE DURING KHARIF 2009

No. Hybrid/Variety Hyderabad Dharwad Open boll Locule Open boll Locule

1 WS103 0.07 (0.88)* b 0.01 (0.38) c 0.58 (4.35)* c 0.24 (2.77) cd 2 Non-WS103 5.06 (12.96) a 1.68 (7.44) a 2.71 (9.41) a 1.01 (5.76) a 3 WS106 0.18 (2.00) b 0.03 (0.85) bc 0.52 (4.13) c 0.16 (2.31) d 4 Non-WS106 5.85 (13.90) a 1.83 (7.69) a 2.68 (9.37) a 1.08 (5.94) a 5 Bunny Bt/ RCH2 Bt 0.20 (2.04) b 0.08 (1.58) b 1.01 (5.75) c 0.76 (4.68) ab 6 Bunny Non Bt 6.11 (14.29) a 1.66 (7.40) a 2.72 (9.48) a 0.96 (5.63) ab 7 DHH-11/LAHH-5 6.35 (14.59) a 2.18 (8.49) a 2.28 (8.67) ab 0.82 (5.18) ab 8 Sahana/ Narasimha 5.96 (14.09) a 1.90 (7.91) a 1.69 (7.44) b 0.52 (4.14) bc LSD (P=0.05) 2.49 1.14 1.59 1.45 Means followed by same letter do not significantly differ (P=0.05) *Figures in parentheses are arc-sine transformed values.

American Bollworm and Tobacco Caterpillar Population and Damage in Biosafety Research Level-2 (BRL-2) Trials Conducted During Kharif 2010 in South Zone

TABLE 7: PERCENT SQUARE DAMAGE IN SOUTH ZONE DURING KHARIF 2010

No. Hybrid/Variety Attur Dharwad Guntur 1 WS103 0.37 ± 0.12‡ 0.10 ± 0.06 0.12 ± 0.04 2 Non-WS103 6.32 ± 0.99 10.13 ± 1.29 5.85 ± 1.50 3 WS106 0.32 ± 0.12 0.12 ± 0.06 0.08 ± 0.03 4 Non-WS106 6.32 ± 0.86 9.91 ± 1.65 4.51 ± 1.06 5 Bunny BGI/RCH-2 BGI 0.19 ± 0.05 0.17 ± 0.08 0.22 ± 0.09 6 Bunny BGII/RCH BGII 0.20 ± 0.06 0.11 ± 0.07 0.15 ± 0.07 7 Surabhi/Sahana/Narasimha 7.39 ± 1.32 9.02 ± 1.12 5.13 ± 1.38 8 Bunny non-Bt/RCH-2 non-Bt 6.68 ± 0.97 9.09 ± 1.02 5.72 ± 1.34 ‡ Mean ± standard error of mean

American bollworm, H. armigera, was observed across the season at all the three locations in the BRL-2 trials conducted in South Zone. The H. armigera larval population was high in Attur and Dharwad while it was low in Guntur. The population was high during 90 to 120 days of the crop growth in Attur and Dharwad. The population of S. litura was higher at Guntur compared to Attur and Dharwad (Figures 5 & 6). The highest population of S. litura was recorded during 70 to 90 days of the crop growth. The lepidopteran population also correlated well with higher fruiting body damage in Attur and Dharwad compared to Guntur. Population of American bollworm and its damage was much less in WS hybrids compared to their non-WS hybrids, across all the three locations. The population of H. armigera larvae was less than 0.03 larvae per plant on WS hybrids, while it ranged from 0.09 to 0.55 per plant on non-WS hybrids. Similarly, S. litura population was negligible (< 0.02 larva/ plant) on WS hybrids, while it ranged between 0.15 and 0.72 larva per plant on non-WS hybrids (Figures 7 & 8).


The square damage was recorded to be the highest in Dharwad followed by Attur and Guntur. It ranged between 4.51 and 10.13% in non-WS hybrids while the damage in WS hybrids was negligible (0.08 to 0.37%) (Table 7)

Green boll damage was higher in Dharwad and Attur when compared to Guntur. The damage ranged from 2.11 to 9.35% in non-transgenic hybrids whereas it was less than 0.23% in WideStrike hybrids across locations and season (Table 8)

TABLE 8: PERCENT GREEN BOLL DAMAGE IN SOUTH ZONE DURING KHARIF 2010

No. Hybrid/Variety Attur Dharwad Guntur 1 WS103 0.23 ± 0.10‡ 0.12 ± 0.06 0.00 2 Non-WS103 7.63 ± 1.46 9.35 ± 2.07 3.47 ± 0.96 3 WS106 0.16 ± 0.06 0.08 ± 0.05 0.00 4 Non-WS106 8.66 ± 1.89 6.69 ± 1.76 2.11 ± 0.74 5 Bunny BGI/RCH-2 BGI 0.23 ± 0.09 0.10 ± 0.06 0.05 ± 0.02 6 Bunny BGII/RCH BGII 0.27 ± 0.07 0.09 ± 0.06 0.03 ± 0.01 7 Surabhi/Sahana/Narasimha 7.16 ± 1.36 7.37 ± 2.13 2.80 ± 0.80 8 Bunny non-Bt/RCH-2 non-Bt 7.95 ± 1.54 7.05 ± 2.26 2.22 ± 0.77 ‡ Mean ± standard error of mean

Moderate to high level of open boll and locule damage was observed during harvest at all locations. In WideStrike hybrids open boll damage was lower (0.23 – 2.75%) than their non-transgenic counterpart hybrids (12.20 – 18.85%). Likewise, locule damage in WideStrike hybrids was also much less (0.10 – 1.27%) compared to their non-transgenic counterparts (4.63 – 16.37%) (Table 9)

TABLE 9: PERCENT OPEN BOLL AND LOCULE DAMAGE IN SOUTH ZONE DURING KHARIF 2010

No. Hybrid/Variety Open Boll Damage Locule Damage Attur Dharwad Guntur Attur Dharwad Guntur

1 WS103 2.75 ± 0.37‡ 0.36 ± 0.07 0.34 ± 0.19 1.27 ± 0.15 0.11 ± 0.03 0.11 ± 0.06 2 Non-WS103 17.95 ± 3.26 16.99 ± 1.04 14.27 ± 1.00 16.37 ± 2.05 9.24 ± 1.11 4.63 ± 0.39

3 WS106 1.73 ± 0.41 0.35 ± 0.08 0.23 ± 0.23 1.15 ± 0.16 0.11 ± 0.02 0.10 ± 0.10 4 Non-WS106 18.25 ± 1.94 12.20 ± 0.19 15.33 ± 0.24 13.99 ± 1.77 7.42 ± 0.25 5.21 ± 0.19 5 Bunny BGI/RCH-2 BGI 1.93 ± 0.56 0.49 ± 0.06 0.44 ± 0.09 1.29 ± 0.04 0.09 ± 0.02 0.11 ± 0.03 6 Bunny BGII/RCH BGII 1.27 ± 0.44 0.41 ± 0.00 0.31 ± 0.01 0.91 ± 0.18 0.07 ± 0.03 0.08 ± 0.02 7 Surabhi/Sahana/Narasimha 14.07 ± 1.02 13.83 ± 1.63 15.20 ± 0.14 12.03 ± 0.99 8.23 ± 1.35 5.89 ± 0.15 8 Bunny non-Bt/RCH-2 non-Bt 15.57 ± 2.17 11.10 ± 0.53 13.05 ± 0.93 13.28 ± 1.10 6.46 ± 0.47 4.85 ± 0.17

‡ Mean ± standard error of mean

DISCUSSION

Dow AgroSciences India Pvt Ltd conducted Biosafety Research Level – 1 (BRL-1) trials at two locations during Kharif 2008 and 2009 in South Zone; at two locations during Kharif 2009 and 2010 in Central Zone; and Biosafety Research Level – 2 (BRL-2) trials at three locations during Kharif 2010 in South Zone. Efficacy data recorded during these BRL-1 and BRL-2 trials on American bollworm (H. armigera) population, tobacco caterpillar (S. litura) population and fruiting body damage clearly demonstrated that the WideStrike trait offered high levels of protection to leaves, squares and bolls from American bollworm and tobacco caterpillar in WS103 and WS106 hybrids expressing the insecticidal proteins Cry1Ac and Cry1F. The population of H. armigera was prominent during all the years of BRL trials while S. litura was observed in the BRL-2 trials conducted during 2010 in south zone. It was further observed that the fruiting body damage on WideStrike hybrids was greatly reduced as compared to the non-transgenic hybrids indicating superior efficacy of WideStrike in controlling the target pests. This is the first published report on the field efficacy of WideStrike cotton hybrids from India.

The reduction in population of H. armigera and its damage in WideStrike hybrids may be contributed by Cry1Ac protein because Cry1Ac has been reported to be the most effective toxin among different Cry toxins tested against H. armigera (Chakrabarti et al., 1998; Akhurst et al., 2003; Avilla et al., 2005). Other researchers have also reported the efficacy of Bt cotton hybrids expressing Cry1Ac protein in India (Kranthi et al., 2005; Gujar et al., 2010). Literature also suggests that Spodoptera spp. is relatively tolerant to most of the known Bt endotoxins including Cry1Ac (Regev et al., 1996; Singh et al., 2004).


However, WideStrike cotton which expresses a novel Cry1F protein in addition to Cry1Ac which controls S. litura effectively and also has activity on Heliothine species. Similarly, Tindall et al., 2009 reported that Cry1F protein in transgenic cotton and maize provided very effective control of Spodoptera spp. Apart from the above field efficacy data, laboratory assays also confirmed that WideStrike hybrids and the individual proteins in diet assays controlled H. armigera and S. litura effectively (Moudgal, unpublished information).

Upon regulatory approval, introduction of WideStrike dual Bt cotton in India will diversify the choice of insect protection traits available to Indian farmers and enable effective management of bollworms and improved control of S. litura in cotton. The additional diversity in insect proteins can contributed to a delay in resistance development and therefore help preserve the technology of Bt cotton. Globally, this event has been approved in USA (2004) and recently in Brazil (2009) for cultivation and in Australia, Canada, Japan, Korea and Mexico for feed/food import, after completing necessary safety assessments.

REFERENCES [1] Akhurst, R. T., James, W.J., Bird, L.J. and Beard, C. (2003) - Resistance to the Cry1Ac δ-endotoxin of Bacillus

thuringiensis in the cotton bollworm H. armigera (Lepidoptera: Noctuidae), J. Econ. Entomol. 96:1290–1299 [2] Avilla, C., Vargas-Osuna E., González-Cabrera J., Ferré, J., and González-Zamora, J. E. (2005) - Toxicity of several δ-

endotoxins of Bacillus thuringiensis against H. armigera (Lepidoptera: Noctuidae) from Spain. J. Invertebr. Pathol., 90: 51–54.

[3] Brookes, G. and Barfoot, P. (2010) - GM Crops: Global Socio-economic and Environmental Impacts 1996-2008. P.G. Economics Ltd, Dorchester, UK. http://www.pgeconomics.co.uk/pdf/2010-global-gm-crop-impact-study-final-April-2010.pdf.

[4] Chakrabarti, S. K., Mandaokar, A. D., Kumar, P. A. and Sharma, R. P. (1998) - Efficacy of lepidopteran specific delta-endotoxin to Bacillus thuringiensis against H. armigera. J. Invertebr. Pathol., 72: 336-337.

[5] Gujar, G. T, Kalia, V., Bunker, G. K. and Dhurua, S. (2010) - Impact of different levels of non-Bt cotton refuges on pest populations, bollworm damage, and Bt cotton production. J. Asia-Pac. Ent. 13: 249–253.

[6] James, C. (2010) - Global Status of Commercialized Biotech/GM Crops: 2010. ISAAA Brief No. 42. ISAAA: Ithaca, NY. [7] Kranthi, K.R. Naidu, S., Dhawad, C.S., Tatwawadi, A., Mate, K., Patil, E., Bharose, A. A., Behere, G. T., Wadaskar, R. M.

and Kranthi, S. (2005) - Temporal and intra-plant variability of Cry1Ac expression in Bt cotton and its influence on the survival of the cotton bollworm, H. armigera (Hübner) (Noctuidae: Lepidoptera), Curr. Sci. 89: 291-298.

[8] Padaria, R. N. Singh, B., Sivaramane, N., Naik, Y. K., Modi, R. and Surya, S. (2009) - A Logit Analysis of Bt Cotton Adoption and Assessment of Farmers’ Training Need. Ind, Res. J. Ext. Edu. 9 (2): 39-45

[9] Regev, A., Keller, M., Strizhov, N., Sneh, B., Prudovsky, E., Chet, I., Ginzberg, I., Koncz-Kalman, Z., Koncz, C., Schell, J. and Zilberstein, A. (1996) - Synergistic activity of a Bacillus thuringiensis delta-endotoxin and a bacterial endochitinase against Spodoptera littoralis larvae. Appl. Environ. Microbiol., 62 (10): 3581–3586.

[10] Singh, P. K., Kumar, M., Chaturvedi, C. P., Yadav, D. and Tuli, R. (2004) - Development of a hybrid delta-endotoxin and its expression in tobacco and cotton for control of a polyphagous pest S. litura. Transgenic Res., 13 (5): 397-410.

[11] Subramanian, A. amd Qaim, M. (2009) - Village-wide Effects of Agricultural Biotechnology: The Case of Bt Cotton in India. World Development, 37 (1): 256-267.

[12] Tindall, K. V., Willrich Siebert, M., Leonard, B. R., All, J. and Haile, F. J. (2009) - Efficacy of Cry1Ac:Cry1F proteins in cotton leaf tissue against fall armyworm, beet armyworm, and soybean looper (Lepidoptera: Noctuidae). J. Econ. Entomol., 102 (4):1497-1505.

Influence of Weather Parameters on Population of Mealybug, Phenacoccus solenopsis and its Natural

Enemies on Bt Cotton

B.V. Patil, S.G. Hanchinal, M. Bheemanna and A.C. Hosamani

Main Agricultural Research Station, University of Agricultural Sciences, Raichur-584102 E-mail: [email protected]

Abstract—Seasonal incidence of mealybug, Phenacoccus solenopsis (Tinsley) on cotton was studied at main agricultural research station, UAS, Raichur during 2008-09 and 2009-10 cropping seasons. Mealy bug incidence was started in the month of September (40th standard week) during both the seasons. Initially mealy bug population was low and gradually increased as the crop stage advanced. Steep increase of mealybug population was observed after January and reached peak in the month of March. Population was varied from 66.28 to 146.64 and 12.32 to 122.64 per 10 cm apical shoot during 2008-09 and 2009-10 seasons, respectively. In general predator population was low through out the season in both the years. Hymenopteran parasitoids activity was started in the month of October and it was ranged between 0.52 to 22.12 per cent during 2008-09 and 0.08 to 34.64 per cent during 2009-10. Parasitoid cocoons were maximum in the month of March which recorded 22.12 and 34.64 per cent during 2008-09 and 2009-10 seasons, respectively. Maximum temperature was positively correlated and significant where as other parameters were negatively correlated.

INTRODUCTION

Mealybugs (Hemiptera: Pseudococcidae) are the soft bodied insects found feeding on variety of plants. In the recent past various mealybug species have been recorded on many field crops, orchards, vegetables and wild plants due to certain abiotic changes in climate and environment. Two species of mealybugs ie Phenacoccus solenopsis and Maconellicoccus hirsutus (Green) damaged the cotton crop in 47 locations in nine cotton growing states (Nagarare et el., 2009). Recently, mealy bug has taken upper hand among sucking pests in cotton in the states like Punjab, Rajastan, Gujarat and Maharashtra in North India and moderate incidence in Central and South India. Among two species of mealy bug, Phenacoccus solenopsis was the dominant species damaged the cotton crop in Punjab. Mealy bug has been recorded on most of the cotton growing areas in Karnataka, especially incidence was more in the isolated patches of Raichur and Bellary districts (Hanchinal et al., 2009 ). It has been also recorded on many alternative hosts which includes sunflower, vegetables, weeds, ornamentals etc., Saini et al.(2009) and Deshmukh et al.(2009)

Mealy bugs feed on all parts of a plant, particularly on growing tips or on leaves that join stems or along leaf veins. The crawlers disperse from the ovisac by way of walking, wind, or ants. The nymphs feed and develop into adults in approximately 30 days. The insect has a life cycle of 24 to 30 days. The female mealy bug produces 10-15 generations per year in colonies of 500-600 eggs (Tanwar et al., 2007).


The investigation was carried out at the main agricultural research station, UAS, Raichur during 2008-09 and 2009-10 cropping seasons. Population dynamics of mealybug was recorded on Bt cotton (BG-II, NCS-145). One acre of unprotected cotton plot was maintained at MARS, Raichur. Observations were recorded weekly interval on 20 randomly selected plants. Mealybugs were recorded from 10cm apical shoot length from September to March during both the seasons. Natural enemies like predators and parasitoids were also recorded per plant. Correlation was worked out between seasonal fluctuation of mealy bug, predators and parasitoid cocoons and percent emergence of parasitoids in the laboratory. Correlation was also worked out between weather parameters and natural enemies of mealybug during 2008-09 and 2009-10 cropping period.

31



Mealybug incidence varied from 0.50 to 180.42 per 10 cm apical shoot from 38th to 14th meteorological week in main agricultural research station, Raichur during 2008-09 cropping season(Table.1). During 2009-10 cropping period population varied between lowest of 0.14 in October first week to highest of 184.32 mealybugs per 10 cm apical shoot during March third week. Mealybug infestation started appearing in the month of September and gradually increased as crop growth advanced during both the seasons. Mealybug population was 0.50 and 0.14 per 10cm apical shoot in the 38th and 40th meteorological week during 2008-09 and 2009-10 seasons, respectively and progressive increase in the population was recorded throughout the season. Population reached to 115.42/10 cm apical shoot in the third week of January and there after population increased suddenly and attained 180.42/10cm apical shoot in the 7th meteorological week during 2008-09 season. Similarly during 2009-10 season peak activity observed between February to March (64.68 to 184.32/10 cm apical shoot).Later on infestation of mealybug declined gradually at end of the cropping period in both the seasons (Fig.1). Overall mealybug population was low in the second season and it was due to increased activity of parasitoids.

In general predator population was low during the cropping season. Maximum population of coccinellids, chrysoperla and spiders were 0.14, 0.13 and 0.16 per plant during 2008-09 season and 0.30, 0.27 and 0.32 per plant during 2009-2010 season, respectively. Per cent parasitoid cocoons ranged between 0.52 to 20.02 and 008 to 34.64 during 2008-09 and 2009-10 seasons, respectively. Parasitoid activity started in the month of October and reached to peak during February and March months in both the seasons. Highest per cent parasitoid cocoons of 22.12 and 34.64 on cotton plants were recorded during 8th and 12th meteorological week during 2008-09 and 2009-10 cropping period, respectively. Peak activity of parasitoid cocoons were coincidence with the higher population of mealybug during same period in both the seasons.

Among five different hymenopteran parasitoids and a dipteran parasitoid, Aenasius bambawalei Hayat was the dominant species. Similarly Pinjarkar et al (2009) reported that A. bambawalei was the only species recorded on P. solenopsis in Maharashtra. Correlation coefficients were calculated between field infestation of mealy bug, coccinellids, chrysoperla, Spiders, percent parasitoid cocoons and weather parameters.

The impact of weather parameters has revealed that maximum temperature showed a positive and significant correlation with the mealybug population (0.821), while others showed significantly negative correlation. Presence of predators with respect to weather parameters were non significant. Minimum temperature and number of rainy days showed significantly negative correlation (-0.537 and -0.419) with coccinellids and relative humidity was positively correlated (0.377) with chrysoperla predators. However, presence of parasitoid cocoons on mealybug infested cotton plants showed significantly positive correlation (0.734) with maximum temperature while other parameters showed significantly negative correlation (Table 3). Present results also corroborated with (Dhawan et al., 2009) who reported that positive correlation with the maximum temperature and negative correlation among the relative humidity and rainfall in case of mealybug in Punjab.

The relationship of mealybug population and its natural enemies like coccinellids, Chrysoperla, spiders, parasitoid cocoons and parasitoid emergence was studied using correlation coefficients. Presence of predators were non significant, however positive correlation was observed with coccinellids (0.184) while Chrysoperla (-0.244) and spiders (-0.129) were negatively correlated. Mealybug population was significantly influenced by the parasitoids and their emergence in laboratory. Parasitoids cocoons (0.973) were highly significant and showed positive correlation. Correlation of P. solenopsis population with parasitoid emergence in the laboratory was significant and positively correlated with all the five parasitoids (Table 4).

Influence of Weather Parameters on Population of Mealybug, Phenacoccus solenopsis and its Natural Enemies 195

The partial regression co-efficient of the mealybugs, parasitoid cocoons on plants and parasitoids emergence in laboratory were found to be highly significant. However, the partial regression coefficients of weather factors on predators population was non significant. Regression equations calculated for maximum temperature were Y = -455.83 + 15.07, Y = -68.48 + 2.32 and Y = -21.23 + 0.74 with R2 value of 0.79, 0.71 and 0.76 for mealybugs, parasitoid cocoons and parasitoid emergence, respectively. It indicated that about 79.30, 71.10 and 76.90 per cent of population fluctuation depends on weather parameters. The multiple regression equation fitted with A. bambawalei and weather parameter to predict the mealybug population (Y) was:

Y= -164.055X1+ 6.853X2 -2.615X3 + 0.047X4 + 1.489X5 - 0.198X6 -0.302 X7 + 3.895X8 with a R2 value of 0.865 at main agricultural research station, Raichur. Where X1, X2, X3, X4, X5, X6, X7 and X8 denote maximum temperature, minimum temperature, rainfall, rainy days, relative humidity maximum, relative humidity minimum and parasitoids, respectively

TABLE 1: SEASONAL INCIDENCE OF MEALYBUGS, PREDATORS AND PARASITOIDS ON COTTON (NCS-145 BT) UNDER IRRIGATED ECOSYSTEM DURING 2008-09

Months ISD Week

Mealybugs*/ 10 cm Apical Shoot

Predators Per Plant Per Cent Parasitoid Cocoons Per Plant Coccinellids Chrysoperla Spiders

Sep 1-7 36 0.00 0.02 0.00 0.04 0.00 Sep 8-14 37 0.00 0.00 0.04 0.00 0.00 Sep 15-21 38 0.50 0.02 0.02 0.00 0.00 S ep 22-28 39 0.52 0.00 0.00 0.02 0.00 Sep 29-5 40 0.61 0.02 0.00 0.02 0.00 Oct 6-12 41 0.65 0.04 0.00 0.02 0.00 Oct 13-19 42 0.72 0.06 0.00 0.04 0.00 Oct 20-26 43 0.84 0.02 0.00 0.06 0.00 Oct 27-2 44 0.86 0.00 0.00 0.02 0.52 Nov 3-9 45 2.16 0.02 0.04 0.04 1.28 Nov 10-16 46 6.24 0.00 0.00 0.00 1.32 Nov 17-23 47 6.58 0.00 0.02 0.00 2.12 Nov 24-30 48 8.24 0.00 0.00 0.16 3.62 Dec 1-7 49 10.64 0.04 0.12 0.04 4.54 Dec 8-14 50 13.21 0.02 0.13 0.02 6.24 Dec 15-21 51 16.58 0.08 0.04 0.08 7.60 Dec 22-28 52 22.42 0.02 0.00 0.04 9.21 Dec 29-4 1 36.52 0.00 0.00 0.00 9.44 Jan 5 -11 2 66.28 0.12 0.00 0.04 9.82

Jan 12-18 3 85.34 0.14 0.02 0.00 10.25 Jan 19-25 4 115.42 0.00 0.00 0.02 12.62 Jan 26 -1 5 154.62 0.10 0.00 0.00 13.45 Feb 2 -8 6 142.16 0.00 0.00 0.02 15.62 Feb 9 -15 7 180.42 0.08 0.00 0.00 20.65 Feb 16 -22 8 158.44 0.00 0.00 0.04 22.12 Feb 23 -1 9 162.24 0.02 0.00 0.00 20.02 Mar 2 - 8 10 154.50 0.00 0.00 0.02 16.42 Mar 9-15 11 152.26 0.00 0.00 0.00 12.64 Mar 16-22 12 150.65 0.00 0.00 0.02 10.20 Mar 23-29 13 148.64 0.00 0.00 0.00 4.62 March 30-5 14 146.64 0.00 0.00 0.00 3.26 Mean 54.03 0.02 0.01 0.02 6.04 S.D. 68.43 0.04 0.03 0.03 6.90

* Mean of 20 plants S.D = standard deviation


TABLE 2: SEASONAL INCIDENCE OF MEALY BUGS, PREDATORS AND PARASITOIDS ON COTTON (NCS-145 BT) UNDER IRRIGATED ECOSYSTEM DURING 2009-10 SEASON

Months ISD Week Number of Mealybugs Per 10

Cm Apical Shoot Length Number of Predators Per Plant* Per Cent Parasitoid

Cocoons Per Plant Coccinellids Chrysoperla Spiders Sep 10-16 37 0.00 0.00 0.02 0.05 0.00 Sep 17-23 38 0.00 0.00 0.04 0.02 0.00 Sep 24-30 39 0.00 0.00 0.02 0.15 0.00 Oct 1-7 40 0.14 0.00 0.12 0.02 0.08 Oct 8-14 41 0.33 0.02 0.05 0.30 0.12 Oct 15-21 42 0.41 0.03 0.12 0.02 0.18 Oct 22-28 43 0.52 0.04 0.06 0.25 0.21 Oct 29-4 44 2.53 0.02 0.02 0.06 0.23 Nov 5-11 45 0.22 0.03 0.14 0.32 0.08 Nov 12-18 46 0.45 0.01 0.30 0.04 0.06 Nov 19-25 47 0.62 0.01 0.12 0.25 0.36 Nov 26-2 48 0.66 0.08 0.02 0.00 0.92 Dec 3-9 49 1.22 0.12 0.04 0.16 1.15 Dec 10-16 50 1.64 0.07 0.12 0.04 3.55 Dec 17-23 51 3.27 0.05 0.25 0.12 4.23 Dec 24-31 52 6.24 0.06 0.27 0.28 5.11 Jan1-7 1 12.32 0.02 0.02 0.24 7.25 Jan 8-14 2 16.42 0.04 0.04 0.27 8.44 Jan 15-21 3 28.25 0.14 0.07 0.15 8.82 Jan 22-28 4 35.37 0.12 0.02 0.24 9.27 Jan 29-4 5 45.42 0.15 0.05 0.25 12.45 Feb 5-11 6 64.68 0.22 0.02 0.32 13.84 Feb 12-18 7 82.13 0.30 0.12 0.22 15.08 Feb 19-25 8 88.55 0.04 0.27 0.30 15.66 Feb 26-4 9 108.13 0.02 0.00 0.04 18.12 Mar 5-11 10 122.21 0.04 0.00 0.12 22.42 Mar 12-18 11 184.32 0.05 0.00 0.02 26.56 Mar 19-25 12 154.20 0.03 0.00 0.00 34.64 Mar 26-1 13 122.64 0.00 0.00 0.00 32.20 Mean 33.84 0.05 0.07 0.14 7.54 S.D. 52.71 0.07 0.09 0.12 10.04

S.D = standard deviation * Mean of 20 plants.

TABLE 3: CORRELATION CO-EFFICIENT BETWEEN WEATHER PARAMETERS AND SEASONAL FLUCTUATION OF MEALYBUGS, PREDATORS AND PARASITOIDS ON BT COTTON

Parameters Mealy Bugs Coccinellids Chrysoperla Spiders Per Cent Parasitoid Cocoons Per Plant Maximum Temperature (o C) 0.821** -0.021 -0.280 -0.280 0.734** Minimum Temperature (o C) 0.147 -0.537** -0.07 -0.393* 0.017 Rainfall (mm) -0.237 -0.261 0.058 -0.247 -0.277 No. of Rainy days -0.402* -0.419* -0.047 -0.311 -0.465** Relative Humidity-I -0.736** 0.235 0.377* 0.331 -0.686** Relative Humidity-II -0.688** -0.064 0.088 0.109 -0.677**

* Differs significantly (P = 0.05) **Differs significantly (P = 0.01)

TABLE 4: CORRELATION CO-EFFICIENT BETWEEN SEASONAL FLUCTUATION OF MEALY BUGS, PREDATORS AND PARASITOIDS

Parameters Mealybugs Coccinellid predators 0.184 Chrysoperla predators - 0.244 Spiders - 0.129 Per cent parasitoid cocoons 0.973 ** Per cent parasitoid emergence in laboratory Aenasius bambawalei 0.923** Promuscidea unfasciativentris 0.840** Homalotylus eytelweinii 0.899** Prochiloneurus pulchellus 0.882** Anagyrus dactylopii 0.820**

* Differs significantly (P = 0.05) ** Differs significantly (P = 0.01)

Influence of Weather Parameters on Population of Mealybug, Phenacoccus solenopsis and its Natural Enemies 197

Fig. 1: Average Population of Mealybug and Natural Enemies on Bt Cotton during 2008-09 and 2009-10 Seasons

REFERENCES [1] Deshmukh, A. J. Vennila, S., Pinjarakar, D.B, Ghodki, B.S. and Kranthi, K.R, 2009, Host range of mealybug, Phenacoccus

solenopsis Tinsley in cotton +pigeon pea cropping system of central India. : In proceedings of National symposium on Bt-cotton: Opportunities and Prospectus,CICR,Nagpur,November 17-19,pp150

[2] Dhavan, A. K, Kamaldeep, S,A and Sarika, S, 2009. Distribution of mealybug, Phenacoccus solenopsis Tinsley in cotton with relation to weather factors in south-Western districts of Punjab. J.ent.Res.,33(1):59-63

[3] Hanchinal, S,G, Patil, B,V, Bheemanna, M, Hosamani, A.C and Sharanbassappa, 2009. Incidence of mealy bug on cotton in Tungbhadra project area: In proceedings of Dr. Leslie C. Coleman memorial national symposium on plant protection, 4 - 6 December 2008, University of Agricultural Sciences, GKVK, Bangalore 560 065

[4] Hanchinal, S,G, Patil, B,V, Bheemanna, M,and.Hosamani, A.C,2009, Incidence of mealybug Phenacoccus solenopsis Tinsley and its natural enemies on cotton in Karnataka: In proceedings of National symposium on Bt-cotton:Opportunities and Prospectus,CICR,Nagpur,November 17-19,pp150

[5] Nagrare,V.S, Kranthi,S, Biradar,V.K, Zade,N.N, Sangode,V, Kakde,G,Shukla,R.M, Shivare,D, Khadi,B.M, and Kranthi,K.R,2009.Widespread infestation of the exotic mealybug species, Phenacoccus solenopsis (Tinsley) (Hemiptera: Pseudococcidae) on cotton in India,Bulletin of Entomological Research: P.1-5

[6] Pinjarakar,D.B,Vennila,S,Ramamuthy,V.V,Kranthi,K.R,Ghodki,B.S and Deshmukh,A.J, 2009, Diversity and abundance of Hymenopteran parasitoids of mealybugs in rainfed cotton: In proceedings of National symposium on Bt-cotton:Opportunities and Prospectus,CICR,Nagpur,November 17-19,pp150

[7] Saini,R.K,Palaram, Sharma,S.S and Rohilla,H.R, mealybug Phenacoccus solenopsis Tinsley and its survival in cotton ecosystem in Haryana: In proceedings of National symposium on Bt-cotton: Opportunities and Prospectus, CICR, Nagpur, November 17-19,pp150

[8] Tanwar, R.K, Jeyakumar, P and Monga,D., 2007, Mealybugs and their management.Tech.Bull.No.19.NCIPM, New Delhi (India)

0

0.02

0.04

0.06

0.08

0.1

0.12

0.14

0.16

0.18

36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 1 2 3 4 5 6 7 8 9 10 11 12 13 14

Standard weeks

mea

lybu

gs/1

0 cm

api

cal s

0

20

40

60

80

100

120

140

160

180

200

num

bers

/pl

coccinellids chrysoperla spiders %parasitoid cocoons mealybug

Insecticide Induced Resurgence of Mealybug, Phenacoccus solenopsis Tinsley in Cotton

Rishi Kumar1, Dinesh Swami1, Vijender Pal1 and K.R. Kranthi2 1Central Institute for Cotton Research, Regional Station, Sirsa, Haryana-125055,

2Central Institute for Cotton Research, Nagpur E-mail: [email protected]

Abstract—The knowledge relating to risk associated with the insecticide as regards resurgence is of paramount importance, the influence of the commonly used insecticides alone and in combination was studied for their role in resurgence of mealybug population on cotton cultivar RCH134 during 2008 and 2009.The insecticides i.e. cypermethrin, monocrotophos, acephate, ethion, profenophos, spinosad, cypermethrin + monocrotophos, cypermethrin + acephate, cypermethrin + ethion, cypermethrin + profenophos were applied 11 time at 10 day intervals in mealybug infested fields spreading throughout the cotton season at their recommended dosages. On the basis of two year cumulative data 14.53 per cent resurgence in mealybug population was recorded due to Spinosad. No resurgence in mealybug population during the year 2008 after 1st and IInd spray was observed but 0 .69 to 11.24% resurgence was recorded after 3rd , 4th , 6th , 7th , 8th , 9th , 10th and 11th spray after 7th day of each spray application. During the 2009, 4.53 to 43.53 % resurgence in mealy bug due to spinosad was recorded after 2nd , 3rd , 4th , 5th, 6th, 7th, 8th, 9th, 10th and 11th spray after 7th day of each spray application. The studies conducted under polyhouse conditions also revealed 12.92 % resurgence in mealybug population due to spinosad after 5 sprays at weekly intervals.

Among the other insecticides applied, 10.89 to 21.92% resurgence due to cypermethrin during the 2009 was recorded after 5th, 6th, 7th, 8th, 9th, 10th, and 11th spray after 7th day of each spray application. 12.12 to 29.08 % resurgence due to monocrotophos was recorded after 6th, 7th, 8th, 9th and 11th spray after 7th day of each spray application. As per the record, though the infestation of mealybug was more during 2008 but the resurgence in mealybug population due to insecticides was more during 2009. The reason for the resurgence like biochemical changes in plant, changes in insect reproduction physiology or ecological changes could not be traced at this stage which has to be confirmed through more planned and systemic studies.

INTRODUCTION

Resurgence was defined as an increase in target arthropod pest species abundance to a level which exceeds that of control or untreated population following the application of insecticides (Hardin et al., 1995). Insecticides-induced outbreaks of insects have been reported as early as 1951 in walnut (Bartlett and Ewart, 1951). Ripper (1956) listed more than 50 species of phytophagous arthropods whose population has resurged with wide spread use of insecticides. After the introduction of Bt cotton, the insecticidal usage in cotton was for sucking pests only. Sucking pests especially, whitefly, jassid, thrips and mealy bug have become quite serious from seedling stage. The mealybug species Phenacoccus solenopsis Tinsley, an exotic species appeared in 2006 in cotton growing zones of country (Nagrare et al 2009) and insecticide application became an integral part of its management. The wide spread use of chemical pesticide is known to induce the population resurgence of pests (Gu et at., 1996 and Yin et al., 2008). Mealy bug is amenable to control with insecticides, but repeated application often results in problems such as induction of resurgence and development of resistance. Insecticides may affect the physiology of target insect pest directly through stimulation of growth and reproduction or indirectly through alteration in the nutritional quality of host plant that leads to favorable biological effects on target pests, such as shortening of development period, increased survival, increased feeding rate and reproduction or other related changes in behavior of the insects (Ravindhran and Xavier, 1997 and Singh et. al., 2008). As large numbers of insecticides alone and in combinations are repeatedly used for the management of mealy bug, the present study was therefore, undertaken to determine the influence of these insecticides in relation to resurgence.

32

Insecticide Induced Resurgence of Mealybug, Phenacoccus solenopsis Tinsley in Cotton 199


The experiment was conducted at Experimental area of Central Institute for Cotton Research, Regional Station; Sirsa to study the effect of most frequently used insecticides alone and in combination by the farmers on the resurgence of mealybug by using RCH-134Bt, the most popular Bt cotton hybrid of the North Zone of India. The experiment was sown on 18.05.2008 and 17.05.2009.The experiment was conducted in three replications with a plot size of 9.6 x 7.0 M in randomized block design (RBD), with spacing of 100 x 60cm. These insecticides, 11 treatments (Cypermethrin, Monocrotophos, Acephate, Ethion, Profenophos, Spinosad, Cypermethrin+Monocrotophos, Cypermethrin+Acephate, Cypermethrin+Ethion, Cypermethrin+Profenophos and No spray) and 11 repeated applications were applied at 10 days interval (For 2 years) .The observations on mealybug were recorded one day before application of insecticides (pre-treatment) and one and seven days after application of insecticides (post-treatment). The observations were recorded from 5 randomly selected and tagged plants per plot (observed over time).

The studies conducted in field were again confirmed through Polyhouse experiment, where Cotton was planted in pots. A single pot containing one plant was considered as one replication so 5 pots were taken for each treatment. The polyhouse studies were conducted on Spinosad, Profenophos, Fipronil and control. The potted cotton plant of one month age were artificially infested with the mealybugs and after the establishment of mealybug when the population reached to the IInd grade injury level, the spray application of each insecticide at recommended dose were applied through Baby Hand Sprayer at 10 days intervals. The data on mealybug population was recorded as pre spray and 1 and 7 day after application of insecticides. The % resurgence in population was calculated as per the method used for field experiments.

The data was compiled and the % resurgence was calculated on the basis of formula suggested by Henderson and Tilton (1955) and slightly modified by Jayaraj and Reghupathy,1987 and finally approved through All India Cotton Improvement Project, Coimbatore, Tamilnadu (Anonymous, 1993)

Resurgence (%) = Ts X CF- 1 X 100 Cs TF Where Ts - Subsequent observations in treated plot (Post treatment) Cs - Subsequent observations in control plot (Post treatment) TF – First observation in a treated plot (Pre-treatment) CF - First observation in a control plot (Pre-treatment)


On the basis of pooled data of two years and 11 sprays applied at 10 days intervals, 14.53 per cent resurgence in mealybug population was recorded due to application of Spinosad (Table-1).

Besides the cumulative effect the individual spray application also indicated resurgence in mealybug population and during the year 2008 (Table - 3) after 1st and IInd spray no resurgence in mealybug population was recorded due to Spinosad but the induced resurgence due to spinosad in mealybug population was recorded after 3rd spray (Nil and 5.93%), 4th spray (0.69% and 20.90%), 6th spray (0.57% and Nil), 7th spray (Nil and 0.53%), 8th spray (Nil and 4.00%), 9th spray (0.81% and 11.24%), 10th spray (Nil and 7.25%) and 11th spray (Nil and 5.35%) at 1 and 7 day of spray application. Some inconsistent resurgence in mealybug population after 10th spray of Acephate (8.21%) and after 9th spray of Ethion (5.29%) was reported at 7 days of spray application during 2008.Among the combinations, 2.53% resurgence due to Cypermethrin+Ethion after 9th spray application and 5.62% resurgence due to Cypermethrin+Profenophos after 2nd spray application, in mealybug population was reported at 7 days of spray application.

During 2009, resurgence due to Spinosad application (Table - 4) in mealy bug population was recorded after 2nd spray (Nil & 4.53%), 3rd spray (11.44% & 13.88%), 4th spray (12.21% & 15.22%), 5th


(14.20% & 27.72 %), 6th spray ( 14.12% & 36.47%), 7th spray (18.06% & 30.24%), 8th spray (16.23% & 33.05%) 9th spray (33.73% & 43.53%), 10th spray (Nil & 13.69%) and 11th spray (11.18 & 21.15 % ) at 1st and 7th day of spray applications.Inconsistent resurgence due to cypermethrin application during the 2009 was recorded after 5th spray (Nil & 10.89%), 6th spray (Nil & 15.87%), 7th spray (17.56% & 19.99%), 8th spray (12.21% & 18.23%), 9th spray (Nil & 21.92%), 10th spray (Nil & 10.72%), and 11th spray application (9.79% & 12.56%) at 1 and 7 day of spray applications.

Due to monocrotophos in 2009 after 6th spray (Nil & 12.12%), 7th spray (16.27% & 29.08%), 8th

spray (16.29% & 19.57%), 9th spray (Nil & 28.00%) and 11th spray (14.28% & 25.70 %) resurgence was recorded after 1 and 7 days of spray applications. Unlike to 2008, in 2009 resurgence in mealybug population was not recorded due to the application of combinations of insecticides.

Comparatively more resurgence in mealybug population was recorded during 2008 than to 2009. The studies conducted under polyhouse conditions also revealed 9.71 and 12.92 % resurgence in mealybug population after 5 sprays applied at weekly intervals (Table - 2).The resurgence recorded other than spinosad was inconsistent as it was not recorded after each spray during both the years.

As the mealybug appeared in cotton in 2006 from Gujarat (Kuchh) to Punjab (Bathinda) and it multiplied and spread very rapidly across India. This situation led to confusion among farmers and an era of usage of unwanted, unrecommended insecticides started. Farmers were spraying against the pest whatsoever was available in market. Many insecticides which were totally out of use in cotton crop started again. The purpose of the experiment was to study whether any of these commonly used insecticides are responsible for resurgence in mealybug population though few were giving good results. There are large numbers of reports and findings on the resurgence of mealybug due to synthetic pyrethroids like the adverse effect of insecticide treatments on mealy bug population density and pest status is characterized by the fact that the cryptic nature of mealy bug renders the use of many of the insecticides ineffective, and the frequent use of non-selective insecticide to be responsible for the outbreak of mealy bugs (Browning, 1994 and Smith et al., 1997). The phenomenon of resurgence has recently been reviewed and discussed by Hardin et al., (1995). The resurgence of Japanese mealybug against Cypermethrin was reported by Morishita, 2005. Weires (1984) reported the resurgence of Comstock mealy bug, Pseudococcus comstoki (Kuwani) on apple treated with flucythrinate. Mendel. et. al. (1994) reported the outbreak of mealy bug due to the use of the pyriproxifen for controlling the Aonidiella aurantii. Rosen (1974) reported the outbreak of Planococcus citri and Pseudococcus longispinus because of the frequent use of organophosphate and carbamates. The outbreaks of mealybug on grape vine in part of Karnataka after insecticide sprayed were also recorded by Manjunath (1985). The spinosad triggered resurgence in mealybug population reported in present studies could be due to direct or indirect effects which need careful and systematic studies. In majority of insecticides induced resurgence, the elimination of natural enemies due to insecticides is considered as an important factor but, the spinosad was recorded safer to the potential parasitoid, Aenasius bambawalei Hayat (Rishi et al, 2009) but monocrotophos was recorded as most toxic for it and in present studies the activity of the parasitoid Aenasius bambawalei was not affected as per visual observations.. The confirmatory studies conducted in polyhouse also indicate towards changes in plant or insect physiology as there was no parasitoid activity observed under polyhouse condition.

The resurgence studies conducted through periodical application of most commonly used insecticides in cotton pest management resulted into resurgence in mealybug population. The resurgence recorded in many insecticides alone and in combination was not consistent. However, the resurgence recorded in mealybug population in spinosad treated plots was observed after each spray application. The resurgence recorded in mealybug population during 2008 was less as compared to 2009. The exact mechanism for spinosad triggered resurgence in mealybug population has to found out.

Insecticide Induced Resurgence of Mealybug, Phenacoccus solenopsis Tinsley in Cotton 201

TABLE 1: CUMULATIVE* POPULATION OF MEALY BUG (ON 5 CM PORTION OF STEM) AND PER CENT RESURGENCE DUE TO INSECTICIDES

Treatment Cumulative Population (on the Basis of 11 Spray) Resurgence (%) Pre-Treatment After 1 Day After 7 Day After 1 Day After 7 Day

Cypermethrin 5.205 4.39 4.84 -14.94 -2.125 Monocrotophos 4.65 3.78 4.14 -23.07 -9.03 Acephate 4.255 3.25 3.36 -32.16 -29.05 Ethion 5.31 4.26 4.17 -29.49 -15.765 Profenophos 2.705 1.06 1.495 -60.65 -41.285 Spinosad 6.075 5.96 6.99 -6.72 14.53 Cyp+Mono 4.495 3.53 3.8 -29.84 -21.38 Cyp+Acephate 4.8 3.63 3.605 -24.57 -24.635 Cyp+Ethion 5.305 4.155 4.345 -31.215 -23.295 Cyp+Profenophos 4.29 3.125 3.495 -31.585 -20.105 No spray 5.03 5.19 5.25 0.0 0.0

(Pooled data of 11 sprays applied during 2008 and 2009); -ve values indicate no resurgence

TABLE 2: INSECTICIDE INDUCED RESURGENCE IN MEALY BUG POPULATION UNDER POLY HOUSE CONDITION DURING 2010

Treatments Per cent Resurgence 1st Spray 2nd Spray 3rd Spray 4th Spray 5th Spray Cumulative Population

1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS Profenophos -59.18 -96.11 -100.00 -100.00 -100.00 -100.00 -100.00 -100.00 -100.00 -100.00 -55.72 -95.67 Spinosad 44.30 6.71 -56.74 11.32 47.88 14.39 8.43 12.19 33.91 21.42 9.71 12.92 Control 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

-ve values indicate no resurgence

TABLE 3: PER CENT RESURGENCE IN MEALY BUG POPULATION DUE TO INSECTICIDE DURING 2008

Treatmens Per cent Resurgence 1st Spray 2nd Spray 3rd Spray 4th Spray 5th Spray 6th Spray 7th Spray 8th Spray 9th Spray 10th Spray 11th Spray

1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DASCypermethrin 0.0 0.0 -33.33 -24.16 -23.05 -24.32 -42.52 -9.62 -10.69 -3.08 -12.77 -12.90 -36.47 -16.92 -17.21 -3.95 -0.54 -6.96 -31.12 -18.07 -0.67 -21.83Monocrotophos 0.0 0.0 -33.33 -18.75 -44.51 -47.94 -72.11 -49.96 -1.23 -32.00 -19.70 -15.72 -3.08 -8.02 -12.14 -7.83 -21.70 -18.27 -25.29 -10.21 -29.24 -29.53Acephate 0.0 0.0 -30.76 -25.00 -2.75 -56.85 -73.68 -45.45 -1.89 -56.55 -7.74 -3.03 -17.50 -14.70 -20.73 -12.46 -10.91 -24.49 -23.92 8.21 -36.19 -29.03Ethion 0.0 0.0 -60.60 -3.97 -19.48 -16.19 -26.98 -19.17 -1.33 -49.99 -12.60 -0.39 -4.37 -12.66 -32.63 -19.32 -21.51 5.29 -11.03 -39.59 -24.81 -44.42Profenophos 0.0 0.0 -50.00 -18.75 -61.66 -24.10 -84.83 -70.76 -54.30 -40.85 -74.52 -45.29 -54.84 -19.84 -63.22 -50.39 -32.27 -52.25 -52.21 -32.08 -60.07 -8.67 Spinosad 0.0 0.0 -21.21 -18.75 -7.07 5.93 0.69 20.90 -2.67 -14.90 0.57 -13.02 -20.65 0.53 -28.16 4.00 0.81 11.24 -20.05 7.25 -5.84 5.35 Cyp+Mono 0.0 0.0 -45.45 -11.36 -64.34 -29.39 -22.94 -19.14 -4.37 -38.97 -14.25 -12.96 -19.14 -3.04 -37.25 -15.58 -21.14 2.53 -14.95 -5.00 -0.63 -31.53Cyp+Acephate 0.0 0.0 -21.21 -1.51 -7.27 -54.00 -32.17 -4.24 -1.62 -67.39 -22.96 -24.94 -21.53 -10.57 -19.77 -7.78 -50.53 -27.78 -25.66 -19.99 -17.91 -17.15Cyp+Ethion 0.0 0.0 -21.42 -11.01 -31.31 -25.25 -59.65 -31.70 -0.12 -62.50 -15.46 -6.91 -20.52 -4.22 -34.63 -9.33 -2.59 2.53 -0.69 -25.38 -15.90 -20.62Cyp+Profeno 0.0 0.0 -50.00 5.62 -8.73 -55.64 -18.60 3.09 -7.22 -51.07 -26.13 -17.42 -11.56 -0.18 -32.63 -18.55 -35.71 -25.20 -17.54 -13.71 -25.52 -3.77 No spray 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

-ve values indicate no resurgence

TABLE 4: PER CENT RESURGENCE IN MEALY BUG POPULATION DUE TO INSECTICIDE DURING 2009

Treat Per Cent Resurgence 1st Spray 2nd Spray 3rd Spray 4th Spray 5th Spray 6th Spray 7th Spray 8th Spray 9th Spray 10th Spray 11th Spray

1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DAS 1DAS 7DASCyper -93.48 -65.57 -23.70 -33.69 -9.70 -8.13 -27.12 -65.43 -53.97 10.89 -44.50 15.87 17.56 19.99 12.21 18.23 -18.49 21.92 -4.83 10.72 9.79 12.56 Mono -93.36 -70.63 -30.06 -37.11 -9.35 -5.17 -29.49 -48.42 -11.55 -38.05 -41.90 12.12 16.27 29.08 16.29 19.57 -54.17 28.00 -23.74 -15.65 14.28 25.70 Acephate -97.38 -89.77 -34.45 -26.57 -8.56 -12.84 -38.00 -53.23 -33.08 -18.88 -34.70 -31.58 -15.45 -31.51 -36.39 -44.66 -64.94 -38.03 -31.30 -14.42 -40.87 -29.11Ethion -97.38 -95.08 -30.40 -23.94 -16.41 -24.54 -17.23 -59.88 -10.58 -9.92 -36.97 -36.76 -14.86 -14.29 -65.84 -53.20 -73.25 -39.64 -23.86 -6.19 -26.03 -19.34Profen -94.99 -56.13 -40.84 -61.57 -20.69 -27.07 -73.44 -69.27 -57.35 -49.60 -57.03 -32.14 -63.61 -53.99 -69.71 -41.53 -80.02 -49.76 -71.04 -42.42 -83.73 -83.24Spinosad -79.67 -51.75 -22.86 4.53 11.44 13.88 12.21 15.22 14.20 27.72 14.12 36.47 18.06 30.24 16.23 33.05 33.73 43.53 -17.28 13.69 11.18 21.15 Cyp+Mon -83.60 -64.36 -34.50 -22.51 -22.53 -14.86 -6.44 -9.26 -9.59 -11.60 -13.14 18.39 -14.52 -8.03 -17.75 -34.48 -58.08 -9.92 -55.80 -33.36 -17.06 -4.29 Cyp+Acep -92.72 -90.75 -48.14 -30.65 -15.49 -19.59 -20.33 -12.53 -29.31 -22.56 -34.03 -43.40 -20.22 -22.86 -68.45 -29.63 -53.01 -19.38 -16.14 -9.52 -18.34 -25.35Cyp+Ethio -83.29 -62.88 -40.41 -44.28 -3.79 -7.91 -32.66 -18.44 -21.67 -34.85 -36.91 -10.17 -28.50 -30.87 -87.80 -27.59 -62.12 -29.68 -27.91 -10.17 -9.00 -2.25 Cyp+Profe -81.27 -34.47 -34.25 -36.04 -3.11 -3.31 -74.12 -47.22 -48.69 -41.19 -48.18 -10.81 -36.45 -38.55 -44.24 -16.36 -68.29 -37.78 -17.53 -8.62 -61.84 -37.98No spray 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

REFERENCES [1] Anonymous (1993)-Tocklai Experimental Station, Tea Research Association, Jorhat, Assam. India. Pest Management Ann.

Sci. Rep., 124-140. [2] Bartlett, B. R. and Ewart, W. H. (1951) - Effect of parathion on parasites of Coccus hesperidum. J. Econ. Entomol., 44:

344-347. [3] Browning, H. W. (1994) - Early classical biological control in citrus. In: Rosen, D., Benett, F. D. and Capinera, J. L. (Eds.)

Pest management in the subtropics: Biological control, A Florida Perspective. Intercept Limited, Andover, UK. Pp. 27-46. [4] Gu, Z. Y., Han, L. J., Huang, X. L., Wang, Q., Xu, X. L., Hua, J. L., Jin, D., and Yan, D. F., (1996) - Study on population

dynamics of plant hopper in different habitats. Acta Phytophyl. Sin., 23:170-173. [5] Hardin, M. R., Benrey, B., Coll, M., Lamp, W. O., Roderick, G. K. and Barbosa, P. (1995) - Arthropod pest resurgence: an

overview of potential mechanism. Crop Prot. 14:3-18.


[6] Henderson, C. F. and Tilton, E. W. (1955) - Test with acaricides against the white flour mite. J. Econ. Entomol., 48: 157-161.

[7] Manjunath, T. M. (1985) - Outbreaks and new records. Plant Protection Bulletin. 33: 71-76. [8] Mendel, Z., Blumberg, D. and Ishaaya, I. (1994) - Effect of some insect growth regulators on natural enemies of scale

insects (Hom.: Coccoidea). Entomophaga, 39: 199-209. [9] Morishita M. (2005) - Resurgence of Japanese mealy bug, Planococcus krauhiae (Kuwana), in persimmon induced by a

synthetic pyrethroid Cypermethrin. Annual Report of the Kansai Plant Protection Society, 47:125-126. [10] Nagrare, V. S., Kranthi, S., Biradar, V. K., Zade, N. N., Sangode, V., Kakde, G., Shukla, R.M., Shivare, D., Khadi, B. M.

and Kranthi, K. R. (2009). - Widespread infestation of the exotic mealybug species, Phenacoccus solenopsis (Tinsley) (Hemiptera: Pseudococcidae), on cotton in India. Bulletin of Entomological Research, 10: 1-5.

[11] Ravindhran, R. and Xavier, A. (1997) - Effect of pyrethroids on resurgence of aphid (Aphis gossypii) and alternation of plant metabolism in cotton. Pestic. Res. J. 9:79-85.

[12] Ripper, W. E. (1956) - Effect of pesticides on the balance of arthropod population. Annul. Rev. Entomol. 1: 403-438. [13] Jayaraj, S. and Regupathy, A. (1987) - Studies on the resurgence of sucking pests of crops in Tamil Nadu. Resurgence of

Sucking Pest Proceeding of National Symposium. Tamil Nadu Agricultural University, Coimbatore. 225-240. [14] Rishi Kumar, Kranthi, K. R., Monga, D. and Jat, S. L. (2009) - Natural parasitization of Phenacoccus solenopsis Tinsley

(Hemiptera: Pseudococcidae) on cotton by Aenasius bambawalei Hayat (Hymenoptera: Encyrtidae). J. Biol. Control. 23(4): 457-460.

[15] Rosen, D. (1974) - Current status of integrated control of citrus pests in Israel. Bull. OEPP 4:363-368. [16] Singh, G., Kaur, J. and Suchita (2008) - Influence of insecticides on cotton whitefly, Bemisia tabaci (Gennadius) J. Insect

Sci. 21(2): 107-119. [17] Smith, D., Beattie, G. A. C. and Broadly, R. (1997) - Citrus pests and their natural enemies: Integrated pest management in

Australia. Queensland DPI and HRDC, Brisbane, Australia. [18] Weires, R. W. (1984) - Economic impact of a flucythrinate induced resurgence of the Comstock mealy bug (Homoptera:

pseudococcidae) on apple. J. Eco. Ento. 77(4):186-189. [19] Yin, J. L., Xu, H. W., Wu, J. C., Hu, J. H. and Yang, G. Q. (2008) - Cultivar and insecticide applications affect the

physiological development of the brown plant hopper, Nilaprvata lugens (Stal) (Homoptera: Delphacidae), Environ. Entomol. 37: 206-212.

Species Diversity, Pestiferous Nature, Bionomics and Management of Mirid Bugs and Flower Bud Maggots:

the New Key Pests of Bt Cottons

S. Udikeri1, S. Kranthi2, K.R. Kranthi2, N. Vandal1, A. Hallad1 S.B. Patil1 and B.M. Khadi

1Agricultural Research Station.Dharwad-580007 Karnataka India 2CICR,Nagpur-440010 Maharashtra India

e-mail: [email protected]

Abstract—Unforeseen insect pests have emerged as potential threats in India and elsewhere due to large scale cultivation of Bt cottons. Upto 69 % reduction in usage of pesticides has been achieved and reliance on synthetic pyrethroids, broad spectrum highly toxic organophosphates has been almost ceased, paving way for dominance of emerging pests. Hence, since 2007 field and laboratory investigations are in progress under TMC to unearth potential threats from emerging pests to cotton cultivation. Three different species of mirid bugs (Miridae: Hemiptera) viz., Creontiades biseratense (Distant), Compylomma livida (Reuter) and Hyalopeplus linefer (Walker) have been found infesting cotton recently. Creontiades biseratense has become major production constraint presently in South India and Maharastra. They are ‘number one’ pests in Karnataka state presently. Adults and nymphs suck the sap from base of square and tiny bolls leading to heavy shedding of these fruiting structures. Feeding on matured bolls leads to parrot beaking and improper opening. It has five nymphal stages that span 14 days and adult longevity of 13 and 21 days respectively for males and females. No Bt transgenic cotton cultivar or event could show appreciable resistance to mirid bugs in cultivar association studies. The estimated minimum avoidable yield loss is 20.6 %. Acephate 75 SP @ 700 gai/ha appeared to be promising chemical control option which limited the population to 14 mirids / 25 squares with maximum seed cotton yield of 2664 Kg/ha. Another mirid tea mosquito Helopeltis bradyi (Waterhouse) has been noticed for the first time in interspecific Bt cotton hybrids causing 85 % yield loss through severe boll and square damage. This paper also presents a new report on flower bud maggot Dasineura gossypii Fletcher (Cecidomyiidae: Diptera) which appeared as potential pest for first time in the history of cotton entomology. Currently > 90 % fruiting body damage has been recorded in largely cultivated Bt cotton cultivars viz Kanaka and Neeraj. The reproductive biology of this pest spreads over 12 -13 days spending all stages in squares or flower buds leading to heavy loss. Bioefficacy of Malathion 50 EC @ 2.0 ml / lit was better over the rest with 4.3 damaged buds / plant limiting avoidable yield loss to 480 kg/ha or 24 per cent.

INTRODUCTION

Since commercialization of Bt transgenic genotypes in 2002 there is miraculous increase in area and production of cotton in India. During 2009/10 the area under cotton was 103.29 lakh ha being highest in the world. With 295 lakh bales production the country remained second largest producer of seed cotton globally. The contribution from Bt cultivars is nearly 90 % which occupied 8.4 m ha area. Upto 69 % reduction in usage of pesticides has been achieved through Bt transgenic cottons. The reliance on synthetic pyrethroids and highly toxic broad spectrum organophosphate insecticides has ceased. Further commercialization of Bollgard-II (2006) cottons expressing Cry1Ac and Cry2Ab together paved way for dominance of emerging pests in cotton. By 2010 six different Bt transgenic events have been approved for commercial cultivation in India. Hence there is mosaic of different hybrids and Bt genes offering varied level of resistance /susceptibility to bollworms and sucking pests. Emerging pests have become significant issue in sustainability of Bt cottons in many countries. The incidence, spread and chemical control exercised over mealy bugs Phenacoccus solenopsis Tinsley (Pseudococcidae: Hemiptera) recently in India stands as an example for altered insect pest scenario. In South India and Maharastra the mirid bugs (often referred as true bugs) are now creating havoc. Creontiades biseratense (Distant) since its first appearance in 2005 (Patil et al 2005) is rampant these days. The present paper deals with status of mirid bugs and flower bud maggots as emerging pests of Bt of cotton in India.

33


MATERIALS AND METHODS Diversity of mirid bugs was assessed through regular survey in farmer’s fields in Karnataka state. The association of cultivars with mirid bugs was assessed by growing different Bt cottons (and non Bt as check) in two replicated randomized block design. The number of cultivars included varied in different years but were tested for two consecutive seasons. Each genotype was grown in six rows at spacing of 90 cm X 60 cm. Standard package of practices were followed except that it include any pesticide sprays. Avoidable loss was assessed by protecting the crop twice in the peak mirid bug incidence period with different concentrations of most effective chemical Acephate 75 SP to create differential population. A similar study was conducted involving different insecticides and biorationales to assess best management option. In this study, two rounds of treatment applications were maintained and were carried out between 2007 to 2011 under rain fed conditions at Agricultural Research Station, Dharwad (Karnataka: India), which is situated between 15° 07' N latitude and 76° 06' E longitude with an altitude of 678 m above MSL in the northern transitional region (zone-8) of Karnataka (India). The average rainfall of ARS, Dharwad is 733.8 mm. The mirid species under consideration was C. biseratense only for all these experiments as a dominant and regularly occurring species. The information from other states covered (if any) is based on personal communications with cotton entomologist under TMC /AICCIP projects.

The bionomics and oviposition pattern of C.biseratense discussed here is based on laboratory study conducted during 2009. The details are available in the publication Udikeri et al (2010). The informations on another mirid threat Helopeltis bradyi (Waterhouse) and a new pest flower bud maggots Dasineura gossypii (Fletcher) are based on survey and strict vigilance over emerging pests in the state. The bionomics of flower bud maggot has been studied in laboratory (on Bt cotton plants) at ARS, Dharwad 2010. The avoidable loss -cultivar association studies were carried out in Haveri district (Karnataka)


Species Complex, Distribution of Mirid Bugs and Severity in India Three species of mirid bugs are found infesting cotton in India. None of these have been historically referred as key pests of cotton. It is only after widespread cultivation of Bt cottons that mirid bugs have assumed key status. Three different species of mirid bugs (Miridae: Hemiptera) viz., Creontiades biseratense (Distant), Campylomma livida (Reuter) and Hyalopeplus linefer (Walker) were infesting cotton since 2005. Unlike widespread distribution of mealy bug Phenacoccous solenopsis Tinsley (Nagrare et al., 2009) mirid bugs have been restricted to Central and South India. The dominant species is Creontiades biseratense (Distant). It is most potential, widespread and also becoming a production constraint every year (Plate 1 and 2). In Karnataka Creontiades biseratense mirid bugs are the major pest as in TamilNadu, Maharastra and Andhra Pradesh. Campylomma livida (Reuter) is dominant species in Maharastra, however it is noticed in Karnataka also. Hyalopeplus linefer (Walker) is seen in Karnataka and Maharastra, but, not as regular pest. Its status is negligible (Udikeri et al., 2008).

Identifying Characters The commonly occurring key mirid bug Creontiades biseratense appears in different colour morphs, brown and green being common. Black and red morphs are also often noticed. Such green and brown mirids are common Australia and US also. But they are colour morphs. In recent years, two species of mirid bugs were recorded in Australia, of which Green mirid (Creontiades dilutus) considered as a significant pest and brown mirid (C. pacificus) are quite common in pulse crops (Khan, 2004). Adult of Indian cotton mirid bug Creontiades biseratense are brown in color with dark brown T-shaped band on pronotum. Nymphs are greenish in color with dark brown wing pads. The characters of Megacoelum biserratense reported long from Thailand (Hormachan et al., 1998) are similar to the Creontiades biseratense. Both could same also. Taxonomic revision is essential in this regard. Major identifying character of Hyalopeplus linefer is the presence of brownish parallel streaks on the pronotum. Distinct color morphs have been noticed in H. lineifer also. Nymphs of this species are creamish yellow in color with long antenna and wing pad. Both of these species are larger in size than Compylomma livida. The wing margins in these species are fringed and eyes are diaptic.

Species Diversity, Pestiferous Nature, Bionomics and Management of Mirid Bugs and Flower Bud Maggots 205

Nature of Damage

Both adults and nymphs damage developing flower buds/ squares and tender bolls. One to two days old bolls with dried petals intact provide a good habitat to the insects for feeding and sheltering. The characteristic symptoms of feeding on the flower bud shows oozing out of yellow fluid from the buds and staining of this yellow fluid on the inner surface of the bracts. Infested tender bolls have number of black patches on all sides of the outer surface of boll rind. It was observed shedding of most of the damaged squares and tender bolls. Usually the adults are swift fliers and brown in color. Nymphs are small with yellowish green abdomen and fast moving when disturbed. Feeding on matured bolls leads to parrot beaking and improper opening. It was estimated that damage leading to shedding of tender bolls for two day period revealed a loss of seed cotton yield. The symptoms of infestation and impact of mirid bugs observed in India do not deviate from the pestiferous cotton mirids described elsewhere (Udikeri et al., 2008).

Cultivar Association

A total of 100 Bt and four conventional cotton hybrids were evaluated to assess host plant resistance to mirid bug C biseratense. Conducted over three seasons none could show resistance to mirid bugs. Thus mirid attack was not genotype dependent, however slightly higher numbers on interspecific biotech hybrids were observed. There was no significant difference among BG and BG-II, Non Bt and Bt hybrids also. Two cultivars viz., Kanak (MRC 7351) and Neeraj (MRC 7201) always demonstrated higher incidence of mirid bugs. These two hybrids have been affected in farmers fields too (Table 1.)

TABLE 1: BT COTTON GENOTYPES WITH COMPARATIVELY LOW INCIDENCE OF MIRID BUGS

Cultivar Group and Bt Event Genotypes with Less than Average 28.08 Bugs per 25 Squares HxB BG-I NCHB 945,RCH-708 HxB BG-II Nil HxB Non Bt hybrids DCH-32 N Bt, HxH BG-I NCS-145, BN Bt, RCH-2Bt, RCH-20Bt, NCS-954,NCS-929,Jk-ISHWAR,JK-DURGA,

CHIRANJEEVI Bt, AKKA, DRUVA, NCS-907 HxH BG-II NCS 145 BG-II, KCH 15, TULSI-9, TULSI 45, SP 1037, CHIRANJEEVI, JAI-BG-II,

AKKA-BG-II, RCH-2, NCS-207 HxH Non Bt hybrids NCH 145, DHH-11 N Bt, Susceptible genotype KANAKA, NIRAJ

Assessment of Avoidable Loss

Two applications of Acephate 75 SP @ 1400 g ai /ha at peak incidence offered maximum protection against mirid bugs. The estimated loss was 449 Kg /ha or 20.6% over zero protection. This was on an average true with either BG or BG-II cultivars under moderate insect pressure. This could also be more if incidence is more or avoidable loss may increase with extended spray schedule. However two sprays were ideal considering the pest and damage potential nature (Figure 1).

Fig. 1: Avoidable Yield Loss Due to Mirid Bug Incidence

g y g

0

10

20

30

40

50

60

70

175 350 700 1400 0

Different dosages of Acephate 75 SP (gai/ha)

Miri

d bu

gs/2

5squ

ares

0

100

200

300

400

500

600

Avoi

dabl

e yi

eld

loss

(kg/

ha)

Mirid bugs/25 squares Avaoidable loss (kg/ha)


Management of Mirid Bugs

Among various treatments, Acephate 75 SP @ 1.0 g/l was found be most significant treatment in reducing mirid infestation. Acephate could limit the mirid incidence to 13.87 bugs/25 squares against 46 bug in untreated control leading to maximum recorded seed cotton yield 2664Kg /ha. It was followed by Acetamiprid 20 SP and Imidacloprid 200SL. In Australia, trials have shown that reduced rate of Indoxacarb or Fipronil combined with salt rendered effective control of mirid bugs (Khan, 2003). Fungal pathogens viz., Verticillium, Metahrrhizium and Beauveria were not promising (Figure 2).

Fig. 2: Management of Mirid Bugs Through Insecticides and Boirationals

Bionomics of Mirid Bug C. biseratense and Oviposition Pattern

The females of mirid bugs C. biseratense preferred to lay eggs in petiole where in 855 eggs were traced. There are five instars in the life history extending the total life cycle upto 39-41 days. The details are available in Udikeri et al.(2010) (Table 2).

TABLE 2: BIOLOGICAL PARAMETERS AND MORPHOMETRIC MEASUREMENTS OF MIRID BUG C. BISERATENSE

Stage Mean±SD Length (mm) Mean±SD Breadth (mm) Mean±SD Egg (Incubation period) Days 5.60±1.1 1.55±9.5 0.45±6.9 Nymphal Duration (Days) I instar 2.69±0.36 1.15±0.14 0.29±2.7 II instar 2.76±0.18 2.9±0.13 0.86±0.15 III instar 2.83±0.21 3.3±0.20 1.1±2.4 IV instar 2.89±0.24 4.4±1.27 2.7±1.6 V instar 2.83±0.20 5.5±0.26 2.6±0.25 Total Nymphal Period (Days) 14±1.19 - - Pre mating period 1.75±0.42 - - Mating period 3.60±0.51 - - Pre oviposition 2.51±0.24 - - Oviposition 9.51±1.2 - - Post oviposition 8.22±0.64 - - Fecundity (Number of eggs) 15.0±1.2 - - Adult Longevity (Days) Male 13.20±2.61 7.0±0.15 3.0±9.8 Female 21.0±3.50 9.0±0.1 3.4±0.15 Adult Life Cycle (Days) Male 41.13±6.1 - - Female 39.94±5.8 - -

0

5

10

15

20

25

30

35

40

T1- D

imet

hoat

e30

EC

-1.7

ml

T2-Im

idac

lopr

id20

0SL-

0.2m

l

T3-A

ceta

mip

rid20

SP-

0.2g

T4-

Thia

met

hoxa

m25

WG

-0.2

5g

T5-A

ceph

ate

70SP

-1.0

g

T6-

Chl

orpy

ryph

os20

EC

-2.0

ml

T7-N

eem

oil

+N

irma

pow

der-

2.5m

l+1.

0g

T8-N

irma

pow

der-1

0g

T9-V

ertic

illiu

mle

ccan

i-2.0

g

T10-

Bea

uver

iaba

ssia

na-2

.0g

Dosage per lit spray volume

Miri

d bu

gs/2

5squ

ares

0

500

1000

1500

2000

2500

3000

Yie

ld k

g/ha

Mirid bugs /25squares Yield kg/ha"


Management of Flower Bud Maggots

The bio efficacy of Malthion 50EC @ 2.0 ml/l was found to be most significant treatment in reducing flower bud maggots infestation with 4.3 damaged buds / plant and maximum seed cotton (2475 kg /ha) yield. It accounted for an avoidable yield loss of 480 kg/ha or 24 per cent. The next best chemical was Profenophos 50 EC @ 2 ml/ lit with 24.0% avoidable loss (Figure 3).

Fig. 3: Management of Flower Bud Maggots (Midge) and Avoidable Loss in Bt Cotton

New Report of Tea Mosquito or Guava Kajji Bug as Pest of Bt cotton

Helopeltis bryadi (Waterhouse) a Hemipteran pest has been found damaging the Bt cottons severely. It is a common pest on Guava / Cashew/ tea etc. and is called kajji bug as it causes black lesions on the almost all leaves and young shoots, squares and bolls. However, it appears rarely on cotton crop. It has been reported for the first time on DCH-32 during 1996 in Honnali of Davangere district. Later in 2002, on the same genotype it was noticed in H. D. Kote taluka of Mysore district. The most severe damage of this pest insect was noticed on Bt cotton in Hosalli village of Uttar Kannada district. Affected genotypes are interspecific biotech hybrids, MRC -6918 and RCH-708 (Udikeri et al., 2011).

Both nymph and adults suck the sap from leaves and young shoots, squares and bolls. As a result of it leaves get rolled at the edge with brown central black lessons particularly near the main veins. Cankers like lesions develop on the lower green bolls. Linear scars with white papery layer appearance in tender shoots. Retarded growth leads to gradual dying of shoots. Mature bolls bear blackish brown circular pits towards tip of the bolls. Rotting of boll takes place due to entry of rainwater and such infested dried up bolls / squares remain intact in plant (Plate 3 and 4).

Flower Bud Maggot or Gall Midge of Cotton: A New Report

During 2009 severe incidence of gall midge Dasineura gossypii Fletcher, 1914 (Cecidomyiidae: Diptera) was seen in a farmer’s field at Hesarur (Taluk: Savanur District: Haveri). The crop was sown in first week June and by August incidence took severe proportions. Later in Kakol, Konanatambagi etc villages (Haveri District) also it has been noticed in severe form. In the research farm (ARS, Dharwad) it has been noticed in negligible proportions earlier, but, since couple of years its incidence is increasing. In Raichur, Bellary, Belgaum, Haveri, Gulburga and Dharwad district also the pest has been recorded during survey but, in low proportions (figure 4).

0

2

4

6

8

10

12

14

16

Acephate 75 SP-1.0g

Acephate 75 SP +DDVP 76 EC-1.0g+0.25ml

Fipronil 5% SC-1.0ml

Malathian 50EC-2.0ml

Profenophos 50EC-2.0ml

Untreated control-0

Dam

age

(%)

0

50

100150

200

250

300

350400

450

500

Avoi

dabl

e lo

ss (k

g/ha

)

Avoidable loss (kg/ha) Flower bud damge (%)


Fig. 4: Per Cent Square Damage of Flower Bud Maggot or Gall Midge in Different Bt Cotton

As the pest remains inside the flower and multiplies quickly, it was difficult to manage this pest by the farmers even with 3-4 sprays. The insecticides used viz Imidacloprid (Confidor 200 SL), Oxydemeton methyl (Metasystox 25 EC), Monocrotophos (Monocil 40 SL), Acephate (Starthene 75 SP), Neem oil etc could not render satisfactory results. When these insecticides are used along with DDVP (Nuvan 78 EC) as tank mix (@ 0.25 ml/l) the spread of incidence was checked to certain extent. In all the locations where the pest has caused wide spread damage the cultivar was MRC-7351 BG-II (Kanaka) only.

History of the Pest/ Previous Reports

Dasineura gossypii was described by Professor T. B. Fletcher in 1940 in Pusa, Bihar based on collections from cotton flower buds (Fletcher, 1916). From Tamil Nadu also (Coimbatore) it has been reported earlier as a pest on cotton as referred to as floral bud maggot (Ayyar 1932). Thus it could find a place in “Cotton in India: A Monograph” Vol. – II: 1960 (Dastur et al., 1960). After the initial reports, no single reference about its appearance as a major/ minor pest is available. This is the first report of Dasineura gossypii as a major pest in India.

Nature of Damage

Maggots feed on anthers and stamenal column leading to degradation / decaying. Three to fifteen maggots are observed in a flower bud. The infested flower buds fail to grow properly and they will not open as the petals as well as tissue inside dries. Thus comprehensive symptoms give a picture of flower drying through organ degradation and death. The pupation take place inside dried flowers itself.

0

10

20

30

40

50

60

70

80

90

100

1

Bt Cotton cultivars

Squ

are

dam

ge (%

)

KanakaNeerajMRC-7383SurpassMiracleMallika BtRCH-2 BtBunny BtTulsi-9 Bg-IJai BtMRC-6918MRC-7918Chiranjeevi Bg-I


In general square formed will not turn into a boll, due to death at flowering stage. Tissue drying and/or death unevenly lead to twisted or contorted stamenal column/ anthers. Compared to normal boll persistent stamina column is seen in affected ones but it needs confirmation. In some cases, where fertilization is not affected, the boll formation is affected. The size remains smaller. Tissue degradation is prominent on boll rind also. The bolls will not reach normal size and no proper filling with fibre is seen (plate 5 & 6).

Bionomics of Dasineura gossypii and Oviposition Pattern

The females of Dasineura gossypii preferred to lay eggs in square tips where in 42-45 eggs were traced. There are three instars in the life history and pupation takes 4 to 5 days on bracts extending total life cycle upto 10 -13 days. Further studies are under progress.

Large scale cultivation of bollworm resistant Bt transgenic cottons suppressed the dreaded pests successfully world wide. Significant reduction in usage of insecticide especially broad spectrum organophosphates and pyrethroids gave scope for emergence of new pests especially the sap feeders. Mirid bugs either prevailing hitherto or newer ones have assumed key status warranting couple of sprays during reproductive phase. Increased incidence of mirids in cotton may give rise to host range expansion as well as enhanced damage in alternate hosts of these pests. Key strategies and integrated approaches are essential for sustainable use of Bt technology.

ACKNOWLEDGEMENT The funds received from Indian Council of Agricultural Research (ICAR) New Delhi in addition to the technical support accorded by Central Institute for Cotton Research (CICR) Nagpur through TMC MM-I 3.1 project” Emerging and key pests: their characterization, taxonomy, genetic diversity and control’ is gratefully acknowledged.

Dr. C.A. Viraktamath. UAS. Bengaluru and Dr R.M.Sharma. ZSI. Jabalpur are acknowledged for taxonomic services.

REFERENCES [1] Ayyar, J. V. R. (1932)- Insects affecting the cotton plant in India. Madras Agril Dept Bulletin 28: 1-28. [2] Dastur, R. H., Asana, R. D., Sawhney, K., Sikka, S. M., Vasudeva, R. S., Quadiruddin, K. and Roa V. P., and Sethi, B. L.

(1960)- Indian Central Cotton Committee., Bombay [3] Hormachan, P. A.,Wongpiyasatid and Piyapuntawanon (1998)- New record of Megacoelum biseratense (Heteroptera:

Hemiptera) in Thailand. Proc. KUDRI Res. Conf., 20-23. [4] Khan, M. (2003)-Salt mixtures for mirid management. The Australian Cotton Grower 24: 10. [5] Khan, M., Kelly, D., Hickman, M., Mensah, R., Brier, H., and Wilson, L. (2004)- Mirid ecology in Australian

cotton.www.csiro.org [6] Nagrare, V. S., Kranthi, S., Biradar, V. K., Zade, N. N, Sangode, V., Kakde, G., Shukla, R.M., Shivare, D., Khadi, B. M.,

Kranthi, K. R. (2009)- Widespread infestation of the exotic mealybug species, Phenacoccus solenopsis (Tinsley) (Hemiptera: Pseudococcidae), on cotton in India. Bull. Entomol. Res. 99: 537-41.

[7] Patil, B. V., Bheemanna, M., Patil, S. B., Udikeri, S. S., and Hosaman, I. (2006)- A record of mirid bug Creontiades biseratense (Distant) on cotton from Karnataka., India. Insect Environ. 11: 176-77.

[8] Udikeri, S. S. (2006)- Evaluation of new generation Bt cotton genotypes, Sustainability of Cry protein expression, computation of ETL, Effect on aphid predators and development of IPM module for Bt Cotton under rainfed conditions. Ph. D. Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

[9] Udikeri, S. S. (2008)- Mirid Menace: An emerging potential sucking pest problem in cotton. The ICAC recorder Vol- XXVI No.4

[10] Udikeri, S. S., Kranthi, K. R., Patil, S. B., Modagi, S.A and Vandal, N.B. (2010)- Bionomics of mirid bug Creontiades biseratense (Distant) and oviposition pattern in Bt cotton, Karnataka J. Agri. Sci. 23: 153-156.

[11] Udikeri, S.S., Kranthi, K.R., Patil, S.B. and Khadi, B.M. (2011)- Emerging pests of Bt cotton and dynamics of insect pests in different events of Bt cotton. Paper presented in 5th Asian Cotton Research and Development Network Meeting, Lahore, Pakistan 23-25th February 2011. (www.icac.org)

Influence of Spatial Cropping Patterns of Cotton Cultivation on Population Dynamics of Mirid Bug,

Creontiades biseratense (Distant)

B. Dhara Jothi1, T. Sonai Rajan1, V.S. Nagrare2, M. Amutha1, Rishi Kumar3 and T. Surulivelu1

1Central Institute for Cotton Research, Regional Station, Coimbatore, India 2Central Institute for Cotton Research (CICR), P. B. No. 2., Shankar Nagar P. O., Nagpur, India

3Central Institute for Cotton Research (CICR), Regional Station, Sirsa, Haryana, India e-mail: [email protected]

Abstract—Mirid bug Creontiades biseratense (Distant) has been reported as an emerging pest on Bt cotton from the States of Tamil Nadu and Karnataka. Nymphs and adults of C. biseratense cause damage to squares, flowers and tender bolls leading to the affected parts gradually turning to yellow followed by shriveling and premature dropping. Such damage results in significant reduction in seed cotton yield. Spatial cropping patterns with different adjacent crops of cotton fields are expected to exert influence on the population dynamics of mirids. Present study assessed the population dynamics of C. biseratense across different spatial cropping patterns of cotton viz., cotton surrounded by non-target crop (Tomato) and cotton with intercrop (cowpea) during (2008-09) and additional adjacency cropping patterns viz., cotton adjacent to weedy road and cotton adjacent to fallow weeds during 2009-10 with cotton as sole crop as control during both the years were studied under farmers field conditions at Coimbatore, Tamil Nadu. Influence of the spatial cropping patterns on nymphs, adults, natural enemies and the damage potential of the pest on squares and bolls were documented throughout the season, and compared. During 2008-09, nymphal population varied significantly with the cropping system between 37th standard meteorological week (SMW) and 41st SMW wherein minimum population was recorded in cotton + cow pea (0.85 - 2.90/plant) consistently. Among the five cropping patterns during 2009-10, cotton adjacent to weedy road recorded the maximum seasonal mean population of nymphs besides for two periods. The adult population recorded across different cropping patterns was of the order: cotton + cowpea (0.80-1.20/plant) > cotton surrounded by tomato (1.05-1.70/plant) > cotton as sole crop > cotton adjacent to weedy road > cotton adjacent to fallow fields. Significant difference in square damage was recorded during second fortnights of September, November and December during 2008-09. Square damage recorded was minimum in cotton + cowpea (8.40-12.76%) andcotton + tomato (10.62-14.86%) and maximum in cotton as sole crop (14.67-30.02%). During 2009-10, though cotton adjacent to weedy road recorded maximum square damage initially, cotton surrounded by tomato recorded maximum damage in the later stages of the crop. Cotton + cowpea cropping system recorded minimum boll damage (9.06 - 18.61%) as compared to other patterns of cotton cultivation. Cotton surrounded by tomato recorded maximum Square and boll damage. Significant influence of cropping patterns on the spider population was also recorded. The results indicated that cotton + cowpea intercrop with weed free surroundings reduced the mirid bug population, and hence could form an important component of IPM package for the management of the pest.

INTRODUCTION

Genetically engineered cotton crop that express δ endotoxin (Cry protein) from Bacillus thuringiensis (Bt) is mainly toxic to the bollworms, (American bollworm, Spotted and Spiny bollworm and Pink bollworm) semiloopers and hairy caterpillars in India (Kranthi, 2009). Reports (Qaim and Zibberman, 2003; Barwale et al., 2004, Bennet et al., 2004 & Morse et al., 2005) showed that yields increased substantially by adopting Bt cotton and farmers in India were able to reduce insecticides use by at least 2 – 3 applications. Reduced insecticide application coupled with selective use of insecticides have allowed minor pests to survive and emerge as important ones and the changed pest complex comprises of mirids, aphids, whiteflies, thrips and mealybugs (www.crdc.com.au). In China, mirid bug have historically been considered occasional (or) minor pests in most crops, occurring at relatively low population levels and only sporadically pests management intervention (Lu and Wu, 2008). The mirids (true bugs) comprise a large and diverse insect family miridae belonging to the order Hemiptera. These are small terrestrial insects, usually oval shaped (or) elongate measuring less than 12 mm in length (en.wikipedia.org). Most

34

Influence of Spatial Cropping Patterns of Cotton Cultivation on Population Dynamics of Mirid Bug 211

of the mirids are agricultural pests with a wide host range of sunflower, safflower, pigeon pea, lucern, legumes, maize, sorghum, bajra (Khan et al., 2004). The cotton mirid bug, Creontiades biseratense (Distant) is an emerging insect pest on Bt cotton in Karnataka and Tamil Nadu, India causing heavy shedding of squares and bolls which lead to significant reduction in seed cotton yield (Patil et al., 2006, Surulivelu and Dharajothi, 2007, Ravi, 2007 and Udikeri et al., 2009). Mirid bugs can easily attain outbreak levels; switch host crops (or) experience geographic spread due to their environmental adaptability (Lu & Wu, 2008 and Ting, 1963 & 64), high population growth rate (Lu & Wu, 2008 and Ting, 1963) and strong dispersal capacity. Detailed studies on the influence of spatial cropping pattern of cotton cultivation on population dynamics of mirid bug, C. biseratense were conducted in Coimbatore region and presented in this paper.


To study the influence of spatial cropping patterns of cotton cultivation on population dynamics of cotton mirid bug, C. biseratense studies were conducted at Coimbatore under farmers’ field conditions during the winter cotton season of 2008 – 09 and 2009 – 10. The village farms are located 30 Kms away from Coimbatore. During 2008 – 09, three fields with cotton as sole crop, cotton with cow pea as intercrop and cotton surrounded by non-target crop (tomato) and during 2009 – 10 apart from the above three adjacent cropping patterns (cotton adjacent to weedy road and cotton adjacent to fallow land) were selected as study fields. Cotton as sole crop was kept as control in both the years. Periodical observations were recorded at weekly intervals on the population dynamics of mirid bug - nymphs, adults, natural enemies and damage caused by the mirids on squares and bolls. All the data were analyzed statistically and interpretations were drawn.


Dynamics of nymphs and adults of C. biseratense were recorded under 3 spatial cropping patterns of cotton during 2008-09. Nymphal population appeared during September II fortnight to December II fortnight. Within the observation period nymphal population was significantly varied from September to October I fortnight, minimum population of nymphs were recorded in cotton with cowpea (0.85 to 2.90) followed by cotton surrounded by tomato (2.40 to 3.75) and cotton as sole crop 2.60 to 3.0 (except October I fortnight). However overall seasonal mean of the nymphs indicated that there was no significant difference among the three cropping patterns (Table 1& Fig.1.a). Adult population recorded in all the cropping systems vary significantly from September I fortnight to November II fortnight. Initially minimum population of adult was recorded on cotton as sole crop (1.45 to 5.0) from September I fortnight to October I fortnight. However, influence of cotton with cow pea cropping pattern was recorded with the minimum population of adults varied from 0.6 to 3.45 followed by cotton surrounded by tomato (0.75 to 4.25) and cotton as sole crop (1.25 to 5.50) from October II fortnight to November II fortnight. Overall mean population of adults recorded were significantly low in cotton with cowpea as intercrop followed by cotton surrounded by tomato and cotton as sole crop (Table 1& Fig. 1b.).

TABLE 1: INFLUENCE OF SPATIAL CROPPING PATTERNS OF COTTON CULTIVATION ON POPULATION DYNAMICS OF MIRID BUG, CREONTIADES BISERATENSE

S. No

Cropping System Population & Damage/ 20 Plants Nymph Adult Spider Square Damage (%) Boll Damage (%)

08 - 09 09 - 10 08 - 09 09 - 10 08 - 09 09 - 10 08 - 09 09 - 10 08 - 09 09 - 10 1. Cotton as sole crop 2.32 0.86 3.14 0.42 1.03 0.36 18.19 12.04 28.06 13.95 2. Cotton surrounded by Tomato 2.77 1.14 1.95 0.75 0.97 0.43 14.58 11.98 28.97 19.05 3. Cotton with cowpea 2.63 1.04 1.32 0.59 1.05 0.30 9.95 9.31 20.60 18.75 4. Cotton adjacent to weedy road - 1.29 - 1.88 - 0.53 - 12.51 - 16.58 5. Cotton adjacent to fallow land - 0.89 - 0.99 - 0.40 - 6.91 - 17.58 SEd 0.11 0.07 0.06 0.07 0.05 0.06 1.04 1.79 1.36 1.70 CD (P = 0.05) N.S 0.14 0.12 0.14 N.S 0.12 2.11 N.S 2.76 N.S.


Fig. 1: Influence of Cropping Pattern of Cotton on Dynamics of Mirid Bug during 2008-09

a. Nymphal Population

0

1

2

3

4

5

6

7

Sep I fort Sep II fort Oct I fort Oct II fort Nov I fort Nov II fort Dec I fort Dec II fort

Standard weeks

Nym

ph / 2

0 pl

ants

Coton as Sole crop Cotton‐Surrounded by tomato Cotton‐with Cow pea

b. Adult Population

0

1

2

3

4

5

6


Standard weeks

Adu

lt /

20 plan

ts


c. Square damage

0

5

10

15

20

25

30

35


Standard weeks

Squa

re dam

age / 20

plant

s


d. Boll damage

0

5

10

15

20

25

30

35

Sep II fort Oct I fort Oct II fort Nov I fort Nov II fort Dec I fort Dec II fort

Standard weeks

Boll da

mag

e / 20

plant

s


e. Spider population

0

0.5

1

1.5

2

2.5


Standard week

Popu

lation

/20 plan

ts



Fig. 2: Influence of Cropping Pattern of Cotton on Dynamics of Mirid Bug during 2009-10

a. Nymph Population

0

0.5

1

1.5

2

2.5

3

3.5

4

Oct I fort Oct II fort Nov I fort Nov II fort Dec I fort Dec II fort Dec II fort

Standard weeks

Popu

lation

/20 Plan

ts

Coton as Solecrop Cotton surounded tomato Cotton with cowpea

Coton adjacent to weedy road Cotton adjacent to fa l low land

b. Adult population

0

1

2

3

4

5

6

7


Standard weeks

Popu

lation

/20 Plan

ts


Coton adjacent to weedy road Cotton adjacent to fa l low l and

c. Square Damage

0

5

10

15

20

25

30

35


Standard weeks

Squa

re dam

age/20

plants

Coton as Solecrop Cotton surounded tomato

Cotton with cowpea Coton adjacent to weedy road

Cotton adjacent to fa l low l and

d. Boll damage

0

5

10

15

20

25

30

35

40

45


Standard weeks

Boll da

mag

e/20

plant

s


Coton adjacent to weedy road Cotton adjacent to fa l low l and

e. Spider Population

0

0.2

0.4

0.6

0.8

1

1.2

1.4


Standard weeks

Population/20 plants

Coton as Solecrop Cotton surounded tomato

Cotton with cowpea Coton adjacent to weedy road

Cotton adjacent to fa l low land


Significant difference in square damage was observed during II fortnight of September, November and December. Square damage was recorded as minimum in the cotton + cowpea (8.40-12.76) and cotton + tomato (10.62-14.86) and maximum in cotton as sole crop (14.67-30.02). No significant difference was recorded during September I fortnight, October I & II fortnight, November II fortnight on the square damage (Table 1& Fig 1c.). Mean square damage was minimum in cotton with cowpea as intercrop followed by cotton surrounded by tomato and maximum square damage was recorded in cotton as sole crop.

Significant difference in the per cent of boll damage was observed within the cropping patterns during II fortnights of September, October, November and December. Cotton + cowpea cropping system recorded minimum per cent of boll damage (9.06 - 18.61) as compared to other cropping patterns. No significant difference in the per cent of boll damage was recorded during October I fortnight and December II fortnight within the cropping system (Table 1 & Fig 1d.). Seasonal mean damage within the cropping pattern also indicated minimum per cent of boll damage in cotton with cowpea as intercrop. No significant difference in the spider population within the cropping patterns, however numerically higher number of spiders was recorded in cotton with cow pea (Table 1 & Fig. 1e.).

During 2009 - 10 the influence of single cropping system on the nymphal population was not observed consistently. The population varied significantly within the 5 cropping patterns only during October I & II fortnight, November II fortnight and December I fortnight. On October I fortnight cotton adjacent to weed road influenced the population of nymphs of the pest by recording highest population of 3.65 / 20 squares. During October II fortnight cotton adjacent to fallow weeds and sole crop of cotton cropping system influenced the nymphal population by recording 1.85 and 2.95 / 20 squares respectively. On November II fortnight cotton with cow pea and cotton surrounded by tomato recorded highest population of 0.95 and 1.40 nymphs / 20 squares respectively (Table 1 & Fig 2a.).

Seasonal mean population was highest in cotton adjacent to weedy road & cotton surrounded by tomato and the significantly minimum population was recorded in cotton as sole crop, cotton adjacent to fallow land and cotton + cowpea and were on par with each other.

Significantly higher and lower number of adults was recorded in cotton adjacent to weedy road and cotton as sole crop, respectively. Populations on all other cropping patterns were on par with each other. Adult population of mirid bug was highly influenced by the cropping systems. During I and II fortnight October and November cotton adjacent to weedy road and cotton adjacent to fallow weeds recorded significantly highest level of adult population (Table 1 and Fig 2b.).

Square damage was significantly different within the cropping pattern during October I fortnight to December II fortnight. Cotton surrounded by weedy road and cotton surrounded by tomato recorded higher percentage of square damage during I and II fortnights of October, November and December (Table 1 and Fig 2c). Significant difference in the per cent of boll damage was recorded during II fortnight of November and December. Among the cropping pattern cotton surrounded by tomato and cotton surrounded by weedy road recorded higher per cent of infestation consistently for two weeks (Table 1 and Fig 2 d).

Overall spider numbers were minimum however, within the available population among the cropping pattern, cotton adjacent to weedy road recorded higher mean population of spiders (Table 1 and Fig 2 e).

In general mirid population level was minimum during the observation period. Population of nymphs, adults, square and boll damage observed during 2008-09 was higher than 2009-10. However, with a mean population ranging from 2.32-2.77 / 20 plants 0.86-1.29 / 20 plants during 2008-09 and 2009-10 respectively caused % of square and boll damage ranging from 9.95 - 18.19, 6.91 - 12.51 and 20.60 - 28.97 and 13.95 -19.05 during 2008-09 and 2009-10 respectively (Table 1). Square and boll damage were correspondingly higher during the availability of peak nymph and adult population.

Planting crops that are more attractive to mirids close to cotton crops may reduce population in cotton. Lucerne has been shown to be an excellent trap crop for mirids, (www.cotton.crc.org.au). In the


present study influence of cropping patterns were studied for the level of mirid nymphs and adult population level. Results indicated that cowpea intercropped in cotton recorded minimum population of mirid nymphs, adults than in other cropping pattern. This is in agreement with Altieri, 1987 and Venugopal Rao (1995) who has reported that polyculture, intercropping provides a favourable habitat for the buildup of natural enemies which makes less convenient to establish crop pests. According to the present study cotton intercropped with pulses (Cowpea) registered minimum damage in squares and bolls as compared to other cropping patterns. As per the present study, cotton surrounded by tomato and cotton surrounded by weedy road recorded higher level of infestation. Mensah and Khan, (1997) reported the movement of Creontiades dilutus adults into adjacent weeds. The present study indicated that cotton + cowpea (as intercrop) and weed free surroundings will reduce the mirid bug population, and form an important component of IPM package for the management of sucking pests including the mirid bugs.

ACKNOWLEDGEMENT

We acknowledge the financial assistance by World Bank through Indian Council of Agricultural Research, New Delhi to carry out the present study as a part of National Agricultural Innovation Project (NAIP/DSS/C 2046) at Central Institute for Cotton Research, Regional Station, Coimbatore.

REFERENCES [1] Altieri, M.A. 1987. The Scientific basis of alternative agriculture. Agro. Ecology, Boulder / London: Crestview/ITP. pp. [2] Barwale, R.B., V.R., Gadwal, U. Zehr, and B. Zehr, 2004. Prospects for Bt–cotton technology in India.

Ag Bioforum 7: 23 – 26. [3] Bennet, R.M., Y., Ismael, U. Kambhampatti, and S. Morse. 2004. Economic impact of genetically modified cotton in India.

AgbioForum 7: 96 – 100. [4] http:// www.cotton.crc.org.au [5] http://en.wikipedia.org/wiki/miridae [6] Khan, M., D. Kelly, M. Hickman, R. Mensah, H. Brier and L. Wilson. 2004. Mirid ecology in Australia. CRS Research

Rev. 15. [7] Kranthi, K.R. and D.A. Russell. 2009. Changing trends in cotton pest management. R. Peshin, A. k. Dhawan (eds.),

Integrated Pest Management: Innovation – Development Process. Pp. 499 – 541. [8] Lu Y.H. and K.M. Wu, Biology and control of cotton mirids, (Golden shield Press, Beijing, 2008). [9] Mensah, R.K. and M. Khan. 1997. Use of Medicago sativa (L.) interplantings / trap crops in the management of the green

mirid Creontiades dilutus (Stal) in commercial cotton in Australia. Int. Journ of pests Mgt. 43 (3): 197 – 202. [10] Morse, S., R.M. Bennett, and Y. Ismael, 2005. Genetically modified insect resistance in cotton: Some economic impacts in

India. Crop Protection 24(5): 433 – 440. [11] Patil, B.V., M., Bheemanna, S.B. Patil, S.S. Udikeri, and A. Hosamani, 2006. Record of mirid bug, Creontiades biseratense

(Distant) on cotton from Karnataka, India, Insect Environ. 11: 176 – 177. [12] Ravi, P.R., 2007. Bio-ecology, loss estimation and management of Mirid bug Creontiades biseratense (Distant)

(Hemiptera: Miridae) on Bt cotton. M.Sc., (Agri) Thesis, Univ. Agric. Sci., Dharwad (India). [13] Surulivelu, T. and B. Dhara Jothi. 2007. Mirid bug, Creontiades biseratense (Distant) damage on cotton in Coimbatore,

http://www.cicr.gov.in. [14] Ting, Y.Q., Acta Phytophyl. Sin. 2, 285 (1963) [15] Ting, Y.Q., Acta Entomol. Sin. 13, 298 (1964) [16] Udikeri, S.S., S.B. Patil, H.M. Shaila, G.S. Guruprasad, S.S. Patil, K.R. Kranthi, and B.M. Khadi. 2009. Mirid menace – a

potential emerging sucking pest problem in cotton. [17] http://www.icac.org. [18] Venugopal Rao, N. 1995. Bio-ecology and management of H. armigera in the cotton ecosystem of Andhra Pradesh.

Bulletin of APAU, R. Nagar, Hyderabad. [19] Qaim, M. and D. Zibberman, 2003. Yield effects of genetically modified crops in developing countries. Science 299: 900 –

902.

Determination of Economic Injury Level for Defoliator Spodoptera litura (Fab.) on Bt Cotton

M. Bheemanna, S. Hanchinal, A.K. Hosamani and R. Chowdary

University of Agricultural Sciences, Raichur, India e-mail: [email protected]

Abstract—Cotton defoliator Spodoptera litura (Fab.) is considered to be one of the important pests after introduction of Bt cotton. The damage potential and economic injury level (EIL) for S. litura larvae on Bt cotton (NCS 145 BG) at different days after sowing were worked out. The EIL was worked out for two years during 2008-09 and 2009-10 seasons. Economic injury level was 2.64, 3.47 and 4.27 larvae per plant at 90,120 and 135 days after sowing, respectively during 2008-09. Similarly during 2009-10, EIL was 1.68, 2.44, 2.54 and 3.59 larvae per plant at 90, 105, 120 and 135 DAS, respectively.

INTRODUCTION

The knowledge of economic threshold level (ETL) helps in determining whether an insect is to be classified as a pest or not. Without a doubt, economic decision levels are the key stones of insect pest management programmes and they are indispensable because they indicate the course of action to be taken in any given pest situation (Pedigo,1991). The ideas expressed by Pierce(1934) with regard to the assessment of insect damage and the initiation of control measures become one incentive for development of the concept of economic injury level (EIL). In later years, it was Stern et. al (1959) who formally proposed the concept of economic threshold level as the number of insects(density or intensity) when management action should be taken to prevent the increasing pest population from reaching economic injury level.

The effective management of most of the pests in cotton depends on the use of chemical insecticides, but its use should be judicious, need based and based on ETL (Economic threshold level) concepts. The earlier concept of ‘pest control” arising cent per cent elimination of pests from the agricultural ecosystem was replaced by the term “Pest Management” concept, the established and accurate determination of action thresholds of any pest species is a prerequisite. Considering these points the present investigation was undertaken to assess the economic injury level (EIL) of S. litura infesting Bt cotton.


The calculation of EIL for S.litura was done based on the economic losses in yield resulting from insect pest and the cost involved in plant protection against the particular pest. An experiment in randomized block design (RBD) was laid out during 2008-09 and 2009-10 under field conditions at Main Agricultural Research Station, UAS, Raichur with eight treatments and three replications using the popular Bt cotton hybrid (NCS-145 BG).

The treatments were

T1- Complete protection T2- Releasing 5 larvae/plant T3- Releasing 10 larvae/plant T4- Releasing 15 larvae/plant T5- Releasing 20 larvae/plant T6- Releasing 25 larvae/plant T7- Releasing 30 larvae/plant T8- Releasing 35 larvae/plant

35

Determination of Economic Injury Level for Defoliator Spodoptera litura (Fab.) on Bt Cotton 217

For each treatment, six plants were maintained in each plot, such three replications were maintained for each treatment. All the plots were covered with fine nylon mesh to prevent infestation from outside. Second instar larvae of S .litura obtained from laboratory culture were released on cotton plants at 90,120 and 135 days after sowing during 2008-09 and 90,105,120 and 135 days after sowing during 2009-10 season. Different blocks were maintained for releasing the larvae at different days after sowing to assess the yield loss. The cages were so designed that they did not allow free passage of larvae. The bottom edges of the cages were inserted into the soil on all the sides so as to check the escape or entry of larvae. Nylon net cages were erected on bamboo sticks fixed in four corners.

The larvae were released thrice during 2008-09 and four times during 2009-10 season. The total weight of seed cotton lint from all the treatments was worked out by correlation co-efficients and regression equations. Yield data were converted into q/ha. Yield loss from different treatments was derived by delinting the yield in the respective treatment from the yield in control (where no larvae were released).The value of yield loss was determined at the wholesale market price of cotton prevailing at Raichur just after harvest during two seasons.

The EIL was computed based on the procedure given by Stone and Pedigo (1972) and modified by Ogmana and Pedigo(1974) using the following formula

Gain threshold = Management cost (Rs/ha)

Market value of cotton (Rs/q) Management cost was calculated for the insecticide Buprofezin @ 1ml/lt (Rs 2500/lt) along with

application cost including the labour charges. Two sprays were required to keep the crop free from infestation.

The correlation co efficient ‘r between the variables, population level of the pest reduction in cotton yield per hectare were worked out using the following formula.

r =N.∑ xy ‐ ∑ x ∑ y

√(N ∑ x ( ∑x ) ) ( N ∑ y ( ∑ y) )2 2 2 2

Where, N is the total number of observations 0X is the population levels of larvae/plant 0Y is the reduction in grain yield

Regression equation of y = a + bx form was deduced where ‘a” is the intercept, ‘b” is the yield reduction per larva. Thus ‘b” is the per plant reduction in yield by increasing five larva. Substituting the values in the above formula EIL was computed.


There was significant difference in leaf damage between treatments, which received varied number of larvae and the plants which received no larvae during 2008-09 (Table 1).The per cent leaf damage ranged from zero in completely protected (T1) plants to 46.44 where 35 larvae per plant where released (T8) at 90 DAS (Days after sowing). The plants which received 5, 10 and 15 larvae per plant were on par with each other and differed significantly with treatment which received 20,25,30 and 35 larvae per plant. The treatments which received 20 and 25 larvae per plant were on par with each other and differed significantly with treatments which received 30 and 35 larvae per plant.


TABLE 1: PER CENT LEAF DAMAGE AND SEED COTTON YIELD DUE TO SPODOPTERA LITURA ON BT COTTON DURING 2008-09

No. of Larvae Released Per Plant

Per Cent Leaf Damage Seed Cotton Yield (q/ha) Per Cent Reduction over Control

90 DAS 120 DAS 135 DAS 90 DAS 120 DAS 135 DAS 90 DAS 120 DAS 135 DAS Complete Protection 0.00a (0.00) 0.00a (0.00) 0.00a(0.00) 32.14a 31.33a 31.88a 0.00 0.00 0.00

5 5.62b (13.37) 6.84b(14.20) 16.44b(23.82) 30.48b 29.24b 30.24a 5.16 6.67 5.23 10 9.48c(17.79) 8.24bc(16.60) 18.84b(25.70) 29.12c 29.08b 30.08a 9.40 7.18 5.75 15 12.44c(20.56 10.24c(18.29) 22.34c(28.17) 28.44cd 28.84b 30.11ab 11.51 7.95 5.65 20 24.36d(29.52) 22.24d(28.10) 24.56d(29.70) 28.04cd 28.46b 29.48ab 12.76 9.16 7.66 25 28.50d(32.26) 28.42e(32.21) 28..36e(32.17) 27.52d 27.84bc 29.22ab 14.37 11.14 8.49 30 35.64e(36.65) 32.12e(34.51) 32.36f(34.66) 27.48d 27.44bc 28.48ab 14.50 12.42 10.85 35 46.44f(42.96) 38.44f(38.31) 36.33g(37.06) 26.12e 26.58c 28.12b 18.73 15.16 12.00

S Em ± 1.38 0.99 0.75 0.36 0.48 0.65 CD 4.19 3.04 2.29 1.08 1.46 1.96

Figures in the same column with similar alphabets do not differ significantly at P=0.05 by DMRT

TABLE 2: PER CENT LEAF DAMAGE AND SEED COTTON YIELD DUE TO SPODOPTERA LITURA ON BT COTTON DURING 2009-10

No. of Larvae

Released Per Plant

Per Cent Leaf Damage Seed Cotton Yield (q/ha) Per Cent Reduction Over Control

90 DAS 105 DAS 120 DAS 135 DAS 90DAS 105DAS 120DAS 135DAS 90DAS 105DAS 120DAS 135DASComplete Protection

0.00a(0.00) 0.00a(0.00) 0.00a(0.00) 0.00a(0.00) 32.08a 36.32a 36.88a 36.84a 0.00 0.00 0.00 0.00

5 0.00a(0.00) 14.64b(22.41) 24.36b(29.57) 26.44b(30.91) 30.24b 36.21a 36.24a 36.58ab 5.74 0.30 1.74 0.71 10 0.00a(0.00) 18.24c(25.22) 25.64b(30.42) 28.84c(32.46) 30.12b 36.13a 36.84a 36.12ab 6.11 0.52 0.11 1.95 15 0.00a(0.00) 18.25c(25.20) 30.31c(33.40) 32.34d(34.64) 29.52bc 36.04a 36.12a 36.00ab 7.98 0.77 2.06 2.28 20 5.34b(13.40) 26.88d(31.20) 32.58d(34.81) 34.56e(35.99) 28.36c 35.58a 35.88ab 34.64ab 11.60 2.04 2.71 5.97 25 8.45c(16.90) 30.22e(33.22) 37.34e(37.67) 38.36f(38.26) 27.48cd 34.21b 34.89b 34.12ab 14.34 5.81 5.40 7.38 30 8.22c(16.70) 36.52f(37.16) 40.46f(39.50) 42.36g(40.60) 26.12d 32.21c 32.85c 33.42ab 18.58 11.32 10.93 9.28 35 10.11c(18.50) 42.44g(46.39) 46.55g(43.02) 52.33h(46.34) 23.44e 30.11d 30.45d 33.02b 26.93 17.10 17.43 10.37

S Em ± 0.78 0.47 0.32 0.42 1.44 0.10 0.38 1.22 CD 2.36 1.44 0.98 1.30 4.34 0.31 1.14 3.58

DAS: Days after Sowing Values in parenthesis are arcsin transformed values Figures in the same column with similar alphabets do not differ significantly at P=0.05 by DM

The correlation between the number of larvae per plant and per cent leaf damage was positive and significant (r = 0.99) seed cotton yield at 90 days after sowing plot was ranged between 26.12 to 32.14 q/ha with yield reduction over control varied from 5.16 to 18.73 per cent. The correlation between the number of larvae per plant and seed cotton yield was negative and significant (r = - 0.96), where as correlation between the larval population per plant and reduction in cotton yield over control was positive and significant (r = 0.96). From the regression equation yield reduction per larva (b) was 0.42 and gain threshold was 1.11, hence EIL was 2.64 larvae/plant at 90 DAS.

Similarly larvae released at 120 days after sowing, per cent leaf damage was varied from zero in complete protection plant to 38.44 in 35 larvae released plot. There was no significant difference between the treatments which received 5, 10 and 15 larvae per plant and these treatments significantly differed from rest of the treatments. Seed cotton yield was ranged between 26.58 to 31.33 q/ha with yield reduction over control varied from 6.67 to 15.16 per cent. There was no significant difference in the seed cotton yield of different treatments except complete protection.

The correlation between the number of larvae per plant and the percent leaf damage was positive and significant (r = 0.98) where as correlation between number of larvae and seed cotton yield was negative and significant (r = - 0.95). Correlation between the number of larvae released and percent reduction of yield over control was positive and significant (r = 0.93). From the regression equation yield reduction per larva was 0.32 and gain threshold was 1.11, hence EIL was 3.47 larvae/plant at 120 days after sowing.

Percent leaf damage ranged from zero in complete protection plot to 36.33 in the treatment which received 35 larvae per plant at 135 DAS plots. There was no significant yield reduction among different treatments and it ranged between 28.12 to 31.88 q/ha with yield reduction over control that varied from 5.23 to 12.00 per cent. Correlation between the number of larvae released and per cent leaf damage and

Determination of Economic Injury Level for Defoliator Spodoptera litura (Fab.) on Bt Cotton 219

percent yield reduction over control was positive and significant (r = 0.95), where as correlation between number of larvae and seed cotton yield was negative and significant (r = -0.85). Regression equation indicated that yield reduction per larvae (b) was 0.26, gain threshold was 1.11 and hence EIL was 4.27 larvae per plant at 135 DAS.

During 2009-10 season, EIL was worked out for different days after sowing viz, 90,105,120 and 135 days after sowing.

Per cent leaf damage was ranged between zero to 10.11 at 90 DAS with seed cotton yield varied from 23.44 to 32.08 q/ha. The correlation between the number of larvae, per cent leaf damage and percent yield reduction over control was positive and significant (r = 0.93 and r = 0.97), where as correlation between number of larvae and seed cotton yield was negative and significant (r = -0.97). From the regression equation yield reduction per larvae (b) was 0.62 and gain threshold was 1.04, hence EIL was 1.68 larvae per plant at 90 DAS.

Per cent leaf damage differed significantly with each other among different treatments at 105,120 and 135 days after sowing with per cent ranging from zero to 42.44, zero to 46.55 and zero to 52.33, respectively. There was no significant difference in the yield among various treatments which received 5,10,15,20 and 25 larvae/plant but differed significantly from the treatments which received 30 and 35 larvae per plant at 105 and 120 DAS.

There was no significant difference in the seed cotton yield among the different treatments at 135 DAS. The correlations between number of larvae and seed cotton yield were negative and significant at 105,120 and 135 with ‘r’ value of - 0.88, - 0.88 and – 0.98 respectively. Correlation between number of larvae and per cent yield reduction over control was positive and significant at 90,105,120 and 135 DAS with ‘r’ value of 0.97, 0.86, 0.86 and 0.85, respectively. From the regression equation yield reduction per larvae (b) was 0.43, 0.41 and 0.29 with gain threshold value of 1.04 at 105,120 and 135 days after sowing respectively EIL was 2.44, 2.54 and 3.59 larvae per plant at 105,120 and 135 DAS, respectively.

Similar studies were made by Miranda et al (2007) who developed Economic injury level of Spodoptera frugiperda in Brazilian cotton.

ACKNOWLEDGEMENT

This study is an output of the Technology Mission on Cotton MMI (2007-2012) funded by the Ministry of Agriculture with technical support from CICR, Nagpur.

REFERENCES [1] Miranda, J.E, Barbosa, K.A and Nascimento, S. (2007)- Economic injury level of Spodoptera frugiperda in

Brazilian cotton crops. www.backupfly.com [2] Ogunlana, M.O. and Pedigo, L. P. (1974)- Economic injury levels of potato leaf hopper on soybeans in Iowa. J. Econ. Ent.

67: 29- 32. [3] Pedigo, L. P. (1991)- Entomology and Pest Management, Macmillan Publishing Company, New York. pp. 107 119. [4] Pierce, W. D. (1934)- At what point does insect attack becomes damage. Entomol. News. 45: 1-4. [5] Stern, V. NiL, R. F. Smith, R. Vanden Bosch, and KS. Hagen. (1959)- The integrated control concept, Htlgarda 29: 81-101. [6] Stone, J.D. and Pedigo, L. P. (1972)- Development of economic injury level of the green clover worm on soybean in Iowa.

J. Econ. Ent. 65: 197-201.

Development of Metapopulation Approach for Landscape-level Lygus hesperus

Management in Texas

M.N. Parajulee, R.B. Shrestha, W.O. Mcspadden and S.C. Carroll

Texas A&M System AgriLife Research, 1102 East FM 1294, Lubbock, Texas 79403, USA

Abstract—Insect source-sink dynamics are vital to ecologically intensive pest management. Maintaining sink plant hosts, or “trap crops,” and destroying alternate hosts or breeding places adjacent to the field crop are effective pest management strategies for some arthropods. However, determining whether a host acts as a source or a sink is challenging, especially when the pest species is highly mobile and polyphagous. The western tarnished plant bug, Lygus hesperus, is highly polyphagous, and can utilize >300 hosts. Its presence has been documented in 26 roadside weed hosts in the Texas High Plains. Previous studies demonstrated that Lygus hesperus prefer alfalfa over cotton and several alternate weed hosts. A four-year project involved surveying and sampling for Lygus hesperus in the agricultural landscapes of several sub-regions of the southwestern United States, including the Texas High Plains. In Texas, geographic information of the landscape vegetation complex was compiled from a 150-km radius in the Texas High Plains. In one study, fifty irrigated cotton fields representing the crop diversity within this region were sampled via sweep-net for 10 weeks. This effort also included sampling of up to six non-cotton insect habitats within a 3-km radius of each field. Seasonal average Lygus hesperus abundance data were regressed with 27 field characteristics (variables), including habitat-specific land cover, distance between focal cotton fields and non-cotton habitats, longitude, latitude, elevation, habitat heterogeneity index, and several environmental/ecological variables. Significant variables were selected using a stepwise regression at 15% probability rate. A 10-parameter linear model explained 93% of the variation in the data. Major parameters contributing significantly to variation in Lygus hesperus abundance in cotton were corn and sunflower acreages, focal cotton field distances from several non-cotton hosts, and habitat heterogeneity index. In addition, field marking and capture (FMC) studies were conducted using protein markers and enzyme-linked immunosorbent assays to characterize Lygus hesperus intercrop movement behavior. The FMC approach can be used to study the effects of various crop management practices on L. hesperus intercrop movement and can potentially be applied to other pests and cropping systems.

INTRODUCTION

Cotton [Gossypium hirsutum (L.)] is grown in 17 states in the U.S. with coverage exceeding 9 million harvested acres. U.S. cotton farmers harvest ~16.7 million bales of cotton annually, valued at $8 billion (@$1$ per lb) (NASS, 2010 to 2006, last five year average data). Texas is the largest cotton-producing state in the U.S. In Texas, on an average 5.4 million acres of cotton are planted and 7.3 million bales of cotton are produced (valued at $3.5 billion) in 2010 (Williams, 2011). In fact, approximately 50% of U.S. cotton is produced in Texas, while 65% of Texas cotton is produced in the Texas High Plains. Thus, cotton produced in the Texas High Plains accounts for 32% of total U.S. cotton production.

Texas High Plains cotton production was a low-insecticide use system until boll weevil populations arrived in early 1990s. A significant shift in arthropod pest management approach was expected after eradication programs eliminated the boll weevil from the Texas High Plains. Increased adoption of transgenic cotton cultivars conferring tolerance to lepidopteran pests reduced the insecticide load in cotton insect management. Despite this reduction, increased public concerns for environmental safety and questions regarding the sustainability of current crop protection practices have placed a premium on the development of integrated pest management (IPM) approaches.

The IPM approaches have been widely used to manage cotton pests. These approaches include biological, cultural, chemical, and plant resistance methods (Frisbie et al. 1989). Integration of these approaches has been hindered due to a lack of understanding of the biology and ecology of the target pests, often resulting in the unilateral reliance on insecticides. The ecological effects of widespread insecticide use have often fueled other pest problems, environmental pollution, and affected non-target

36

Development of Metapopulation Approach for Landscape-level Lygus hesperus Management in Texas 221

organisms. Recognition of the ecological changes and problems associated with reliance on insecticides fostered the development of IPM concepts which are now well-established in all cotton-production regions of the U.S. (Luttrell 1994).

The western tarnished plant bug, Lygus hesperus (Knight), is highly polyphagous, and can survive on a broad range of hosts (Day 1996). Its presence has been reported in 26 unique roadside weed hosts in the Texas High Plains (Parajulee et al. 2003). Previous studies have demonstrated that Lygus hesperus prefer alfalfa over cotton and several weed hosts (Sevacherian and Stern 1974, Barman et al. 2010). These data suggest that the insect source-sink dynamics could be a valuable component of L. hesperus management strategy.

Maintaining sink plant hosts, or “trap crops,” and destroying source plant hosts (alternate hosts or breeding sites) adjacent to the field crop are effective strategies in managing many pest populations. Determining whether a particular host acts as a source or a sink is challenging, especially when the pest species is highly mobile and polyphagous. Lygus hesperus sub-populations in the crop field are continuously interacting with sub-population in nearby host habitats through intermigration. These strong interactions represent an important opportunity for exploitation in an integrated pest management system, particularly, since even if all Lygus hesperus are removed from a specific field, re-colonization pressure due to these interactions will continue. In fact, landscape-level management of metapopulation dynamics can be a sustainable, economical, and environmentally conscious approach of pest management.

Previous studies have indicated that Lygus hesperus move from alfalfa and other weed hosts into cotton (Sevacherian and Stern 1975, Fleischer et al. 1988). Lygus hesperus management decisions in cotton might be greatly affected by advancing the understanding of host availability and Lygus hesperus source-sink dynamics. For example, Lygus hesperus population dispersal from alfalfa to adjacent cotton might be increased by government-enforced mowing of rural roadside weed hosts such as volunteer alfalfa. Researchers in California demonstrated that strip-cutting commercial alfalfa mitigates Lygus hesperus dispersal to cotton (Mueller et al. 2005). Similarly, an area-wide Lygus hesperus management project in Mississippi, funded by U.S. Department of Agriculture, demonstrated that roadside weed management is an effective means of minimizing tarnished plant bugs, Lygus lineolaris (Palisot de Beauvois), in adjacent cotton (Snodgrass et al. 2000). L. hesperus intercrop movement behavior has not been fully characterized in cotton-alfalfa systems in the Texas High Plains. Doing so could improve L. hesperus management strategies in the region and the utility of such strategy could be expanded to other cotton producing regions of the United States.

Development of a sustainable and environmentally conscious Lygus hesperus management approach requires a deeper understanding of metapopulation dynamics. Information on the Lygus hesperus metapopulation dynamics is lacking in current scientific literature. Therefore, the goals of this research are to 1) identify the Lygus hesperus sub-populations in Texas High Plains via habitat survey, 2) characterize the metapopulation dynamics through landscape-level studies, and 3) validate Lygus hesperus sub-population interactions (intermigration) in a field marking and intercrop movement study.


Lygus hesperus Habitat Survey

A four-year (2002-2005) survey of cotton and non-cotton hosts was conducted to examine the role of non-cotton hosts in supporting Lygus hesperus populations in cotton in the Texas High Plains. An area wide survey of prevalent non-cotton hosts was conducted in April (pre-season survey) and in late July/early August (to coincide with peak cotton blooming/fruiting) in each of the twenty-five counties comprising the Plains Cotton Growers, Inc. (PCG) service area in the Texas High Plains. At four


locations in each county, two 100-sweep samples were collected per host habitat plant species using standard 15” sweep-nets, resulting in 800 sweeps per habitat per county. In each of the twenty-five PCG service area counties, cotton was sampled in late July/early August at a rate of approximately 500 sweeps per county.

Landscape-Level Study of Lygus hesperus

A two year (2008-2009) survey of cotton and non-cotton hosts was conducted to examine the effects of host habitat spatial distribution and cotton surrounding landscape composition heterogeneity on Lygus hesperus abundance in Texas High Plains cotton. During each year’s cotton growing season, fifty irrigated cotton fields were selected from a six-county (~5,400 mile2) (2008) or seven-county (~6,300 mile2) (2009) area near Lubbock, Texas. These selected focal field and their surrounding habitats were used for a late-season cartographic study and classification of agricultural fields and non-cotton host habitats within a 3-km radius and weekly sweep-net sampling. Of the fifty selected cotton focal fields, ten were chosen for more detailed sampling work, to consist of weekly sampling of six non-cotton host habitat patches within a 3-km buffer zone. Sweep-net samples were placed in cold storage and later processed to determine insect abundances.

Late-season host habitat classification and ground-truthing of the agricultural landscape surrounding cotton focal fields to a buffer radius of 3 km were performed with the aid of GPS technology and in conjunction with manual cartographic techniques. The accuracy of the resulting habitat maps were subsequently validated through meticulous matching and association with high-resolution USDA-FSA-AFPO NAIP digitally orthorectified aerial imagery, as well as USDA-NASS cropland data layers. A high-throughput geographical information system (GIS), ESRI ArcGIS Desktop, was used for data storage and processing.

Lygus hesperus Intercrop Movement Study

A two-year (2008-2009) experiment was conducted at the Texas AgriLife Research farm located near Lubbock, Texas to assess bidirectional Lygus hesperus intercrop movement in a cotton-alfalfa system. Lygus hesperus intercrop movement was determined by field-marking Lygus hesperus insects in alfalfa and adjacent cotton using two different protein markers, capturing the insects via “keep it simple” KIS vacuum sampling, and then detecting protein markers using indirect ELISA. Field-marking and Lygus hesperus sampling in alfalfa and cotton was initiated at the “7-8 true leaf” cotton stage. Weekly spray applications of 10% egg white (EW) marker solution (185 L/ha) in alfalfa and 10% non-fat dairy milk (NFDM) marker solution (185 L/ha) in cotton were made from cotton squaring to cotton boll maturation. KIS sampling was conducted following a 24-hour post-spray foraging period. Indirect ELISA was used to detect Lygus hesperus protein marker acquisition. Based on indirect ELISA results, Lygus hesperus samples were classified into four categories: residents, immigrants, visitors, and roamers. Lygus hesperus testing positive for a protein marker applied in the opposing host were categorized as immigrants. Lygus hesperus testing positive only for the protein marker applied to the capture source host were categorized as residents. Lygus hesperus testing negative for both protein markers were recorded as visitors. Lygus hesperus testing positive for both protein markers, evidence of protein acquisition in both hosts, were recorded as roamers.

External immigration (visitors, for example) was eliminated from movement calculations due to irrelevance. For analytical purposes, 24-hour unidirectional and bidirectional movement were combined into a final Lygus hesperus intercrop movement indicator, ‘Total Lygus hesperus Influx’, for each host. Thus, for each host, immigrants + roamers = Total Lygus hesperus Influx. Data were analyzed by ANOVA using PROC MIXED, SAS 9.2. Means were separated using LSMEANS with 0.1 alpha levels. The relationship between Lygus hesperus abundance in cotton and the number of immigrants from alfalfa was evaluated via correlation and regression analyses of two-year data. The relationship between alfalfa Lygus hesperus immigrants and roamers was also determined via correlation and regression analyses.



Non-cotton Host Habitats of Lygus hesperus

Throughout surveying, Lygus hesperus bugs were collected from 23 host plants (Table 1). Among non-cotton host plants, wild mustards (flixweed, tumble mustard, black mustard, and London rocket) supported the highest number of Lygus hesperus adults and nymphs, but these hosts senesced well before cotton was available as a suitable host for Lygus hesperus (Table 1). In most of the High Plains region, London rocket was available as a Lygus hesperus host as early as in late January, whereas no other apparent host plants were available for Lygus hesperus until late February. Therefore, it appears that London rocket is responsible for supporting early-emerging Lygus hesperus (emerging from overwintering quarters) in the northern region of the High Plains.

TABLE 1: NUMBER OF 100-SWEEP SAMPLES AND SEASONAL AVERAGE ABUNDANCE (NUMBER/100 SWEEPS) OF LYGUS HESPERUS BUGS IN COTTON AND 22 NON-COTTON HOSTS IN THE TEXAS HIGH PLAINS (ALL 25 COUNTIES AVERAGED), 2003.

Host Common Name Scientific Name Number of Samples Adult Nymph Total Flixweed Descurainia sophia 144 170.2 50.6 220.8 Tumble mustard Sisymbrium altissimum 13 105.1 51.6 156.7 Black mustard Brassica nigra 15 102.2 20.6 122.8 London rocket Sisymbrium irio 41 96.2 24.2 120.4 Yellow sweet clover Melilotus officinalis 18 79.4 12.4 91.8 Alfalfa Medicago sativa 222 45.8 10.3 56.1 Curly dock Rumex crispus 3 47 1.7 48.7 Russian thistle Salsola iberica 71 39.6 3.9 43.5 Pigweed Amaranthus spp. 76 27.5 7.1 34.6 Redstem filaree Erodium cicutarium 5 14 4.6 18.6 Prairie sunflower Helianthus petiolaris 4 10 1.8 11.8 Scarlet gaura Gaura coccinea 4 9.5 0.5 10 Wooly leaf bursage Ambrosia grayi 36 9.4 0.5 9.9 Texas blueweed Helianthus ciliaris 49 7.6 1.3 8.9 Kochia Kochia scoparia 30 7 0.4 7.4 Huisache daisy Amblyolepis setigera 3 7.3 0 7.3 Gumweed Grindelia squarrosa 5 3.2 1.8 5 Ragweed Ambrosia artemisiifolia 26 3.5 0 3.5 Silverleaf nightshade Solanum elaeagnifolium 45 2.8 0.3 3.1 Blue mustard Chorispora tenella 21 2.8 0.1 2.9 Cotton Gossypium hirsutum 143 2.5 0.3 2.8 Wavy gaura Gaura sinuata 3 1.7 0 1.7 Wild sunflower Helianthus annuus 20 0.5 0.1 0.6

In the northern region, five (Hale County) to 12 (Lubbock County) non-cotton host plants were observed to “bridge” the sequence between non-cotton host plants and cotton during the cotton squaring stage. However, in the southern region, alfalfa and Russian thistle were the only non-cotton hosts that bridged the host sequence with cotton during cotton fruiting season. Among the weed hosts surveyed, samples collected from huisache daisy, ragweed, and wavy gaura did not have any Lygus hesperus nymphs, indicating that these weed hosts may not be suitable for Lygus hesperus reproduction. Higher numbers of Lygus hesperus nymphs (>10 nymphs per 100 sweeps) were found in flixweed, tumble mustard, black mustard, London rocket, yellow sweet clover, and alfalfa. Identification of reproductively suitable host habitats for Lygus hesperus would later help in determining sub-populations and estimating the total Lygus hesperus population in Texas High Plains landscape.

Effect of Landscape Characteristics on Lygus hesperus Populations in Cotton Twenty-five landscape variables or characteristics were calculated for each focal field surveyed in 2008 and 2009. The landscape characters analyzed were Latitude, Longitude, Corn Area (ha), Mixed Weeds Area (ha), Non-Habitat Area (ha), Playa Area (ha), Habitat Heterogeneity (Shannon’s H’), Alfalfa Area (ha), Sorghum Area (ha), Alfalfa Distance (m), Cotton Distance (m), Cotton Area (ha), Conservation Research Program grass or CRP Area (ha), Mixed Weeds Distance (m), Non-Habitat Distance (m), Sunflower Distance (m), Urban Area (ha), Excess Area (ha), Sunflower Area (ha), Corn Distance (m),


Urban Distance (m), CRP Distance (m), Playa Distance (m), and Sorghum Distance (m). Distances were measured between the closest boundaries of two habitat patches.

Of twenty-five landscape variables, only six (Latitude, Corn Area, Mixed Weeds Area, Non-Habitat Area, Playa Area and Habitat Heterogeneity) were found to be significantly positively correlated with the number of Lygus hesperus collected from cotton focal fields (Table 2, Fig. 1). Five landscape variables (Cotton Area, CRP Area, Mixed Weeds Distance, Non-Habitat Distance, and Sunflower Patch Distance) were significantly negatively correlated with Lygus hesperus abundance in focal field cotton.

TABLE 2: RELATIONSHIPS OF AVERAGE NUMBER OF LYGUS HESPERUS IN COTTON FIELD (PER 1000 SWEEPS) WITH VARIOUS HABITAT ABUNDANCE AND PROXIMITY VARIABLES: THE PEARSON CORRELATION ANALYSIS.

Variables Correlation Significance Latitude + s Corn Area (ha) + s Mixed Weed Area (ha) + s Non-habitat Area (ha) + s Playa Area (ha) + s Habitat heterogeneity (Shannon’s H’) + s Alfalfa Area (ha) + ns Longitude + ns Sorghum Area (ha) + ns Alfalfa Distance (m) + ns Cotton Distance (m) + ns Cotton Area (ha) - s CRP Area (ha) - s Mixed Weed Distance (m) - s Non-habitat Distance (m) - s Sunflower Distance (m) - s Urban Area (ha) - ns Excess Area (ha) - ns Sunflower Area (ha) - ns Corn Distance (m) - ns Urban D Distance (m) - ns CRP Distance (m) - ns Playa Distance (m) - ns Sorghum Distance (m) - ns

At alpha=0.1, s=significant, ns=non-significant correlation.

Fig. 1: Color-coded 2009 THP Corn Hectares (Per Focal Field Buffer Zone) Versus Seasonal Average Lygus Abundances Per Cotton Focal Field (Indicated by Red Columns). 2009 Corn Crop Coverage in the THP is Shown in the Background.

The season-long cotton survey showed that the Lygus hesperus metapopulation is divided amongst many habitats and geographically specific sub-populations. Cotton growers are primarily concerned with managing Lygus hesperus sub-populations present in their cotton fields. Understanding metapopulation dynamics among these sub-populations is essential for successful management of Lygus hesperus in cotton. Promoting those landscape characteristics showing negative relationships with Lygus hesperus sub-populations in cotton and minimizing those showing positive relationships with Lygus hesperus in cotton is necessary for landscape-level Lygus hesperus metapopulation dynamics management.


A stepwise regression analysis of all twenty-five landscape variables predicting Lygus hesperus abundance in focal field cotton showed that only nine variables were useful in a predictive model (Table 3). The multivariate regression model developed based on two years of focal field survey data was significant, with a 93% model R2 (Fig. 2). Model validation and optimization is yet to be performed, but landscape metapopulation management based upon a strong predictive model is necessary to map potential risks for Lygus hesperus infestation and outbreak. Such a risk map will help in management decision-making and in directing the overall landscape-level pest management effort. TABLE 3: MULTIVARIATE LINEAR MODEL VARIABLES AND PARAMETERS PREDICTING AVERAGE LYGUS HESPERUS DENSITY IN FOCAL FIELD COTTON BASED ON VARIOUS LANDSCAPE PARAMETERS.

Variables Parameter F Value Pr > F Partial R2 Model R2 Intercept 162.2713 10.94 0.01 - - Corn area 0.0105 48.43 <.0001 0.36 0.36 Sunflower area 0.1189 47.81 <.0001 0.15 0.52 Playa distance -0.0126 30.70 0.00 0.08 0.60 Mixed weed distance 0.0134 32.23 0.00 0.07 0.66 Corn distance 0.0070 33.97 0.00 0.10 0.77 CRP distance -0.0101 19.48 0.00 0.05 0.82 Urban distance 0.0043 11.42 0.01 0.04 0.86 Longitude -0.0002 10.44 0.01 0.04 0.90 Habitat heterogeneity -2.2409 5.12 0.05 0.03 0.93

Fig. 2: Model Prediction of Average Lygus Abundance in Focal Fields

Fig. 3: Weekly Average Lygus Abundance in Cotton and Alfalfa and Net Lygus Intercrop Movement Between Alfalfa and Adjacent Cotton, Lubbock, Texas, 2008 (left) and 2009 (right). Note: 1 ha = 833.3 KIS Samples, the Negative Value Suggest the Opposite Direction of Lygus Movement (i.e., from Alfalfa

Into Cotton). The Similar Alphabet on the Top or Bottom of the bar Among the Sampling Weeks Within a Specific Host and Year are Not Significantly Different at Alpha=0.1 When Means Were Separated by LSMEAN.


A study investigating physical tracking of Lygus hesperus intermigration dynamics between or among major habitats was conducted to validate this model and further characterize Lygus hesperus metapopulation dynamics.

Intercrop Movement Dynamics of Lygus hesperus

Influx into Cotton

Analysis of variance of Lygus hesperus influx into cotton (year and host combined) revealed significant differences in the pattern of Lygus hesperus influx into cotton among the sampling weeks (df = 6, 24; F = 5.2; P = <0.0015). There were significant interactions between Lygus hesperus intercrop movement with week and year (df = 6, 24; F = 3.74; P = <0.0091). Lygus hesperus influx to a cotton field from nearby alfalfa was very low when cotton was in its vegetative growth stage (0-40 DAP, days after planting, prior to July). During the first five weeks following cotton planting, Lygus hesperus was not detected in cotton. Once cotton began squaring (40-45 DAP), Lygus hesperus began moving into cotton from alfalfa therefore obviously alfalfa was a source of Lygus hesperus to nearby cotton during the cotton squaring stage.

In 2008, Lygus hesperus influx into cotton was highest at 83 DAP (fifth sampling week), followed by 97, 62, 76, 47, 69, and 104 DAP. In 2009, Lygus hesperus influx into cotton was highest at 56, 82, and 90 DAP (fifth sampling week), followed by 107, 65, 42, and 56 DAP. Peak Lygus hesperus influx into cotton in both years occurred during the second week of August (during the fifth sampling week), when cotton was in full bloom. Lygus hesperus influx was low in all weeks prior to this peak (during squaring). The first peak of Lygus hesperus influx in cotton in 2009 occurred at 56 DAP or during the third sampling week. It is unanticipated to have detected peak influx during squaring, as this is not considered to be the most favorable cotton stage with respect to Lygus hesperus. High influx during squaring in 2009 might be accounted for by temporarily reduced alfalfa quality due to poor irrigation timing as a result of an irrigation system backlog on the research farm and concurrently high temperatures and low relative humidity.

Influx into Alfalfa

In order to understand the effect of cotton Lygus hesperus influx on a Lygus hesperus population in cotton, and to understand the potential for cotton injury due to Lygus hesperus, Lygus hesperus retention in cotton, rather than influx, is more important. For the purposes of this study, Lygus hesperus retention can be calculated by subtracting outflow from inflow. Inflow can be estimated via sampling, but estimating outflow is difficult. Assuming the cotton-alfalfa system as closed, Lygus hesperus outflow from cotton can be estimated by sampling alfalfa and determining the quantity of influx into adjacent alfalfa. In this study, Lygus hesperus influx in cotton and alfalfa was quantified for each sampling week. Analysis of variance of Lygus hesperus influx in alfalfa (both years and both hosts combined) revealed significant differences in the patterns of Lygus hesperus intercrop movement among the sampling weeks (df = 6, 24; F = 10.65; P = <0.0001). Week and year interacted significantly (df = 6, 24; F = 10.78; P = <0.0001) in terms of Lygus hesperus intercrop movement. In 2008, Lygus hesperus influx into alfalfa from nearby cotton was near-zero when cotton was in its vegetative growth stage (0-40 DAP, prior to July). Lygus hesperus was not detected in cotton during the first five weeks following cotton planting. Once cotton began squaring (40-45 DAP), Lygus hesperus began moving between alfalfa and cotton.

Net Movement

Net Lygus hesperus intercrop movement between cotton and alfalfa was calculated by subtracting cotton ‘Total Lygus hesperus Influx’ (EW-marked Lygus hesperus captured in cotton) from cotton ‘Total Lygus hesperus Out flux’ (NFDM-marked Lygus hesperus captured in alfalfa). Positive net movement values indicate net Lygus hesperus gains in cotton. Likewise, negative net movement values indicate net Lygus hesperus losses. Lygus hesperus net movement data have the potential to indicate the timing of host source-sink dynamics – information which may be of value in making pest management decisions.


Lygus hesperus net movement into cotton varied significantly (df = 1, 2; F = 230.41; P = 0.0043) between 2008 and 2009. Year and phenological stage affected Lygus hesperus net movement significantly (df = 2, 32; F = 9.57; P = 0.0006). In both 2008 and 2009, Lygus hesperus net movement was negative during cotton squaring, indicating net outflow from cotton. Net outflow peaked during the second week of July, at 49-62 DAP in 2008 and 2009 (Fig. 3). During this period, few Lygus hesperus (<1 Lygus hesperus /12 m2) were retained in cotton, and most Lygus hesperus visiting cotton moved back to alfalfa. In 2008, as cotton grew older, and cotton squares continued to grow and blooming began, Lygus hesperus net movement, with respect to cotton, gradually increased from negative toward zero, and became positive as cotton approached full bloom (76 DAP). Thereafter, Lygus hesperus net movement remained positive in cotton, indicating an increased cotton capability to retain more Lygus hesperus having moved from alfalfa. In 2008, average Lygus hesperus net movement into cotton was significantly higher (df = 2, 16; F = 3.64; P = 0.05) during cotton blooming (821.9 Lygus hesperus per ha or 0.99 Lygus hesperus/12 m2 influx) and boll maturation (358.2 Lygus hesperus per ha or 0.43 Lygus hesperus/12 m2 influx) than during squaring (1,458 Lygus hesperus per ha or 1.75 Lygus hesperus/12 m2 out flux). The Lygus hesperus net movement pattern in 2009 differed from that in 2008.

In 2009, Lygus hesperus net movement in cotton never became positive during the cotton growing season. This indicates that alfalfa remained more attractive than cotton throughout the cotton growing season. Unexpectedly, Lygus hesperus density in cotton increased continually, and cotton was able to retain some Lygus hesperus migrants from alfalfa, even when Lygus hesperus net movement was negative in cotton. It is somewhat puzzling to have observed Lygus hesperus net movement favoring alfalfa while simultaneously observing increases in EW-marked Lygus hesperus retention and population in cotton. This phenomenon indicates that calculation of Lygus hesperus net movement did not account for actual Lygus hesperus population changes due to intercrop movement between cotton and alfalfa.

Although differences in crop structure, combined with the chosen sampling method, may have led to overestimation of Lygus hesperus densities in alfalfa, it is likely that naturally higher Lygus hesperus densities in alfalfa and naturally high Lygus hesperus intercrop movement between cotton and alfalfa may have contributed to said overestimation. Many Lygus hesperus from alfalfa may have visited cotton, but most returned to alfalfa. Only a few actually “settled” in cotton. Each time a large number of Lygus hesperus move from alfalfa to cotton, a few Lygus hesperus may remain and settle, which explains the steady, gradual Lygus hesperus population increase in cotton. However, since most returned to alfalfa, Lygus hesperus net movement calculations indicated high Lygus hesperus influx into alfalfa.

Because Lygus hesperus is highly mobile, and moves quite freely back and forth between hosts in the open agroecosystem, currently available knowledge and technology are insufficient to accurately quantify net movement mathematically, as opposed to in a hypothetical closed ecosystem with only unidirectional movement.

CONCLUSION AND FUTURE RESEARCH

Lygus hesperus

Sub-populations in agricultural field crops and host habitats continuously interact, and these interactions represent an excellent opportunity for exploitation in Lygus hesperus metapopulation management. This is particularly true, given that even if all Lygus hesperus are removed from a specific crop field, Lygus hesperus source populations residing in nearby habitats will continue to exert considerable re-colonization pressure and pose an infestation risk. Managing pests at the landscape-level via intelligent exploitation of metapopulation dynamics may prove to be sustainable, economical, and environmentally conscious tool for use in conjunction with other methods in an integrated pest management system. In fact, development of elegant, environmentally conscious pest management approaches requires a deeper understanding of metapopulation dynamics. Further detailed investigations of Lygus hesperus metapopulation dynamics in the Texas High Plains is necessary for continued development of landscape-level, sustainable, integrated approaches to L. hesperus management.


ACKNOWLEDGMENT

This project was partially funded by Cotton Incorporated Core Program, USDA CSREES RAMP, International Cotton Research Center, and Plains Cotton Growers, Inc.

REFERENCES [1] Barman, A. K., Parajulee, M. N., and Carroll, S. C. (2010) - Relative preference of Lygus hesperus (Hemiptera: Miridae) to

selected host plants in the field. Insect Sci. 17: 542-548. [2] Day, W. H. (1996) - Evaluation of biological control of the tarnished plant bug (Hemiptera: Miridae) in alfalfa by the

introduced parasite Peristenus digoneutis (Hymenoptera: Braconidae). Environ. Entomol. 25: 512-518. [3] Frisbie, R. E., Crawford, J. L., Bonner, C. M., and Zalom, F. G. (1989) - Implementing IPM in cotton. In R. E. Frisbie, K.

M. El.Zik, and L. T. Wilson [eds.]. Integrated Pest Management Systems and Cotton Production. John Wiley & Sons, New York, NY. pp. 389-412

[4] Fleischer, S. J., Gaylor, M. J., and Hue, N. V. (1988) - Dispersal of Lygus lineolaris (Heteroptera: Miridae) adults through cotton following nursery host destruction. Environ. Entomol. 17: 533-541.

[5] Luttrell, R. G. (1994) - Cotton pest management: Part 2. A U.S. perspective. Annu. Rev. Entomol. 39: 527-542. [6] Mueller, S.C., Summers, C. G., and Goodell, P. B. (2005) - Strip cutting alfalfa for Lygus management: Forage quality

implications. Crop Manage, http://www.plantmanagementnetwork.org/pub/cm/research/2005/Lygus/ [7] National Agricultural Statistics Service, web page,

http://www.nass.usda.gov/Statistics_by_Subject/index.php?sector=CROPS [8] Parajulee, M. N., Arnold, M. D., Carroll, S. C., Cranmer, A. M., Shrestha, R. B. and Bommireddy, P. L. (2003) - Lygus

abundance on wild hosts: A survey across the Texas High Plains,. In Proc. Beltwide Cotton. Conf., National Cotton Council, Memphis, TN. pp. 970-973

[9] Sevacherian, V., and Stern, V. M. (1974) - Host plant preference of Lygus bugs in alfalfa-interplanted cotton fields. Environ. Entomol. 3: 761-766.

[10] Sevacherian, V., and Stern, V. (1975) - Movement of Lygus bugs between alfalfa and cotton. Environ. Entomol. 4: 163-165. [11] Snodgrass, G. L., Scott, W. P. and Hardee, D. D. (2000) - Results from two years of an experiment on tarnished plant bug

control in cotton through reduction in numbers of early-season wild host plants, pp. 1229-1233. In Proc. Beltwide Cotton Conference, National Cotton Council, Memphis, TN.

[12] Williams. (2011)-Cotton insect losses-2010. In Proceedings, Beltwide Cotton Conf., National Cotton Council, Memphis, TN.

Survival of Pink Bollworm, Pectinophora gossypiella (Saunders) in Bt and Non Bt Cotton In Normal

and Late Sowing With A Special Emphasize to Avoid Population Pressure

S. Mohan and S. Nandini

Department of Agricultural Entomology, Centre for plant protection studies, Tamil Nadu Agricultural University, Coimbatore–3

INTRODUCTION

Cotton Gossypium hirsutum L., is one of the principal commercial crops playing a key role in economic, social, and political affairs of the country. India is an important grower of cotton on a global scale. In India, cotton is cultivated in an area of 110 lakh ha with an average productivity of 503 kg/ha. (Anonymous, 2011).

The insect pests spectrum of cotton is quite complex and as many as 1326 species of insect pests have been reported on this crop throughout the world. Among the bollworms, the pink bollworm assumed major pest status in recent past (Ghosh, 2001). World over, Pink bollworm Pectinophora gossypiella (Saunders) has become economically the most destructive pest of cotton and has known to cause 2.8 to 61.9 per cent loss in seed cotton yield, 2.1 to 47.10 per cent loss in oil content and 10.70 to 59.20 per cent loss in normal opening of bolls (Patil, 2003).

In India Bt cotton has gained considerable importance in recent years. The area under Bt cotton reached 7.6 million hectares in 2008-09 constituting nearly 81% of the total cotton area in India. As a result, the production also reached 4.9 million tons (Anonymous, 2009). Bt cotton (Bollgard®) offers high level of resistance against cotton bollworm complex ie., Helicoverpa armigera (Hubner), Earias vittella (Fabricius) and Pectinophora gossypiella (Saunders) both under laboratory as well as field conditions (Kranthi and Kranthi., 2004).

However recent report of ineffectiveness of Bollgard (Cry1Ac) to pink boll worm in certain parts of Gujarat (The Hindu, Dated 6.3.2010) made it necessary to investigate the pink bollworm incidence in Bt cotton. Hence, studies were carried out under the All India Coordinated Cotton Improvement Project (ICAR) regarding the incidence of pink bollworm in Bt and Non Bt cotton at the Cotton farm of Tamil Nadu Agricultural University during winter season, 2010-11.

The Bt cotton hybrid, Bt Bunny (Cry1Ac) was sown in one acre along with a non-Bt cotton, MCU-5 in another one acre. Sowing was done on 13th August 2010 with a spacing of 90 cm x 60 cm by following all standard agronomical practices.


The observation on rosette flowers due to pink bollworm infestation was made, starting from 70 DAS and continued upto 130 DAS at weekly intervals, on twenty five plants selected randomly and tagged in both Bt and Non Bt cotton fields.

Collections of twenty five green bolls were made from fields where Bt and Non Bt were sown during 125 and 140 DAS. Collected bolls were taken to the laboratory and each green boll was cut opened along with ridges of the locules with help of sharp cutter carefully and the damage was estimated by counting the number of live PBW larvae in each boll. At the time of cotton picking, 50 fully opened bolls were sampled randomly from each field and the total number locules and damaged locules due to PBW larva were counted.

37



Pink Bollworm Damage in Bt Cotton and Non Cotton The first incidence of rosette flowers was observed when the crop was 100 days old in Non Bt (MCU 5). The rosette flowers observed in MCU 5 ranged from 1–3 in numbers/100 flowers. First to third instar larvae were found in the rosette flowers. No rosette flower was observed in Bt Bunny.

TABLE 1: OBSERVATION ON ROSETTE FLOWER–PINK BOLLWORM DAMAGE

Date of Collection

Non Bt field (MCU 5) Total Flowers Observed No. of Rosette flowers No. of Larvae Collected Instar of Larvae

I II III IV 13/11/2010 100 0 0 0 0 0 0 24/11/2010 100 1 0 0 0 0 0 09/12/2010 100 2 1 0 1 0 0 17/12/2010 100 5 3 1 1 0 0 03/01/2011 100 3 2 0 1 1 0 Green boll damage in MCU 5 ranged from 4-8%. The first incidence of pink bollworm in MCU 5

occurred on 125 DAS. The stage of the larvae observed was 2 to 4th instar in MCU 5. No bolls were infested by PBW larvae in Bt Bunny.

Bt field (Bt Bunny)

Total Flowers Observed No. of Rosette Flowers No. of Larvae Collected Instar of Larvae I II III IV

100 0 0 0 0 0 0 100 0 0 0 0 0 0 100 0 0 0 0 0 0 100 0 0 0 0 0 0 100 0 0 0 0 0 0

TABLE 2: OBSERVATION ON GREEN BOLL DAMAGE AND LOCULE DAMAGE

Date of Collection

Non Bt Field (MCU 5) Total Green Bolls

Observed No. of Damaged

GB No. of Locules

Damaged No of Larvae

Collected Instar of Larvae

I II III IV 13/12/2010 25 0 0 0 0 0 0 0 18/12/2010 25 0 0 0 0 0 0 0 03/01/2011 25 1 1 1 0 1 0 0 23/01/2011 25 2 1 2 0 0 1 1

In MCU 5, the open boll damage (at harvest) (135 DAS) and locule damage were observed. The open boll damage due to pink bollworm ranged from 8-20% and locule damage ranged from 1-3%. The larval stage observed was 3 and 4th instar.

Bt Field (Bt Bunny) Total Green Bolls

Observed No. of Damaged GB No. of Locules Damaged No of Larvae Collected Instar of Larvae

I II III IV 25 0 0 0 0 0 0 0 25 0 0 0 0 0 0 0 25 0 0 0 0 0 0 0 25 0 0 0 0 0 0 0

TABLE 3: OBSERVATION ON LOCULE DAMAGE (AT HARVEST)

Date of Collection

Non Bt field (MCU 5) Total Open Bolls

Observed No. of Damaged

OB No. of Locules

Damaged No of Larvae

Collected Instar of Larvae

I II III IV 27/12/2010 25 2 1 0 0 0 0 0 13/01/2011 25 4 2 2 0 0 1 0 23/01/2011 25 3 2 1 0 0 0 1 6/02/2011 25 5 3 2 0 0 0 1

Bt field (Bt Bunny) Total Open Bolls

Observed No. of Damaged OB No. of Locules Damaged No of Larvae Collected Instar of Larvae

I II III IV 25 0 0 0 0 0 0 0 25 0 0 0 0 0 0 0 25 0 0 0 0 0 0 0 25 0 0 0 0 0 0 0

Survival of Pink Bollworm, Pectinophora gossypiella (Saunders) in Bt and Non Bt Cotton In Normal and Late Sowing 231

No pink bollworm damage was observed in Bt Bunny during this period also. These findings are in agreement with the reports of Udikeri et al. (2003) and Surulivelu et al. (2004) who recorded significantly very less locule damage in Bt cotton hybrids over non Bt cotton hybrid.

The present finding is important in the sense that even in Bollgard® (Cry1Ac) we did not observe any pink bollworm damage. Currently, we have Bollgard II (Cry1Ac +Cry2Ab) under cultivation in majority of the cotton growing areas of India. As even the Bt Bunny with the single gene (Bollgard®) had no pink bollworm incidence, we assume that the Bollgard II with Cry IAc and Cry2Ab can do still better without any resistance problem as it has double gene. However careful and continuous monitoring of field incidence is a must for evolving better management strategy of pink bollworm in cotton.

REFERENCES [1] Anonymous. (2011) - Annual report. All India Coordinated Cotton Improvement Project, Hisar, Haryana. [2] Anonymous. (2009) - A Status report on Bt cotton. Asia-Pacific Consortium on Agricultural Biotechnology and National

Research Centre on Plant Biotechnology, 2009. New Delhi. [3] Ghosh, S. K., (2001) - G. M. Crops: Rationally irresistible, Curr. Sci., 6: 655-660. [4] Kranthi, K. R. and Kranthi, N. R., (2004) - Modelling adaptability of the cotton bollworm, Helicoverpa armigera (Hubner)

to Bt cotton in India. Curr. Sci., 87: 1096-1107. [5] Patil, S. B., (2003) - Studies on management of cotton pink bollworm Pectionophora gossypiella (Saunders) (Lepidoptera:

Gelechiidae). Ph. D. Thesis, Univ. Agric. Sci., Dharwad (India). [6] Surulivelu, T., Sumathi, E., Mathirajan, V. G. and Rajendran, T. P., (2004) - Temporal distribution of pink bollworm in Bt

cotton hybrids. In: Int. Symp. Strat. Sust Cotton Prodn, - A Global Vision Vol. 3. Crop Protection, 23-25 November 2004, UAS, Dharwad, Karnataka (India), pp. 86-88.

[7] Udikeri, S. S., Patil, S. B., Nadaf, A. M. and Khadi. (2003) - Performance of Bt-cotton genotypes under unprotected conditions. Proc. World Cotton Res. Con., - III. 9-13 March, 2003, Cape Town, South Africa: 1282-1286.

Dynamics of Biotypes ‘b’ and ‘q’ of Bemisia tabaci in Cotton Fields and Their Relevance

to Insecticide Resistance

A.R. Horowitz1, H. Breslauer1, M. Rippa1, S. Kontsedalov2, M. Ghanim2, P. Weintraub1 and I. Ishaaya2

1Department of Entomology, Agricultural Research Organization, Gilat Research Center, M.P. Negev, 85280

2The Volcani Center, Bet Dagan 50250, Israel E-mail: [email protected]

Abstract—An extensive survey for identifying Bemisia tabaci biotypes and monitoring insecticide resistance was conducted from 2003 to 2010 in cotton fields from several locations in Israel. Two biotypes of B. tabaci, B and Q, were identified; and some differences in the biotype dynamics were recorded from different areas. From 2003 to 2007 in northern Israel, a higher proportion of the B biotype was consistently found in the early season. However, by the end of the season a definite rise of the Q biotype was recorded, ranging from 60 to 100%, along with high resistance to the insect growth regulator (IGR) pyriproxyfen and to the neonicotinoid insecticides. The Q biotype was predominant throughout the season in fields located in the east-central part of Israel, with high resistance to pyriproxyfen; on the other hand, in cotton fields located in southern Israel, the B was the widespread biotype during the entire season with no significant resistance to pyriproxyfen.

From 2008 to date, we identified a significant shift in the biotype dynamics: the B biotype is currently predominating in all cotton fields, reaching up to 90% or more. Concurrently, resistance to pyriproxyfen and neonicotinoids has reduced considerably. The possible reasons for the change in the dynamics of B. tabaci biotypes are discussed.

INTRODUCTION

The whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a key pest in many agricultural crops including vegetables, ornamentals and field crops (Byrne and Bellows 1991, Oliveira et al. 2001, Stansly and Naranjo 2010). It directly damages the plants by feeding on phloem sap, and excretes honeydew on leaves and fruit. The sticky, sugary surface forms a substrate for the growth of black sooty mold that stains the cotton and covers the leaves; thus, impairing photosynthesis. The resulting stickiness and discoloration greatly reduce the value of agricultural crops such as ornamentals, vegetables and cotton. In cotton, the honeydew may cause fiber stickiness that interferes with the spinning process in the textile mills, and greatly reduces the product's value (Hequet et al. 2007). Bemisia tabaci is a vector of several important families of plant viruses (Jones 2003, Hogenhout et al. 2008) including cotton (e.g. the cotton leaf curl geminivirus (CLCuV).

Bemisia tabaci is known for its genetic diversity, which is expressed in a complex of biotypes (Brown et al. 1995, Perring 2001, De Barro et al. 2005) or, as recently suggested, a complex of distinct cryptic species (Xu et al. 2010, De Barro et al. 2011). The biotypes are largely differentiated based on biochemical or molecular polymorphism, and differ in their characteristics such as host plant range, the capacity to cause plant disorders, attraction by natural enemies, expression of resistance, and plant virus-transmission capabilities (e.g. Bedford et al. 1994, Brown et al. 1995, Sanchez-Campos et al. 1999, Perring 2001, Horowitz et al. 2005). Recent reports have suggested that the floral composition of bacterial symbionts might be specific to certain biotypes (Gottlieb et al. 2006, Chiel et al. 2007) and might confer upon them resistance to insecticides (Kontsedalov et al. 2008). The most widespread biotype, B, was identified in the late 1980s (Costa and Brown 1991, Costa et al. 1993), following extensive outbreaks of B. tabaci in the southwestern USA, and has a worldwide distribution. An additional common biotype, Q, which probably originated in the Iberian Peninsula (Guirao et al. 1997), has since spread globally (Horowitz et al. 2003, Boykin et al. 2007, Chu et al. 2010).

38

Dynamics of Biotypes ‘b’ and ‘q’ of Bemisia tabaci in Cotton Fields and Their Relevance to Insecticide Resistance 233

An extensive survey for identifying B. tabaci biotypes along with monitoring insecticide resistance was conducted from 2003 to 2011 in cotton fields in several locations of Israel. The main objective of this paper is to summarize the results of this survey and discuss the shift in biotype composition and resistance status that has occurred during recent cotton seasons.

METHODS AND MATERIALS

Collections of Whiteflies

Collections of whiteflies from commercial cotton fields in Israel were conducted from 2003 to 2011 throughout six regions (Fig. 1) to characterize the distributions of the B and Q biotypes along with resistance to the new insecticides pyriproxyfen (IGR) and neonicotinoids (e.g. acetamiprid and thiamethoxam). In most years, each field was sampled twice per season, once in late June and another in early September. The exception was in 2005 and 2006, where fields were sampled every month from June to October. Whiteflies were sampled randomly from plants in each field using an aspirator. Samplers performed a random walk diagonally through the center of each field; beginning 50-100 meters inside the field edge and walking towards the center, until a total of 80-100 whiteflies were sampled. The samples were kept in vials with 90% ethanol at -20°C until biotypes were identified using DNA markers (Khasdan et al. 2005). A total of 15-20 individuals per sample were used for molecular analyses. The average proportion of the B and Q was calculated across the fields in each region. In case of high population of whiteflies, a large amount of adults was taken for resistance monitoring bioassays.

Fig. 1: Collection Sites of Bemisia Tabaci Populations in Israel During the 2003 – 2011 Cotton Growing Seasons. The Locations: 1- Western Galilee; 2 – Carmel Coast; 3 – Central Israel; 4 – Ayalon Valley; 5 – South District; 6 – Western Negev.

Egypt

Dea

d Se

a

Med

iterr

anea

n Se

a

Jordan

Lebanon

Syria

25 km25 km

Elat

Beer-Sheva

Gaza

Tel-Aviv

Jerusalem

Jericho

Haifa Nazareth

Egypt

Dea

d Se

a

Med

iterr

anea

n Se

a

Jordan

Lebanon

Syria

25 km25 km

Elat

Beer-Sheva

Gaza

Tel-Aviv

Jerusalem

Jericho

Haifa Nazareth


Fig. 2: Proportion of B and Q Biotypes of Bemisia Tabaci Collected in the Ayalon Valley During the 2003 – 2011 Cotton Growing Seasons

Fig. 3: Proportion of B and Q Biotypes of Bemisia Tabaci Collected in the Carmel Coast During the 2003 – 2011 Cotton Growing Seasons

Fig. 4: Log Concentration-Response Curves (on a Probit Scale) for the Effect of Pyriproxyfen on Bemisia Tabaci Populations Collected from 2003 to 2010 from Cotton Fields in the Ayalon Valley, Israel

2003 2004 2005 2006 2007 2008 2009 2010 2011

Year

0

20

40

60

80

100

Prop

ortio

n B

bio

type

(%)

Early Season Late Season

Ayalon Valley

2003 2004 2005 2006 2007 2008 2009 2010 2011

Year

0

20

40

60

80

100

Prop

ortio

n B

bio

type

(%)

Early Season Late Season

Carmel Coast

0.0001 0.001 0.01 0.1 1 10 100 1000

Concentration, ppm

1

510

30

50

70

9095

99

Egg

mor

talit

y, %

S

2003

2006

2007

2010

Ayalon Valley


Fig. 5: Log Concentration-Response Curves (on a Probit Scale) for the Effect of Acetamiprid on Bemisia Tabaci Populations Collected from 2003 to 2010 from Cotton Fields in the Ayalon Valley, Israel

Resistance bioassays

Insecticides

The following insecticides were used for bioassay procedures. Pyriproxyfen, commercial name Tiger, was formulated as 10% EC (emulsion concentrate) (Sumitomo Co. Tokyo, Japan). Acetamiprid, commercial name Mospilan, was formulated as 200 g [AI]/ Kg SP (soluble powder9, (Nippon Soda Co., Tokyo, Japan): both were obtained from Agan Chemical Company, Ashdod, Israel. Thiamethoxam, commercial name Actara, was formulated as 25 250 g [AI]/ Kg WG (water-dispersible granules), (Syngenta AG, Basel, Switzerland, obtained from C.T.S., Hod Hasharon, Israel).

Bioassay Procedure

Cotton seedlings (15-20 cm tall with two true leaves) were dipped in aqueous concentrations of insecticide, or in deionized water (untreated control), and then allowing the plant to air-dry for 2 h. Fifteen B. tabaci females, confined in clip-on leaf cages, were exposed to treated cotton seedlings for 48 h and kept under standard laboratory conditions of 26 ± 2°C, 60% RH, and a photoperiod of 14:10 (L: D). For acetamiprid and thiamethoxam, female adult mortality was determined; for pyriproxyfen, females were removed and fecundity was recorded. Egg viability (egg hatch suppression) was determined eight days after treatment (Ishaaya and Horowitz, 1992). Each bioassay was done with at least four concentrations, each with five replicates, and repeated three times on different days. Mortality curves along with LC values were then determined.

Data Analysis

Probit analyses of the concentration-dependent mortality data were made using POLO-PC (LeOra Software, 1987) after correction with Abbott’s (1925) formula. Failure of 95% C.L. (confidence limits) to overlap at a particular lethal concentration indicated a significant difference.


Figures 2 and 3 show the changes in the ratios of the biotypes B and Q from 2003 until 2011 cotton growing seasons in two representative locations, Ayalon Valley (east-central Israel) and Carmel Coast (northern Israel), respectively. In the Ayalon Valley, the Q biotype was the predominant until 2007, and

0.1 1 10 100 1000

Concentration, ppm

1

510

30

50

70

9095

99

Adu

lt M

orta

lity,

%S

2003

2005

2007

2010

Ayalon Valley

acetamiprid


approximately 20% biotype B was sampled in 2005 – 2007 during the early seasons. However, in 2009 – 2011 there was a drastic shift where almost no Q biotypes were sampled in the cotton fields (Fig. 2). In the Carmel Coast, more B biotypes were sampled than in the Ayalon Valley 2003 – 2008 seasons (no cotton was grown in this area in 2009). In 2003 – 2006, around 50% of biotype B was sampled in the early seasons but in the late seasons, the Q was more widespread. However during 2010 – 2011 the B was the predominant biotype, as was observed in the Ayalon Valley (Fig. 3). During recent years, similar pattern was found in other open field-crops; however, in protected crops where chemical regime is common, the Q was the predominant biotype (Kontsedalov et al. in press).

In addition to the biotyping of whiteflies, in some seasons, resistance to insecticides was monitored especially in the two aforementioned locations, Ayalon Valley and Carmel Coast. In Fig. 4 the dynamic of resistance to pyriproxyfen in the Ayalon Valley is demonstrated in some of the late seasons from 2003 – 2010 as compared with the susceptible standard strain. In the 2003, 2006 and 2007 seasons, high resistance was found ranging from 300 to 1000-fold. As resistance to pyriproxyfen has been detected since the 1990’s, very high resistance in B. tabaci was found in both locations (Horowitz et al., 2002, Horowitz et al. 2005). However, in 2010, susceptibility to pyriproxyfen was almost restored to a level of the standard strain (Fig. 4). The resistance to acetamiprid was less decisive (about 4-6 fold); however, high cross-resistance was detected to thiamethoxam, an insecticide that has never been applied in cotton in this area (Horowitz et al., 2004).

Horowitz et al. (2005) have demonstrated that the B biotype was more competitive than the Q biotype under untreated conditions; however, repeated applications of either pyriproxyfen or a neonicotinoid would encourage the Q biotype and depress the B biotype. Crowder et al. (2010) assumed that the main reason for the high competitiveness trait of B biotype is its ability to copulate more effectively than the Q biotype, resulting in a faster population growth, and consequently an exclusion of the Q biotype.

There could be some explanations for the shift in the biotype composition. Firstly, reduction in acreage of cotton fields during recent years along with a decrease in insecticide use, especially pyriproxyfen, for controlling the whitefly. This decrease resulted in less selection for the Q biotype along with the fact that the B biotype without insecticide selection is more competitive than the Q. Nonetheless, as was mentioned, in greenhouses with many chemical treatments the Q was the predominant (Kontsedalov et al. in press). We assume that applications of the IGR pyriproxyfen are the main cause for the establishment of the Q biotype in some cotton fields. However, other reasons could result from encouragement of a specific biotype such as different regional climate (Mahadav et al. 2009, Kontsedalov et al. in press) and differences in agroecology and topography among growing regions (Castle et al. 2010). Another possibility to the high levels of the B biotype is the increase in resistance to insecticides. In general, no resistance to pyriproxyfen was detected in the B biotype in Israel (Horowitz et al. 2002, 2005), although the B biotype was found to be resistant to the same insecticide in the US (Crowder et al. 2010). However, high resistance to neonicotinoids in the B biotype from Israel was reported (Rauch and Nauen, 2003). Our results from the Ayalon Valley in 2010 did not confirm resistance to pyriproxyfen in an Israeli-B biotype but more monitoring is required to validate such resistance.

A practical implementation resulted from our research is the possible reuse of pyriproxyfen in areas where the B is the predominant; however, it should be accompanied with strict biotyping determination before and after a pyriproxyfen application to prevent any field failure.

ACKNOWLEDGMENT

The authors gratefully acknowledge the Chief Scientist of the Ministry of Agriculture and the Israeli Cotton Board for their partial support of the research. This paper is contribution No.507/2011, from the Agricultural Research Organization, the Volcani Center, Bet Dagan, Israel.


REFERENCES [1] Abbott, W.S. (1925) A method of computing the effectiveness of an insecticide. [2] J Econ Entomol 18, 265–267. [3] Bedford ID, Briddon RW, Brown JK, Rosell RC, Markham PG (1994) Geminivirus transmission and biological

characterisation of Bemisia tabaci (Gennadius) biotypes from different geographic regions. Ann Appl Biol 125:311–325 [4] Boykin LM, Shatters RG Jr, Rosell RC, McKenzie CL, Bagnall RN, De Barro P, Frohlich DR (2007) Global relationships

of Bemisia tabaci (Hemiptera: Aleyrodidae) revealed usingBayesian analysis of mitochondrial COI DNA sequences. Mol Phylogenet Evol 44:1306–1319

[5] Brown JK, Frohlich DR, Rosell RC (1995) The sweetpotato or silverleaf whiteflies: biotypes of Bemisia tabaci or a species complex? Annu Rev Entomol 40:511–534

[6] Byrne DN, Bellows TS Jr (1991) Whitefly biology. Annu Rev Entomol 36:431–457. [7] Castle SJ, Palumbo JC, Prabhaker N, Horowitz AR, Denholm I (2010) Ecological determinants of Bemisia tabaci resistance

to insecticides. In: Stansly PA, Naranjo SE (eds.) Bemisia: bionomics and management of a global pest. Springer, Dordrecht.

[8] Chiel E, Gottlieb Y, Zchori-Fein E, Mozes-Daube N, Katzir N, Inbar M, Ghanim M (2007) Biotype-dependent secondary symbiont communities in sympatric populations of Bemisia tabaci. Bull Entomol Res 97:407–413

[9] Chu D, Wan FH, Zhang YJ, Brown JK (2010) Change in the biotype composition of Bemisia tabaci in Shandong Province of China from 2005 to 2008. Environ Entomol 39:1028–1036

[10] Costa HS, Brown JK (1991) Variation in biological characteristics and esterase patterns among populations of Bemisia tabaci (Genn.) and the association of one population with silverleaf symptom induction. Entomol Exp Appl 61:211–219

[11] Costa HS, Brown JK, Sivasupramaniam S, Bird J (1993) Regional distribution, insecticide resistance, and reciprocal crosses between the ‘A’ and ‘B’ biotypes of Bemisia tabaci. Insect Sci Appl 14:255–266.

[12] Crowder DW, Horowitz AR, De Barro PJ, Liu SS, Showalter AM, Kontsedalov S, Khasdan V, Shargal A, Liu J, Carrière Y. (2010) Mating behaviour, life history and adaptation to insecticides determine species exclusion between whiteflies. J Anim Ecol. 79:563-70

[13] De Barro PJ, Trueman JWH, Frohlich DR (2005) Bemisia argentifolii is a race of B. tabaci (Hemiptera: Aleyrodidae): the molecular genetic differentiation of B. tabaci populations around the world. Bull Entomol Res 95:193–203.

[14] De Barro PJ, Liu SS, Boykin LM, Dinsdale A (2011) Bemisia tabaci: a statement of species status. Annu Rev Entomol 56:1–19.

[15] Gottlieb Y, Ghanim M, Chiel E, Gerling D, Portnoy V, Steinberg S, Tzuri G, Horowitz AR,Belausov E, Mozes-Daube N, Kontsedalov S, Gershon M, Gal S, Katzir N, Zchori-Fein E(2006) Identification and localization of a Rickettsia sp in Bemisia tabaci (Homoptera: Aleyrodidae). Appl Environ Microbiol 72:3646–3652

[16] Guirao P, Beitia F, Cenis JL (1997) Biotype determination of Spanish populations of Bemisia tabaci (Hemiptera: Aleyrodidae). Bull Entomol Res 87:587–593

[17] Hequet E, Henneberry TJ, Nichols RL (eds.) (2007) Sticky cotton: causes, effects, and prevention. USDA-ARS Technical Bulletin No 1915

[18] Hogenhout SA, Ammar ED, Whitfield AE, Redinbaugh MG (2008) Insect vector interactions with persistently transmitted viruses. Annu Rev Phytopathol 46:327–359

[19] Horowitz AR, Kontsedalov S, Denholm I, Ishaaya I (2002) Dynamics of insecticide resistance in Bemisia tabaci – a case study with an insect growth regulator. Pest Manag Sci 58:1096–1100.

[20] Horowitz AR, Denholm I, Gorman K, Cenis JL, Kontsedalov S, Ishaaya I (2003) Biotype Q of Bemisia tabaci identified in Israel. Phytoparasitica 31:94–98

[21] Horowitz AR, Kontsedalov S, Ishaaya I (2004) Dynamics of resistance to the neonicotinoids acetamiprid and thiamethoxam in Bemisia tabaci (Homoptera: Aleyrodidae). J Econ Entomol 97:2051–2056.

[22] Horowitz AR, Kontsedalov S, Khasdan V, Ishaaya I (2005) Biotypes B and Q of Bemisia tabaci and their relevance to neonicotinoid and pyriproxyfen resistance. Arch Insect Biochem Physiol 58:216–225

[23] Ishaaya I, Horowitz AR (1992) A novel phenoxy juvenile hormone analog (pyriproxyfen) suppresses embryogenesis and adult emergence of the sweetpotato whitefly (Homoptera: Aleyrodidae). J Econ Entomol 85:2113–2117

[24] Jones DR (2003) Plant viruses transmitted by whiteflies. Eur J Plant Pathol 109:195–219. [25] Khasdan, V., Levin, I., Rosner, A., Morin, S., Kontsedalov, S., Maslenin, L. and Horowitz, A.R. (2005) DNA markers for

identifying biotypes B and Q of Bemisia tabaci (Hemiptera: Aleyrodidae) and studying population dynamics. Bull Entomol Res, 95:605–613.

[26] Kontsedalov S, Zchori-Fein E, Chiel E, Gottlieb Y, Inbar M, Ghanim M (2008) The presence of Rickettsia is associated with increased susceptibility of Bemisia tabaci (Homoptera: Aleyrodidae) to insecticides. Pest Manag Sci 64:789–792

[27] Kontsedalov S, Abu-Moch F, Lebedev G, Czosnek H, Horowitz AR, Ghanim M (in press) Bemisia tabaci biotype dynamics and resistance to insecticides in Israel during the years 2008-2010. Agricultural Sciences in China

[28] LeOra Software. 1987. POLO-PC. A user’s guide to probit or logit analysis. Berkeley, CA: LeOra Software. [29] Mahadav A, Kontsedalov S, Czosnek H, Ghanim M. 2009. Thermotolerance and gene expression following heat stress in

the whitefly bemisia tabaci B and Q biotypes. Insect Biochem Molec Biol, 39: 668-76. [30] Oliveira MRV, Henneberry TJ, Anderson P (2001) History, current status, and collaborative research projects for Bemisia

tabaci. Crop Prot 20:709–723 [31] Perring TM (2001) The Bemisia tabaci species complex. Crop Prot 20:725–737


[32] Rauch N, Nauen R. 2003. Identification of biochemical markers linked to neonicotinoid cross-resistance in Bemisia tabaci (Hemiptera: Aleyrodidae). Arch Insect Biochem Physiol 54:165–176.

[33] Sanchez-Campos S, Navas-Castillo J, Camero R, Soria C, Diaz JA, Moriones E (1999) Displacement of tomato yellow leaf curl virus (TYLCV-Sr) by TYLCV-Is in tomato epidemics in Spain. Phytopathology 89:1038–1043.

[34] Stansly PA, Naranjo SE (2010) Bemisia: bionomics and management of a global pest. Springer, Dordrecht. [35] Xu J, De Barro PJ, Liu SS (2010) Reproductive incompatibility among genetic groups of Bemisia tabaci supports the

proposition that the whitefly is a cryptic species complex. Bull Entomol Res 100:359–366.

Gambit of IPM for Insect Resistant Transgenic Cotton

N.V.V.S. Durga Prasad, G.M.V. Prasad Rao and V. Chenga Reddy

Insect Pest Management, Regional Agricultural Research Station, Lam, ANGRAU, Guntur

Abstract—Field experiments were conducted at Regional Agricultural Research station, Lam, Guntur to study the performance of Transgenic Bt cotton BG, BG II and non Bt cotton of Mallika hybrid under IPM, conventional control (CC) and unprotected conditions (check) for two consecutive seasons. The incidence of whiteflies was significantly low in IPM block of all the hybrids compared to conventional control, while the incidence of thrips, aphids and jassids were marginally high under IPM module. The larval incidence and fruiting bodies damage of American and pink bollworms were significantly high in IPM module compared to conventional control. The activity of natural enemies under ecofriendly IPM in all the hybrids were more compared to conventional control and check without pesticidal application. Though there were slight difference in yield levels the cost benefit ratio was high from IPM module (1:1.55 in BG, 1:1.73 in BG II and 1:1.35 in NBt) compared to conventional control (1:1.34 in BG, 1:1.45 in BG II and 1:1.23 in NBt) due to low cost of plant protection. The untreated check module without any protection to pest complex in Bt cotton system recorded low yield and cost benefit ratio which may not be a viable system. Hence, ‘Bt’ cotton hybrids should be viewed as a foundation on which Integrated Pest Management (IPM) has to be built up to combat the pest problems for sustainable transgenic Bt cotton cultivation.

INTRODUCTION

Cotton is one of the most important commercial crop of Andhra Pradesh and insect pest complex is one of the major constraint for cotton cultivation. Over dependence and indiscriminate use of insecticides led to the control failures of the cotton pests due to development of resistance in the major pests and resurgence of minor pests besides deleterious effect on the bio control agents paving the way for the development of IPM. There are number of reports on successful IPM programmes against different pests on major crops in different states of our country. IPM helps in preservation of natural biodiversity apart from reducing the cost of plant protection by using environmentally safer methods of pest management. The rapid changes witnessed in the biotechnology resulted in the development of genetically modified crops which evolved as effective alternate tools for pest management. The genetically modified transgenic Bt cotton (BG) was commercially available in India from 2002 and stacked BG II hybrids from 2006 which found favor with farmers with considerable increase in area of Bt cotton in the country. Though the Bt cotton hybrids are resistant to bollworms, there are reports regarding the high incidence of sucking pests in Bt cotton hybrids (Cui and Xia, 2000; Barwale et al., 2002) and varied trends on the occurrence of natural enemies in Bt cotton hybrids. Transgenic Bt cotton with potential to combat certain insect pests should become a major component in IPM. Therefore it is most important to evaluate the impact of present IPM strategies visa a vis conventional insecticide dependent control and under completely unprotected conditions on Transgenic BG and BGII cotton to formulate suitable IPM module for Bt cotton towards sustainable cultivation. Hence, the present study was aimed to assess the advantage of IPM module for insect resistant transgenic Bt cotton under different modules.


The experiment was conducted at Regional Agricultural Research station (RARS), Lam, Guntur, Andhra Pradesh, India during kharif, 2009-10 and 2010-11 under rainfed conditions in black cotton soils. Mallika BG, Mallika BG II and non Bt cotton hybrids

(NBt hybrid) were grown in three modules IPM, conventional control (CC) and unprotected conditions (Check) in three replications. All the hybrids were sowm during IInd fortnight of July in both

39


the seasons at a spacing of 105 cm X 60 cm. The agronomic practices and fertilizer application were taken up similarly as per the recommendations in all the blocks except plant protection measures.

IPM MODULE

The following IPM practices were followed

• Seed treatment with imidacloprid @ 5g/kg seed • Stem application with monocrotophos @1:4 ratio at 30,45 and imidacloprid @ 1:20 ratio at 60

DAS • Intercropping with green gram • Growing jowar as border crop • Erection of bird perches • Monitoring of bollworms through pheromone traps • Yellow sticky traps for whitefly • Use of botanical insecticides, 5 % NSKE and neemoil • Need based application of insecticides based on ETL

CONVENTIONAL CONTROL BLOCKS (CC)

Insecticidal interventions were taken up for every 10 to 15 days in all Bt and non Bt hybrids under conventional control.

Unprotected Block (Check)

Bt and Non Bt cotton hybrids were kept under completely unprotected conditions without any pest management interventions.

The incidence of sucking pests, bollworms, fruiting body damage due to bollworms and the occurrence of natural enemies were recorded at weekly interval from each block from 25 randomly selected plants. Sucking pests such as aphids, leafhoppers, thrips and whiteflies were recorded from three leaves, each one from top, middle and bottom canopies of the plant. While for the bollworms damage to fruiting parts and natural enemies were recorded from whole plant. Cost of cultivation and yields were recorded from different control modules and cost benefit ratios were calculated. The incidence of different pests, damage and cost of cultivation were given as seasonal mean for both the seasons. The data was subjected to suitable transformations and analyzed through ANOVA using MSTATC


The pooled data over the two seasons showed that the seasonal mean incidence of whitefly was significantly low under IPM module (2.35 in BG, 3.03 in BG II and 3.43 in NBt per 3 leaves) compared to conventional control (CC) (5.52 in BG, 4.46 in BG II and 4.82 in NBt per 3 leaves) and check (2.70 in BG I, 4.25 in BG II and 3.70 in NBt per 3 leaves), IPM practices played a major role in suppressing whitefly population. The population of thrips, aphids and jassids (1.34, 1.62 and 2.19/3 leaves, respectively in BG; 1.65, 2.24 and 1.85/3 leaves, respectively in BG II; 1.33, 1.81 and 2.10/3 leaves, respectively in NBt) were low under conventional control when compared to population levels in IPM (2.21, 2.76 and 3.45/3 leaves, respectively in BG; 2.29, 3.36 and 2.93/3 leaves, respectively in BG II; 2.77, 2.53 and 3.62/3 leaves, respectively in NBt) and check (1.60, 9.44 and 5.91/3 leaves, respectively in BG; 1.38, 7.24 and 5.20/3 leaves, respectively in BG II; 1.48, 7.99 and 5.48/3 leaves, respectively in NBt), which indicates that the incidence of thrips, aphids and jassids were reduced by frequent insecticidal interventions effectively than IPM practices (Table 1). But the incidence of whiteflies was high in conventional control block compared to IPM and check which clearly indicates the resurgence of whiteflies due to frequent insecticidal sprayings. In general, the population of all the sucking pests was high in check block compared to IPM and conventional control modules except whiteflies. The lower

Gambit of IPM for Insect Resistant Transgenic Cotton 241

incidence of sucking pests under conventional control can be attributed to insecticidal interventions at frequent intervals, but resulted in resurgence of whiteflies. While adoption of IPM practices such as seed treatment, stem application, intercropping with green gram and spraying with 5%NSKE reduced the population of sucking pests under IPM without any insecticidal interventions. The efficacy of imidacloprid at 5, 7.5 and 10 g /kg seed as seed dresser was proved effective earlier by many workers in controlling the populations of leafhoppers, aphids, thrips and whiteflies up to 30-50 days after sowing (Gupta et al., 1998; Satpute et al., 2001; Kannan et al., 2004). Rama Rao et al. (1998) reported that stem application with imidacloprid (200 SL) at 1:20 dilution at 20, 40 and 60 DAS was highly effective in controlling aphids, leafhoppers and mealy bugs in cotton. Venkatesan et al. (1987) observed the lower incidence of leafhoppers on cotton when intercropped with green gram and black gram, while Rao and Chari (1992) reported that the cotton crop bordered by sorghum showed significantly lower aleyrodid populations. Sohi et al. (2004) reported that the incidence of leafhoppers and whiteflies per leaf were low in IPM fields compared to that of non IPM fields.

TABLE 1: INFLUENCE OF TRANSGENIC BT COTTON AND NON BT COTTON ON PEST COMPLEX IN DIFFERENT MODULES

Pests/damage BG I Hybrid BG II Hybrid Non Bt Hybrid (NBt) F test C.D. IPM CC Check IPM CC Check IPM CC Check Thrips/3 leaves 2.21(1.79) 1.34(1.53) 1.60(1.61) 2.29(1.81) 1.65(1.63) 1.38(1.54) 2.77(1.94) 1.33(1.53) 1.48(1.57) SIG 0.06 Aphids/3 leaves 2.76(1.94) 1.62(1.62) 9.44(3.23) 3.36(2.01) 2.24(1.80) 7.24(2.87) 2.53(1.88) 1.81(1.68) 7.99(3.00) SIG 0.10 Jassids/3 leaves 3.45(2.11) 2.19(1.79) 5.91(2.63) 2.93(1.98) 1.85(1.69) 5.20(2.49) 3.62(2.15) 2.10(1.76) 5.48(2.54) SIG 0.09 Whiteflies/3 leaves 2.35(1.83) 5.52(2.55) 2.70(1.92) 3.03(2.01) 4.46(2.34) 4.25(2.29) 3.43(2.11) 4.82(2.41) 3.70(2.17) SIG 0.11 Predators/plant 0.14(1.07) 0.08(1.04) 0.12(1.06) 0.16(1.08) 0.24(1.12 0.16(1.08) 0.16(1.08) 0.08(1.04) 0.18(1.09) SIG 0.02 Helicoverpa larva/plant 0.03(1.01) 0.00(1.00) 0.01(1.01) 0.00(1.00) 0.00(1.00) 0.01(1.01) 0.18(1.09) 0.09(1.04) 0.24(1.12) SIG 0.013

Pink bollworm larvae/10 bolls 0.00(1.00) 0.00(1.00) 0.00(1.00) 0.00(1.00) 0.00(1.00) 0.00(1.00) 0.08(1.04) 0.11(1.06) 0.16(1.08) SIG 0.006

Fruiting bodies (squares) damage% 0.91[5.46] 0.00[0.00] 0.35[3.39] 0.44[3.81] 0.00[0.00] 0.10[1.80] 3.64[10.99] 1.03[5.83] 3.44[10.68] SIG 0.47

Boll damage% 0.07[1.45] 0.00[0.00] 0.05[1.32] 0.00[0.00] 0.00[0.00] 0.00[0.00] 1.11[6.04] 0.19[2.50] 1.10[6.02] SIG 0.44 Locule damage- green bolls % (PBW) 0.00[0.00] 0.00[0.00] 0.00[0.00] 0.00[0.00] 0.00[0.00] 0.00[0.00] 0.60[4.41] 0.90[5.43] 2.05[8.23] SIG 0.49

Figures in ( ) parentheses are √x+1 transformed values Figures in [ ] parentheses are Arcsin transformed values

TABLE 2: PLANT PROTECTION AND ECONOMICS OF TRANSGENIC BT COTTON AND NON BT COTTON IN DIFFERENT MODULES

Particulars BG I Hybrid BG II Hybrid Non Bt Hybrid (NBt) F test C.D.IPM CC Check IPM CC Check IPM CC Check

Number of Sprays a)Stem application 3 0 0 3 0 0 3 0 0 b)Sucking pests 2 7 0 2 7 0 2 7 0 c) Helicoverpa 0 1 0 0 1 0 1 3 0 d) Spodoptera 1 2 0 0 1 0 1 2 0 e)Pink bollworm 0 0 0 0 0 0 0 0 0 Total 6 9 0 5 8 0 7 11 0 Plant protection cost (Rs/ha) 6515 13490 0 4550 11500 0 8175 15835 0 Yield (q/ha) 19.62 20.93 12.55 20.19 21.45 13.20 17.56 20.10 10.55 SIG 1.89Gross income (Rs/ha) 70600 75280 45972 72325 77110 48202 36930 72384 39440 Cost of cultivation (Rs/ha) 45940 56115 37375 42725 53375 37625 47600 58960 36375 Net profit (Rs/ha) 24660 19165 8597 29600 23735 10577 16330 13424 3065 Cost benefit ratio 1:1.55 1:1.34 1:1.25 1:1.73 1:1.45 1:1.31 1:1.35 1:1.23 1: 1.09

The larval population was nil in IPM due to toxic effect of Bt protein present in cotton plant, where as in Conventional control of BG II and BG hybrids due to the toxic effect of Bt protein and insecticides. In non Bt hybrids very low incidence of 0.18, 0.09 and 0.24 larvae/plant were recorded in IPM, conventional control and check modules, respectively and never reached ETL (Table 1). The higher population of natural enemies and spraying of NSKE 5 % may reduced Helicoverpa armigera (Hub.) larval population by suppression of the egg load under IPM, while it can be attributed to insecticidal sprays under conventional control. Ramteke et al. (2002) reported that NSKE (5 %) and neem oil (300 ppm) were more economical in suppressing the population of H.armigera in cotton. Sohi et al. (2004) reported that the larval incidence of H.armigera per plant, E.vittella and P.gossypiella in intact green fruiting bodies were low in IPM fields compared to that of non IPM fields.


The per cent square (i.e. 0.81 in BG hybrid, 0.44 in BG II hybrid and 3.64 in NBt hybrid) and boll damages (i.e. 0.07 in BG hybrid and 1.11 in NBt hybrid) were high in IPM module compared to conventional control module which can be attributed to insecticidal interventions, while boll damage was nil in IPM block of BG II hybrid which is attributed to the presence of double gene might be given full protection against bollworms. In contrast, Kulkarni et al. (2004) reported that the mean boll damage was 12.16 % in Bt cotton with IPM against 14.58 % in Bt cotton with insecticide spraying. Bambawale et al. (2004) reported significant reduction in boll damage by the bollworms in Bt cotton with IPM which was 11.5 % as against 29.4 % in conventional control.

The larval incidence of pink bollworm through destructive sampling showed that the larval population was nil in both IPM and conventional control modules of both BG and BG II hybrids with no locule damage in green bolls, whereas in NBt hybrid per cent locule damage (0.60) was low in IPM block compared to conventional control (0.90) and check (2.05) due to pink bollworm and the number of pink bollworm larvae/10 bolls was 0.08, 0.11 and 0.16 under IPM, conventional control and check, respectively. (Table 1). Earlier, Sohi et al., (2004) reported that the larval incidence of P.gossypiella in intact green fruiting bodies were low in IPM fields compared to that of non IPM fields.

The occurrence of natural enemies was high under IPM (0.14, 0.16 and 0.16/plant in BG, BG II and NBt hybrids, respectively) and check blocks (0.12, 0.16 and 0.18 /plant in BG, BG II and NBt hybrids, respectively) in all the modules, while it was low under conventional control (0.08, 0.24 and 0.08 /plant in BG, BG II and NBt hybrids, respectively) in all the modules except in BG II cotton hybrid(Table 1). The populations of natural enemies were conserved under IPM due to growing of intercrop, application of safer chemicals like NSKE, avoidance of early season sprays by adopting seed treatment and stem application. The increased incidence of natural enemies due to seed treatment (Kannan et al., 2004), intercropping with greengram or black gram (Venkatesan et al., 1987) were well documented. Kulkarni et al. (2004) reported that the mean population of natural enemies was significantly higher i.e. 9.93/ plant in Bt cotton IPM when compared to 7.87/ plant in Bt cotton with insecticidal sprayings. The population of coccinellids and chrysopids increased by 45.5 and 38.7 per cent, respectively in Bt cotton IPM plots over control (Cui and Xia, 1998).

The seed cotton yield was slightly high from conventional control compared to IPM and checks in all the modules. But, the cost benefit ratio was favourable from IPM (1:1.55, 1:173 and 1:1.35 in in BG, BG II and NBt hybrids, respectively) compared to conventional control (1:1.34, 1:1.45 and 1:1.23 in BG, BG II and NBt hybrids, respectively) and check (1:1.25, 1:1.31 and 1:1.09 in BG, BG II and NBt hybrids, respectively) (Table.2). Though the yield was high, the net profit and cost benefit ratio were low from conventional control modules due to higher plant protection cost than IPM and check. The total number of interventions in BG, BG II and NBt hybrids were only 6, 5 and 7, respectively with low cost techniques like stem application and spraying of botanical insecticides lead to low plant protection cost of Rs. 6515, 4550 and 8175/ha in BG, BG II and NBt hybrids, respectively under IPM as against 9,8 and 11 insecticidal interventions with Rs. 13490, 11500 and 15835/ha under conventional control in all the three hybrids, which resulted in low net profit though the yield was high in conventional control. The present results clearly indicated that the use of insecticides indiscriminately lead to the reduction in net profits with low cost benefit ratio and adverse effect on natural enemies. The present findings are in conformity with Sohi et al. (2004) who reported that there was 53.3 % reduction in insecticide use in IPM fields with 12.2 number of insecticide sprays as against 18.7 sprays in non IPM fields which resulted in higher economic returns. Kumar (2006) reported that growing of Bt cotton reduced the cost of bollworm control upto 60 % with corresponding saving from plant protection cost and increase in seed cotton yield. Rao et al. (1995) reported that the seed cotton yield from IPM plots was high which resulted in a higher cost benefit ratio (1:5.3) in comparison with conventional farming practice (1:2.5). Hence transgenic Bt cotton with inbuilt resistance to bollworms under IPM umbrella can combat pest problems for sustainable cotton cultivation.

Gambit of IPM for Insect Resistant Transgenic Cotton 243

REFERENCES [1] Bambawale, O. M., Singh, A., Sharma, O. P., Bhosle, B. B., Lavekar, R.C., Dhandapani, A., Kanwar, V., Tanwar, R. K.,

Rathod, K. S., Patange, N. R. and Pawar, V. M. 2004. Performance of Bt cotton (MECH-162) under Integrated Pest Management in farmers' participatory field trial in Nanded district, Central India. Current Science 86(12) : 1628-1633.

[2] Barwale, R. B., Brent, E. Z. and Singh, F. 2002. Bt cotton in India delivered in short course. Proceedings of seminar on “Advances in Implemental Pest Management Technology” July 8-17, DOR, Hyderabad.

[3] Cui, J. J. and Xia, J. Y. 1998. Effects of early seasonal strain of Bt transgenic cotton on population dynamics of main pests and their natural enemies. Acta Gossypii Sinica 10: 255-262.

[4] Cui, J. J. and Xia, J. Y. 2000. Effects of Bt (Bacillus thuringiensis) transgenic cotton on the dynamics of pest population and their enemies. Acta Phytophylacica Sinica 27: 141-145.

[5] Gupta, G.P., Agnihotri, N.P., Sharma, K., Gajbhiye, V.T. and Sharma, K. 1998. Bioefficacy and residue of imidacloprid in cotton. Pesticide Research Journal 10: 149-154.

[6] Kannan, M., Uthamasamy, S. and Mohan, S. 2004. Impact of insecticides on sucking pests and natural enemy complex of transgenic cotton. Current Science 86: 726-729.

[7] Kulkarni, K.A., Kambrekar, D.N., Gundannavar, K.P., Devaraj, K. and Udikeri, S.S. 2004. Biointensive Integrated pests management for Bt cotton. Proceedings of National symposium on “Strategies for Sustainable Cotton Production – A Global vision” 23-25, November, 2004, UAS, Dharwad, pp.149-151.

[8] Kumar, Y. 2006. Experiences with Bt cotton in Gujarat. Proceedings of National Seminar on “Transgenic crops in Indian Agriculture: Status, Risks and Acceptance”: Souvenir, Extended Summaries and Abstracts, (eds: S.K.Sethi, S.S.Siwach and R.K.Yadav), 28-29 Jan,2006, CCS HAU, Hisar, pp. 32-35.

[9] Rao, G.R. and Chari, M.S. 1992. Population dynamics of whitefly, Bemisia tabaci Gen. in cotton and tobacco in relation to weather factors. Tobacco Research 18: 73-78.

[10] Rao, N.V., Rao, B.R., Sekhar, PR., Venkataiah, M. and Rao, A.G. 1995. Development of an integrated pest management module for cotton in Andhra Pradesh. Journal of Biological Control 9: 105-108.

[11] Ramteke, M.S., Peshlar, L.N., Burange, P.S. and Panchabhavi, P.R. 2002. Efficacy of neem seed kernel extract in comparison to Bacillus thuringiensis Ber. and Ha NPV in the management of Helicoverpa armigera Hubner on chickpea. Pestology 26:45-47.

[12] Rama Rao, B., Rao, N.H.P. and Raghunada Rao, C. 1998. Stem application - A new technique for controlling sucking pests of cotton. Journal of Cotton Research and Development 12:127-129.

[13] Satpute, N.S., Katole, S.R., Nimbalkar, S.A., Sarnaik, D.N. and Satpute, U.S. 2001. Efficacy of imidacloprid and thiamethoxam as seed treatment against cotton jassid, Amarasca devastans Distant. Journal of Applied Zoological Research 12: 88-90.

[14] Sohi, A.S., Singh, J., Brar, K.S., Simwat, G.S., Sharma, S. and Bhullar, H.S. 2004. Promotion of integrated pest management technology in irrigated cotton at farmer's field. Pest Management and Economic Zoology 12: 49-53.

[15] Venkatesan, S., Balasubramanian, G., Siva Prakasam, N., Narayanan, A. and Gopalan, M. 1987. Effect of intercropping of pulses and sunflower on the incidence of sucking pests of rainfed cotton. Madras Agricultural Journal 74:364-368.

Cotton Pest Management Programmes using Threshold-Based Interventions Developed by CIRAD and its Partners in Sub‐Saharan

African Countries

Silvie P.J.1, Adegnika M.A.2, Akantetou K.P.3, Ayeva B.3, Bonni G.4, Brevault, T.5 Gautier C.6, Héma O.7 Houndete T.A.8, Ochou G.9, Prudent P.6

Renou A.10 and Togola M.11

1CIRAD, UPR Systèmes de culture annuels, Montpellier, France 2INRAB/CRA-CF, Cotonou, Benin, 3ITRA/ CRA-SH, Anie, Togo

4INRAB/CRA-CF, Parakou, Benin, 5CIRAD, UPR Systèmes de culture annuels, Montpellier, France 6CIRAD, UPR Systèmes de culture annuels, Maroua, Cameroon

7INERA, Bobo-Dioulasso, Burkina Faso, 8INRAB/CRA-CF, Bohicon, Benin 9CNRA, Abidjan, Côte D’Ivoire, 6CIRAD, UPR Systèmes de culture annuels, Maroua, Cameroon

10CIRAD, UPR Systèmes de culture annuels, Bamako, Mali, 11IER, Sikasso, Mali

Abstract—In the late 1980s, after a long period during which insecticides were sprayed at preset dates to control cotton pests and their damage, some French-speaking countries in sub-Saharan areas decided to disseminate a more sustainable crop protection approach among smallholders: targeted staggered control (LEC, for Lutte étagée ciblée). According to this approach, decisions on some insecticide sprays were made on the basis of infestation levels or the extent of crop damage induced by major pests: Aphis gossypii aphids, Haritalodes (= Syllepte) derogata leaf-eating caterpillars, and more generally Helicoverpa armigera, Diparopsis watersi, Earias insulana and E. biplaga bollworms. Polyphagotarsonemus latus mites were sometimes included on this list. Due to changes in cotton production conditions over the past 10 years, especially the development of pyrethroid resistance in H. armigera, and depending on the country, this programme has been abandoned, preserved or replaced by other programmes. The strict use of thresholds in Mali was thus taken to be a logical follow-up to LEC, which is still widely implemented. A targeted ‘threshold-based’ programme was developed in Togo. Cameroon abandoned LEC and opted for a ‘sequential plan for individual decision’ (SPID) programme (LOIC, for Lutte après observation individuelle des chenilles), based on control after sequential sampling of bollworms. In Benin, LEC has been presented in two forms, i.e. ‘complete’ and ‘partial’, tailored to two regions delineated according to the extent of damage of some bollworms that live inside cotton bolls, i.e. Pectinophora gossypiella, Thaumatotibia (= Cryptophlebia) leucotreta. In Ivory Coast, where these Lepidopteran pests are also present, the use of treatment thresholds is limited to the beginning of the cotton crop cycle. On the contrary, in Burkina Faso, thresholds are used after the first two calendar sprayings. The present article fully describes these new crop protection programmes, sampling methods and associated intervention thresholds, in addition to the advantages and constraints associated with their adoption.

INTRODUCTION

The concept of Integrated Pest Management remains widely recommended in crop protection programmes against pests. Before any decision is taken to apply a toxic product, the use of action thresholds is an essential step (Stern et al., 1959). In cotton production, the use of action thresholds (called ‘thresholds’ in the rest of this article), linked to the level of pests or damage, has been adopted in numerous countries where the growth of this crop is conducted in a mechanical way over large acreages, with the aim of reducing the quantity of pesticide use (the undesirable effects of pesticides are known) and, as a result, reducing production costs.

At the end of the 1980s in the French-speaking sub-Saharan Africa region, cotton producing countries developed various forms of integrated protection programmes for cotton which were called ‘Lutte étagée ciblée’ (LEC) or ‘targeted staggered control’ (TSC). A basic programme, sometimes seen as a ‘protection or safety net’, is recommended according to a calendar preset in the conventional standard protection programme (usually five or six sprays at fortnightly intervals), with the application of

40

Cotton Pest Management Programmes using Threshold-Based Interventions Developed by CIRAD and its Partners 245

insecticide doses reduced by half. Additional treatments or doses are carried out when the action thresholds are reached. Amongst the diversified fauna of Arthropods which are present on this crop (Vaissayre, 1994) certain groups of pests have been taken into account more specifically for the application of these thresholds. Therefore observation has mainly focused on aphids (Aphis gossypii), leaf-eating caterpillars such as Haritalodes (= Syllepte) derogata, Anomis flava, or Spodoptera littoralis and caterpillars described as ‘carpophagous’ such as Helicoverpa armigera, Diparopsis watersi, Earias insulana and E.biplaga, which feed on fruiting organs and are visible on the outside of them (i.e. ‘exocarpic’). In some countries, such as Togo and Benin for example, the presence of carpophagous caterpillars which live inside green bolls (‘endocarpic’) has led to the definition of two phytosanitary regions (a northern zone and a southern zone). In fact, populations of these species are higher in the southern regions where they cause significant damage to cotton and maize. The species concerned are Thaumatotibia (= Cryptophlebia) leucotreta, which is also present in Ivory Coast (Ochou et al., 1998a,b), and the Lepidoptera Mussidia nigrivenella, a pest best known in maize but sometimes reported in significant numbers in southern Togo (Silvie, 1990).

A first summary detailing protection programmes using thresholds was published by Silvie et al. (2001). Since this time, the context in which cotton is produced in sub-Saharan Africa has changed. Major events have occurred locally, such as the privatization of cotton networks, leading to the division of operations and reorganisation of the production chain. In Burkina Faso, for example, the production zones have been consigned to three different entities, of which Faso Coton is part. In the Côte d’Ivoire, the Ivoire Coton group manages the north-west of the country. This geographical carving up of cotton production has led to a fragmentation which does not always make it easy to interpret production at the national scale, particularly when it comes to agricultural statistics. There is also a possible threat to pest management, caused by the definition of different phytosanitary protection strategies from one geographical zone to another within the same country. Regarding pest management, the ways cotton crops are protected have changed since the evolution of resistance to pyrethroids in the cotton bollworm H. armigera was highlighted in countries such as the Côte d’Ivoire (Martin et al., 2002, 2005; Vaissayre et al., 1998), Benin (Djihinto et al., 2009) and, later, Cameroon (Achaleke & Brévault, 2010 ; Brévault et al., 2008). On the other hand, the recent highlighting of resistance in Bemisia tabaci (Houndété et al., 2010) does not appear to have changed the pest management programmes applied. Finally, another recent change has been the introduction of genetically modified cotton varieties carrying the cry1Ac and cry2Ab genes, which come from the bacterium Bacillus thuringiensis (Bt). Thanks to the production of insecticidal proteins, these cotton plants, known as ‘Bt cotton’, are resistant to the major Lepidopteran pests (Héma et al., 2008; Traore et al., 2008). Following these changes and according to the country, LEC programmes have been abandoned, modified or replaced by other types of protection programme which still use thresholds to decide when to apply insecticides.

The recently published summaries on cotton pest management (Peshin et al., 2009 ; Kranthi & Kranthi, 2010) rarely mention the experiences of French-speaking Africa in this area (van Huis, 2009 ; Kranthi & Russell, 2009). It seems useful therefore, 10 years on, to update our knowledge on the use of thresholds in cotton pest management programmes in French-speaking sub-Saharan Africa.

Published knowledge on the current status of cotton protection programmes varies according to the country. As an example, the latest information on the protection of cotton crops in Chad and Central African Republic dates back to data published by Nibouche et al. (2003a). For these authors, the existence of various protection programmes, offered simultaneously to farmers, and changes in application techniques (from one to 10 liters of water plus insecticide applied per hectare), appear to be the cause for withdrawing the LEC programmes in these countries.

PAST AND CURRENT STATUS OF THRESHOLD-BASED PROGRAMMES IN WEST AFRICAN COUNTRIES

LEC programmes are based on a basic calendar programme. This calendar is the same as the conventional programme, comprising five or six sprays at fortnightly intervals starting from the 45th day after emergence (early squaring), but with insecticide doses reduced by half.

246

In 200(called thein the cale(the ‘D+7spraying wabove thetarget pest

Todayobservatiotreatment.Helicoverpingredient‘protectiowindow c

01, two broae ‘D-1' progendar progra

7' programmewith pesticid

e threshold, st.

y, Benin, Tons. Supplem. But new vrpa armigerats, to allow n windows’

corresponds t

World Cot

ad types of thramme), in B

amme to adjue), in Burkindes applied spraying wa

TABLE 1: CHARACTE

Togo, Camementary treatvariations ara to pyrethrobetter contrhave been d

to two treatmTABLE 2: US

tton Research C

he LEC progBenin and Cust active inna Faso, Malat a reduceds performed

ERIZATION OF THRESHO

eroon, Ivorytments, basere also offerids has, logi

rol of bollwodefined withinments in the ‘

E OF ACTIVE IN GRADIE

Conference on T

grammes werCameroon, scngredient andli and Togo,d dosage in the next da

OLD-BASED CONTROL P

y Coast, Md on threshored to producally, led to orms and den the croppinconventiona

ENT RELATIVELY TO WIN

Technologies fo

re noted by Scouting was pd dosage the , insect sampthe calenda

ay with the a

PROGRAMMES IN WEST

Mali and Buolds, can be ucers (Tab. temporal res

elay the evolng season (T

al’ programmNDOWS OF SPRAYING (

or Prosperity

Silvie et al. (performed thfollowing d

pling was pear programmactive ingred

AFRICAN COUNTRIES

urkina Fasoapplied seve1). Evidencstrictions on lution of res

Tab. 2) (Brévme.

(W1,W2, W3)

(2001). In thehe day beforday. In the seerformed six

me. If pest dedient depend

o recommenen days aftere of the resthe use of th

sistance. Twvault et al., 20

e first type re spraying econd type days after

ensity was ding on the

nd weekly r the initial sistance of hese active

wo or three 009). Each


TABLE 3: COMPARISON OF MARGINS (IN CFA (1)/HA) CALCULATED FOR VARIOUS COTTON PROTECTION PROGRAMMES IN FRENCH-SPEAKING SUB-SAHARAN AFRICA

Margin and Country Conventional' Programme Programmes using Thresholds (LEC - LOIC) Reference MARI(2) Burkina Faso 41 243 68 206

COMPACI et al., 2010Cameroon 51 340 79 630 Ivory Coast 33 300 107 300 Net margin Benin Weak guidance LEC

Mathess et al., 2005 North 33 682 46 391 North-central -11 431 20 468 Centre -64 384 14 026 South -91 806 (1)cfa = Franc of the African Financial Community (€1 = 655.96 cfa) (2)MARI = Margin After Repayment of Inputs

Faced with the importance of resistance, Togo, that abandoned the LEC programme in 2000, adopted a ‘reinforced programme’. Special scouting for H. armigera is systematically conducted six days after the five treatments (northern region) or six treatments (southern region) of the conventional calendar programme.

Between 2000 and 2002 in Ivory Coast, the Ivoire Coton company adopted a programme that used thresholds only during the first protection window (Tab. 2). From 2009, the same company has been using this strategy within the scope of the ‘COMPACI’ project (Ochou and Amon, 2010). The programme uses thresholds only This covers the first two application dates in the calendar programme (‘conventional’). Following this, the calendar programme is followed. The explanation for this is the presence of endocarpic caterpillars, which are difficult to control with insecticide applications.

In contrast, for its crops grown in Burkina Faso, the Faso Coton company has decided to employ a programme based on thresholds but only after two first treatments in a predefined calendar programme (Leynaert, 2010).

Mali followed the logic set in motion through its adoption of an initial LEC programme and by 2008 had implemented a programme of treatments decided on sensu stricto thresholds (SST). With this programme, there is no longer a ‘basic programme’ of insecticide applications. The decision to spray is taken only after the passing of defined thresholds, which remain the same as those in the LEC programme (Tab. 1). However, it is clearly defined for economic reasons that the interval between two consecutive treatments must be no less than 14 days. In 2008, Mali implemented 14,000 hectares of cotton land with LEC programme, 52,000 hectares with the SST programme, while the preset calendar or ‘conventional’ programme was performed on 112,000 hectares. Therefore, programmes using thresholds represented 37% of the area devoted to cotton production.

In Benin, two forms of the programme adapted to the two regions, ‘LEC complete’ (north) and ‘LEC partial’ (south), have evolved during the development of the Projet d’Amélioration et de Diversification des Systèmes d’Exploitation (improvement and diversification of growing systems project) (Prudent et al.. 2006). A total area of 17,000 hectares was managed under LEC in 2009, representing nearly 12% of Benin’s total cotton area.

In 2006, after studies by Nibouche et al. (2003b) and Beyo et al. (2004), Cameroon opted for a protection programme called ‘LOIC’ (Lutte après Observation Individuelle des Chenilles) or ‘SPID’ (Sequential Plan for Individual Decision). This programme uses sequential sampling on individual bollworms. It therefore does not include the counting of leaf-eating caterpillars and aphids or their damage. This simplified observation method for pests was adopted by 2,195 growers in 2009, representing 1,170 hectares of cotton crops (less than 1% of the total surface area).

There has been a marked diversification in the cotton protection programmes using thresholds over the past 10 years. They are more fully detailed below.


Sampling of Plants, Pests and Decision-Making Procedures

The sampling procedures are very similar in each country, with the exception of Cameroon which has opted for sequential sampling.

For all the countries, observation field by field and the decision to spray (or not to spray) concern only the field under observation. Treatment by crop ‘block’, which used to be conducted in Cameroon, is no longer possible everywhere because of the presence of other crops in these ‘blocks’.

The number of plants observed in Cameroon varies according to the results obtained as scouting in the field continues. A maximum of 25 plants is analyzed per area of 0.25 hectares. For the other countries, between 25 and 40 plants are observed. They are chosen individually at random (therefore not next to each other in the same row), in general following one or two diagonals. Their observation is completed and damage or pest presence is noted, at a minimum, for bollworms (H. armigera, D. watersi, Earias spp.), leaf-eating caterpillars (H. derogata, A. flava, S. littoralis) and the aphid A. gossypii. The threshold levels leading to the decision to spray vary according to the country (Tab. 1 and 2). For example, the threshold of three caterpillars of H. armigera per 30 observed cotton plants is used in Togo to decide if treatment is needed against this pest (Tab. 1). This threshold is 5 larvae for 40 observed plants in Benin. In other countries, all the exocarpic larvae are considered together. Mite (Polyphagotarsonemus latus) damage is also taken into account in Ivory Coast and Benin (Tab. 1). Leafhoppers (Cicadellidae) are taken into account only in the Côte d’Ivoire and the Bemisia tabaci whitefly in Burkina Faso (Tab.2). In the latter country, following the introduction of Bt cotton plants, there are no specific thresholds used for bugs (Pentatomidae, Pyrrhocoridae or Miridae) which represent an important group in West African growing systems (Poutouli et al., 2011).

For easier record keeping in the field, various types of pegboards have been created for LEC programmes in each country. An original pegboard was specially created for the LOIC programme in Cameroon, which uses the sequential sampling technique (Beyo et al., 2004).

Active Ingredients, Dosage and Spraying Technique

The first protection window (W1) no longer includes pyrethroids. The two treatments in the first window (Tab. 2) are designed to control the first caterpillars of H. armigera. The active ingredients are used in ‘conventional’ programme doses, sometimes described as ‘full doses’. In some countries, such as Cameroon and Mali, this family of insecticides is not recommended in the third protection window either (Tab. 2). Following this, in Burkina Faso, there is no reduction in the dose and the products used are binary associations of pyrethroids (against caterpillars) and organophosphorous insecticides aimed at aphids, whiteflies and mites (Leynaert, comm. pers.) or neocicotinoid. In Mali’s LEC programme, from the second protection window products based on the binary association of pyrethroids-organophosphorous insecticides are applied in half doses (compared to the ‘full dose’). Similarly, in Benin, the doses of the last four applications are reduced. They are conducted using a combination of cypermethrin and triazophos (SHERPHOS® 370 or 320 EC depending on the region, north or south). For additional applications, based on thresholds, and according to the country, simple or combined products are used. In Benin, if the mite threshold is exceeded, triazophos (HOSTATHION® 400) should be applied at the rate of 200ml/ha (in the north) or 300ml/ha (in the south). For bollworms, aphid and H. armigera thresholds, the products used can be respectively CYPERCAL® 87.5 EC (cypermethrin) at 200ml/ha, GAZELLE ® 200 SL (acetamiprid) at 40ml/ha and LASER ® 480 SC (spinosad) at 100ml/ha.

In Togo, the principle of alternating active ingredients is followed. In the northern area, for example, the active ingredient used for the ‘reinforced’ treatment against H. armigera is different to that used for the first two treatments in the calendar. However, the choice of active ingredients beyond pyrethroids remains limited. Endosulfan, which was originally used, was prohibited in 2009 for toxicological


reasons. Spinosad, an active ingredient recognized as being efficient for the control of H. armigera, is not generally used because of its cost. Products such as indoxacarb (AVAUNT® 150 SC) or organophosphorous ingredients such as profenofos (CALFOS® 720 EC) are available and used alone (Tab. 3). In Burkina Faso, profenofos has been used at only 500g/ha rather than 720g/ha (used in Togo). Emamectin benzoate could also be used on its own at 9.5g/ha in the next future (Leynaert, comm. pers.). In the case of Cameroon (Prudent, comm.. pers.), there are no thresholds used to control aphids or whiteflies. The treatment decision is taken by the producer and the agent who supports him when they judge that the infestation is too large. A neonicotinoid, acetamiprid, is applied at 10g/ha against aphids or 20g/ha against whiteflies.

The widespread spraying technique is to use a volume of 10 litres of fluid per hectare (Very Low Volume). The operator passes through every third row (0.80m between rows) with a sprayer which has a rotary disc from, for example, the Berthoud company (model C5-10®, equipped with a green nozzle, in Togo) or MicronSprayer (from MicroUlva® with a black nozzle, in Togo, or Ulva Plus®, in Mali and Cameroon). These devices have a reservoir which is carried on the back of sufficient capacity (10 litres). This technique uses the wind to help spread the toxic mixture (water plus insecticide) which always carries an increased risk of contamination for the operator, especially when the wind changes direction during spraying.

ADVANTAGES OF THRESHOLD-BASED PROGRAMMES

In French sub-Saharan Africa the main advantages expected for protection programmes using thresholds (‘threshold programmes’) are economic, combining a reduction in the insecticide use, number of applications or quantity and increase of yields.

Insecticide Reduction

When pest pressure is low, programmes using sensu stricto thresholds, such as in Mali and Cameroon, lead to a reduction in the number of treatments. For example, in Cameroon the LOIC programme, tested over 2,000 hectares in 2006 and 2007, led to a reduction in the number of sprays in five of the 17 villages that were monitored (Brévault et al., 2009). In 2008, the farmers who adopted this programme carried out less insecticide treatments than other growers and their average cottonseed yields were no lower (Bertrand et al., 2010).

But the application of thresholds does not always lead to a reduction of all insecticide used. In Togo in 1995, before the implementation of the current ‘reinforced’ programme, 50% savings in cypermethrin were noted by Ayeva and Agossou (2000) with, however, additional use of chlorpyrifos-ethyl to control infestations of the leaf-eating caterpillar H. derogata.

Yield Increase

When reducing the number of applications and the volume of insecticides used, there is often an increase in average yields in fields which are protected by threshold programmes. This increase in yield, which could in part be due to closer monitoring in the fields, is dependant on the weather and agronomic conditions. In Mali in 2010, an average yield of 833kg of seed cotton per hectare was achieved with the application of sensu stricto application thresholds, whereas it was 1,051kg two years earlier. In Cameroon in 2009, a comparison of the ‘conventional’ and ‘LOIC’ programmes on 266 producers’ fields showed a gain of 259kg/ha of cottonseed in favour of the latter programme (Gautier et al., 2010).


Economic Balance

Reducing the quantity of insecticides sprayed leads to economic savings. Ayeva and Agossou (2000), in a comparison of the same 20 fields in Togo in 1995, identified a monetary saving of 30% in the costs when using LEC programmes compared to the ‘conventional’ programme. In Cameroon, Gauthier et al. (2010) identified an additional cost of 1335cfa/ha (= €2.0) with the ‘conventional’ spray programme.

Calculating margins is an analysis tool often used for comparing crop protection programmes. Thus COMPACI et al. (2010) have calculated the margins after repayment of inputs (MARI) in the case of calendar-based (‘conventional’), threshold and LEC programmes (Tab. 4).

In Benin, the Matthess et al. (2005) study concerned three programmes actually used in the country, ‘conventional’, organic cotton and LEC, and two programmes defined by ‘extrapolation’, Bt cotton and fair trade cotton. As in the case of MARI, the net margin determined by these authors was in favour of LEC programmes. The profitability of the LEC programmes in Benin is also confirmed by Prudent et al. (2006).

Ecological Impact and Human Health

Lower pollution of watercourses and air and greater conservation of the fauna which regulates pest populations are ecological advantages which have not been measured in a quantitative way. The use of indicators of environmental quality is an aspect which merits further investigation. The risk of contamination to the person applying the treatment has not generally been measured. With the possible increase in the number of passages when a threshold is reached at the end of seven days, it could be thought that the risk of contact with insecticides would increase.

MAJOR CONSTRAINTS

Transfer of Knowledge

The first constraints met are those linked to the dissemination of any innovation among smallholders. Communicating in local languages concepts such as the management of insecticide resistance and thresholds may present translation problems (Tourneux, 2003). The coexistence of several protection programmes within the same country, or a new parameter to consider, and several production chains (organic cotton, fair trade cotton) can further complicate the task of disseminating these programmes to small growers.

The major constraint is the lack of knowledge of observers on the biology and ecology of Arthropods (Sinzongan et al., 2004), on sampling techniques and on spotting and identifying problems associated to pests and their damage, plant diseases and mineral deficiencies. Besides field diagnostic tools such as pegboards, audio-visual tools and booklets identifying problems are generally available to personnel who are trained. Beneficial insects (natural enemies of damage-causing insect pests) are also detailed. Observers are members of farmers’ associations. Some, such as those in Mali, are qualified ‘neo-literates’ and are part of a programme to eliminate illiteracy.

Knowledge about pesticides and spraying equipment is sometimes deficient (Sougnabe et al., 2010), including the risks relating to their use and guidelines for protecting the user, linked with the problem of interpreting symbolic messages such as the warning pictograms on bottles (Tourneux, 1993). The option of creating rural schools, proposed by Ochou et al. (1998a,c), or Champs-Ecoles des Producteurs (CEP), equivalent to Farmer Field Schools (FFS), offering participative training, have been developed in the sub-regional GIPD programme (Gestion Intégrée de la Production et des Déprédateurs, integrated management of production and pests) in Mali, Benin, Burkina Faso and Senegal (COS-Coton, 2011). But this approach is considered as too expensive (Treen & Burgstaller, 2003).


Compliance with Threshold Principles

Independent of the adoption of threshold protection programmes, the economic crisis of the cotton chains in cotton-producing countries have led to a reduction in the acreages dedicated to cotton growing over the past few years. Investigations carried out within farmers’ associations have shown that official recommendations are not strictly applied, with frequent under-dosing of plant protection products for economic reasons (Sinzongan et al., 2004) or the inappropriate use of insecticides on other crops such as cowpea (Vigna unguiculata) and tomato (Sougnabe et al., 2010). Given this context, the increase in the number of treatments reported in Benin by Williamson et al. (2008) appears difficult to interpret.

Strict compliance with recommendations is difficult to obtain for several reasons. Prudent et al. (2007) have shown, for example, in Benin that planters who have learned LEC techniques find it difficult to remember the methods a few years after training. The complexity of the observations which have to be carried out have been mentioned by Sinzogan et al. (2004). Another constraint is the necessity of conducting weekly observations. Finally, instances of under-dosage, or non-application of insecticide, despite a threshold being reached, are sometimes seen. The opposite is true too, with cases reported of treatments being carried out even if the defined threshold has not been reached.

Economic Benefits

At the producer level, the job of observation in the field may be given to paid observers. In Togo, for example, where an observer carried out the job in 10 fields in 1995, the payment was 100 cfa (= €0.15) per observation and per field. The payment for this service, when carried out by a third party like this, is a limitation very often mentioned by owner-producers. Another cost mentioned by producers is for the management of the insecticides that have not been used for threshold treatments. This cost has sometimes been included in the purchase price of products destined for producers wanting to apply LEC programmes, but this ‘discriminatory’ policy has triggered complaints from the producers involved. Packaging in 15 litre containers is a handicap in Cameroon because each drum opened and not completely used must still be paid for.

There are also economic constraints to be considered at the organisational level. The cost of ‘cascade’ or ‘stepped’ training is never mentioned. In the programme offered in the Côte d’Ivoire, for example, National Research (CNRA) has to train 205 extension officers, who in turn train 500 ‘producer-instructors’ who in turn train 1,500 producers. As a result of this, by 2012 it is forecast that in three years 1,500 ‘producer-instructors’ and 500 LEC producers will have been trained (Ochou and Amon, 2010). And yet this training represents a major effort and investment for a number of extension staff (Bertrand et al., 2010).

CONCLUSION

In French-speaking sub-Saharan Africa, the current situation for cotton protection programmes using action thresholds reveals a great variation from one country to another. All the same, their development over significant acreages in some countries provides a measure of the interest shown in this type of programme by both producers and the organisations which provide them with technical and financial assistance. The multiplicity of the programmes offered is sometimes, but not always, linked to an ecological reality. For example, in those regions with endocarpic Lepidopteran species (southern Benin, Togo and the Côte d’Ivoire) it is more difficult to envisage the application of thresholds. For cost reasons, there is no general monitoring of adult populations of Thaumatotibia leucotreta or Pectinophora gossypiella with sexual pheromones, and producers are reluctant to destroy green cotton bolls to evaluate the presence of these pests. Furthermore, the ‘rosetted bloom’ damage caused by P. gossypiella does not allow an action threshold to be established. The situation for these pests therefore remains unchanged since the studies presented by Vaissayre (1994).


An increase in this diversity of protection programmes is a reasonable perspective, linked with new projects under development financed by external institutions (for example, COMPACI, Cotton made in Africa, Better Cotton Initiative). The GIPD programme, which is under development in Mali, is the only project until now which seeks to take natural enemies into consideration through the calculation of target pest/natural enemy ratios, such as those offered in Australia, albeit in a very different context. Producers’ knowledge of these beneficial aids to crop production is often limited (Prudent et al., 2007) and a special effort will have to be made in terms of training.

A simplification of the numerous existing threshold-based protection programmes, logically oriented by an ecological and a regional analysis would probably be more satisfactory for a better diffusion among smallholders, and consequently, for a reduction of costs. It will need the development of a network involving researchers, growers, and all the actors of the production chain. For a large scale monitoring of the impact of these new programmes, the contribution of producers will be essential.

A future challenge will be posed to pest management in countries which adopt or will adopt transgenic resistant cotton to Lepidoptera. Until now, only Burkina Faso has very recently grown genetically modified (GM) cotton over large acreages. According to the available information (Leynaert, 2010, COS-Coton, 2011), the first four treatments in the ‘conventional’ programme were eliminated, while the two applications at the end of the cycle were maintained, to control biting and sucking insects. Research is continuing to evaluate the impact on non-targeted fauna, particularly bugs, and, with National Research, adjustments are being made to the protection programme. In this context, definition of thresholds for likely-emerging pests, as Mirids or Pentatomids bugs observed in other countries for example, will be very useful.

Thus, the challenge is to develop a more theoretical approach for a better definition of threshold - than the empirical one applied in many cases – and at the same time, to succeed by a participative way of extension and field application of the threshold, with a clear message, a good management of inputs and a collective evaluation of the economical benefits of threshold-based programmes.

ACKNOWLEDGEMENT

The authors would like to thank the cotton companies who were willing to provide the agricultural statistics used in this article and in particular Mr Paul Asfom (Sodecoton, Cameroon), as well as Mr Marc Leynaert (Faso Coton, Burkina Faso) for the technical information pertinent to this country.

REFERENCES [1] Achaleke, J. and Brévault, T. (2010) - Inheritance and stability of pyrethroid resistance in the cotton bollworm Helicoverpa

armigera (Lepidoptera: Noctuidae) in Central Africa. Pest Manag. Sci. 66 : 137-41. [2] Ayeva, B. and Agossou, Y. (2000) - La lutte étagée ciblée au Togo : bilan et perspectives. In : Réunion phytosanitaire de

l’Afrique de l’Ouest et du Centre, Lomé, Togo, 22-25 février 2000, 242 -254. [3] Bertrand, A., Brevault, T., Theze, M. and Vaissayre, M. (2010) - De la LEC à la LOIC. Comment aider les paysans à

prendre en charge la protection phytosanitaire de leurs parcelles de coton ? In : Seiny-Boukar L., Boumard P. (Eds.) Actes du colloque « Savanes africaines en développement : innover pour durer », 20-23 avril 2009, Garoua, Cameroun. Prasac, N’Djaména, Tchad ; CIRAD, Montpellier, France, 12p.

[4] Beyo, J., Nibouche, S., Gozé, E. and Deguine, J.-P. (2004) - Application of probability distribution to the sampling of cotton bollworms (Lepidoptera: Noctuidae) in Northern Cameroon. Crop Prot. 23, 1111 - 17.

[5] Brévault, T., Achaleke, J., Sougnabé, S.P. and Vaissayre, M. (2008) - Tracking pyrethroid resistance in the polyphagous bollworm, Helicoverpa armigera, in the shifting landscape of a cotton-growing area. Bull. Entomol. Res. 98: 565-73.

[6] Brévault, T., Couston, L., Bertrand, A., Thézé, M., Nibouche, S. and Vaissayre, M. (2009) -Sequential pegboard to support small farmers in cotton pest control decision-making in Cameroon. Crop Prot. 28: 968-73.

[7] COMPACI, CmiA and UdC. (2010) -Proceedings of the workshop: “Exchange of experiences in promoting integrated crop protection in coton production”, 31/05- 03/06/2010, Hôtel Dako 1er, Bohicon, Benin.

[8] COS-Coton (2011) - Mise à jour relative au partenariat Union Européenne-Afrique sur le coton. Document du Comité d’orientation et de suivi du partenariat UE-Afrique sur le coton, mai 2011, 96p.

[9] Djihinto A., Katary A., Prudent P., Vassal J.-M. and Vaissayre, M. (2009) - Variation in resistance to pyrethroids in Helicoverpa armigera from Benin Republic, West Africa. J. Econ. Entomol. 102, 1928-34.

[10] Gautier, C., Saïbou, M. and Prudent, P. (2010) - Rapport annuel d’activité. Lutte sur Observation individuelle des chenilles de la capsule du cotonnier. Campagne 2009/2010. CIRAD (non publié), 60 p.


[11] Héma, O., Somé, H.N., Traore, O., Greenplate, J. and Abdennadher M. (2008) - Efficacy of transgenic cotton plant containing the cry1Ac and cry2Ab genes of Bacillus thuringiensis against Helicoverpa armigera and Syllepte derogata in cotton cultivation in Burkina Faso.Crop Prot. 28: 205-14.

[12] Houndété, T.A., Kétoh, G.K., Hema, O.S.A., Brévault, T., Glitho, I.A. and Martin, T. (2010) - Insecticide resistance in field populations of Bemisia tabaci (Hemiptera: Aleyrodidae) in West Africa. Pest Manag. Sci. 66: 1181-1185.

[13] Kranthi K.R. and Russell D.A. (2009) - Changing trends in cotton pest management. In: Integrated pest management: Innovation-development process. R. Peshin, A. K. Dhawan (Eds), Springer Netherlands, 499-541.

[14] Kranthi K.R. and Kranthi S. (2010) - Cotton insect pests and their control in the 21st Century. In: Cotton: technology for the 21st Century, Ph.J. Wakelyn & R. Chaudhry (Eds.), International Cotton Advisory Committee, 99-122.

[15] Leynaert, M. (2010) - In: Exchange of experiences in promoting integrated crop protection in cotton production. Workshop, 31/05 – 03/06, Hôtel Dako 1er, Bohicon, Benin.

[16] Martin, T., Ochou, O.G., Djihinto, A., Traore, D., Togola, M., Vassal, J.-M., Vaissayre, M. and Fournier, F. (2005) - Controlling an insecticide-resistant bollworm in West Africa. Agriculture, Ecosys. Environ. 107: 409-411.

[17] Martin, T., Ochou, O.G., Vaissayre M. and Fournier, D. (2002) - Monitoring of the insecticides resistance in Helicoverpa armigera (Hubner) from 1998 to 2002 in Côte d’Ivoire, West Africa. Proceedings of the World Cotton Conference - 3, Cape Town, South Africa, March 9-13, 1061 - 1067.

[18] Matthess, A., van den Akker, E., Chougourou, D. and Midingoyi, S. Junior. (2005) - Le coton au Bénin: Compétitivité et durabilité de cinq systèmes culturaux cotonniers dans le cadre de la filière. Eschborn, Germany: GTZ (Deutsche Gesellschaft für Technische Zusammenarbeit), 206p.

[19] Nibouche, S., Beyo, J., Djonnewa, A., Goipaye, I., Yandia, A. (2003a) - La lutte étagée ciblée a-t-elle un avenir en Afrique centrale? In: Jamin, J.Y., Seiny Boukar, L., Floret, C. (Eds.), Savanes africaines: des espaces en mutation, des acteurs face à de nouveaux défis. Actes du colloque, Garoua, Cameroun, 27–31 mai 2002. CIRAD, Montpellier, 9p.

[20] Nibouche, S., Beyo, J. and Gozé, E. (2003b) - Mise au point de plans d’échantillonnage pour la protection sur seuil contre les chenilles de la capsule du cotonnier. In: Jamin, J.Y., Seiny Boukar, L., Floret, C. (Eds.), Savanes africaines: des espaces en mutation, des acteurs face à de nouveaux défis. Actes du colloque, Garoua, Cameroun, 27–31 mai 2002. CIRAD, Montpellier, 5p.

[21] Ochou, O.G. and Amon, B.P. (2010) - La protection du cotonnier sur seuil en Côte d’Ivoire – Phase I. In: Exchange of experiences in promoting integrated crop protection in cotton production. Workshop, 31/05 – 03/06, Hôtel Dako 1er, Bohicon, Benin.

[22] Ochou, O.G., Martin, T. and Hala, N.F. (1998a) - Cotton insect pest problems and management strategies in Côte d’Ivoire, W. Africa. Proceedings of the World Cotton Conference - 2, Athens, Greece, September 6-12, 1989, pp. 833 - 837.

[23] Ochou, G.O., Matthews, G.A. and Mumford, J.D. (1998b) - Comparison of different strategies for cotton insect pest management in Africa. Crop Prot. 17: 735-741.

[24] Ochou, G.O., Matthews, G.A. and Mumford, J.D. (1998c) - Farmer’s knowledge and perception of cotton insect pest problems in Côte d’Ivoire. Int. J. Pest Mgmt. 44: 5-9.

[25] Peshin, R., Bandral, R.S., Zhang, W., Wilson, L. and Dhawan A.K. (2009) - Integrated pest management: A global overview of history, programs and adoption. In: Integrated pest management: Innovation-development process. Ed. by R Peshin, A K Dhawan, Springer Netherlands, 1-49.

[26] Poutouli, W. Silvie, P. and Aberlenc, H.-P. (2011) - Phytophagous and predatory Heteroptera in West Africa. CTA & Quae (eds.), 80 p.

[27] Prudent, P., Midingoyi, S.-K., Aboua, C. and Fadoegnon, B. (2006) - La lutte étagée ciblée (LEC) pour une production durable du coton. INRAB, Bénin, Ed. GTZ (ProCGRN),105 p.

[28] Prudent, P., Loko, S., Deybe, D. and Vaissayre, M. (2007) - Factors limiting the adoption of IPM practices by cotton farmers in Benin : a participatory approach. Expl. Agric. 43 : 113-24.

[29] Silvie, P. (1990) - Mussidia nigrivenella Ragonot (Pyralidae, Phycitinae) : un ravageur mal connu du cotonnier. Coton et Fibres Tropicales 45 : 323-33.

[30] Silvie, P. Deguine, J.-P., Nibouche, S., Michel, B. and Vaissayre, M. (2001) -Potential of threshold-based interventions for cotton pest control by small farmers in West Africa. Crop Protection 20, 297-301.

[31] Sinzogan, A.A.C., Van Huis, A., Kossou, D.K., Jiggins, J. & Vodouhé, S. (2004) - Farmer’s knowledge and perception of cotton pests and pest control practices in Benin. Wageningen Journal of Life Sciences 52: 285-303.

[32] Sougnabe, S.P., Yandia, A., Acheleke, J., Brévault, T., Vaissayre, M. and Ngartoubam, L.T. (2010) - Pratiques phytosanitaires paysannes dans les savanes d’Afrique centrale. In : Seiny-Boukar L., Boumard P. (Eds.) Actes du colloque « Savanes africaines en développement : innover pour durer », 20-23 avril 2009, Garoua, Cameroun. Prasac, N’Djaména, Tchad; CIRAD, Montpellier, France, 13p.

[33] Stern, V.M., Smith, R.F., Van den Bosch, R. and Hagen, K.S. (1959) - The integrated control concept. Hilgardia 29: 81-99. [34] Traore, O., Denys, S., Vitale, J., Traore, K. and K. Bazoumana K. (2008) - Testing the Efficacy and Economic Potential of

Bollgard II under Burkina Faso Cropping Conditions. J. Cotton Sci. 12, 87–98. [35] Tourneux, H. (1993) - La perception des pictogrammes phytosanitaires par les paysans du Nord-Cameroun. Coton et Fibres

Tropicales 48 : 41-48. [36] Tourneux, H. (2003) - Communiquer avec les paysans dans les savanes d'Afrique centrale. In: Jamin, J.Y., Seiny Boukar,

L., Floret, C. (Eds.), Savanes africaines: des espaces en mutation, des acteurs face à de nouveaux défis. Actes du colloque, Garoua, Cameroun, 27–31 mai 2002. CIRAD, Montpellier, 4p.


[37] Treen, A.J. and Burgstaller, H. (2003) - Cotton IPM. Research success and field disappointment: why are implementation projects not succeeding? Proceedings of the World Cotton Research Conference-3. Cape Town, South Africa, March 9-13, 1001 - 6.

[38] Vaissayre, M. (1994) - Ecological attributes of major cotton pests: implications for management. Proceedings of the World Cotton Research Conference-1. Brisbane, Australia, February 14-17, 499 - 510.

[39] Vaissayre, M., Martin, T. and Vassal, J.-M. (1998) - Pyrethroid resistance in bollworm Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) in West Africa. Proceedings of the World Cotton Research Conference-2. Athens, Greece, September 6-12, 701-5.

[40] van Huis, A. (2009) -Challenges of integrated pest management in sub-saharan Africa. In: Integrated pest management: Dissemination and impact. Ed. by R Peshin, A K Dhawan, Springer Netherlands, 395-417.

[41] Williamson, S., Ball, A. and Pretty, J. (2008) - Trends in pesticide use and drivers for safer pest management in four African countries. Crop Prot. 27: 1327-34.

Can Natural Refuges Delay Insect Resistance to Bt Cotton

Brévault Thierry1,2, Nibouche Samuel3, Achaleke Joseph4 and Carrière Yves2 1CIRAD, UPR 102, F-34398 Montpellier, France

2Department of Entomology, University of Arizona, Tucson, AZ, USA 3CIRAD, UMR PVBMT, F-97410 Saint-Pierre, La Réunion, France

4IRAD, PRASAC-ARDESAC, Garoua, Cameroon

Abstract—Non-cotton host plants without Bacillus thuringiensis (Bt) toxins can provide refuges that delay resistance to Bt cotton in polyphagous insect pests. It has proven difficult, however, to determine the effective contribution of such refuges and their role in delaying resistance evolution. Here we used biogeochemical markers to quantify movement of Helicoverpa armigera moths from non-cotton hosts to cotton fields throughout the cropping season, in three agricultural landscapes of the West African cotton belt (Cameroon) where Bt cotton was absent. We show that the contribution of non-cotton hosts as a source of moths was spatially and temporally variable, but at least equivalent to a 7.5% sprayed refuge of non-Bt cotton. Simulation models incorporating H. armigera biological parameters, however, indicate that planting non-Bt cotton refuges may be needed to significantly delay resistance to cotton producing the toxins Cry1Ac and Cry2Ab. Specifically, when the concentration of one toxin (here Cry1Ac) declined seasonally, resistance to Bt cotton occurred rapidly when refuges of non-Bt cotton were rare, because resistance was essentially driven by one toxin (here Cry2Ab). The use of biogeochemical markers to quantify insect movement can provide a valuable tool to evaluate the role of non-cotton refuges in delaying the evolution of H. armigera resistance to Bt cotton.

Cotton is widely grown in West Africa, where it helps sustain millions of resource-poor farmers and rural communities. Transgenic cotton producing the Bacillus thuringiensis (Bt) toxins Cry1Ac and Cry2Ab was recently introduced to Burkina Faso (1) to increase agricultural profitability. Such Bt cotton is called “pyramid” because it produces two distinct Bt toxins active against some pest species (2-5). Management of insect resistance to Bt crops requires production of abundant susceptible individuals in refuges of non-Bt host plants that disperse and mate with the rare resistant survivors in Bt fields (2-5). Because the most important insect pest of cotton in West Africa, Helicoverpa armigera, is polyphagous and highly mobile (6, 7), non-cotton host plants could reduce the reliance on refuges of non-Bt cotton to delay resistance. While some studies have evaluated production of H. armigera by non-cotton host plants elsewhere (8-11), movement of moths from non-cotton hosts to cotton fields has never been quantified in space and time. Nevertheless, it is often assumed that cotton refuges are not required to delay H. armigera resistance to Cry1Ac/Cry2Ab cotton in agroecosystems where small fields of diversified crops and patches of non-cultivated hosts are close together (10), such as in West Africa.

We used biogeochemical markers to measure movement of H. armigera moths from non-cotton hosts to cotton fields in Cameroon (in the West African cotton belt). A total of 18 moth collections were taken from pheromone traps in cotton fields from June to November 2006 at three locations (Guider, Djalingo, and Tcholliré). Larval host plants were identified by analyzing moths’ abdomens for gossypol (a phytochemical present in cotton) and wings for stable carbon isotope ratio. We categorized plants as cotton, non-cotton C3 plants (e.g., weeds such as Cleome spp. and Hyptis sp.), and C4 plants (e.g., corn).

Most moths trapped early in the growing season (June-July) had signatures of C3 and C4 non-cotton plants (Fig. 1a-c). The few gossypol-positive moths detected at that time likely originated from overwintering pupae and possibly from early-planted cotton or cotton left in fields from the previous growing season. When the first moth generation emerged from cotton (August), most moths had signatures of C3 and C4 non-cotton plants (Fig. 1a-c). The contribution of non-cotton refuges to the pool of moths trapped in cotton fields decreased during the second (September) and third (October) generations, particularly at Djalingo, and to a lesser extent Tcholliré and Guider. At cotton harvest (November), most moths originated from non-cotton C3 plants at Djalingo and Tcholliré, whereas moths

41


from cotton still contributed significantly to the pool of moths at Guider (Fig. 1a-c), where cotton is usually harvested a few weeks later.

Fig. 1: (a-c). Moths Trapped in Cotton Fields (%) that Originated from Non-cotton Host Plants. Remaining Moths (100 – % Indicated by bar) Originated from Cotton. Moths were Trapped at Three Locations (Guider, Djalingo, and Tcholliré) in Cameroon in 2006.

(d) Typical Sequence of Helicoverpa Armigera Host Plants in the West Africa Cotton Belt Throughout the Cropping Season. Curves Represent Temporal Occurrence and Relative Area of Host plants.

We used a two-locus population genetics model incorporating empirical estimates of H. armigera biological parameters to evaluate how movement from non-cotton refuges may affect the evolution of resistance to Cry1Ac/Cry2Ab cotton at each of the three locations. The model considered the seasonal decline in mortality of a strain resistant to Cry2Ab on Cry1Ac/Cry2Ab cotton (12), which paralleled the decline in Cry1Ac concentration generally observed in Bt cotton during the course of the growing season (5, 13). Such reduction in mortality of Cry2Ab-resistant insects on Cry1Ac/Cry2Ab cotton invalidates one of the fundamental assumptions of the pyramid strategy, i.e., the killing of insects resistant to one toxin by the other toxin, and thus could accelerate resistance evolution (2-5, 14).

Seasonal declines in Cry1Ac-induced mortality and more stable Cry2Ab-induced mortality necessarily generates stronger selection for resistance to Cry2Ab than Cry1Ac. Simulations showed that the evolution of resistance was primarily driven by Cry2Ab resistance alleles, as the initial resistance allele frequency and the dominance of Cry1Ac resistance had little effect. Among-site variability affected the role of non-cotton refuges in delaying resistance evolution (Fig. 2a,b). With partially recessive resistance to Cry2Ab (DLC = 0.1) and initial resistance allele frequency of 0.0033 to Cry2Ab, non-cotton refuges delayed resistance ≥32 years at Guider, ≥16 years at Tcholliré, and ≥8 years at Djalingo (Fig. 2a). With partially recessive resistance to Cry2Ab (DLC = 0.1) and higher initial resistance allele frequency of 0.033 to Cry2Ab, however, resistance evolution was faster and non-cotton refuges delayed resistance ≥17 years at Guider, ≥9 years at Tcholliré, and ≤6 years at Djalingo (Fig. 2b). With higher dominance of Cry2Ab resistance (DLC = 0.3 or 0.5), sprayed refuges of 20% non-Bt cotton in addition to non-cotton refuges delayed resistance ≥8 years at Guider, ≤11 years at Tchollire´, and ≤8 years at Djalingo (Fig. 2b). In a worst-case scenario with an initial resistance frequency of 0.033 and semi-dominant resistance to Cry2Ab (DLC = 0.5), sprayed refuges of 50% non-Bt cotton delayed resistance 15 years at Guider, 8 years at Tcholliré, and 6 years at Djalingo (Fig. 2b).

Can Natural Refuges Delay Insect Resistance to Bt Cotton 257

Fig. 2: Effect of the Abundance of Sprayed Refuges of Non-Bt cotton (%) on the Evolution of Helicoverpa Armigera Resistance to Cry1Ac/Cry2Ab Cotton at three Locations (Guider, Djalingo, and Tcholliré) in Cameroon. For Cry2Ab, the Initial Resistance Allele Frequency Was 0.0033 (a) or 0.033 (b), and Resistance was Partially Recessive (DLC = 0.1, Dashed line) or semi-Dominant (DLC = 0.5, Solid Line). For Cry1Ac, the Initial Resistance Allele Frequency

was 0.0003 and Resistance was Partially Recessive (DLC = 0.3). The Criterion for Resistance Evolution was >20% Survival on Bt Cotton

Our seasonal assessment of H. armigera movement shows that non-cotton refuges were equivalent to ≥7.5% non-Bt cotton refuges treated with insecticides throughout the cotton-growing season (Fig. 1b). Despite the important but temporally and regionally variable moth contribution from non-cotton hosts to putative Bt cotton fields, our modeling results show low efficacy of the pyramid strategy when the concentration of Cry1Ac declines during the growing season, resistance to Cry2Ab is non-recessive, and only non-cotton refuges are available. Under the first two conditions, refuges of non-Bt cotton would be needed to significantly delay resistance, unless high sustained movement from non-cotton refuges to cotton fields occurs during the growing season (e.g., Guider), or long-range migration is more important northward than southward. More generally, we demonstrate that biogeochemical markers provide a basis to evaluate the role of a variety of refuges in delaying the evolution of resistance to Bt crops in polyphagous insect pests. Such markers will be useful to assess the role of non-cotton hosts in delaying H. armigera resistance to Bt in Burkina Faso and other West African countries that may adopt Bt cotton.

REFERENCES [1] C. James, ISAAA Briefs 39, 129-132 (2008). [2] B.E. Tabashnik et al., Nat. Biotechnol. 26, 199-202 (2008). [3] B.E Tabashnik. et al., J. Econ. Entomol. 102, 2011-2025 (2009). [4] F. Gould, Annu. Rev. Entomol. 43, 701-726 (1998). [5] A.M. Showalter et al., J. Insect Sci. 9, 1-39 (2009). [6] T. Brévault et al., Bull. Entomol. Res. 98, 565-573 (2008). [7] J.M. Vassal et al., Comm. Appl. Biol. Sci., 73, 433-437 (2008). [8] W.M. Green et al., Afr. Entomol. 11, 21-29 (2003). [9] K.C. Ravi et al., Environ. Entomol. 34, 59-69 (2005). [10] K.M. Wu, Y.Y. Guo, Annu. Rev. Entomol. 50, 31-52 (2005). [11] G.H. Baker, C.R. Tann, G.P. Fitt, Aust. J. Agr. Res. 59, 723-732 (2008). [12] R.J. Mahon, K.M. Olsen, J. Econ. Entomol. 102, 708-716 (2009). [13] K.R. Kranthi et al., Curr. Sci. 89, 291-298 (2005). [14] F. Gould et al., J. Econ. Entomol. 99, 2091-2099 (2006).

Can Tomato be a Potential Host Plant for Pink Bollworm

N. Ariela1, S. Harpaz Liora2, R. Mario3, S. Roee4 and H.A. Rami3 1Israel Cotton Board, P.O.B. 384 Herzlia B' 46103 Israel;

2Northern R & D, P.O. Box 831, Kiryat Shmona–11016, Israel 3Department of Entomology, Agricultural Research Organization,

Gilat Research Center, M.P. Negev, 85280, Israel 4Department of Entomology, The Robert H. Smith Faculty of Agriculture, Food and Environment,

The Hebrew University of Jerusalem P.O.Box12, Rehovot–76100, Israel E-mail: [email protected]

Abstract—The pink bollworm (PBW), Pectinophora gossypiella (Saunders) is a major pest of cotton in Israel. Recently, processed tomatoes growers from northern Israel have reported that, suspected PBW larvae were found inside tomato fruits in the field. Since tomato (Solanum lycopersicum) has not been recorded as a host plant for the PBW, a laboratory study was conducted to find out whether PBW neonates can penetrate tomato fruits and complete a whole life cycle on them. PBW eggs were placed on tomato fruits; thereafter, some neonates penetrated the fruits and succeeded to complete a whole life cycle in tomato fruit. In another experiment, tomato plants were placed in net cages and PBW adults were introduced into the cages. Females laid eggs on the tomato plants and a few larvae developed in the fruits. These findings shed new light on the understanding of PBW host range and have implications on area wide IPM programs.

INTRODUCTION

The pink bollworm (PBW), Pectinophora gossypiella (Saunders) is the major pest of cotton in Israel; and mating disruption is a very common practice in all cotton fields (Kehat and Dunkelblum 1993, Kehat et al. 1998). During the past ten years, the pest has spread all over the country, causing a real threat to cotton growth in Israel. PBW is found mainly on cotton, although a few larvae were noticed also on other Malvaceae species such as Hibiscus sp. and Okra Recently processed tomatoes growers from northern Israel have reported that suspected PBW larvae were found inside tomato fruits in the field. As tomato (Solanum lycopersicum) has not been recorded as a host plant for the PBWs, (Shiller et al. 1962), a laboratory study was conducted to find out whether PBW neonates can penetrate tomato fruits and complete on them a whole life cycle.


Thirty ripe tomato fruits with their vines were put into plastic cups along with twenty PBW eggs placed on each fruit. The fruits were held under standard laboratory conditions of 27±2°C, 50% humidity and photoperiod of 14:10 hours light: dark conditions. Every few days the fruits were checked for larva penetration.

In another experiment, three tomato plants, each from a different variety, (Brigade, 5811, 9780) were put in net cages.

60 males and 60 females were introduced to each cage. The cages were placed on tables in outdoor conditions (summer).

After 14 days, the fruits were checked for PBW eggs and entrance holes; then, the fruits were cut into slices to find PBW larvae.

42

Can Tomato be a Potential Host Plant for Pink Bollworm 259


At the first experiment, tiny holes were found on the upper part of the tomato fruit underneath the sepal. Later on, PBW larvae were found inside the fruits feeding on flesh and seeds (figure 1).

Fig. 1: PBW Larvae Inside a Tomato Fruit

Two weeks later, exit holes and damage to fruits were detected and larvae dropped down and pupated (figure 2, 3). Adults that emerged from the pupae mated normally and laid fertile eggs. In conclusion, the PBW has succeeded to complete a whole life cycle in tomato fruit.

Fig. 2: Exit Hole of PBW

Fig. 3: Damage Made by PBW


At the second experiment with tomato plants, we found entrance holes and larvae only in the variety 9780. Penetrations of PBW larvae were detected inside just two fruits out of 25 red and green fruits that were on the plants.

The results showed that PBW not only could develop in tomato fruits but females might lay eggs spontaneously on tomato plants.

These findings shed new light on the understanding of PBW host range and have implications on area wide IPM programs.

Further choice experiments will be planned to learn whether PBW females would select and lay eggs on tomato fruits in the presence of cotton plants.

REFERENCES [1] Kehat, M, and Dunkelblum, E. 1993. Sex pheromones: Achievements in monitoring and mating disruption of cotton pests

in Israel. Arch. Insect Biochem. Physiol. 22: 425-431. [2] Kehat, M., Anshelevich, L, Gordon, D., Harel, M. and Dunkelblum, D. 1998. Evaluation of Shin-Etsu twist-tie rope

dispensers by the mating table technique for disrupting mating of the cotton bollworm, Helicoverpa armigera (Lepidoptera: Noctuidae), and the pink bollworm, Pectinophora gossypiella (Lepidoptera: Gelechiidae). Bull. Entomol. Res. 88: 141-148.

[3] Shiller, I., L. W. Noble, and L.C. Fife. 1962. Host plants of pink bollworm. J. Entomol. 55: 67-70.

Impact of IRM Strategies on Bt Cotton in Andhra Pradesh

T.V.K. Singh, N.V.V.S.D. Prasad, S. Sharma and S. Dayakar

Acharya N.G.Ranga Agricultural University, Rajendranagar, Hyderabad, India E-mail: [email protected]

Abstract—Cotton is extensively cultivated in entire Andhra Pradesh, which is one of the important agrarian states in India under diverse farming situations with high inputs. Cotton in highly vulnerable to pest attack and insect pests cause losses up to 87% in seed cotton yield (Taley et al. 1988). Among insect pests aphids [Aphis gossypii (Glover)], Leaf hopper [Amrasca biguttula biguttula (Jshida)], whiteflies [Bemisia tabaci (Genn.)], thrips [Thrips tabaci (Linde)] and boll worm complex viz., Gram caterpillar [Helicoverpa armigera (Hub.)], Tobacco caterpillar [Spodoptera litura (Boisd.)] and Pink bollworm [Pectinophora gossypiella (Saund)] are considered to be the major constraints. Excessive and indiscriminate use of insecticides in cotton has led to problems of insecticide resistance, pest resurgence, accumulation of harmful residues and toxicity to non-target organisms. This has prompted the necessity for the development of strategies for judicious management of insecticides and a window based insecticide resistance management (IRM) strategies on cotton was implemented in three districts of Andhra Pradesh viz., Guntur, Khammam and Kurnool. The strategies blend all crop production practices to incorporate proper and low use of insecticides. Natural enemy populations are least disturbed and, different groups of chemicals are alternated.

The dissemination of insecticide Resistance Management (IRM) strategies at village level by way of trainings and field visits prompted the adaptation of strategies by farmers for managing cotton pest complex on Bt cotton. To disseminate IRM strategies, a total of 165 villages were adopted in three districts from 2008 to 2011 along with 75 villages that were selected as non IRM villages for comparing the impact of IRM strategies. The adoption of IRM strategies led to reduction in pest incidence in IRM villages. Boll worm incidence was very less in IRM and non IRM villages. The population of sucking pests was less in IRM villages than non IRM villages.

The strategic positioning of insecticides coupled with ecofriendly technologies led to abundance of natural enemies in cotton ecosystem in IRM fields, while the incidence of these insects was lower in non IRM fields due to insecticidal sprays. Impact of adoption of IRM strategies resulted in the reduction in insecticidal sprays (28.84%) in IRM villages over non IRM villages. Cotton yield was higher in IRM adopted village (26.67 qt/ha) compared to non IRM villages (22.46 qt/ha). Net profit per/ha was more in IRM villages than non IRM villages. Farmers, by adopting IRM strategies realized higher net returns by saving in plant protection cost due to less number of insecticidal sprays and increased seed cotton yield.

INTRODUCTION

Cotton popularly known as “white gold” is the most important commercial crop in India and plays a vital role in agricultural, industrial, social and monetary affairs of the country. Area wise, India ranks first in global scenario (about 33 per cent of the world cotton area) but with regard to production, it is ranked next to China, which is the top producer (AICCIP,2011). The production increased from a meager 2.8 million bales (170 kg lint/bale) in 1947-48 to a high of 17.6 million bales in 1996-97 and a record of 31.5 million bales was recorded during 2007-08(AICCIP, 2008). During 2009-10, it was grown on an area of 10.3 million hectares with the production of 29.5 million bales and average lint yield of 486 kg/ha. Among cotton growing states, Gujarat leads in production with 9.8 million bales followed by Maharashtra (6.3 million bales) and Andhra Pradesh (5.2 million bales). However, the productivity of cotton in India is still far less than other cotton growing countries of the world, viz., Australia (1579 kg/ha) Brazil (1480 kg/ha), China (1301kg/ha), USA (943 kg/ha), Uzbekistan (775 kg/ha) and Pakistan (1579kg/ha) (AICCIP, 2011).

The insect pests are one of the major constraints in achieving optimum yield potential. Cotton crop harbored 1326 species of insects from sowing to maturity in different cotton growing areas of the world (Hargreaves, 1948) and 162 species have been reported on the crop in India. Among these, 9 are of utmost importance inflicting significant losses in yield. The monetary value of yield losses due to insect pests has been estimated to be Rs. 33, 9660/- million annually (Dhaliwal et al., 2010).

43


Before the introduction of Bt cotton, cotton growers were mainly using the synthetic insecticides to combat the pests. As a result, bollworms, developed resistance to almost all major classes of pesticides. Development of transgenic cotton resulted in an immense increase in seed cotton yield and reduction in insecticidal sprays (Barwale et al., 2004) and it helped the farmers to manage the population of H. armigera, the most important pest causing about 31.0 per cent loss in non-transgenic cotton (Grover and Pental, 2003). Keeping in view the above facts, the present study on impact adoption of insecticide resistance management (IRM) strategies in Bt cotton was planned to manage insect pests below economic threshold level (ETL), reduction in number of sprays, and increase the cotton yield by disseminating the IRM strategies in the adopted villages in Andhra Pradesh.

TABLE 1: DETAILS OF VILLAGES UNDER IRM AND NON-IRM IN ANDHRA PRADESH DURING 2010-11

Year Guntur Khammam Kurnool

No. of IRM Villages

No. of Non-IRM Villages

No. of IRM Villages


No. of IRM Villages


2008-09 15 2 15 15 60 15 2009-10 15 5 15 15 15 5 2010-11 10 5 10 3 10 10 TOTAL 40 12 40 33 85 30

Total IRM Villages = 165 Total Non-IRM Villages = 75


IRM module developed by CICR for Bt Cotton Pest Management was implemented for three consecutive years during 2008 to 2011 and evaluated in 165 villages in three districts viz., Guntur, Khammam and Kurnool districts of Andhra Pradesh. Seventy five villages were also selected as non IRM villages for comparing the impact of IRM strategies(Table-1). A total of 6245 farmers (Table-2) followed IRM strategies in an area of 12898.54ha during 2008 to 2011. Recommended package of practices of ANGRAU was followed (ANGRAU Panchangam, 2011). In the beginning of every year, farmers were educated about the IRM strategies. Various techniques, field days and field visits were conducted for demonstrating IRM strategies in IRM adopted villages. Literature in local language pertaining to agronomic practices, insect pests, economic threshold levels and their management strategies were distributed to farmers.

TABLE 2: DETAILS OF BENEFICIARY FARMERS AND AREA COVERED IN ANDHRA PRADESH DURING

Year Guntur Khammam Kurnool

No. of IRM Beneficiary

Farmers

Area under

IRM (ha)

Area under Non-IRM

(ha)


Farmers

Area under IRM

(ha)

Area under Non-IRM

(ha)


Farmers

Area under

IRM (ha)

Area under Non-IRM

(ha) 2008-09 737 2252.50 159.10 819 1110.50 62.10 1600 3343.56 536.20 2009-10 653 1605.20 306.20 787 1393.20 1008.00 385 565.40 128.94 2010-11 420 1026.20 360.00 544 1175.20 501.80 300 426.78 32.00 TOTAL 1810 4883.90 825.30 2150 3678.90 1571.90 2285 4335.74 697.14

IRM strategies which were implemented are as follows

Early Sucking Pests: No Foliar Spray (Till 60 Das)

• Cultivation of sucking pest tolerant genotypes (Bt or non BT) • Intercropping with cowpea, soyabean and blackgram • Eradication of weeds in and around the cotton fields • Avoidance of chlorothalonil and organophospate sprays for sucking pest control • Stem application or soil application of dimethoate or acephate at 30-40 DAS and 50-60 DAS for

control of thrips, mirid bugs, mealybugs and other sucking pests • Neem oil 2.5 lit/ha mixed with 0.1% Nirma washing soap powder

Impact of IRM Strategies on Bt Cotton in Andhra Pradesh 263

Biological and Biopesticide Window (61-90 Das) Initial Bollworm Infestation

• Verticillium lecanii to be used for sucking pest control especially for the control of mealy bugs • Cryptolaemus montrouzieri as inoculative releases on weeds or fruit crops adjacent to cotton

fields • Use of HaNPV on Bt cotton at 50% bollworm infested plants followed by the application of 5%

NSKE a week later • Not to spray against minor lepidopteran insects such as cotton leaf folder and cotton semilooper • Trichogramma can be used on non-Bt genotypes at 70-80 DAS • Not to spray Bt formulation on Bt cotton to avoid further selection pressure

Insecticide Window (91-120 Das)

• Use of spinosad or emamectin benzoate on only non-Bt cotton at ETLs of 50% infested plants. Avoid these insecticides on Bt cotton

• Use of indoxacarb only once only on non-Bt cotton for control at ETLs of 90-100% plants showing flared up squares

• Use organophospate or carbamates only once either on Bt cotton or non-Bt cotton as effective larvicides for control of bollworms at ETLs of 90-100% plants

Pink Bollworm Window (>120 Das) Pyrethroids

• ETL based spray: Eight pink bollworm moths per trap per night for 3 consecutive nights. The application of thiodicarb as late season sprays would be effective for pink bollworm management.

• Pyrethorid resistance in H.armigera is generally high, but pyrethroids are very effective against pink and spotted bollworms and are ideally suited for the late season window.

The data pertaining to cultivation of different hybrids, sowing time, different agronomic practices adopted along with the yeasrs by the individual IRM farmers was recorded and pooled.


Pests incidence: The population of leafhoppers, whiteflies, thrips, mealy bugs, tobacco caterpillar and pink boll worm remained below the ETL in all the IRM adopted villages and was significantly less than Non IRM villages (Table-3).

TABLE 3: OCCURRENCE OF INSECT PESTS AND NATURAL ENEMIES IN ANDHRA PRADESH PROJECT VILLAGES

Insects Villages Guntur* Khammam* Kurnool*

Leafhopper / 3 leaves IRM 1.43 1.62 1.33 Non-IRM 2.12 1.94 2.41

Whiteflies /3 leaves IRM 2.01 1.64 1.87 Non –IRM 2.94 2.54 2.48

Thrips / 3 leaves IRM 0.62 0.50 0.41 Non-IRM 0.83 0.76 1.14

Mealy bugs / 2.5 cm IRM 1.14 0.25 0.11 Non IRM 1.45 0.34 0.19

Tobacco caterpillar/plant IRM 0.07 0.22 0.55 Non-IRM 0.23 0.53 0.62

Pink Bollworm/plant IRM 0.12 0.02 0.09 Non-IRM 0.22 0.11 0.23

Natural enemies/plant IRM 0.68 0.61 0.63 Non-IRM 0.54 0.30 0.20

*Mean of 3 years for the entire occurrence of insecticidal pest

The strategies positioning of insecticides coupled with ecofriendly technologies lead to abundance of natural enemies in cotton ecosystem in IRM fields, while the incidence of these insects was lower in non IRM fields due to insecticidal sprays (Table-3).


Impact of IRM strategies: The IRM strategies disseminated in IRM adopted villages on no. of sprays, cost of sprays, cotton yield, gross income and net profit is presented in Table-4. The mean no. of sprays for pests was 3.74 in IRM villages and 5.41 in non IRM villages. The mean cost of sprays was higher in non-IRM villages (Rs.3230) as compared to IRM villages (Rs. 2244).

TABLE 4: IMPACT OF IRM TECHNOLOGY IN ANDHRA PRADESH

Attributes IRM Villages IRM Villages No.of Sprays 3.74 5.41 Cost of sprays (Rs) 2244 3230 Cotton yield (qt/ha) 26.67 22.46 Gross income (Rs/ha) 65264 54420 Net profit (Rs/ha) 41351 34640

The yield was also higher in villages where IRM strategies were adopted (26.67 qt/ha) over non-IRM villages (22.46 qt/ha). The grass income and net profit was more in IRM villages.

The present findings are in conformity with the results of Rajak et al., (1997) and Kranthi et al.,(2000) who reported reduction in pesticide consumption in IRM adopted villages and increase in yields.

ACKNOWLEDGEMENT

This work was funded by the Ministry of Agriculture under the Technology Mission on Cotton II through DOCD with technical support in a network mode from Director, CICR, Nagpur.

REFERENCES [1] AICCIP (2008)-All India Coordinated Cotton Improvement Project. Annual Report 2009-10, Central Institute of Cotton

Research, Regional station, Coimbatore. pp 3-5. [2] AICCIP. (2011)- All India Coordinated Cotton Improvement Project. Annual Report 2010-11, Central Institute of Cotton

Research, Regional station, Coimbatore. pp 3-5. [3] ANGRAU (2011)-Vyavasaya Panchangam ANGRAU, Hyd. [4] Barwale, R.B., Godwal, V.R., Usha, Z. and Zehr, B (2004) - Prospect for Bt cotton technology is India. AgbioForm.7: 23-6. [5] Dhaliwal, G.S., Jindal, V. and Dhawan, A.K. (2010) - Insect pest problems and crop losses: changing trends. Indian J.

Ecology 37: 1-7. [6] Grover, A. and Pental, D. (2003) - Breeding objectives and requirements for producing transgenic for the major field crops

of India. Curr. Sci. 84: 310-20. [7] Hargreaves, H. (1948) - List of recorded cotton insects of the world. Pp50. Commonwealth Institute of Entomology,

London. [8] Kranthi, K.R., Banerjee, S.K. and Russell, D. (2000) - IRM strategies for sustainable cotton pest management in India.

Pestology 24: 58-67. [9] Rajak, R.L.; Diwaker, M.C. and Mishra, M.P. (1997) - National IPM program in India. Pesticide Information 23: 23-26.

Efforts to Mitigate Stickiness Problem in Sudan

A. Abdelatif and E. Babiker

Agricultural Research Corporation, Sudan

Abstract—Stickiness is one of the limiting factors for cotton production and marketing in many countries and obliged cotton grower, worldwide, to sell their sticky cotton at lower prices. In the Sudan, research programs were carried out by Agricultural Research Corporation (ARC), addressing the causes and control measures in an attempt to find a remedy for the problem. Of these efforts manipulating the morphological and physiological characters of the cotton plant in such away to reduce the whitefly population and allow for easy biological, chemical and cultural control, resulted in developing very promising lines. In addition, identification of the type of sugar causing cotton stickiness and the establishment of reliable methods for grading cotton stickiness were developed. Stickiness research project was endorsed and financed by the Common Fund for Commodities (CFC) during 1997-2001. The objectives of the project were to develop a methodology to separate sticky from non-sticky cotton. Another objective of the project was the determination of threshold levels of stickiness for spinning under different conditions to enable the utilization of sticky cotton in spinning process.

The study revealed considerable variability in stickiness levels among the cotton production areas, and also, considerably low levels of stickiness were observed in some schemes. Cultural practices were needed where a long term improvement of stickiness free production were observed.

INTRODUCTION

Cotton “Gossypium” is the major natural textile fibre crop worldwide. In Sudan, cotton has been grown for centuries. The cotton plant is indigenous and a number of its wild relatives (members of the genus Gossypium) existed in various parts of the country.

Commercial growing of the crop, however, started in 1867. However, the big jump was in 1926, which marked the official start of functioning of the Gezira Scheme. Likewise, large production has, since the beginning, been backed by a strong research program The Agricultural Research Corporation (ARC) has an intensive program to develop new varieties, increase yield and improve quality to meet the recent demand of consumers. The bulk of the production is exported as raw fibre (90%) in a highly competitive world market. During the last three decades Sudan cotton faced strong competition in the world market. Sudan cotton suffered mainly from low yields and low quality due to contamination. Major activities of the research program addressed the yield and fibre quality problems. In recent years, however, contamination issues started to acquire their fair share in the research strategies. The main objective of this paper is to focus on efforts to mitigate stickiness in cotton, grown in the Sudan.

STICKINESS PROBLEM

Stickiness was observed in Sudan since the early 1960’s, but was sporadic at that time and of little importance. During the 1980’s the phenomenon became worldwide thus affecting marketability of Sudan cotton. It caused substantial economic losses to the cotton producers, worldwide, and obliged them to sell their sticky cotton at lower prices. In case of the Sudanese cotton the discount prices ranged from 5-30%. (Fadlalla, 1998).

Stickiness of cotton lint was found to be caused by honey-dew excreted by the two insects whitefly and aphids (Gameel 1969).However, other factors causing stickiness contamination has been reported in the literature of these, broken seeds, immature fibres as well as sugary substance of cotton plant which may directly or indirectly affect cotton lint at later processes. (Kalifa1980,Watson 2000).

NATIONAL RESEARCH PROGRAM

Intensive research was carried out regarding stickiness of cotton in Sudan. First, a scientific research committee was established in 1967 with the objective of investigating the nature and the origin of

44


substance causing stickiness, then followed by the National Research Committee on Cotton severed programs (Ali and Khalifa 1982, Khalifa 2001) were launched to address stickness. The programs included:

• Type of sugars causing cotton stickiness. • Quick methods for grading cotton stickiness • Ginning efficiency, and the spinning performance. • Integrated pest management (IPM package) • Breeding of cotton varieties tolerant to whitefly infestation.

These research programs continued and in a very short time main results by researcher were revealed. Ali and Khalifa (1980) found that the sugar deposits mainly consist of fructose, glucose and mannose. The whitefly excretions contained two additional unidentified components X and Y which were absent in aphid secretions. They also reported that the sugar deposits causing stickiness were mainly the excretions of whitefly; those of the aphids ranking second.

Results of the chemical method correlate very well with the results of the mini-card (Ali and Khalifa 1980). This method was modified to suit commercial application by shortening the test period, as well as reducing the amount of the chemical used (Ali 1998). It was also reported that, the sticky cotton may decrease the output of the roller gin to about 5-7 kg/gin/hour, compared to 25-30 kg/gin/hour for the clean cotton (Khalifa and Gameel. 1983). It was found that the distribution of honeydew within the same plant was variable. The level of cotton stickiness was higher in lint collected from bottom and middle of the plant compared with the top (Khalifa 1982). Whitefly usually prefers humid, warm and shady conditions, as well as protection from wind. (Gameel 1982). It was also found that the medium staple cotton (Acala) showed higher stickiness level compared to extra long staple cotton (Barakat). This is mainly because hirsutum (Acala) varieties are hairy and bushy, and hence more susceptible to whitefly infestation (Khalifa 1982). It was found that a single adult could produce excretion that can cover 38 mm2 of leaf surface in one day (Gameel 1968).

The whitefly has a wide range of host plants and cotton is normally planted in Sudan during the period July- August. When the other host plants start to dry up white flies migrate to cotton and start breeding rapidly during September-November. They have about 10-12 generations per growing season (Khalifa 1982). Also, distribution of honey-dew within the same plant was variable. A long term program was conducted (early 1980’s) to breed for tolerant and resistant cultivars to whitefly infestation. Its main objective was to manipulate the morphological and physiological characters of the cotton plant in such a way so as to reduce the whitefly population and allow for easy biological, chemical and cultural control (Okra shape – high gossypol content). Despite research effort the problem of stickness in Sudan cotton persisted.

GLOBAL RESEARCH PROGRAM

Research programs addressing the causes and control measures were carried out by ARC. During 1998-2000, a stickiness research project financed by the Common Fund for Commodities (CFC) was executed with the objectives of developing an objective methodology (rather than the current subjective methods in use) to separate sticky from non-sticky cotton in order that the non-sticky part could be sold at due price. The partners of this project were the Sudan Cotton Company (SCC) and the Agricultural Research Corporation (ARC) in Sudan, the Institut Français du Textile et de l’Habillement (IFTH) and the Centre de Coopération Internationale de Recherche Agronomique pour le Développement (CIRAD) in France. The methodology was developed and, in addition, the study revealed considerable variability in stickiness levels among the cotton production areas, and considerably low levels of stickiness were observed in some schemes.

Efforts to Mitigate Stickiness Problem in Sudan 267

.

Source: Gourlot et al -2011: ITMF continuation survey (Gourlot et al., 2011) indicated that few stickness at a problem with Sudaness cotton.

Fig. 1: Mentioned Stickiness Problems for Sudan Production (in % of Answers), ITMF Cotton Contamination Surveys

REFERENCES [1] Ali, N. A. and H. Khalifa (1980). Development of methods to measurecotton stickiness. Cot.Fib.Trop.xxv,4, 311-313. [2] Fadlalla, A.S. (1998), Summary of project Rationale, Objectives and [3] Execution. Annual Report, cotton Stickiness Project. [4] Khalifa, H. (1980). Cotton stickiness. Paper presented before the [5] Constituent Assembly of the International Committee for Cotton Testing, Bremen- Germany. [6] Khalifa, H. (1982) Variation of cotton stickiness and methods of sampling Proc. of International Committee for Cotton

Testing Conference.Bremen-Germany. [7] Khalifa, H. and Gameel. O.I. (1982). Breeding cotton varieties resistant to [8] Whitfly (Bemisa tabaci:Genn”).Symposium on cotton production and marketing. Khartoum..Sudan.pp.9. [9] Khalifa, H.(1982). The control of cotton stickiness through breeding resistant cotton (Bemisa tabaci:Genn”). Proc. Of

workshop of Advisory Group Meeting on the use of Nuclear Techniques for the improvement of oil seeds and other industrial crops. Proc.IAEA/FOA p233-240, Dakar- Senegal.

[10] Gourlot J.-P. ), Abdin M. A. ) and Latif A., Abdalla A. (2011) long term benefit of a CFC/ICAC project global improvement of the situition

0

10

20

30

40

50

60

70

80

90

100

1989 1991 1993 1995 1997 1999 2001 2003 2005 2007 2009 2011 2013

Year

Present Status of Mealy Bug Phenacoccus solenopsis (Tinsley) on Cotton and Other Plants

in Sindh (Pakistan)

Khuhro S.N.1, A.M. Kalroo1 and R. Mahmood2 1Central Cotton Research Institute Sakrand–67210 Sindh–Pakistan

2CABI South Asia, Rawalpindi–Pakistan

Abstract—In Pakistan mealy bug Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) was recorded first time in 2005 on cotton and other plants. The survey was carried out in different districts of Sindh to know the status of the mealy bug on cotton and other plants. The pest was widely sprayed in the surveyed areas attacking a number of plants including cotton. Mean maximum population (mealy bug 2nd & 3rd instars and adults/shoot) was recorded in the districts Shaheed Benazirabad 46.93 followed by Ghotki district (38.88), Sukkur, (32.17), Naushahro Feroze (32.07), Khairpur (29.67), and Dadu district (14.69). Mealy bug was recorded on 22 plants in Shaheed Benazirabad district. On unsprayed cotton (95%) mealy bugs were found parasitized by Aenasius bambawalei Hayat, followed by (92%), on Abutilon indicum (91%), okra (87%), datura, (86%) , china rose (80%) on egg plant, and on tomato (77%) during 2010. However, mealy bugs parasitized by Aenasius bambawalei very low in 2011 due to indiscriminate use of pesticides and appearance of hyper parasitoid. Different insecticides were also tested for controlling mealy bug on cotton. Maximum mortality of the mealy bug recorded in plots treated with Movento 20 SC (95.2%), followed by Movento energy 480 SC (94.8%), Confidor 50 SC+ Ultra (93.3%), Profenofos 50 EC (92.69%), Confidor 70 WG (92.40%), Fyfanon 57 EC (91.1%), Bono 20 SC (89.60), and Malatox 57 EC (84.65%) up to one week of spray. The meteorological data revealed that mealy bug was more common in the field at temperatures in the range of 30.5-39.5°C.

Keywords: Phenacoccus solenopsis, Aenasius bambawalei, Parasitism and population

INTRODUCTION

Cotton, Gossypium hirsutum L., is the most important fiber crop of Pakistan. It is used in textile as well as oil industries and earns foreign exchange through export in shape of raw cotton, cotton yarn, cloth, garments and other products. It makes about 80% of national edible oil production (Agha, 1994). It engages millions of employees in the farms and factories. It provides edible oil, animal feed, fiber, and fuel to a large proportion of the urban and rural populations. It supplies raw material for about 1200 ginning units, 180 spinning units, about 470 textile mills, and 50 vegetable oil mills operating in the country. It is also a major export item from the crop sector because it directly or indirectly contributes about 66 percent to Pakistan’s export earnings (Government of Pakistan, 1995). Unfortunately, the crop was severely attacked by many sucking and chewing insect pests including cotton mealy bug. Mealy bugs have recently become abundant on cotton in Pakistan. These soft bodied insects belong to family Pseudococcidae of order Hemiptera. About 5000 species of mealy bugs have been reported from 246 families of plants throughout the world. Among these, 56 species have been reported from 15 genera of family Malvaceae, including cotton and many other plants of economic importance (Ben-Dov, 1994).

Mealy bugs were never been reported from cotton in Pakistan until 2005 when for the first time Phenacoccus solenopsis Tinsley was recorded from Vehari-Punjab. This insect alone was held responsible for the loss of 0.2 million bales (bale weighs 375 lbs or 170 kg) in 2007 in Pakistan (Muhammad, 2007). Mahmood et al (2011) reviewed its world distribution. According to them it is a new world species and has recently entered a number of countries in Asia and Australia. They reported that this insect is widespread on the plains of Pakistan. Results of present studies carried out in different districts of Sindh on its distribution and abundance are reported in this paper.

45

Present Status of Mealy Bug Phenacoccus solenopsis (Tinsley) on Cotton and Other Plants in Sindh (Pakistan) 269


Mealy Bug Population on Cotton and other Hosts

Regular survey of mealy bug was under taken to record the phenology and host range in different areas/districts of upper Sindh including Shaheed Benazirabad, Naushahro Feroze, Dadu, Khairpur, Sukkur and Ghotki from May to December 2010. Five terminal shoots each measuring 15cm long were taken at random one each from the four corners and in the center of the of the cotton field. Samples of mealy bugs collected from fields were kept in jars (laboratory (at 26± 2oC temperature and 75.5% R.H). Samples were kept in Petri-dishes for a week for parasitoids emergence, in the lab 20C temperature and 75.5% R.H. Counts were made of healthy and mummified 2nd, 3rd instars and adult mealy bug individuals from the samples. The observations on cotton were made from May to December 2010. Samples of same size were also taken from other plants where the mealy bug was found. Similar experiments were improved upon in 2011.

Efficacy of Insecticides for Controlling Mealy Bug on Cotton Crop

Eight insecticides were tested for the efficacy against cotton mealy bug. The crop was sown on 27-05-2010 and crop was sprayed on 03-08-2010. The trial was conducted at CCRI-Sakrand Farm in Randomized Complete Block Design (RCBD) with four replications. Plot size was kept at 30’ x 40’. Spray were initiated when the mealy bug population increased. The control plot was kept unsprayed for comparison of the pest population.


Phenology

During observations the mealy bug was found breeding profusely on cotton and other plants in May- December. It seems to breed almost throughout the year.

Population Trends of the Mealy Bug on Cotton

The results showed that the mealy bug infestation started initially after germination of cotton plants. The minimum infestation was in June, 2010 and maximum in September was recorded at all areas surveyed (Table-1). The mealy bug infestations were comparatively higher at Shaheed Benazirabad and Ghotki, compared with Khairpur, Naushahro Feroze, Sukkur and Dadu districts of Sind province (Table-1).

TABLE: 1. POPULATION OF MEALY BUG IN DIFFERENT DISTRICTS OF SINDH-IN 2010

Mealy bug Numbers Per Terminal Shoot in Following Districts Shaheed Benazirabad Naushahro Feroze Dadu Khairpur Sukkur Ghotki

Jun. 10.14 5.11 0.78 0.14 4.45 0.22 Jul. 16.33 14.11 2.36 3.43 13.78 13.50

Aug. 23.70 17.10 7.10 19.30 16.8 10.90 Sept. 84.30 8.54 18.0 60.80 24.10 133.33 Oct. 113.00 98.30 22.45 67.30 65.80 72.20 Nov. 50.00 76.00 39.75 53.67 86.50 39.00 Dec. 31.00 5.29 12.33 3.00 13.75 3.00 Mean 46.93 32.07 14.69 29.67 32.17 38.88 Mealy bug on plants other than cotton

The mealy bug was recorded from more than 22 plants however it was consistently found on egg plant, tomato, Abutilon indicum, okra, hollyhock and china rose. At the peak period of its population in September, it was found most abundant on cotton, followed by china rose, Abutilon indicum, okra, eggplant, tomato and hollyhock (Table-2). Commonality of the mealy bug on different plants has been reported by Arif, et al. (2009) who reported the inadence of mealy bug Phenacoccus solenopsis on about 154 plants but was most abundant on cotton.


TABLE 2: MEALY BUG POPULATIONS ON DIFFERENT PLANTS HOSTS IN SINDH IN SEPTEMBER, 2010

English/ Local Name Technical Names Mean Mealy Bug Infestation/ Shoot 1. Egg plant Solanum melongena 45.12 2. Tomato Lycopersicon esculentum 23.41 3. Abutilon Abutilon indicum 65.74 4. Cotton Gossypum hirsutum 84.64 5. Datura Datura alba 24.46 6. Okra Abelmoschus esculentus 77.13 7. Hollyhock Alcea setosa 12.71 8. China Rose Hibiscus rosa-sinensis 69.23

Natural Enemies of the Mealy Bug

Since mealy bug appearance was recorded during 2005 in Pakistan only insecticides have been tried to control the mealy bug on cotton. Natural enemies did not have much role in controlling the mealy bug. Mahmood et al. (2011) developed techniques of conserving predators and parasitoids in field conditions and successfully bred millions of parasitoids and predators using plant debris (mealy bug infested drying twigs and leaves). They reported a number of predators associated with the mealy bug in 2006-2007, however, parasitoid Aenasius bambawalei Hayat was first time reported during 2008 from Tando Jam Sindh-Pakistan (Solangi and Mahmood, 2011). This parasitoid spreads fast and keeps the mealy bug under control. In sprayed cotton fields though parasitoid was rare it was most common on unsprayed cotton fields and helped keep the pest under control (Table- 3). The parasitoid was not only common in cotton but also was common on other plants and most of the mealy bugs were found parasitized. In 2011 the parasitoid’s population was less than 2010 (Table-4).

The main reason of low population of parasitoid is the adverse effect of large scale use of pesticides in cotton and vegetables. Moreover a hyper parasitoid Promuscidea unfasciativentris Girault has appeared thereby impacting parasitoid population. As a result of decline in population of the parasitoid the mealy bug population has increased severely.

TABLE 3: PARASITISM OF AENASIUS BAMBAWALEI ON DIFFERENT HOST PLANTS AT SHAHEED BENAZIRABAD DISTRICT IN AUGUST 2010

English/Local Name Technical Names Parasitism Percent 1. Eggplant Solanum melongena 80 2. Tomato Lycopersicon esculentum 77 3. Abutilon Abutilon indicum 92 4. Cotton Gossypum hirsutum 95 5. Datura Datura alba 87 6. Okra Abelmoschus esculentus 91 7. China Rose Hibiscus rosa-sinensis 86

Efficacy of Insecticides for Controlling Mealy bug on Cotton Crop TABLE 5: EFFICACY OF INSECTICIDES FOR CONTROLLING MEALY BUG AT CCRI-SAKRAND DURING AUGUST 2010

Treatment Dose/ acre (ml/g) Post-Treatment Average Population/Shoot

Mortality (%)

48 hours 72 hours 1 week 48 hours 72 hours 1 week Bono 20 SL 125 ml 26.07 17.41 13.17 76.89 85.70 89.60 Malatox 57 EC 750 ml 31.12 22.01 19.45 72.41 81.90 84.65 Profenofos 50 EC 500 ml 18.31 11.21 9.26 83.76 90.78 92.69 Confidor 20 SC 250 ml 17.0 8.0 5.0 83.5 93.5 95.2 Fyfanon 57 EC 500 ml 33.0 21.0 10.0 66.6 82.9 91.1 Confidor 20 SL+ ultra 250 ml 34.0 13.0 7.0 65.8 89.8 93.3 Confidor 70 WG 140 gm 25.0 12.0 7.0 74.6 88.1 92.4 Movento energy 480 SC 150 + 250 ml 30.0 10.0 5.0 70.2 91.6 94.8 Control - 112.81 121.62 126.74 - - -

Present Status of Mealy Bug Phenacoccus solenopsis (Tinsley) on Cotton and Other Plants in Sindh (Pakistan) 271

Results given in Table-5 indicate that, Movento 20 SC gave maximum (95.2%) mortality followed by Movento Energy 480 SC, Confidor 50 SC+Ultrs, Profenofos 50 EC, Confidor 70 WG, Fyfanon 57 EC, Bono 20 SC and Malatox 57 EC up to one week of spray. Similes results were reported by (Aheer, et al. 2009) who also mentioned that all tested insecticides proved significantly effective against mealy bug up to 7 days after treatment.

METEOROLOGY DATA

The meteorology data was recorded during the survey of cotton mealy bug at CCRI-Sakrand Farm. The results showed that the mealy bug built up its population when the temperature 290C and was maximum in the temperature range of 30.5-39.50 C and decreased at temperatures below 290C. (Table 2,3&6).

TABLE 6: METEOROLOGICAL DATA OF 2010 SEASON RECORDED AT CENTRAL COTTON RESEARCH INSTITUTE, SAKRAND, SINDH-PAKISTAN

Month Mean Mealy Bug Population/ Shoot at

Shaheed Benazirabad

Average Maximum Temp.

and Range oC

Average Minimum Temp. and Range (oC)

Mean relative Humidity and

Range (%)

Rainfall (mm)

Jun. 10.14 40.6(29.0-45.0) 27.4 (25.0-31.0) 57.8(47.0-91.5) 45.2 Jul. 16.33 38.6(35.0-43.0) 28.1(24.5-29.0) 65.7(56.0-90.5) 136.2

Aug. 23.70 35.7 (30.0-38.0) 27.2 (24.5-29.0) 73.8(63.5-90.5) 72.0 Sep. 84.30 34.3 (33.5-38.0) 25.1(21.5-30.0) 75.6(56.0-93.5) 50.0 Oct. 113.00 35.7 (30.5-39.5) 21.9(18.0-25.0) 55.9(41.7-66.0) - Nov. 50.00 29.1(24.0-33.0) 14.9 (8.5-20.5) 52.7(41.3-69.0) - Dec. 31.00 23.2(20.0-25.0) 7.5(4.0-10.0) 55.3(42.0-72.7) -

ACKNOWLEDGEMENT

We acknowledge the financial assistance by former Ministry of Food and Agriculture, Government of Pakistan through PSDP, to carry out the present studies under the project “Biological control of major cotton pests including mealy bug in Pakistan Sakrand Component”. We specially thank Mr. Arshad Ahmed, Vice President and Dr. Tasawar Malik, Ex-Director Research, Pakistan Central Cotton Committee (PCCC) and Dr. Ibad Badar Siddiqi, Project Director BCMCP for their consistent support in conducting research.

REFERENCES [1] Agha, H. K. 1994. Crop Production. Published by Pakistan Book Foundation, Islamabad Pp.6. [2] Aheer, G. M. Riaz Ahmad; Amjad Ali . 2009. Efficacy of different insecticides against cotton mealybug, Phenacoccus

solani Ferris. Journal of Agricultural Research (Lahore) Vol. 47 No. 1 pp. 47-52 [3] Arif M.I, Wazir S, Rafiq M, Ghaffar A, and Mahmood R. 2011. (Incidence of Aenasius bambawalei Hayat on mealybug

Phenacoccus solenopsis Tinsley and its hyperparasite, Promuscidea unfasciativentris Girault at Multan). http://www.icac.org/tis/regional_networks/asian_network/meeting_5/documents/papers /PapArifMI-et_al.pdf

[4] Arif, M.I., M. Rafiq, and A. Ghaffar, 2009. Host plants of cotton mealy bug (Phenacoccus solenopsis): A new menace to cotton agro ecosystem of Punjab, Pakistan. International Journal of Agriculture and Biology 11: 163-167.

[5] Ben-Dov, Y. 1994. A systematic catalogue of the mealy bugs of the world (Insecta: Homoptera: Coccoidea: Pseeudococcidae and Putoidae). Intercept Ltd., Andover, P: 686.

[6] Mahmood, R, M. N. Aslam, G. S. Solangi and A. Samad. 2011. Historical Perspective and achievements in biological management of cotton mealy bug Phenacoccus solenopsis Tinsley in Pakistan. 5th Meeting Asian Cotton Research and Development Network, held during February 23-25. Lahore, pp. 1-17. Online at:

[7] http://www.icac.org/tis/regional_networks/asian_network/meeting_5/documents/papers/MahmoodR.pdf [8] Muhammad, A. 2007. Mealy bug: Cotton Crop’s Worst Catastrophe. Centre for Agro-Informatics Research (CAIR),

Pakistan. Available on-line at http://agroict.org/pdf_news/Mealybug.pdf accessed Jul.2008 (verified 27 May 2009). [9] Government of Pakistan, 1995. Economic Survey, 1994-95. Islamabad: Finance Division, Economic Adviser’s Wing. [10] Solangi G. S. and R. Mahmood. 2011. Biology, host specificity and population trends of Aenasius bambawalei Hayat and

its role in controlling mealy bug Phencoccus solenopsis Tinsley at Tandojam Sindh. 5th Meeting Asian Cotton Research and Development Network held on February 23-25. Lahore, pp. 1-7. Online at:

[11] http://www.icac.org/tis/regional_networks/asian_network/meeting_5/documents/papers/PapSolangiGS-et_al.pdf

Changing Scenario of Cotton Diseases in India—The Challenge Ahead

D. Monga1, K.R. Kranthi2, N. Gopalakrishnan3 and C.D. Mayee4 1Central Institute for Cotton Research (CICR), Regional Station, Sirsa

2C.I.C.R. Nagpur, 3Rishi Bhawan, New Delhi 4Agriculture Scientists Recruitment Board, New Delhi

Abstract—The cotton disease scenario has shown a continuous change during the past sixty four years since independence. When mainly indigenous diploid cottons were being grown in fifties, Fusarium wilt, root rot, seedling blight, anthracnose and grey mildew were the major problems. With the large scale cultivation of tetraploid upland cotton (Gossypium hirsutum), bacterial blight became the major disease to which indigenous cottons were highly resistant. After the introduction of Bt cotton hybrids during 2002 onwards and continuous increase in area under these hybrids to around 85% of total cotton area till date, the disease scenario has also shown some change. The grey mildew, once a serious problem for diploid cottons especially in central India has now become a major problem in Bt cotton hybrids. Grey mildew (percent disease intensity) in central zone was recorded on Bt cotton hybrids during 2010-11 in Maharashtra in the irrigated areas of Vidarbha region (9.2 to 20.4 % & Nanded-6.5 to 27.2%). In south zone it was severe in two states i.e. Karnataka (5.0-30.0%), and Andhra Pradesh (28.9-46.4) during the season. Among other important diseases on Bt hybrids, Bacterial blight was reported as important disease in central zone in Maharashtra ( Vidarbha- 8.3 to 22.2 %; Nanded 2.2 to 15.7 %) and in south zone in Karnataka (5.0-15.0 %) and Andhra Pradesh ( 8.0-47.6%). Alternaria blight was observed serious during 2010-11 season in Gujrat’s Saurashtra area (2.0-15.0%) and Maharashtra’s Rahuri (10.2-35.8%) and Nanded (5.0-21.5%) and in south zone states ie Karnataka (5.0-30.0%), Andhra Pradesh (10.0-54.6%) and Tamil Nadu from 12.6 to 38.8%. (Anonymous 2011).

Fusarium wilt has become less important as upland cotton now occupying 85% area is immune to Indian race of the pathogen. Verticillium wilt which appeared in Tamil Nadu remained restricted mainly to that state only.

In north India, the leaf curl disease caused by gemini virus and transmitted by white fly Bemisia tabaci has become a threat to cotton cultivation due to development of new recombinant strains and introduction of a number of susceptible Bt cotton hybrids in north zone. A disease identified as Tobacco Streak Virus (Ilar virus) transmitted by thrips was observed in the transgenic cotton growing region of Southern Maharashtra and Andhra Pradesh. (Sharma et al, 2007). Avoidable losses due to important diseases like cotton leaf curl virus, (53.6% ),bacterial leaf blight(20.6%), Alternaria leaf spot (26.6%), grey mildew( 29.2%)and Myrothecium leaf spot ( 29.1%) have been documented. Newer chemicals like propiconazole, captan+hexaconazole, tetraconazole and strobilurin compounds (fungicides) and copper hydroxide (bactericides) have been successfully tested for the management of foliar disease of cotton. Strategies for the integrated management of diseases causing losses in terms of yield and quality need to be redefined.

INTRODUCTION

Cotton is an important crop for the sustainable economy of India and livelihood of the Indian farming community. It is cultivated in 11.0 M hectares in the country. India accounts for about 32% of the global cotton area and contributes to 21% of the global cotton produce, currently ranking second after China. The production increased from a meager 2.3 M bales (170 kg lint/bale) in 1947-48 to an all time highest record of 31.5 M bales during 2007-08. Cotton provides employment and sustenance to a population of nearly 42 M people, who are involved directly or indirectly in cotton production, processing, textiles and related activities. India has the unique distinction of being the only country in the world to cultivate all four cultivable Gossypium species, Gossypium arboreum and G.herbaceum (Asian cotton), G. barbadense (Egyptian cotton) and G. hirsutum (American upland cotton) besides hybrid cotton. Approximately 65% of India’s cotton is produced under rainfed conditions and 35% on irrigated lands. Cotton is cultivated in three distinct agro-ecological regions (north, central and south) of the country. The northern zone is almost totally irrigated, while the percentage of irrigated area is much lower in the central (23%) and southern zones (40%). Cotton crop is particularly sensitive to a number of biotic and abiotic stresses and the disease problems are also distinct to some extant in agro-ecological regions

46

Changing Scenario of Cotton Diseases in India—The Challenge Ahead 273

referred above. A number of diseases are prevalent on cotton crop in one part of the country or another. Under north zone, cotton leaf curl virus and root rot diseases are the major problems whereas grey mildew, bacterial blight and Alternaria blight are severe in one or the other region in central and southern zone.


In the present review paper, the historical background and present status of cotton diseases in India has been presented. The information gathered on seed borne diseases, soil borne diseases and emerging diseases is highlighted. Among emerging diseases, cotton leaf curl virus, grey mildew and fungal foliar diseases are covered. An attempt is made to present this information in the context of Bt cotton hybrids presently grown in the country. This is followed by information on changing disease scenario of important diseases with major emphasis on cotton leaf curl virus disease and development of new recombinants during recent years, preparation of disease maps and epidemiological studies and their implications on disease scenario. Economic losses due to diseases and new molecules for disease management are described in subsequent sections.


A number of diseases are prevalent on cotton crop in one part of the country or another (Table 1). TABLE 1: MAJOR COTTON DISEASES IN INDIA AND EMERGING SCENARIO

Disease Causal Agent Remark Seed Borne and Foliar Diseases

Cotton leaf curl Gemini virus North zone (Potential threat) Grey mildew Ramularia areola Central & South zone (Emerging) Bacterial blight Xanthomonas axanopodis pv malvacearum Maharashtra, Gujrat, Karnataka Alternaria leaf spot Alternaria macrospora Maharashtra, Gujrat, Karnataka Myrothecium leaf spot Myrothecium roridum Madhya Pardesh Leaf Rust Phakopsora gossypii Kanataka, Andhra Pardesh (Emerging) Cercospora leaf spots Cercospora gossypina Andhra Pardesh (Minor) Helminthosporium leaf spots Helminthosporium gosyypii Andhra Pardesh (Minor) Anthracnose Colletototricum capsici South zone (Minor) Tobacco streak virus Ilar virus Andhra Pardesh(Emerging)

Soil Borne Diseases Wilt Fusarium oxysporum fsp.vasinfectum Restricted to diploids Root rot Rhizoctonia solani, R. bataticola Scattered Verticillium wilt Verticillium dahliae Tamil Nadu, Karnataka

HISTORICAL BACKGROUND AND PRESENT STATUS OF COTTON DISEASES IN INDIA The cotton disease scenario has shown a continuous change during the past sixty four years. Initially, mainly indigenous diploid(Gossypium arboreum & G herbaceum)cottons were being grown in fifties and the Fusarium wilt, root rot, seedling blight, anthracnose and grey mildew were the major problems. With the large scale cultivation of tetraploid upland cotton (G hirsutum), bacterial blight became the major problem to which indigenous cottons were highly resistant. The susceptibility of American cottons is attributed to their not having been exposed to the disease till its introduction into the Americas in post–Columbian times. Fusarium wilt became less important as upland cotton (Bt cotton hybrids) now occupying above 85 percent area is immune to Indian race of the pathogen. Verticillium wilt which appeared in Tamil Nadu remained restricted mainly to South zone only. The grey mildew, once a serious problem for diploid cottons especially in central India with the continued cultivation and imposed selection pressure got adopted to tetraploid cotton and their hybrids as well. Presently, it is a problem in central and south India in Bt-cotton hybrids. Alternaria blight and Myrothecium leaf spots are prevalent everywhere but are severe in the states of Karnataka and Madhya Pardesh, respectively. Other diseases such as Cercospora and Helminthosporium leaf spots are sporadic only. Rust, although a minor disease may assume significance in southern states in near future. In north India, the cotton leaf curl virus disease (CLCuD) caused by a Gemini virus and transmitted by whitefly, Bemisia tabaci has become a major threat to cotton cultivation since its appearance in 1993.


Grey mildew (percent disease intensity) in central zone was recorded on Bt cotton hybrids during 2010-11 in Maharashtra in the irrigated areas of Vidarbha region (9.2 to 20.4 % & Nanded-6.5 to 27.2%). In south zone it was severe in two states ie Karnataka (5.0-30.0%), and Andhra Pradesh (28.9-46.4) during the season. Among other important diseases on Bt hybrids, Bacterial blight was reported as important disease in central zone in Maharashtra (Vidarbha - 8.3 to 22.2 %; Nanded 2.2 to 15.7 %) and in south zone in Karnataka (5.0-15.0 %) and Andhra Pradesh (8.0-47.6%). Alternaria blight was observed serious during 2010-11 season in Gujrat’s Saurashtra area (2.0-15.0%) and Maharashtra’s Rahuri (10.2-35.8%) & Nanded (5.0-21.5%) and in south zone states ie Karnataka (5.0-30.0%), Andhra Pradesh (10.0-54.6%) and Tamil Nadu from 12.6 to 38.8%. (Anonymous 2010). A disease identified as Tobacco Streak Virus (Ilar virus) transmitted by thrips was observed in the transgenic cotton growing region of Southern Maharashtra and Andhra Pradesh. (Sharma et al, 2007). During the surveys conducted around Guntur (Andhra Pradesh) from September 2010 to January 2011 Tobacco Streak Virus disease incidence on different Bt cotton hybrids varied from 1.0 to 43.7%. Maximum incidence was recorded during September in four months old crop. The disease did not appear to cause significant losses at present (Anonymous,2011).

The prevailing disease problems can be broadly divided into (i) Seed borne diseases (ii) soil borne diseases and (iii) Emerging diseases.

Seed Borne Diseases

Studies on seed transmission of cotton diseases conducted at central institute for cotton research, Nagpur (1983-1998) have indicated that leaf and boll spot pathogen Alternaria macrospora and the anthracnose pathogen Colletotricum capsici could become deep seated (embryo borne) and seed transmitted in diploid cottons (Gossypium arboreum, G herbaceum) varieties and hybrids. The bacterial blight caused by bacterium Xanthomonas axanopodis pv. malvacearum was found seed transmitted mainly in tetraploid cotton (G hirsutum, G barbadense) varieties and hybrids. The black boll rot fungus Botrydiplodia theobromae and the stem break/root rot pathogen Macrophomina phaseolina were recorded seed transmitted both in diploid and tetraploid varieties and hybrids (Mukewar and Kairon,2001). Myrothecium blight has also been shown as seed borne in nature ( Srinivasan, 1994).

Soil Borne Diseases

Root Rot caused by Rhizoctonia solani and R. bataticola and wilt caused by Fusarium oxysporum f.sp. vasinfectum are the two major soil borne fungal disease problems in India. Another soil borne disease Verticillium wilt has been observed in some areas of Tamil Nadu and Karnataka. The root rot disease is serious in northern India and detailed studies on various aspects have been undertaken (Monga and Raj,1994; Monga and Raj,1994a; Monga, 1995 ; Monga and Raj, 1996; Monga and Raj,1996 b; Monga, 1997; Monga and Raj,2000 ; Monga, 2001 ; Monga and Raj, 2003 ; Monga, et. al., 2004a). The disease affects both the hirsutum (American cotton) and arboreum (Desi) cotton species, being more serious on desi cottons (Monga and Raj, 1994a). The wilt disease caused by Fusarium oxysporum f sp. vasinfectum appears at any stage of plant development and affects only Desi cottons. Symptoms of Verticillium wilt depend on the cultivar, virulence of the fungal isolate, development stage of the plant and environmental conditions especially temperature.

EMERGING DISEASES

Cotton Leaf Curl Virus Disease

Cotton leaf curl virus disease caused by whitefly (Bemisia tabaci) transmitted Gemini virus with single stranded circular DNA was observed during 1993 around the border areas in Rajasthan and Punjab. The disease in a short span of 4-5 years spread in the entire north zone as the G hirsutum varieties like F-846, RST-9 and HS-6 being grown in the region at that time were highly susceptible to this disease. The initiation of disease is characterized by small vein thickening (SVT) type symptoms on young upper


leaves of plants. Upward/downward leaf curling followed by formation of cup shaped leaf laminar out growth of veinal tissue on the abaxial side of the leaves is other important symptom. In severe cases reduction of internodal length leading to stunting and reduced flowering/fruiting is also noted.

TABLE 2: PROMISING CLCUD TOLERANT VARIETIES/ HYBRIDS/ BT HYBRIDS IN NORTH ZONE

Name of Variety/ Hybrid Source H-1226, H-1117(Varieties), HHH-223, HHH-287(Hybrid) CCS Haryana Agricultural University, Hisar F-1861,LH 2076(Varieties), LHH-144 (Hybrid ) Punjab Agricultural University, Ludhiana RS-875, RS-810,RS-2013 Rajasthan Agricultural University, (Bikaner) Sriganganagar Shresth (CSSH 198), Kalyan (CSHH-238), Simran (CSHH 243) Central Institute for Cotton Research, Regional Station,

Sirsa MRC 7361, MRC 6025, MRC 7031 BG II, MRC-7017 BG II, MRC-6304, SP-7007, SP-7010,SWCH 4711, BIOSEED 6488, BIOSEED 6488 BG-II, BIOSEED 6317, BIOSEED 2113, BIOSEED 6588 BGII, PCH 877, BIOSEED 6588, ANKUR 3028, SHAKTI -9, VBCH 1008, VBCH 1534, VBCH 1518 BGII, NCEH 31, NCEH 6, JKCH-1, RCH 605, RCH 569 BG II, NCS 855 BGII, NCS 905, VICH-307, VICH-309 BGII, PCH 401,

Private Sector

TABLE 3: COTTON LEAF CURL VIRUS DISEASE HOSTS REPORTED FROM INDIA

Name of Host Type of Test Reference Sida sps, Abutilon Indicum, Hibiscus rosa sinensis, Althea rosea

Based on visual symptoms Singh et al.,1994

Phaseolus vulgaris, Capsicum annum, Nicotiana tabacum, Lycopersicum esculentum

Transmission studies and ELISA Nateshan et al.,1996

Abelmoschus esculentus, Althea rosea, Physalis floridana, Nocotiana benthamiana, Phaseolus vulgaris

Transmission studies Radhakrishnan et al., 2001

Althea rosea, Sida sps., Ageratum sps., Hibiscus rosa sinensis

DNA-A probe hybridization Sharma, 2002

Tribulus terrestris, Cucumis sps. CLCuRv-CPgene and DNA beta amplification

Sivalingam et al., 2004

Chorchorus acutangularis, Melilotus indica, Ageratum conyzoides

DNA-A & DNA beta probe hybridization

Radhakrishnan et al., 2004

Nicotiana tabacum, Lycopersicum esculentum, Zinnia elegans, Mentha arvensis, Capsicum sps, Hibiscus rosa sinensis, Abelmoschus esculentus, Sida alba

PCR using CP primer

Kang et al., 2004

Sida sps., Achyranthus sps., Clearodendron sps. CP gene amplification Monga et al., 2005 Convolvulus arvensis, Capsicum sps., Pathenium sps., Solanum nigrum, Digeria arvensis, Lantana camara, Achyranthus aspera, Chenopodium album, Spinacea sps., Xanthium strumarium

CP gene amplification

Monga et al., 2011b

A vigorous exercise was then taken up by the state agricultural universities and institutions under Indian Council of Agricultural Research (ICAR) in the region to work out strategies for its management. Molecular diagnostic tools for detection of virus were developed.(Chakrabarty et al., 2005). The disease could be managed by development of resistant varieties/hybrids (Table 2), control of its vector whitefly and eradication of weeds (Table 3) harboring cotton leaf curl virus disease (Narula et al., 1999 and Monga et al., 2001). The disease was brought under control and the damage caused by it was considerably reduced. The disease till date is restricted to northern cotton growing zone.

The Bt cotton hybrids were introduced in north zone in 2005 by the private sector initially with six hybrids approved by Genetic Engineering Approval Committee. Subsequently, however, a large number of hybrids were permitted for cultivation with in a span of five years and amongst them a number of hybrids were observed to be highly susceptible to cotton leaf curl virus disease. As a result, the incidence of disease increased and it became an emerging problem after the introduction of susceptible Bt cotton hybrids in north zone. Yield loss estimation was studied in Bt cotton hybrids from 2008-09 to 2010-11 based on percent disease index (PDI) ranging from 5% to 60% and disease severity grades from I to IV.


Based on PDI seed cotton yield reduction ranged from 0.08-59.5% at 5-60 PDI. Seed cotton yield reduction ranged from 7.2-80.1% at severity grades of one to four in different hybrids (Monga et al., 2011b). At present, Bt cotton hybrids tolerant to cotton leaf curl virus disease have been identified under Technology Mission of Cotton project and being advocated to farmers (Table 2).Experiments conducted under AICCIP (2009-11) have shown average losses of 53.6% in some Bt cotton hybrids.

Grey Mildew

The disease caused by Ramularia areola is characterized by irregular, angular, pale, translucent spots measuring 1-10 mm in size surrounded by veinlets. The disease appears on the older leaves usually when the plants are reaching maturity. A frosty or mildew growth consisting of conidiophores of the fungus appear first on the under surface and subsequently on the upper surface of affected leaves. As the infection progresses leaves become yellowish brown and fall off prematurely. The incidence of grey mildew is assuming a serious position in central and southern zone. Majority of released Bt hybrids fall in moderately susceptible to highly susceptible category (Hosagoudar et al., 2008).

Foliar Spots

The bacterial blight caused by Xamthomonas axanopodis pv malvacearum with four distinct phases of the disease (seedling phase, angular leaf spot and vein blight phase, black arm phase and boll rot phase) used to cause considerable losses till 90’s. Gossypium barbadense is more severely affected than G. hirsutum. Resistant genes and occurrence of physiological races of the pathogen were described in detail. Sources of resistance available in G hirsutum include 101-102B, BJA-592, Reba B-50, P14-T-128, HG-9, Tamcot-CAMD-E, TxBonham, BJR 734, C-1412, Badnawar-1 and Khandwa-2 and have been used extensively to develop resistant varieties/hybrids ( Srinivasan, 1994). The primary symptoms due to Alternaria macrospora on leaves are small pale to brown round or circular spots (0.5-3.0 mm diameter) showing concentric rings with cracked centre. These spots coalesce to form larger lesions (1 cm diameter). Severe infection may lead to considerable defoliation. Stem cankers are formed in severe cases and the infection may even reach bolls. Natural infection of seeds or seed inoculation results in disease on cotyledons. The characteristic symptoms caused by Myrothecium roridum are the appearance of circular or oval light ash coloured spots with violet to reddish brown margin. Fruiting bodies (Sporodochia) are produced in concentric rings and protrude from lower as well as upper surface of leaves. Under severe conditions, the lint gets strained to yellow or light brown. The rust caused by Phakospora gossypii (Arth) Hirat. F. occurs sporadically in Tamil Nadu, Andhra Pardesh and Karnataka during December-March. Its early appearance has potential to cause considerable loss by decreasing the photosynthetic area and heavy defoliation. The pathogen initially affects the older leaves and then spreads to the younger ones. Only the uredial stage of the rust occurs in India. Uredial sori appear on the leaves as small (1-3 mm) pinkish brown spots which may coalesce to form larger patches. The uredia are oval to circular on the pedicels and branches and the urediospores are exposed on rupture of the epidermis. The early incidence of rust was noted during the last two seasons in Karnataka and Andhra Pradesh (Anonymous, 2010 and 2011).

CHANGING DISEASE SCENARIO

When the incidence of important diseases in varieties/hybrids/Bt cotton hybrids was studied across the country for the past three years, it was noted that CLCuD, Alternaria blight and Grey mildew showed an increasing trend where as bacterial blight incidence did not show any trend but varied between 17.2 -36.7% over locations (Table 4).


TABLE 4: INCIDENCE OF DISEASES (PDI) IN SCREENING NURSERIES

Disease Location Bt Hybrid/ Hybrid/ Variety 2008-09 2009-10 2010-11 Percent Disease Index CLCuD Faridkot (N.Z.) F-846 0 29 96.2 Sriganganagar (N.Z.) RST-9 35.96 100 100 Bacterial blight Akola(C.Z.) RCH-2 26.3 30.42 22.08 Dharwad (S.Z.) RCH-2 36.73 27.08 17.2* Surat (C.Z.) G. Cot hybrid-10 35.5 25.13 34.5* Alternaria blight Rahuri (C.Z.) LRA-5166 28.66 29.3 36.6 Dharwad (S.Z.) RCH-2 21.28 32.67 39.5 Grey mildew Dharwad (S.Z.) RCH-2 11.53 18.75 32.2 N.Z.-North zone, C.Z.-Central zone, S.Z.-South zone *Bunny Bt at Dharwad and G. Cot hybrid 12 at Surat was tested during 2010-11

The Bt-cotton hybrids have shown higher incidence of fungal foliar spots including grey mildews and bacterial leaf blight diseases. A survey carried out by Hosagoudar et al. (2008) in eight districts in north Karnataka on Bt cotton hybrids revealed higher incidence of grey mildew (5-40%), Alternaria blight (5.0-35%) and bacterial blight (5.0-25%). In another study conducted in central zone, the bacterial blight disease increased progressively and reached its peak in RCH-2 Bt cotton hybrid exhibiting 46.7% incidence with intensity of 20.0% compared to 45.0% incidence and 18.7% intensity in susceptible variety LRA-5166. Maximum temperature and sunshine hours exhibited positive and significant correlation with disease incidence. Maximum temperature of 32.50C and relative humidity above 81 percent with sunshine hours 7.9 contributed to rapid spread and development of this disease (Ingole et al., 2008).

In northern cotton growing zone of the country consisting of about 15 lakh ha area, Leaf curl virus disease is one of the most significant but highly complex disease of cotton caused by the whitefly transmitted Geminivirus. Since the outbreak of the disease in 1994 in Sri Ganganagar region of Rajasthan in north India, the disease established endemically in the entire North West Indian states of Punjab, Haryana and Rajasthan causing moderate to severe losses. The cotton leaf curl virus (CLCuV) emerged with renewed aggressiveness during the crop season of 2009-10, when some of the hitherto resistant genotypes and hybrids succumbed to its onslaught. Regular monitoring of CLCuV affected cotton is done to characterize variability in symptoms, diversity of sequences within the associated isolates and variability in disease pattern, if any. Four distinct symptom types were documented viz, leaf curl with prominent enations, severe leaf curl without prominent enation, upward and downward curling of leaves. Sequences of DNA-A and beta DNA components of the isolates associated with different symptoms showed existence of significant variation and recombination with other strains of CLCuV. Sequence identity matrix and RDP analysis of DNA-A and beta DNA components of six virus isolates analyzed over a period of four years from 2006 showed sequence homology and recombination among several isolates from India and Pakistan. Isolate G6-DC, isolated from cotton cv. RS2013, with compromised resistance and severe leaf curl isolate S2 analyzed during 2009-10, showed close resemblance to several CLCuV isolates from Pakistan. DNA-A component of G6-DC had major recombination events with two Pak strains, besides other Indian strains while S2 isolate showed major recombination with three Pakistan strains. Accumulation of recombination events over the years coupled with favorable environmental conditions appeared to have knocked down the resistance of cotton ( Chakrabarty et al.,2010).

After the appearance of cotton leaf curl virus disease in a severe form during 2009-10 crop season in some areas of north zone, district level disease development maps were prepared and it was noted that in Punjab, out of nine cotton growing districts, the disease was very severe (PDI >50%) in Ferozepur followed by severe (25-50%) in Muktsar and Faridkot and moderate (5-25%) in Moga, Bhatinda, Sangrur and Mansa districts. In Patiala, it was low (1.1-5%) whereas It was observed in traces (0-1.0%) in Ludhiana. However, during 2010-11 season the disease was observed to be in severe form from moderate during 2009-10 in Sangrur and Mansa district also indicating increased severity. Similarly in Haryana the disease was observed in traces in the major cotton growing districts of Sirsa, Fatehabad, Hisar and Jind whereas it was not observed in other districts like Rohtak, Bhiwani, Jhajjar, Mahindergarh and Rewari


during 2009-10. However during 2010-11 season the disease was quite widespread in Haryana and was found to be moderate in Sirsa, Fatehabad and Hisar followed by low in Bhiwani and traces in Rohtak districts. In Rajasthan during both the years, the disease was moderate in Sriganganagar district and low in Hanumangarh (Monga et al., 2011a).

In recent years epidemiological studies have thrown light on the weather factors associated with disease development and its progress. Step wise multiple regression analysis revealed that weather parameters altogether accounted for 53.0 – 86.7% significant variation of cotton leaf curl virus disease during 1999-2005 at Regional Research Station, Faridkot in the state of Punjab. Minimum temperature alone contributed 70.2% negative significant variation whereas minimum relative humidity contributed 86.7% positive significant variation. Two week lag weather parameters played significant role in appearance of the disease over the years (Singh et al.,2010).

In another study (1999-2009) conducted at CICR Regional Station Sirsa, the multiple regression equation of current weekly progress of disease( per cent incidence) during 27 – 31 Met weeks was tried with thirty independent variables (six weather factors for current as well as four prior/lag weeks) using stepwise regression. The value of coefficient of determination ( R2) was found to be 0.8230. Minimum temperature of current and one lag week and sunshine of three lag weeks were significantly negatively correlated and contributed to 47% variation whereas morning RH of three lag weeks, evening RH of current week & four lag weeks, rain fall of current and three lag weeks were significantly positively correlated and contributed to 35% variation.(Monga et al.,2011c).

ECONOMIC LOSSES CAUSED DUE TO DISEASES

Alternaria leaf spots can cause loss upto 26.6% based on results (2006-07 to 2008-09) of study conducted in central India at Rahuri and south zone locations at Guntur and Dharwad. Five sprays of Propiconazole (0.1%) at 35, 50, 65, 80, and 95 DAS decreased percent disease index (PDI) from 31.6 to 20.8% thereby reducing this yield loss due to Alternaria leaf spots in variety LRA-5166 ( Anonymous, 2009). In case of grey mildew disease also, a reduction of loss due to grey mildew disease up to 29.2% with the application of five sprays of carbendazim (35,50,65,80 and 95 days after sowing) in Bt cotton hybrid Bunny was demonstrated based on a study (2008-09 to 2010-11) conducted across central and south zone, (Dharwad, Guntur and Nanded ). PDI showed reduction to 8.1 as compared to 20.9 in control (Anonymous,2011).

In another important fungal disease, Myrothecium leaf spot, a reduction of loss up to 29.1% with the application of five fungicidal sprays of Propiconazole (@ 0.1%) at an interval of 35, 50, 65, 80 and 90 DAS in variety JK-4 was observed on the basis of trial in central zone at Khandwa (2007-08 to 2009-10). Percent disease index (PDI) showed reduction to 7.4 as compared to 22.5 in control (Anonymous,2010). Losses to the tune of 33.8% with 0.1% propiconazole spray at 35,50,65,80 and 95 days after sowing due to Helminthosporium leaf spot disease could be avoided in cotton variety LRA-5166 based on (2007-08 &2008-09) studies carried out at Guntur in South zone ( Bhattiprolu,2010).

Reduction of losses due to bacterial leaf blight up to 20.6% with the application of five sprays at 35,50,65,80 and 95 days after sowing of Copper oxychloride (0.2-0.3%) and Streptocyclin (100-500ppm) on the basis of two year trials (2009-10 &2010-11) in central zone at Surat and Akola and south zone at Dharwad and Guntur were also noted (Anonymous 2010 and 2011).

NEW MOLECULES FOR DISEASE MANAGEMENT

Tetraconazole 11.6 % w/w 900 ml/ha showed effective control ( percent disease index 9.9 compared to 28.1 in control) of Alternaria leaf blight (tested at Arupkotai, Junagarh, Rahuri, Nanded during 2009-10 &2010-11) and led to 30.5% increase of seed cotton yield over control. Kresoxim methyl (Ergon 44.3% at 500ml/ha) when tested against foliar pathogens( Alternaria blight, myrothecium leaf spot and grey mildew) at seven locations showed significant reduction of percent disease index. (Anonymous 2010 and 2011).


The fungicide captan+hexaconazole (Taqat @500g/ha) tested at Coimbatore, Junagarh, Faridkot, Guntur and Dharwad during 2007-08 &2008-09 significantly reduced fungal foliar leaf spots ( Alternaria, Myrothecium, Grey mildew, Helminthosporium and Cercospora leaf spots) with an increase in seed cotton yied of 12% over control(Anonymous 2008 &2009). Taqat at at 500g/ha was economical in managing fungal leaf spot diseases at Guntur with benefit cost ratio of 1.42 ( Bhattiprolu,2010).Evaluation of copper hydroxide ( Dharwad, Surat, Akola, Khandwa, Nanded and Rahuri) during 2007-08 &2008-09 revealed significant reduction of bacterial blight and Alternaria spots at 1500g/ha with maximum increase of seed cotton yield of 20.8% over control.(Anonymous 2008 and 2009).

CONCLUSION

Cotton leaf curl virus disease, an important problem presently restricted to north zone need to be dealt more seriously in the context of changed scenario leading to the development of recombinants and breakdown of resistance. The new sources of resistance should be identified from available germplasm. The introgression of resistance from other available sources is another option. The work on development of transgenics using RNAi technology is in progress and shall go a long way in development of resistance against this important viral disease. Other components of integrated disease management strategy like cultural practices including weed management and vector control using innovative methods need to be pursued vigorously to obtain a holistic approach. Certain other diseases like Alternaria, Bacterial blight and grey mildew showing significant appearance in few areas at present shall need better management options including nanotechnology. A vigil is required on the emerging problems like tobacco streak virus and their likelihood to cause losses and minor disease like rust becoming major due to early appearance in south zone. Another important aspect will be to focus on the disease development and progress vis-a-vis climate changes to understand disease epidemiology and plan management strategies.

REFERENCES [1] Annonymous (2008) - AICCIP Annual Report (2007-08), All India Coordinated Cotton Improvement Project, Coimbatore,

Tamil Nadu. [2] Annonymous (2009) - AICCIP Annual Report (2008-09), All India Coordinated Cotton Improvement Project, Coimbatore,



Tamil Nadu. [5] Bhattiprolu, S. L. (2010) - Efficacy of taqat against fungal leaf spot disease of cotton- J. Cotton Res. Dev., 24: 243-244. [6] Chakrabarty, P.K., Sable, S., Kalbande, B., Vikas, Monga, D. and Pappu, H.R. (2010) - Molecular diversity among strains

of CLCuV prevalent in North West India and approaches to engineering resistance against the disease. Invited paper presented at Conference on whitefly and thrips transmitted diseases held at University of Delhi-South Campus on August 27-28, 2010 p.17.

[7] Chakrabarty, P. K., Sable, S., Monga, D. and Mayee, C. D. (2005) - Polymerase chain reaction-based detection of Xanthomonas axanopodis pv malvacearum and cotton leaf curl virus- Indian J. Agric. Sciences, 75: 524-27.

[8] Hosagoudar, G. N., Chattannavar, S. N., and Kulkarni, S. (2008) - Survey for foliar diseases of Bt Cotton Karnataka - J. Agric. Sci., 21: 139-140.

[9] Ingole, O. V., Patil, B. R., Raut, B. T. and Wandhare, M. R. (2008)- Epidemiological studies on bacterial blight of cotton caused by Xanthomonas axanopodis pv. Malvacearum- J. Cotton Res. Dev., 22: 107-109.

[10] Kang, S. S., Akhtar, M., Cheema, S.S., Malathi, V. G. and Radhakrishnan, G. (2004) - Quick detection of cotton leaf curl virus - Indian Phytopathol., 57 : 245-46.

[11] Monga, D. (1995) - Integrated management of root rot of cotton - Paper published in book entitled “Integrated Disease Management and Plant Health” edited by V. K. Gupta and R. C. Sharma- p 318.

[12] Monga, D. (1997) - Effect of fungicides on cotton root rot pathogens and biocontrol agents - J. Cotton Res. Dev.11: 272-275.

[13] Monga, D. (2001) - Effect of carbon and nitrogen sources on spore germination, biomass production and antifungal metabolism by species of Trichoderma and Gliocladium - Indian Phytopathol., 54: 435-437.


[14] Monga D., Chakrabarty, P. K, and Kranthi, K. R. (2011a) - Cotton leaf curl virus disease in India-Recent status and management strategies. Paper presented at 5th meeting of Asian Cotton Research and Development Network (Full paper at ICAC website) held at Lahore from February 23rd to 25th, 2011.

[15] Monga, D., Kumar, R., Kumar, M. (2005 ) - Detection of DNA A and satellite (DNA beta) in cotton leaf curl virus ( CLCuV) infected weeds and cotton plants using PCR technique - J. Cotton Res. Dev., 19: 105-108.

[16] Monga, D., Kumhar, Kishor Chand, Kumar, Alok , Soni Renu, and Kumar Rishi (2011b) - Identification of inoculum source and estimation of yield losses due to cotton leaf curl virus disease - Poster presentation at 5th World Cotton Research Conference at Mumbai from 7-11 November, 2011.

[17] Monga, D., Manocha, Veena, Kumhar, Kishor Chand, Soni, R. and Singh, N.P. (2011c) - Occurrence and prediction of cotton leaf curl virus disease in northern zone - J. Cotton Res. Dev., 25: 273-277.

[18] Monga, D., Narula, A.M. and Raj, S. (2001) - Management of cotton leaf curl virus- A dreaded disease in North India. Paper published in Book of Papers published by DOCD Mumbai on the occasion of National seminar on Sustainable Cotton Production to Meet the Future Requirement of the Industry held on October 3rd and 4th 2001 at CIRCOT Mumbai .

[19] Monga, D. and Raj, S. (1994 ) - Cultural and pathogenic variability in the isolates of Rhizoctonia sps. causing root rot of cotton - Indian Phytopathol., 47: 217-225.

[20] Monga. D, and Raj, S. (1994 a) - Progress of root rot in American ( Gossypium hirsutum ) and desi ( G .arboreum ) cotton varieties in the northern region. Poster presented at the ‘National Symposium on current trends in the management of plant diseases' held at CCS Haryana Agricultural University Hisar on 10-11 November, 1994.

[21] Monga, D, and Raj, S. (1996) -Varietal screening against root rot of cotton in sick field- Crop Res. 12 : 82-86. [22] Monga, D. and Raj, S. (1996 b) - Biological control of root rot of cotton - J. Indian Soc. Cotton Improv., 21: 58-64. [23] Monga, D. and Raj, S. (2000) - Integrated management of root rot of cotton. Paper published in Proceedings of

International Conference on Integrated Disease Management for Sustainable Agriculture (Volume II), Indian Phytopathological society, Division of Plant Pathology, IARI, New Delhi, p 910-911.

[24] Monga, D. and Raj, S. (2003) - Development of sick field for screening against root rot of cotton - J. Cotton Res. Dev., 17: 59-61.

[25] Monga, D. Rathore, S. S., Mayee, C. D. and Sharma, T. R. (2004a) - Differentiation of isolates of cotton root rot pathogens Rhizoctonia solani and R. bataticola using pathogenicity and RAPD markers - J. Plant Biochem. Biotechnol., 13: 135- 139.

[26] Mukewar, P.M. and Kairon, M.S. (2001) - Seed transmitted diseases of cotton and their control: A Review - J. Cotton Res. Dev., 15: 34-45.

[27] Narula, A.M., Monga, D., Chauhan, M.S. and Raj, S. (1999) - Cotton leaf curl virus disease in India-The Challenge ahead - J. Cotton Res. Dev., 13: 129-138.

[28] Nateshan, H.M., Muniyappa, V., Swanson, M.M. and Harrison, B.D. (1996) - Host range, vector relations and serological relationships of cotton leaf curl virus from southern India - Ann. App. Biol., 128: 233-244.

[29] Radhakrishnan, G., Malathi, V. G. and Varma, A. (2001) - Novel features of cotton leaf curl virus disease in India. In. 3rd International Gemini Virus Symposium, July 24-28, 2001, John Innes Centre, Norwich, Norfolk, U. K., p53.

[30] Radhakrishnan, S., Malathi, V.G. and Varma, A. (2004) -Biological characterization of an isolate of cotton leaf curl Rajasthan virus from northern India and identification of sources of resistance - Indian Phytopathol., 57: 174-180.

[31] Sharma, P. (2002) - Molecular approaches for detection and diagnosis of cotton leaf curl Gemini virus and its mode of dissemination in the field - Ph.D. thesis, Department of Plant Pathology, College of Agriculture, CCS HAU, Hisar.

[32] Sharma, O. P., Bambawale, O. M., Datar, V. V., Chattannavar, S. N., Jain, R. K., and Singh Amerika (2007)- Diseases and disorders of cotton in changing scenario. NCIPM Technical Bulletin. Pp.20.

[33] Singh, Daljeet, Singh, Pritpal, Gill, J. S. and Brar, J. S. (2010) – Weather based prediction model for forecasting cotton leaf curl disease in American cotton - Indian Phytopathol., 63: 87-90

[34] Singh, J., Sohi, A.S., Mann, H.S. and Kapoor, S.P. (1994) - Studies on whitefly Bemisia tabaci (Genn.) transmitted cotton leaf curl virus disease in Punjab - J. Insect Sci., 7: 194-198.

[35] Sivalingam, P. N., Padmalatha, K. V., Mandal, B., Monga, D., Ajmera, B. D. and Malathi, V.G. (2004)-Detection of begomoviruses in weeds and crop plants in and around cotton field surveillance: Disease forecasting and management held at IARI, New Delhi, February 19-21, 2004. Souvenir and abstract, p.36.

[36] Srinivasan, K. V. (1994) - Cotton Diseases. Published by The Secretary, Indian Society for Cotton Improvement C/o CIRCOT, Bombay, p 311.

Emerging and Key Insect Pests on Bt Cotton— Their Identification, Taxonomy,

Genetic Diversity and Management

S. Kranthi1, K.R. Kranthi1, Rishi Kumar2, Dharajothi3, S.S. Udikeri4, G.M.V. Prasad Rao5, P.R. Zanwar6, V.N. Nagrare1, C.B. Naik1, V. Singh7

V.V. Ramamurthy8 and D. Monga2 1Crop Protection Division, Central Institute for Cotton Research, Nagpur

2Central Institute for Cotton Research, Regional Station, Sirsa 3Central Institute for Cotton Research, Regional Station, Nagpur

4Agriculture Research Station, UAS, Dharwad 5ANGRAU, Lam farm Guntur

6Cotton Research Station, Marathwada Agricultural University, Nanded 7Regional Agricultural Research Station, Sriganganagar, Rajasthan

8Entomology Division, Indian Agricultural Research Institute, New Delhi

Abstract—Technology Mission on Cotton in India has proved to be successful in the planning, implementation, execution and monitoring of research projects in a stipulated time with a focused approach. Emerging and key insect pests on Bt cotton- their identification, genetic diversity and management is one of the projects that addressed the changing pest problems in different regions through strategic research. Mealybugs (Phenacoccus solenopsis, Paracoccus marginatus), mirids (Creontiades biseratense, Campylomma livida,Hyalopeplus linefer ) , flower bud maggots (Dasineura gossypii), safflower caterpillar (Perigea capensis) , Tea mosquito bug (Helopeltis bryadi) were emerging insect pests while leaf hoppers (Empoasca devastans), whiteflies (Bemisia sp), pink bollworm (Pectinophora gossypiella) and the armyworm (Spodoptera spp.) were the key pests on Bt cotton. Incidence and damage caused by these pests varied across regions and Bt genotypes being cultivated. Timely taxonomic identification of the mealy bug, P. solenopsis and subsequent molecular study to suggest its narrow genetic diversity led to the development of meaningful management strategies to limit its spread. Studies on the mt COI region of the key pest E. devastans revealed that leaf hopper populations on cotton although morphologically and taxonomically similar were genetically distinct from leaf hoppers of South and Central India. Implications on pest management in light of this finding are presented. Flower bug maggots that were hitherto not reported on cotton were found to cause extensive damage in parts of Karnataka. The life cycle of D. gossypii was elucidated to identify vulnerable stages in its life cycle that can be exploited for pest management. Two botanical formulations Mealy Kill 50EC (against sucking pests) and Mealy Quit (against mealybugs) were identified, developed and validated in multilocation trials. Entomofungi were evaluated for their efficacy in sucking pest management.

INTRODUCTION

India accounts for about 32% of the global cotton area and contributes to 21% of the global cotton production after China. The production increased from a meager 2.3 M bales in 1947-48 to 17.6 M bales in 1996-97 to an all time highest record of 31.5 M bales during 2010-2011. Prior to 2002, cotton production in the country was plagued by bollworm that was a major limiting factor in obtaining the full yield potential of a genotype. This was coupled with the use of genotypes with low yield potential per se. With the introduction of Bt cotton, bollworms have been effectively controlled thus minimizing yield losses. The biggest gain from the technology was in the form of reduced insecticide usage from 46% in 2001 to less than 26% after 2006 and to a further 21% in 2009-10 and 2010-11. The reduction in insecticide usage in India from Rs. 7180 M in 2004 for cotton lepidopteran caterpillars to Rs.1100M with only Rs.230M for the control of American bollworm in 2010 is the spectacular effect of Bt cotton (Vision 2030).

While effectively controlling the American bollworm widespread cultivation of Bt cotton has resulted in emerging pest problems some of which are discussed below.

47



Emerging Pests

Observations were recorded at weekly intervals on Bt cotton from 25 DAS to 120 DAS in Sirsa (Haryana), Nagpur, (Maharashtra) Coimbatore (Tamil Nadu), Guntur (Andhra Pradesh) and Dharwad (Karnataka) in farmers fields cultivating Bt hybrids. Those insects apart from the known insect pests of cotton that appeared in large numbers were recorded. Damage was also recorded.

Feeding of Perigea Capensis under Laboratory Conditions

Field collected larvae on Bunny Bt were collected from Nanded, Yavatmal and were reared to F1 on non Bt cotton terminal leaves. F1 neonates (30 larvae per event in 3 replicates) were provided with one rupee sized terminal leaves of different Cry events under no choice conditions and the leaves were changed each day for a period of 7 days. Mortality was recorded every day and larval weights were recorded at the end of the bioassay period.

Genetic Diversity of Mealy Bug, Phenacoccus Solenopsis and Cotton Leaf Hopper, Empoasca Devastans

Field collected mealy bugs from 49 locations were preserved in absolute ethanol and brought to the lab for further studies in 2007. In 2008 mealy bug samples were collected from cotton fields reared to F1 on potato sprouts and F1 females were used for molecular diversity studies.

Field collected leaf hopper nymphs from cotton at peak vegetative stage were collected in ethanol from all cotton growing locations of the country with samples representing 3 fields in a village in turn covering 3 districts of a state. Nine states were covered during the course of study.

DNA was isolated from individual insect samples and PCR COI specific primers were designed to amplify the COI region of the mitochondrial genome of leaf hopper. Mealy bug PCR amplicons were generated using primers designed specifically to amplify 18s and 28s rDNA. Using annealing temperatures 50.8oC PCR amplicons of the CO1 region of leaf hopper were generated. The annealing temperature used to generate PCR amplicons of mealy bugs was 58oC. Amplicons were subjected to double pass analysis and the resulting sequences were aligned and phylogenetic tree was drawn using MEGA4 (Tamura et. al., 2007).

Formulation of Mealy Kill 50 EC

Using products of insect induced signal transduction pathway limonene was extracted from citrus peel using the cold press method and evaluated in insect bioassays against aphids, jassids whiteflies and mealy bugs. Commercially available synthetic analogues of limonene with 98% purity was evaluated under no choice conditions using log dose probit concentrations as diet incorporation, topical application and leaf dip methods of bioassays and the LC50s were worked out (Finney, 1971). Soap nut powder was used as emulsifier.


Emerging Pests

From the table it is evident that Mealy bugs were the dominant emerging pest on Bt in Haryana, Maharashtra, Gujarat and Guntur while mirid bugs were dominant in Haveri and Belgaum districts of Dharwad in Karnataka. Mealy bugs and mirid bugs were seen as emerging pests in Tamil Nadu (Table 1).

Species Composition of Emerging Pests

Phenacoccus solenopsis was the dominant species of mealy bugs found across the country during its first year of incidence (2007-08). Subsequently Paracoccus marginatus emerged as a pest on cotton and other crops of Tamil Nadu in 2009 since its first report in 2007 (Table 2).

Emerging and Key Insect Pests on Bt Cotton—Their Identification, Taxonomy, Genetic Diversity and Management 283

TABLE 1: INCIDENCE OF EMERGING PESTS

S. No. State Locations Emerging pest

Incidence* Damage

1 Haryana Odhan, SIrsa, Kaleriwal, Dhabwali and Baraguda

Mealy bug 5-44% Grade 3: 1.66-19% Grade 4: 1.33-19%

2 Maharashtra Nanded Mealy bug 33.70** NR 3 Gujarat Surat Mealy bug - Grade 4 in August.

Grade 2 till Jan 4 Andhra

Pradesh Guntur Mealy bug 5.76- 35.35 % 1.71-4

5 Karnataka Haveri Belgaum Mirid bugs 43.85 bugs/25 squares - 6 Tamil Nadu Coimbatore Mealy bug 55-83.1% 1.0-1.22 Mirid bugs 16-85.1 bugs/100 squares - * Refers to number of plants harboring mealy bugs and causing more than Grade 1 damage. **Refers to number of mealy bugs on 2.5 cm stem length.

TABLE 2: DIFFERENCES BETWEEN THE 2 SPECIES OF MEALY BUGS

Phenacoccus Solenopsis Paracoccus Marginatus Body quite large (5mm) with dark dorso sub medial bare spots on inter segmental areas of thorax and abdomen, these areas forming 1 pair of dark longitudinal lines on dorsum, with 18 pairs of lateral wax filaments, posterior pair longer up to 1/4th inch length of body.

The adult female is yellow covered with white waxy coating and measures approximately 2.2 mm in length and 1.4mm wide. A series of short waxy caudal filaments less than 1/4th the length of the body exist around the margin.

Live mealy bug colonies (P. solenopsis) collected across the country from 37 locations were subjected to DNA isolation and PCR using 18S and 28S rDNA primers, elongation factor 1alpha and elongation factor 1 Beta primers. PCR amplicons of approximately 350bp and 700bp were sequenced using double pass analysis in 140 samples representing 3-4 samples per location. All the colonies belonged to a single haplotype reflecting narrow genetic diversity. This information was important in devising simple management strategies to be applied uniformly across the country.

Mirid Bugs

Three species have been found to cause damage of varying intensities on cotton- Creontiaedes biseratense (Distant), Hyalopeplus lineifer (Walker), Campyloma livida (Reuters). Mirids feed on tender shoots, squares and cause excessive shedding of flowers, small squares and parrot beaking of bolls. They occur in large numbers moving rapidly on the plant and often miss the eye. Mirid bugs are reported to cause maximum damage in Haveri and Belgaum districts of Karnataka with up to 2 mirids per square in the months of October and November. Mirids were reported to cause an avoidable loss of 290Kg/Ha in Dharwad. Yield loss due to mirids in Nagpur of Central India ranged from 25-30%. Avoidance of broad spectrum insecticides seems to have assisted in their establishment as emerging pests of cotton. Also, introduction of new genotypes hitherto unknown into the ecosystem seems to have encouraged the occurrence of new pests.

Safflower caterpillar, Perigea capensis were collected as late instar larvae from Bt cotton leaves in Vidarbha, Hingoli and Buldana. It was recorded for the first time along with Spodoptera in cotton fields adjoining soybean in early vegetative stage. It does not feed significantly on Bt cotton leaves (BG and BG II) in the lab as neonates die at the end of 7 days. Even though they survive a poor weight gain of neonate larvae on non Bt cotton leaves was observed (<10mg in a 7 day period).

The adult moth is grayish brown in colour and looks like the pink bollworm moth. It has a pre-oviposition period of 3 days. Eggs are laid in clusters and are covered with rough hair. Egg period is 3-5 days. Neonate larvae are white in colour and translucent and very active. Full grown larvae are light green, fleshy with prominent yellow bands across the larval segments. Full grown larvae look like Helicoverpa with larval period between 14-17 days and a pupal period of 4-5 days.


Genetic Diversity of Mealy Bugs and its Implication for Mealy Bug Management

PCR amplicons of approximately 350 bp and 700 bp were sequenced using double pass analysis in 140 samples representing 3-4 samples per location. All of them had the identical sequence except one sample of the three from Sriganaganagar which we believe may be a different species. The cotton mealy bug was identified as Phenacoccus solenopsis (taxonomically) without any genetic diversity (molecular analysis) throughout the country

PCR Amplification of Mealy Bug DNA From different location with 28S- A,F & R Primers

PCR Amplification of Mealy Bug DNA From different location with 18S F & R Primers

1st Row:- Lane 1-3: Sirsa; Lane 4-6: Hissar; Lane 7-9: Abohar; Lane 10-12: Fatehabad; Lane 13-15: Shriganganagar; Lane 16-18: Hanumangarh; Lane 19-21: Amravati; Lane 22-24: Jalna. 2nd Row:- Lane 1-3: Latur; Lane 4-6: Akola; Lane 7-9: Hingoli; Lane 10-12: Washim; Lane 13-15: Yavatmal; Lane 16-18: Nagpur; Lane 19-21: Nanded; Lane 22-24: Parbhani.

1st Row:- Lane 1-3: Sirsa; Lane 4-6: Hissar; Lane 7-9: Abohar; Lane 10-12: Fatehabad; Lane 13-15: Shriganganagar; Lane 16-18: Hanumangarh; Lane 19-21: Amravati; Lane 22-24: Jalna. 2nd Row:- Lane 1-3: Latur; Lane 4-6: Akola; Lane 7-9: Hingoli; Lane 10-12: Washim; Lane 13-15: Yavatmal; Lane 16-18: Nagpur; Lane 19-21: Nanded; Lane 22-24: Parbhani.

Fig. 1: PCR Amplicons of Mealy Bugs using 18s and 28s rDNA Specific Primers

Management strategies were devised based on the following basic information and the article by Kranthi et. al., (2011) is recommended for further reading. Pigeon pea, maize and bajra are least preferred by the mealy bugs. Mealy bugs survive on weeds during the season and also during off-season. Aenasius bambawalei is the most effective parasitoid. The predatory beetles Cryptolaemus montrouzieri, Brumus suturalis and Scymnus spp. are prominent in the ecosystems in India and Pakistan. The entomopathogenic fungi, Metarrhizium anisopliae, Beauveria bassiana, Verticillium lecanii and Fusarium pallidoroseum are effective in infecting mealybugs. Botanical mixtures containing neem oil, citrus peel extracts and fish oil rosin were found to be effective in controlling the mealybugs. The insect growth regulator, Buprofezin is effective in control. Insecticides such as Malathion and Acephate, which are considered by the WHO as only slightly hazardous (WHO III category) can be used as soil application near the root zone. All the populations collected in India were highly homogenous, indicating scant genetic diversity in India. This implied that a common pest management strategy could be adopted across the country.

Eme

Genetic Div

An un(Punjab, Hleaf hoppKarnatakaresistancemore toler

‘Mealy Kill’

Mealy Ki0.123% (jThe insecdissolves technologinsecticidamanagemsprays ansingle spr

erging and Key I

versity of Lea

nrooted tree Haryana and per populatioa). This is bee patterns wirant to chlorn

for Sucking P

ill essentiallyjassid nymphcticidal compthe waxy co

gy has special compone

ment in organnd provides aray of neonic

Insect Pests on

f Hoppers and

Fig. 2: PCR A

was generatRajasthan) a

ons collectedeing reportedith leafhoppnicotinyls co

Pest Managem

y consists ofhs, leaf dip aponent of M

oating on the al relevance

ent of Mealnic cotton syan alternativcotinoid cost

Bt Cotton—The

d Implication f

Amplicons of Leaf

ted (MEGA and Gujarat fd from Centd for the firster populatio

ompared to le

ment

f a terpenoidassay) and 0

Mealy Kill ismealy bug t

e to citrus by Kill. Sincystems. It isve to the usets about Rs.8

eir Identification

for Leaf Hopp

Hopper Genomic D

4) to show formed a distral (Maharat time and is ons from Ceneaf hopper po

d, and demo.421% (aphis of botanicthus making belt of Vidarce the tech eco-friendlye of insectic800 per acre

n, Taxonomy, Ge

er Manageme

DNA with CO1 Spec

that leaf hopstinct group aashtra) and Ssupported byntral and Soopulations fr

nstrates LC5ids, diet incocal origin. M

it vulnerablerbha as citrunology is ey and reduc

cides. Reducwhile Mealy

enetic Diversity

ent

cific Primers

pper populatand were genSouth India y distinct dif

outh India brom Gujarat

50 values of orporation) inMealy Kill e to dessicatius peels areeco-friendly ces the depenced cost of cy Kill costs

y and Manageme

tions from Nnetically diff(Andhra Pr

fferences in eing atleast and North In

0.342% (men laboratory is very effeion and bioae a rich sou

it is usefundence on incultivation aabout Rs.200

ent 285

North India ferent from radesh and insecticide 5000 fold

ndia.

ealy bugs), bioassays.

ective as it agents. The urce of the ul for pest nsecticidal

as use of a 0 per acre.


It is not only specific to cotton but can be used on any crop for aphid, jassid and whitefly management. Mealy Kill 50EC formulation was supplied to 9 AICCIP centres but was tested at 4 centres namely, Raichur, TNAU, Sirsa and Faridkot, essentially against mealy bugs. It was tested at 20ml/L in north India and 10ml/L in South India. It offered 34% reduction when sprayed once at Sirsa and was on par with other bio-pesticides such as V. lecanii, M. anisopliae and B. bassiana. It was superior to the bio-pesticides tested at Faridkot. There were no significant differences in yield in the insecticide treated plots and Mealy Kill treated plots in Faridkot. In Raichur and TNAU the reduction in mealy bugs observed due to Mealy Kill was 90% that was on par with the insecticidal check chlorpyriphos both in terms of pest control and yield. Mealy Kill was superior to the other bio-pesticides tested, each, sprayed twice, at these centres in terms of mealy bug control and yield.

ACKNOWLEDGEMENT

The funding for this work, received from TMC MMI from Ministry of Agriculture, is gratefully acknowledged.

REFERENCES [1] Vision 2030, CICR (2011). Compiled by K.R. Kranthi, M.V. Venugopalan and M.S. Yadav. Indian Council of Agricultural

Research, New Delhi. [2] Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software

version 4.0. Molecular Biology and Evolution 24: 1596-1599. [3] Finney, D.J. (1971). Probit Analysis, third ed. Cambridge University Press, Cambridge. [4] Kranthi, K.R., V. Nagrare, S. Vennila and S.Kranthi (2011). Package of practices for mealy bug management on cotton.

ICAC, 29 (1): 13-16.

Efficacy of Triazoles in Management of Major Fungal Foliar Diseases of Cotton

A.S. Ashtaputre, N.S. Chattannavar, S. Patil, Rajesh N.K. Pawar and G.N. Hosagoudar

University of Agricultural Sciences, Dharwad, Agricultural Research Station, Dharwad Farm, Dharwad–580007, Karnataka –India

E-mail: [email protected]

Abstract—Grey mildew and Alternaria blight are the major fungal foliar diseases in northern region of Karnataka and two year study was conducted to know the efficacy of triazoles against these major fugal foliar diseases of cotton, grey mildew caused by Ramularia areola Atk. and Alternaria blight caused by Alternaria macrospore Zimm, during kharif 2009 and 2010 under rainfed situation at Agricultural Research Station, Dharwad. The experiment was laid out in replicated trial of randomised block with ten treatments. The study revealed that all the triazoles under study were found to be effective in control of major foliar diseases, which in turn reflected in more yield. Among these triazoles, Percent disease index(PDI) of Penconazole for Alternaria blight(AB) (6.10 PDI) and grey mildew(GM) (10.30 PDI) followed by Hexaconazole (AB 8.20, GM 11.0 PDI), Difenconazole (AB 7.10, GM 11.10 PDI) and Tridemefan (AB 11.3, GM 13.5 PDI), reduced the disease severity of both the diseases effectively and also enhanced the yield. But three sprays of Hexaconazole (0.1%) were more useful not only in reducing the cost of protection but also gave higher benefits (B:C ratio 9.63) as compared to other treatments and can be used for the management of major fungal foliar diseases of cotton. Hexaconazole can be recommended as one of the components in integrated disease management of cotton as it showed the best result in the control of both diseases with higher cost benefit ratio and increased yield(14.3 q/ha).

INTRODUCTION

Cotton, “The White Gold” enjoys a pre-eminent status among all cash crops in the country and is the principal raw material for a flourishing textile industry. India now produces around 290.00 lakh bales of cotton ranging from short staple to extra long staple from an area of 93.73 lakh hectares with productivity of 526 kg per hectare (Anonymous, 2009). In Karnataka, the area under cotton cultivation is 3.90 lakh hectares with a production of 9.00 lakh bales and an average productivity of 392 kg per hectare (Anonymous, 2009). Cotton is known to suffer from number of diseases caused by fungal, bacterial and viral origins. There is now more relative importance for different diseases may be air borne like grey mildew, Alternaria leaf spot, Myrothecium leaf spot, bacterial blight, rust, cotton leaf curl virus (white fly transmitted) or soil borne like seedling rots, Rhizoctonia root rot, Verticillium wilts and even some times Sclerotium rolfsii affecting cotton across India. Only the type of the disease and its virulence differs with different agro – climatic regions. These changes may be due to change over from the cultivation of Asiatic (G. herbeceum and G. arboreum) to American cottons (G. hirsutum) and hybrids. Most of them, even though high yielding, are susceptible to diseases. Only the type of the disease and its virulence differs with different agro – climatic regions. These changes may be due to change over from the cultivation of Asiatic (G. herbeceum and G. arboreum) to American cottons (G. hirsutum) and hybrids. Most of them, even though high yielding are susceptible to diseases (Shivankar and Wangikar, 1992, Chattannavar et al, 2009). Among the fungal diseases grey mildew and Alternaria blight are the predominant ones causing economic losses to the cotton crop in the country. Management of diseases is a continuous process due to development of different resistant races of pathogens imposed by climatic changes, chemicals or even resistance to old resistant cultivars.

48



A field experiment was conducted at Agriculturl Research Station (Cotton), Dharwad farm, Dharwad , Karnataka during Kharif 2009-10 and 2010-11 to evaluate the field bio-efficacy of triazole group of fungicides against major fungal foliar diseases grey mildew caused by Ramularia areola Atk. and Alternaria blight or Alternaria leaf spot caused by Alternaria macrospore Zimm were compared with standard recommendation Carbendazim 50% WP foliar spray treatment @ 0.1%. The experiment was planned in Randomised block Design and replicated thrice on Bt cotton hybrid “Bunny Bt”. The individual treatment plot size was 6.0 x 5.4 m2 with spacing of 90 x 60 cms. Normal recommended cultural practices were adopted. Three sprays of all treatments were undertaken immediately after the appearance of the disease at an interval of 12 days. The observations on percent disease index of Alternaria blight and grey mildew were recorded 15 days after the last spray, on five randomly selected plants in each treatment. In each treatment, ten plants were randomly selected and tagged. Three branches were randomly tagged per plant and the intensity of Alternaria blight and grey mildew on all the leaves of these tagged branches were graded by adopting 0 to 4 scale as given by Sheo Raj (1988).


Per Cent Disease Index (PDI)

The results obtained during 2009 with respect to Alternaria blight, revealed that, all the treatments were significantly superior over untreated control. From the data, it is clear that, the treatments viz., Penconazole, Difenconazole, and Hexaconazole were found on par with each other with PDI of 5.80, 6.70 and 8.30 respectively and they were significantly superior to all other treatments followed by Propiconazole, Mycobutanil, Tridemefon with PDI of 9.40, 10.30 and 11.40 respectively. The results obtained during kharif, 2010 followed similar trend of results but in slightly higher intensity of incidence of disease, as observed during kharif, 2009.

TABLE 1: EFFICACY OF TRIAZOLES AGAINST ALTERNARIA BLIGHT AND GREY MILDEW OF COTTON

Sl. No

Treatments Alternaria blight PDI

Pooled mean PDI

Grey mildew PDI

Pooled mean PDI

Yield (q/ha)

Pooled Yield (q/ha)

B:C

2009-10 2010-11 2009-10 2010-11 2009-10 2010-11 T1 Mycobutanil @

1gm/litre 10.30

(18.73)* 11.20

(19.53) 10.70

(19.13) 8.60 (17.05) 20.30(26.79) 13.90(21.92) 12.80 13.7 13.2 1.81

T2 Hexaconazole @ 1ml/litre

8.30 (16.67)

8.20 (16.59)

8.20 (16.63)

9.40(17.86) 12.70(20.90) 11.00(19.38) 14.30 14.8 14.5 9.63

T3 Penconazole @ 1ml/litre

5.80 (13.93)

6.40 (14.60)

6.10 (14.27)

6.70(15.04) 14.50(22.40) 10.30(18.72) 17.20 15.6 16.4 5.80

T4 Propiconazole @ 1ml/litre

9.40 (17.90)

9.30 (17.73)

9.40 (17.82)

9.50(17.93) 21.00(27.28) 14.80(22.60) 14.10 15.7 14.9 6.2

T5 Difenconazole@ 1ml/litre

6.70 (15.03)

7.40 (15.77)

7.10 (15.40)

8.60(17.00) 13.80(21.83) 11.10 (19.42) 14.80 15.5 15.2 3.27

T6 Tridimefon @ 1gm/litre

11.40 (19.70)

11.20 (19.57)

11.30 (19.63)

8.20(16.63) 19.80(26.40) 13.50(21.51) 14.10 15.3 14.7 3.12

T7 Tridemorph @ 1ml/litre

19.90 (26.50)

20.00 (26.58)

20.00 (26.54)

7.60(15.96) 23.50(28.98) 14.60(22.47) 13.60 14.2 13.9 4.83

T8 Carbendazim @ 1gm/litre

20.10 (25.67)

21.30 (27.50)

20.00 (26.58)

8.20(16.67) 21.30(27.50) 14.10(22.08) 13.20 13.9 13.5 5.77

T9 Propineb @ 3gm/litre

18.20 (25.27)

17.00 (24.35)

17.60 (24.81)

10.80(19.18) 23.00(28.65) 16.40(23.92) 12.90 14.2 13.6 3.65

T10 Control 30.30 (33.37)

33.00 (35.08)

31.60 (34.22)

23.70(29.10) 34.60(36.03) 29.00(32.57) 11.20 12.7 11.9 -

SEm ± 1.187 1.068 0.748 1.192 1.645 0.989 0.351 0.389 0.219 CD at 5% 3.527 3.174 2.222 3.543 4.887 2.938 1.041 1.157 0.651 The pooled data (Table 1) of two years for Alternaria blight and grey mildew indicated that all the

treatments were significantly superior over untreated control. The triazoles under study were found to be significantly effective in the management of the diseases. The least PDI was observed in Penconazole of 6.10 PDI and 10.30 PDI for Alternaria blight and grey mildew respectively followed by Difenconazole

Efficacy of Triazoles in Management of Major Fungal Foliar Diseases of Cotton 289

(7.10 PDI for A. blight and 11.10 PDI for grey mildew) and Hexaconazole (8.20 for A. blight and 11.00 PDI for grey mildew) which were on par with each other and significantly superior over rest of the treatments followed by all other triazole group of fungicides under study.

Cotton Yield

The cotton yield was significantly superior in all the treatments as compared to untreated control. The results indicated that, all the triazoles under study have showed higher yield. Next best treatments were viz., Tridemorph (13.9 q/ha), Propineb (13.6 q/ha), Carbendazim (13.5 q/ha) and Mycobutanil (13.2 q/ha), on par with each other, but differed significantly with the untreated control.

The pooled data of two years depicted that, the triazole group of fungicides was found to be more effective in enhancing the yields significantly (Table 1). Pooled maximum yield of both the years was noticed in Penconazole (16.4 q/ha), which was significantly superior over all other treatments, followed by Difenconazole (15.2 q/ha), Propiconazole (14.9 q/ha), Triadimefon (14.7 q/ha) and Hexaconazole (14.5 q/ha) . The least yield was noticed in untreated control (11.9 q/ha).All the treatments were found to be significantly differ with untreated control.

Benefit Cost Ratio (BCR)

From the pooled data of two years, it is evident that maximum B: C ratio was observed in Hexaconazole (9.63) followed by Propiconazole (6.2) and Penconazole (5.80) (Table 1).

In the present investigation, it is evident that all triazoles under study were found to be effective in control of the grey mildew and Alternaria blight disease, which in turn reflected in more cotton yield. Among these triazoles, Penconazole followed by Hexaconazole and Difenconazole reduced the disease severity of both the diseases effectively and also enhanced the yield. These findings are in accordance with Khodke and Raut( 2009) who reported that these triazoles gave the effective control of grey mildew.

The benefit cost ratio is an important parameter for recommendation of any treatment for successful control of plant disease. In the present study, though the treatments containing three sprays of Penconazole, Hexaconazole, Difenconazole, Triadimefon and Propiconazole gave significant control of both the diseases, maximum Cost Benefit ratio of 9.63 was realized in treatments containing three sprays of Hexaconazole (0.1%) followed by Propiconazole (6.2) and Penconazole (5.80). This clearly indicated that three sprays of Hexaconazole (0.1%) are more useful not only in reducing the cost of protection but also gave higher benefits as compared to other treatments and can be recommended as one of the components in integrated disease management of cotton. This is followed by Difenconazole and Penconazole applications. Similar types of findings are observed by many workers (Khodke and Raut, 2009, Algarsamy and Tagarajan, 1986). Hence, spraying of Hexaconazole (0.1%) could be considered as an effective management practice to manage major fungal foliar diseases.

REFERENCES [1] Anonymous, 2009, Ann. Rep. of All India Co-ordinated Cotton Improvement Project, for 2008-09, Central Institute for

Cotton Research Regional Station, Coimbatore. [2] Algarsamy, C. and Tagarajan, R., 1986, Efficacy of fungicides against grey mldew disease of Cotton. Madras agric. J.,73:

651-652 [3] Chattannavar, S. N., Hosagoudar, G. N., Ashtaputre, S. A. and Ammajamma, R., 2009, Evaluation of cotton genotypes for

grey mildew and Alternaria blight diseases. J. Cotton Res. Dev., 23(1) : 159-162. [4] Khodke, S.W and Raut, B.T., 2009, Chemical management of grey mildew caused by Ramularia areola Atk. of diploid

cotton [5] Sheo Raj, 1988, Grading for cotton disease, CICR, Nagpur. Bull., pp. 1-7. [6] Shivankar, S. K. and Wangikar, P. D., 1992, Estimation of crop loss due to grey mildew disease of cotton caused by

Ramularia areola. Indian Phytopath. 45: 74-76.

Damage Caused in Cotton by Different Levels of Ramulosis in Brazil

Alderi Emídio De Araújo1, Alexandre Cunha De Barcellos Ferreira2 and Camilo De Lelis Morello2

1Embrapa Algodão, CP: Campina Grande, PB, Brazil 174, CEP 58428–095 2Embrapa Algodão, Research Group of Cerrado, Embrapa Arroz e Feijão C.P. 179,

CEP 75375–000, Santo Antônio de Goiás, GO, Brazil e-mail: [email protected]

Abstract—The ramulosis caused by Colletotrichum gossypii var. cephalosporioides is one of the most important diseases of cotton in Brazil. The damage can range from 20 to 30% reaching 85% in severe cases. This study aimed to assess the damage to cotton caused by different levels of disease severity. The experiment was carried out in state of Goiás, in the season of 2006. The treatments were five severity indexes based on the following descriptive key: 1- plant without symptoms; 2-plants with necrotic spots in the young leaves; 3- necrotic spots in the leaves, shortening of internodes and initial broom; 4- necrotic spots in the leaves, shortening of internodes, broom little developed and height reduction; 5- necrotic spots in the leaves, shortening of internodes, broom very developed and height reduction. The plants with 40 days old age were inoculated with a suspension of 2x105 conidia/ml of the pathogen and to assure the occurrence of different levels of severity, the treatments with low scores of the key were sprayed with fungicides according to disease development. The experimental design was in randomized blocks with 5 treatments and 4 repetitions. Were assessed the following variables: height of the plants, number of bolls, weight of the bolls and lint production. The more important damage caused by disease were the reduction in the weight of the bolls and in the lint production. To these variables the reduction was more than 70% when the severity of the disease was high. The reduction in the plant height was higher when the disease severity achieved the 3 and 4 points of the key. Based on these results we conclude that is very important the control of the disease in the initial stages until the point 2 of the descriptive key to avoid significant damage to the fiber production

Keywords: disease, fungus, control, Colletotrichum

INTRODUCTION

The ramulosis, caused by Colletotrichum gossypii var. cephalosporioides, is one of the most important diseases of cotton in Brazil. The main characteristic of this disease is the breaking of apical dominance, which induces successive shoots, giving to the plant the appearance of a broom. The damage can range from 20% to 30%, reaching 85% in severe cases. In Mato Grosso were reported damages of up to 80% (Freire et al., 1997).

The environmental conditions more favorable to ramulosis are high rainfall, temperatures of 25 º C to 30 º C and relative humidity above 80% (Miranda; Suassuna, 2004; Silveira, 1965). In state of Mato Grosso, the temperature range favorable for the development of the disease ranged from 20 C to 30 º C (Araújo, Farias, 2003), while in state of Minas Gerais the optimum temperature for the higher incidence of disease was 18.3 ° C (Santos, 1993).

The first symptoms of ramulosis occur in young leaves and are characterized by circular necrotic spots. Afterwards the tissue of these spots breaks up and detaches itself, resulting in star-shaped perforations. The uneven growth of the tissue induces wrinkling of the leaf. Soon after the emergence of the first leaf injury, death occurs from the apical meristem of the affected branch, halting its growth stimulating the sprouting of lateral buds, which culminates in the formation of a cluster of branches with short internodes and swollen, giving the plant the aspect of a broom (Araújo; Suassuna, 2003; Suassuna, Coutinho, 2007).

49

Damage Caused in Cotton by Different Levels of Ramulosis in Brazil 291

The ramulosis can also affect the quality of fiber, like length, fineness, uniformity and micronaire and the damage can cause the reduction in weight of bolls and in the percentage of fibers (Carvalho et al., 1984).This study aimed to determine the damage caused to cotton by different levels of severity ramulose.


The experiment was carried ou at the Experimental Station of Embrapa / GO Foundation in Santa Helena de Goiás, in the season of 2006. The cultivar used was BRS Ipe, whose seeds were treated with the insecticide imidacloprid (270 g kg ai/100), and fungicides tolylfluanida (75 g kg ai/100) + pencycuron (75 g ai/100 kg).

The treatments were of five levels of disease severity based on the descriptive key proposed by Araújo et al. (2003): 1- plant without symptoms; 2-plants with necrotic spots in the young leaves; 3- necrotic spots in the leaves, shortening of internodes and initial broom; 4- necrotic spots in the leaves, shortening of internodes, broom little developed and height reduction; 5- necrotic spots in the leaves, shortening of internodes, broom very developed and height reduction.

Infection of plants was obtained through inoculation of a suspension of 2x105conidia / ml of the pathogen, 40 days after emergence. Plants with level 1 of the descriptive key were not inoculated. In order to ensure the different levels of severity of the disease, plants with disease severity with levels 1 and 2 were sprayed with the fungicide propiconazole + trifloxystrobin(125 + 125 g / L a.i. / ha), based on data obtained by monitoring the evolution of disease. The other levels of the descriptive key were obtained through the systematic control of the development of the disease with spray with trifloxystrobin + propiconazole (125 +125 g / L a.i. / ha) when necessary in both cases. The first spray was made at the levels 3 and 4, and one application was sufficient to maintain levels while level 5 was obtained without spray.

The design was randomized blocks, with five treatments and four replicates, and the parcel had four lines 5 m, considering how useful the two central rows. The evaluation was performed at 140 days after emergence, having been employed the descriptive key proposed by Araújo et al. (2003). The measured variables were: plant height, number of bolls / plant, boll weight and cotton lint production.


Based on the results shown in Table 1, it was observed that the disease has negatively affected all variables. The largest damage were observed for boll weight and in production of cotton lint per plant. For these variables, the decrease was greater than 70%, indicating that the ramulosis, in advanced stages, causes severe damage to production. Although the differences in the number bolls per plant were not as expressive, it is important to note that the weight the boll was reduced with the increase in disease severity, reflecting directly in the production of cotton lint. The number of capsules suffered the greatest reduction when there was increase in the severity of the disease, Based on the results shown in Table 1, it was observed that the disease has negatively affected all variables. The largest damage were observed for boll weight and in production of cotton lint per plant. For these variables, the decrease was greater than 70%, indicating that the ramulosis, in advanced stages, causes severe damage to production.

Although the differences in the number of bolls per plant were not as expressive, it is important to note that the weight the boll was reduced with the increase in disease severity, reflecting directly in the production of cotton lint. The number of capsules suffered the greatest reduction when there was increase in the severity of the disease, as can be observed the data relating to notes 4 and 5 of the descriptive key. This phenomenon is associated the fact that higher levels of severity of the ramulosis can induce an increased production of branches vegetative rather than fruiting branches, what determines a reduction in production boll. The reduction in plant size was observed more steeply from the notes 3 and 4 of the descriptive key. From these levels disease severity, there were also further damage to production. Thus, based the observations, there is the need for control the disease in the earliest stage, in view of the irreversibility of damage since the early symptoms of broom, that begin to manifest when the plant shows increased levels of severity recorded from the level 3 of the descriptive key.


These results corroborate those already obtained by Carvalho et al. (1984), in the state of Pernambuco. However, it should be pay attention to the fact that climatic conditions of Goiás state may be more favorable to ramulosis, due to higher rainfall and regular rainfall usually recorded in the Midwest of Brazil, with a view that C. gossypii var. cephalosporioides is widespread primarily by splashing water, and the rain is a major agent of dispersal of inoculum. Therefore, monitoring of disease in the state of Goiás, in brazilian Midwest should be more systematic, given the more favorable conditions the development of disease. Therefore, the use of resistant cultivars is recommended and the permanent monitoring of farming, to prevent that the disease reach to rates of high severity and induce significant damage to production.

The control measures that prevent the increase of inoculums such as the use of seed health and crop rotation should be privileged. The chemical control should be implemented in the early stages and should never exceed the level 2 of the descriptive key used for the evaluation of disease severity.

TABLE 1: PLANT HEIGHT (CM), NUMBER OF BOLLS, BOLL WEIGHT (G) AND COTTON LINT PRODUCTION / PLANT (G) OF COTTON FOR DIFFERENT LEVELS OF SEVERITY RAMULOSE. SANTA HELENA DE GOIAS, BRAZIL, 2006.

Level of the Descriptive Key* Plant Height Number of Bolls Boll Weight Fiber Production 1 126,16 a 3,33a 32,51a 12,01a** 2 121,50ab 2,58ab 27,92ab 9,47b 3 111,34b 2,31ab 20,94bc 7,23b 4 85,41c 1,96b 14,54cd 5,51bc 5 69,8d 1,53b 8,48d 3,21c

VC 6,3 24,88 21,12 23,64 *Descriptive key: 1- plant without symptoms; 2-plants with necrotic spots in the young leaves; 3- necrotic spots in the

leaves, shortening of internodes and initial broom; 4- necrotic spots in the leaves, shortening of internodes, broom little developed and height reduction; 5- necrotic spots in the leaves, shortening of internodes, broom very developed and height reduction.

**Means followed by same letter vertically do not differ by Tukey test at 5% probability.

REFERENCES [1] Araújo, A E., Suassuna, N. D., Farias, F. J. C., Freire, E. C. Escalas de Notas Para Avaliação de Doenças Foliares do

Algodoeiro. In: Congresso Brasileiro de Algodão, 4., 2003, Goiânia. anais... campina grande. Embrapa Algodão, 2003, 1 cd-rom.

[2] Araújo, A. E.; Farias, F. J. C. Progress of witches broom disease of cotton in Mato Grosso State Brazil. In: World Cotton Research Conference, 3., 2003, Cape Town, Anais... Cape Town, ICAC, p. 1428-1430.

[3] Carvalho, L. P.; Cavalcanti, F. B., Lima, E. F., Santos, E. V. Influência da ramulose nas características de fibra do algodoeiro. Fitopatologia Brasileira, v. 9, p. 593-598. 1984.

[4] Freire, E. C.; Soares, J. J.; Farias, F. J. C.; Arantes, E. M.; Andrade, F. P.; Paro, H.; Laca-Buendia, J. P. Cultura do algodoeiro no estado de Mato Grosso. Campina Grande-PB: Embrapa Algodão, 1997, 65 p. (Embrapa Algodão. Circular Técnica 23).

[5] Miranda, J. E.; Suassuna, N. D. Guia de Identificação e controle das principais pragas e doenças do algodoeiro. Campina Grande: Embrapa Algodão, 2004. 47 p. (Embrapa Algodão. Circular Técnica, 76).

[6] Santos, G. R. Progresso da ramulose do algodoeiro e transmissão de Colletotrichum gossypii South var. cephalosporioides Costa pelas sementes. 1993. 53 p. Dissertação (Mestrado em Fitopatologia) – Universidade Federal de Viçosa, Viçosa, MG, 1993.

[7] Silveira, A. P. Fungos e bactérias. In: Instituto Brasileiro De Potassa. Cultura e adubação do algodoeiro. São Paulo, 1965. p. 417- 419

Insecticidal Toxin Genes from Bacterial Symbiont of Thermotolerant Isolate of Heterorhabditis indica,

Entomopathogenic Nematode

Nandini Gokte-Narkhedkar, Kanchan Bhanare, Prachi Nawkarkar, Prashanth Chiliveri and K.R. Kranthi

Division of Crop Protection, Central Institute for Cotton Research, Nagpur

INTRODUCTION

In the last two to three decades use of chemical control for pest management has become less acceptable as concerns about contamination of soil and water and deleterious effects on man and livestock have led to restrictions on their use. This and development of resistance in insects against commonly used chemicals has led to demand for development of alternates for pest management and biological control is one such option. Entomopathogenic nematodes with their associated bacteria have been identified as viable option for insect management and toxicity of EPN-bacterial system to insects is largely attributed to toxins produced by bacterial symbiont . Considerable progress has been made in identification of toxin genes from bacteria Photorhabdus and Xenorhabdus (Williamson and Kaya, 2003). Toxin genes from EPN- bacterial system can be used as alternative to Bt toxins or can be used to pyramid multiple resistance genes for broad range and effective resistance against insect pests. A thermophilic isolate of EPN Heterorhabditis indica has been developed at CICR and bacterial isolate found associated with this EPN was found to be very effective against sucking pests of cotton in field trials undertaken at CICR, Nagpur, its regional station Sirsa and at Nanded. Therefore Bacteria isolated from thermophilic EPN H.indica isolate were taken up for further characterization and identification of toxin genes.


Bacteria were isolated from juveniles of nematode H.indica on standard bacteriological media and bacteria were taken up for molecular and biochemical characterization. (Bergy’s Manual). The biochemical parameters taken up were Colony Morphology on Nutrient Agar,Gram Stain, Pigmentation, Levan production, Methyl Red, Voges-Proskauer Test, starch hydrolysis, oxygen requirement, H2S production, indole production, nitrate reduction, Urease test, ADH test, citrate, catalase, gelatinase, motility, tyrosinase and Galactosidase tests. Carbohydrates fermentation studies for the bacterial isolate were carried out for 21 carbohydrates.

For molecular characterization 16s ribosomal RNA sequence of bacterial isolate was amplified using oligonuceotide primers (5’GGA GAG TTA GAT CTT GGC TC3’ sense and 5’AAg GAG GTG ATC CAG CCG CA3’(Brunel et al., 1997). Samples amplified using 25µl of reaction with 10mM of each primer, 0.1 µg of DNA template, 12.5 µl 2X PCR- master mix and distilled Water. PCR conditions were same as Brunel et al., 1997 with amplification at 570C. The sequence amplified was around 1550 bp and it was cloned in pEMT vector for sequencing.

TOXIN ISOLATION

For isolation of toxins, the bacteria was cultured on LB broth for 48 hrs. on shaker. Extracellular and intracellular fractions separated by centrifugation and sonication . Different fractions from the extracellular and intracellular components of bacterium separated using columns, centrifugal devices and gel filteration were bioassayed against 3rd instar larva of Helicoverpa armigera for insecticidal activity. Protein content of different fractions was estimated and fractions were tested against 3rd instar larva of Helicoverpa armigera for insecticidal activity.

50


DESIGNING OF PRIMERS FOR AMPLIFICATION OF TOXIN GENES

The primer pairs have been designed by identifying 8-10 amino acid stretch in protein that is rich in amino acid codes by only one or more codons (Met, Trp, Phe, Cys, His, Lys, Asp, Gly, Gln, Tyr) and that has no or few amino acids coded by six codon (Ser, Leu, Arg). Primers have also been designed by aligning known toxin sequences from data bases.

F-5’ACCGCCGAGTCCCTTGGCTA3’,R-CGCTGCTGTCTGTGGAGCGTT F-5’CTTCGGCGCCATTCCCCGTT 3’, R-GCGCTACTCTCGGCAGCAGG F-5’GCGGAGGATGGCCGCAAACT 3’, R-CGTGCTGTGCTACCGCGTCA F-5’CTTCGGCGCCATTCCCCGTT 3’,R-GCGCTACTCTCGGCAGCAGG F-5’CGGTGACGCCGCACAGTTCT3’,R-TCTGTGCGACCGGAAACGGC F -5’ TACC AATA TGTTAATTG TGGAC 3’, R R - 5’ CCA TCA TTTCAC ATA ACCG 3’ F-5’ TTCG AATA CCAA TATG TTAA TTGTGGAC 3’, R-5’ CCA TCA TTTCAC ATA ACCG 3’ F-5’ ATTACCAATATGT TAATTGTGG 3’, R - 5’ TCATCATATATTTTATAATG F -5’ GGTCTAGAATGTAAAGGCAACAC-3'), R- 5'-GGAAGGACGGAAAGTGGAGA-3‘ F-(5'-ACCATACGCATCGGACAAAC-3'), R-5'-CGTAGCGGTTATTCACTCTTCT-3‘ F -TCAGACTGATGCCAAAGG, R - CCATCAATAGTTCCTGCC, F -TCAGACTGATGCCAAAGG, R -CCATCAATAGTTCCTGCC F-5’ TACTTAGTTGAGCGGTCAGG, R - 5’ GCCATGCTCAGTTACTGC F-5’ TACTTGCTCA GACATTTCTCTATGG 3’,R – TTATTTAATGGTGTAGCG 3’ F 5’ACCATACGCATCGGACAAAC-3’, R 5’’CGTAGCGGTTATTCACTCTTCT-3’ F- 5’GGTCTAGAATGTAAAGGC-3’, R -5’GGAAGGACGGAAAGT 3’ F- 5’TACCACTGACAATACGTTTAT 3’, R- 5’CGGTTACTGACGATTGCTG3’ F- 5’ TCATGAAATACGTCCTAAGTGG 3’, R- 5’ AAA TATGT AAAACTATGGG GTTC3’ F- 5’ ACCTTAACTAATACAGACTTAG 3’, R- 5’ AA AGAAAAGAAATTTACGCGTG 3’ F - 5’ TGTAGTTACAAGAAAGAACC 3’, R- 5’ ATGTCTAAATACAAATTAAACC 3’ F-5’ CTTATACTATACTCAGGCAG 3’, R- 5’ ATTGCAAGATATTAATTACAAAG 3’


Molecular Characterization of Bacterial Isolate

Fig. 1

The sequence amplified was around 1550 bp and it was cloned in pEMT vector for sequencing. Plasmid DNA was isolated using Qiagen miniprep kit and sequenced. The sequences were blasted. The sequence of bacterial isolate showed 96% similarity to Paenibacillus sp. As this bacterial isolate showed toxicity to sucking insect pests, this bacterial isolate was also characterized for biochemical parameters.

Biochemical characterization of bacterial isolate associated with H. indica and identified as Paenibacillus sp.

Insecticidal Toxin Genes from Bacterial Symbiont of Thermotolerant Isolate of Heterorhabditis indica 295

Test Result Test Result Gram Stain Gram Positive. Methyl Red Test Negative. Pigmentation No pigmentation. Voges-Proskauer Test Positive Levan Production No levan Production. Gelatin Test Weakly positive Urease Test Negative Oxygen requirement Facultatively anaerobic. Tyrosinase Test Positive Production of H2S Gas. No H2S production was observed. Citrate Test Positive Production of Indole. No Indole production was seen. Catalase Test Positive Nitrate Reduction Negative Amino Acid decarboxylase Negative Growth on Mc Conkey Agar Growth observed Starch hydrolysis test Positive. Esculin Hydrolase Test Positive Casein Hydrolysis Positive Arginine Hydrolase Test Negative Motility Test Negative Oxidase Test Negative Carbohydrate Fermentation test The Test strongly positive for Glucose, Fructose, Galactose, Maltose, Raffinose, Sucrose, Salicin, Trehalose and weakly positive for adonitol. The test is negative for—Arabinose, Cellobiose, Inositol, Inulin, Lactose, Mannose, Mannitol, Melibiose, Rhamnose, Sorbitol, Xylose and Dulcitol. No gas production was observed.

Toxin Isolation

Different fractions from the extracellular and intracellular components separated using columns, centrifugal devices and gel filteration were bioassayed against 3rd instar larva of Helicoverpa armigera for insecticidal activity. Protein content of different fractions was estimated and found to range between 1.32 -1.68 mg/ml. The fractions were tested against 3rd instar larva of Helicoverpa armigera for insecticidal activity.

TABLE 1: INSECTICIDAL EFFICACY OF DIFFERENT FRACTIONS AT 10 μG

Fraction % Dead Intrahaemocoelic % Dead Oral 1KG 22 20 3KG 40 60

10KG 58 80 50kG 67 100

100KG 45 40 Control 10 0

1K-More than 1kDa, 3-more than 3kDa, 10, More than 1kDa, 50- More than 1kDa, 100 -More than 1kDa

Individual fractions at three different concentrations were (5, 10 and 15µg) were injected into haemocoel of 3rd instar H.armigera larvae. At l0 µg difference in efficacy of different fractions was evident and results are presented in Table 1. Control was maintained with physiological saline solution. Observations on insect mortality after 24 hrs revealed that fraction 50 -100 kDa recorded more than 98% mortality after 24 h while 10K fraction recorded 60% morality. In other fractions mortality was recorded after 48 hrs only while in control there was nil mortality up to 48 hr. These fractions were also evaluated for oral toxicity with H.armigera neonates. 50K fraction was also recorded to have oral toxicity.

50K fraction was run on native PAGE and individual bands were cut, eluted in buffer (140 mm NaCl, 2.7 mM KCl, 10mM Na2HPO4, 1.8 mMKH2PO4, pH 7.3) and analysed for insecticidal activity.

Fig. 2


The elutes of bands were applied to artificial diet for oral toxicity to Helicoverpa armigera neonates. These were also injected in intrahaemoceolic for toxicity to H.armigera. LC50 experiments were conducted for 48 h with neonate larvae, and were replicated on three separate occasions with 12 larvae per treatment. Growth inhibition studies were 72 h in duration and were repeated twice with 12 individuals per treatment. Mortality data from the LC50 experiments was analyzed by Probit analysis. Results indicate that two bands of approximately 950kDa had insecticidal effect. Lc50 for A band was calculated at 0.1 µg while Lc50 for B band was 0.12 µg. At concentration of 0.18 µg injected in haemocoel mortality ranged between 89-87%. Oral toxicity to neonates of H. armigera was also recorded. At 0.05 µg oral toxicity to neonates was recorded with 78-85% mortality of neonates. Evaluation of toxicity of these components against sucking pests is underway.

Rajagopal and Bhatnagar(2002) has isolated two protein complexes of approx. 1000kDa from Photorhabdus luminescens subsp. akhurstii which were active against Spodoptera litura and Galleria mellonella. Amplification of Toxin Genes

Fig. 3

Insecticidal Toxin Genes from Bacterial Symbiont of Thermotolerant Isolate of Heterorhabditis indica 297

D6TcdB, Wg TcdA, D6TcdA2,Wg TcdA2,G1 TcdB, G1 TcdAB, G5 TcdA2, Photo TcdA, WgTcd Ab could be amplified by using primers designed for amplification of toxin genes and standardization of PCR conditions. These were cloned in pGEM-T vector and sequenced.

The sequences of PhotoTcdAB, TcdB were blasted. These were found to have 98% similarily with Serine protease gene and phospholipase of Bacillus thuringiensis and B.cereus.

Amplification of Tcc Genes from Paenibacillus sp. is significant as this appears to be first reports of a Paenibacillus species, strain, or protein having toxicity to lepidopterans. Furthermore, this may also first known report of a Paenibacillus having toxin complex (TC)-like proteins controlling insects and like pests. Genes from Photorhabdus encode large insecticidal toxin complexes which cause septicaemia in insects. Arabidopsis thaliana plants expressing toxin A from Photorhabdus luminescens showed considerable activity against lepidopteran insects and moderate activity against colepteran insects (Liu et al, 2003). Identification and cloning of toxin genes from Paenibacillus would make available genes effective against sucking pests. Further work on cloning of full length gene and their expression in suitable vector is underway.

REFERENCES [1] Brunel B., Givaudan A., Lanois A., Akhurst R.J. and Boemare N.E. (1997). Fast and accurate identification of Xenorhabdus

and Photorhabdus by restriction analysis of PCR amplification. Appl. Environ. Microbiol., 63:574-580. [2] Liu, D., Burton, S., Glancy T., Li, Z.S., Hampton, R., Meade, T. and Merlo, D.J. (2003). Insect resistance conferred by 283

kDa Photorhabdus luminescens protein TcdA in Arabidopsis thaliana. Nat. Biotechnology 21: 1022-1028. [3] Rajagopal, R. and Bhatnagar, R.K. (2002). Insecticidal toxic proteins produced by Photorhabdus luminescens akurstii, a

symbiont of Heterorhabdits indica. J.Nematol. 34” 23-27. [4] Williamson, V.M. and Kaya, H.K. (2003). Sequence of a symbiont. Nat. Biotechnology 21: 1294-1295.

Identification and Characterization of a Novel Source of Resistance to Root-Knot Nematode in Cotton

Mota C. Fabiane, Giband Marc, Carneiro, D.G. Marina, Silva, H. Esdras, Furlanetto Cleber, Nicole Michel, Barroso, A.V. Paulo and Carneiro and M.D.G. Regina

Research Scientist, Cirad, UMR AGAP–Embrapa Algodão, Rodovia Go–462, Km 12, Zona Rural 75.375–000 Santo Antônio de Goiás, Go–Brazil

E-mail: [email protected].

Abstract—The root-knot nematode (RKN) Meloidogyne incognita Kofoid and White 1919, Chitwood 1949 is a major constraint in cotton (Gossypium hirsutum L.) production in numerous countries. Control of RKN has been hampered by the lack of high-quality local varieties exhibiting high levels of resistance as well as the lack of options for crop rotation. High levels of resistance occur in breeding lines, but this high level of resistance has not been readily transferred to cultivated varieties. Resistance to RKN is also found in wild tetraploid cotton accessions that represent valuable resources for novel genes/mechanisms to be used for cotton improvement.

In this work, accessions of Gossypium spp. were evaluated for resistance to RKN in greenhouse experiments. Responses to infection by M. incognita varied among the tested accessions, ranging from highly susceptible to resistant. Some accessions displayed a significant reduction in the nematode reproduction. Histological observations of one of the highly resistant G. barbadense accession showed that resistance may occur through two-stage mechanism involving a hypersensitive-like response.

The highly resistant accession was crossed with a susceptible one to generate F1 and F2 plants for further genetic studies. Analysis of the response of these F1 and F2 plants to RKN inoculation indicated that resistance is recessive, and controlled by at least one major gene. Analyses using molecular markers associated to known RKN resistance loci showed that the allele(s) involved are different from those previously described.

The characterization of the genetics and of the defense mechanisms associated with this novel source of resistance to RKN in cotton constituted a first step towards its use in crop improvement.

Keywords: Gossypium, cotton, root-knot nematode, host-plant resistance, hypersensitive response

INTRODUCTION The root-knot nematode (RKN) [Meloidogyne incognita Kofoid and White 1919 (Chitwood 1949)] is a major constraint in cotton (Gossypium hirsutum L.) production in a number of countries, causing direct damages and increasing in the severity of other root diseases, including Fusarium wilt disease (Hyer et al. 1979; Shepherd 1982; Jeffers and Roberts 1993). The importance of this pest has been increasing over the years, and in some regions, it has become one of the major causes of yield reduction.

Resistant varieties not only help control the disease and maintaining crop productivity, but they also help decrease nematode populations in the soil and protect following rotations (Williamson and Hussey 1996; Ogallo et al. 1999; Starr et al. 2007; Davis and Kemerait 2009). Control of RKN has been hampered by the lack of high-quality locally-adapted varieties exhibiting high levels of resistance as well as the lack of adequate options for crop rotation.

Search for high levels of RKN resistant in cotton germplasm has been undertaken over the years, in both cultivated species as well as in wild relatives (Jenkins et al.1979; Shepherd 1983; Robinson and Percival 1997). Despite these efforts, few accessions with a high level of resistance have been identified. In a more recent study, Robinson et al. (2004) identified three accessions of G. hirsutum (TX-25, TX-1828, and TX-1860) that showed resistance levels equivalent to that of Auburn 623 RNR. This elite breeding line (Shepherd 1974a), that was selected from crossing between two moderately-resistant accessions – Clevewilt 6 and Wild Mexican Jack Jones (Shepherd 1974b), exhibits the highest level of resistance to RKN known to date in cotton, and has been used to derive a number of breeding lines (Shepherd et al. 1996). Nevertheless, the high level of resistance of Auburn 623 RNR and of its derivatives (“M-series”) has not been transferred to superior cultivars. Only very recently were

51

Identification and Characterization of a Novel Source of Resistance to Root-Knot Nematode in Cotton 299

lines with high levels of resistance released (Davis et al. 2011; Starr et al. 2011). The cultivar Clevewilt 6 is also at the origin of the obsolete varieties Stoneville LA 887 (Jones et al. 1991) and Paymaster (Hartz) 1560, that were widely cultivated for their moderate levels of resistance to RKN, and of their sister lines (La. RN 4-4, La. RN 909, La. RN 910, La. RN 1032) (Jones et al. 1988). To date, the only available moderately RKN-resistant varieties with desirable agronomical and quality standards are Acala Nem X (Oakley 1995) and Acala NemX H Y (Anonymous 2005), which have a restricted diffusion due to their particular characteristics (“Acala-type cotton”).

Variability in virulence of RKN isolates on resistant cotton genotypes has been demonstrated (Robinson and Percival 1997; Zhou et al. 2000). Furthermore, selection of isolates with increased reproduction on resistant varieties after repeated exposures to resistant cotton was also evidenced (Ogallo et al. 1997), indicating the need to increase the number of the sources of resistance to achieve effective durable resistance. Indeed, cotton breeding for RKN resistance presently relies on a small number of – if not a unique – source of resistance, which make such genotypes vulnerable to resistance breakdown. Alternating sources of resistance, or pyramiding resistance factors constitutes a way to mitigate this problem.

Breeding for nematode resistance in cotton has been an arduous task. The difficulty in the phenotypic screening for resistance on a scale compatible with that of breeding programs, and the lack of a clear understanding of the genetic basis of resistance has made progress difficult. Genetic analyses involving different sources of resistance point out to the presence of multiple genes. Depending on the source of resistance and on the crosses used, genes with dominant and others with recessive effects have been detected; additive effects as well as transgressive segregation have also been shown to occur (Shepherd 1974b; Bezawada et al. 2003; McPherson et al. 2004; Zhang et al. 2007; Wang et al 2008; Ulloa et al 2010).

The efficient transfer of RKN resistance to improved commercial cultivars will largely depend on a clear knowledge of the genetics of the trait and on the availability of tools to facilitate such a transfer. Furthermore, the knowledge of resistance gene/locus diversity and of the allelic relations between these genes/loci is important to achieve a durable high level of resistance.

Molecular genetics tools, and in particular the genetic mapping of resistance genes/loci and the identification of molecular markers tightly associated with these resistance genes or loci have been useful in better understanding the genetics of RKN resistance in cotton, in studying the genetic relation between genes/loci, and represent powerful tools to assist the transfer of resistance for cotton crop improvement. In recent years, a number of genetic mapping studies have been undertaken aiming at the mapping resistance of loci and at identifying molecular markers associated with RKN resistance (Bezawada et al 2003; Shen et al 2006; Wang and Roberts 2006; Wang et al 2006; Ynturi et al 2006; Niu et al 2007; Wang et al 2008; Gutiérrez et al 2010; Shen et al 2010). These studies have allowed to clarify the status of nematode resistance loci in cotton, and to identify molecular markers tightly associated to major resistance genes that are useful in breeding.

These and other studies (Roberts and Ulloa 2010) point out to chromosome 11 as bearing major genes in at least two sources of resistance, and have resulted the identification of markers closely associated to resistance. In Acala NemX, the microsatellite marker CIR316 is closely associated with a major recessive gene (rkn1) (Wang et al 2006). In the Auburn 623 RNR-derived sources of resistance (M240 and M120), the same markers is associated with a major dominant gene, Mi-C11(Gutiérrez et al 2010, Shen et al 2010). It is not clear whether these loci are allelic or not. Interestingly, Clevewilt 6, one of the parental lines used to develop the highly resistant Auburn 623 RNR accession, also carries a resistance QTL associated with marker CIR316 (Bezawada et al 2003, Gutiérrez et al 2010). Similarly, a major QTL for resistance (galling index) was mapped on the same chromosome in M-495, a wild cotton germplasm line (He et al 2010). In G. barbadense, in addition to these major genes, chromosome 11 has also been shown to carry a transgressive segregation factor (RKN2) associated with the recessive rkn1 gene. On its own, RKN2 does not impart resistance, but when present with the rkn1 allele, RKN2


increases resistance (Wang et al 2008). The major resistance allele identified by marker CIR316 is not present in Wild Mexican Jack Jones (WMJJ), the second parental line of Auburn 623 RNR. Instead, WMJJ carries another locus on chromosome 14, linked to markers BNL 3545 and BNL 3661 that is also present in Auburn 623 RNR and its derivatives, but not in Clevewilt 6 (Gutiérrez et al 2010).

Consistent with previous studies, this latter molecular mapping study also showed that each one of the major genes/loci is responsible for different resistance mechanisms, that, when present together, lead to the highest level of resistance. The gene/locus on chromosome 11 primarily impacts root galling, while the proper allelic combination at locus on chromosome 14 induces a reduced egg production. The favorable allelic composition at all three markers lead to the highest level of resistance (Gutiérrez et al 2010).

IDENTIFICATION OF A NOVEL SOURCE OF RESISTANCE TO RKN IN COTTON

Accessions of Gossypium species, which included modern or obsolete cultivars, breeding lines, and wild accessions of G. hirustum, G. barbadense, and G. arboreum with known or suspected resistance to RKN were evaluated for their resistance to a Brazilian isolate of M. incognita race 3 under controlled conditions in a greenhouse. Resistance was evaluated based on three criteria: galling index (GI), egg mass index (EMI) and reproduction factor (RF).

Among the accessions tested, reactions to RKN inoculation varied from highly susceptible to resistant (data not shown). In agreement with previous studies (Shepherd 1983; Robinson and Percival 1997; Robinson et al. 2004), no general trend between species and reaction to inoculation was observed. Similarly, no relation with geographical origin was evidenced. Most of the accessions that had been tested in other studies showed responses in agreement with published results. Among the accessions tested, the G. barbadense accession from Peru CIR1348 showed highly reduced nematode reproduction (Table 1), and was classified as highly resistant. This accession was as efficient as M-315RNR – the resistant control – in reducing nematode reproduction (RF = 0.01 vs. RF = 0.03 for M315RNR). In addition, this accessions displayed very low galling index (GI = 0) and egg mass index (EMI = 0).

TABLE 1: GALLING INDEX (GI), EGG MASS INDEX (EMI) AND REPRODUCTION FACTOR (RF) PRESENTED BY DIFFERENT GOSSYPIUM SPP. 120 DAYS AFTER INOCULATION WITH 5,000 M. INCOGNITA EGGS PER PLANT

Accession GI1 EMI1 RF2

FM966 – susceptible control G. hirsutum 5 5 14a M-315RNR – resistant control G. hirsutum 0.8 0 0.03b CIR1348 G. barbadense 0 0 0.01b 1Mean value (8 repetitions) of GI or EMI. 0: no galls or egg masses, 1: 1-2 galls or egg masses, 2: 3-10 galls or egg masses, 3: 11-30 galls or egg masses, 4: 31-100galls or egg masses, and 5 >100 galls or egg masses per root system. 2 RF = FP/IP, were FP = final nematode population and IP = initial nematode population (IP = 5,000). Mean values (8 repetitions) were transformed in log (x+1). Means followed by different letters are significantly (P< 0.05) according to Scott-Knot’s test.

Accession CIR1348 thus appears to be as resistant to RKN inoculation as the accessions that display the highest level of resistance known to date (Auburn 623RNR and derivatives). Interestingly, CIR1348 is wild accessions of G. barbadense from Peru. South America, and in particular Peru, is considered to be the center of origin and diversity of G. barbadense (Giband et al 2010). It is thus expected that a rich genetic variability is encountered in wild accessions from this region (Westengen et al. 2005), including for resistance to RKN and other disease or pests. This situation is similar to that of wild accessions and landraces of G. hirsutum from Mexico, the center of origin of the species, which include the accessions Wild Mexican Jack Jones and TX-25 in which notable levels of resistance were identified (Shepherd 1983; Robinson and Percival 1997; Robinson et al. 2004).

HISTOLOGICAL CHARACTERIZATION OF THE RESISTANCE REACTION IN ACCESSION CIR1348

The mechanism of the resistant displayed by the highly resistant accession CIR1348 was studied through the observation of histological sections of root samples using bright-field and UV microscopy.


Stage 2 juvenile (J2) penetration was not affected in accession CIR1348, since similar numbers of J2s could be observed in the susceptible and resistant accessions. Similar observations were made in the moderately resistant accession Clevewilt-6 (McClure et al. 1974), in the highly resistant accession M-315 RNR (Jenkins et al. 1995), and in number of other resistant accessions (Faske and Starr 2009). Pre-existing mechanisms which could impede nematode penetration seems to be apparently absent in cotton. Rather, in accession CIR1348, as in other RKN-resistant accessions of cotton, it appears that resistance may result from post-penetration events associated with the blocking or delay of nematode development and reproduction.

Root sections harvested at 7-21 days after inoculation (DAI) showed major alteration in the cells in contact with the nematodes. Hypersensitive- response (HR)-like lesions were found around all nematodes after they penetrated the epidermis and migrated through the cortex, or when they reached the vascular cylinder. Sections also showed almost entire bodies of nematodes completely surrounded by autofluorescence or toluidine dark-stained components.

At 21-29 DAI, only a few giant cells were observed, some of them showing multiple nuclei and reduced thickening of walls. At 21 DAI, strongly deformed J3/J4 juveniles were detected in the vicinity of the altered giant cells. At 29 DAI, most giant cells had degenerated, and presented a retracted cytoplasm containing numerous small vacuoles. No adult female with eggs were seen in any of the 34-45 DAI sections that were analyzed.

It thus appears that in CIR1348 at least two different mechanisms could be involved in the expression of resistance. One mechanism, which occurs at about 7 DAI, blocks or delays the development of J2 that have penetrated the roots. The second, that involves a mechanism impeding the formation of functional feeding sites, occurs at about 21 DAI and further impedes the formation of adult females.

Genetic analyses (McPherson et al. 2004; Zhang et al. 2007) point out to a 2-gene model for the inheritance of resistance to RKN in cotton. In their study, Jenkins et al. (1995) proposed that one gene acting at an earlier stage is responsible for the mechanism seen at 8 DAI, while the second explains the later (24 DAI) phenomenon. Molecular mapping data (Ynturi et al. 2006; Gutiérrez et al. 2010) support these hypotheses, and revealed the occurrence of QTLs on chromosomes 11 and 14 to explain the resistance in cotton accessions (Auburn 634 RNR and M-240 RNR, respectively) which share the same source of resistance as M-315 RNR. The QTL on chromosome 11 is associated with reduced root galling index, while that on chromosome 14 is associated with reduced egg production (Gutiérrez et al. 2010). Whether this situation holds true for accession CIR1348 remains to be clarified.

GENETIC ANALYSIS OF THE RESISTANCE IN ACCESSION CIR1348

The highly resistant accession CIR1348 was crossed with a susceptible one (the susceptible control FM966) to generate F1 and F2 plants for further genetics studies. As above, progenies were assessed for GI, RMI, and RF after RKN inoculation under controlled conditions. The analysis of the response of the F1 plants clearly showed that resistance in accession CIR1348 is recessive, the F1 showing a GI = 5, EMI = 4.8, and RF = 25, values similar to that of the susceptible parent FM966 (GI = 5, EMI = 5 and RF = 29).

The results of the F2 plants were more complex to analyze. Analyses conducted on a reduced number of plants (n = 18) showed that at least one major recessive gene is involved in the determination of the phenotype. Nevertheless, these analyses cannot rule out the hypothesis that a second recessive gene, with a more moderate effect on the phenotype, is also involved in determining the high level of resistance observed in accession CIR1348. The analysis of a larger number of F2 plants is underway to clarify this point.

If the second hypothesis holds true, the situation in accession CIR1348 would be similar to that in other sources of resistance, with the main difference being that the resistance in the former is recessive, while it is usually considered dominant (or partially dominant) in the latter.


A number of studies (Shen et al 2006; Wang et al 2006; Gutiérrez et al 2010; He et al 2010; Shen et al 2010) have shown that the SSR marker CIR316, mapped on chromosome 11, is associated to RKN resistance in a number of accessions. To verify if the same locus is also involved in the resistance in accession CIR1348, we applied marker CIR316 and analyzed the resulting amplification profile.

While the susceptible and resistant controls (FM966 and M-315RNR, respectively) exhibited the banding pattern expected for marker CIR316, accession CIR1348 showed an amplification pattern different from that of both controls. It thus appears that resistance in accession CIR1348 is determined by allele(s) different from that (those) previously described for known sources of resistance.

The present study on the characterization of the genetics and of the defense mechanisms associated with this novel source of resistance to RKN in cotton constituted a first step towards its use in crop improvement.

REFERENCES [1] Anonymous (2005). Plant variety protection certification no. 200500113 for cotton Acala [2] NemX HY. Plant Variety Protection Office, Agricultural Marketing Service, US Department of Agriculture, Washington,

DC. [3] Bezawada, C., Saha, S., Jenkins, J.N., Creech, R.G.,and McCarty J.C. (2003). SSR marker(s) associated with root knot

resistance gene(s) in cotton. The Journal of Cotton Science, 7, 179-184. [4] Davis, R. F. and Kemerait, R.C. (2009). The multi-year effects of repeatedly growing cotton with moderate resistance to

Meloidogyne incognita. Journal of Nematology, 41, 140-145. [5] Davis, R.F., Chee, P., W., Lubbers, E. L., and May, O. L. (2011). Registration of GA120R1B3 germplasm line of cotton.

Journal of Plant Registrations, 5, 384-387. [6] Faske, T. R. and Starr, J. L. (2009). Mechanism of resistance to Meloidogyne incognita in resistant cotton genotypes.

Nematropica, 39, 281-288. [7] Giband, M., Dessauw, D., and Barroso P. A. V. (2010). Cotton: Taxonomy, Origin, and Domestication. In Wakelyn, P.J. &

Chaudhry M.R (Eds) Cotton: Technology for the 21st Century (pp 5-17). International Cotton Advisory Committee, Washington DC, USA.

[8] Gutiérrez, O.A., Jenkins, J.J., McCarty, J.C., Wubben, M.J., Hayes, R.W. and Callahan, F.E. (2010). SSR markers closely associated with genes for resistance to root-knot nematode on chromosomes 11 and 14 of Upland cotton. Theoretical and Applied Genetics, 121, 1323-1337.

[9] He, Y., Iqbal, N., Shen, X., Davis, R.F., and Chee, P. (2010). QTL mapping of resistance to root-knot nematode in the wild cotton germplasm line M-495RNR. P. 763. In: Proceedings of the Beltwide Cotton Conference, New Orleans, LA, Jan 4–7, 2010. National Cotton Council of America, Memphis, TN, USA.

[10] Hyer, A. H, Jorgenson, E. C., Garber, R. H., and Smith, S. (1979). Resistance to root-knot nematode in control of root-knot nematode – Fusarium wilt disease complex in cotton. Crop Science, 19, 898-901.

[11] Jeffers, D. P., and Roberts, P. A. (1993). Effect of plant date and host genotype on the root-knot – Fusarium wilt disease complex of cotton. Phytopathology, 83, 645-654.

[12] Jenkins, J. N., Parrott, W. L., Kappelman, A. J., & Shepherd, R. (1979). Registration of JPM 781-783 cotton germplasm. Crop Science, 19, 932.

[13] Jenkins, J. N., Creech, R. G., Tang, B., Lawrence, G. W., & McCarty, J. C. (1995). Cotton resistance to root-knot nematode : II. Post-penetration development. Crop Science, 35, 369-373.

[14] Jones, J. E., Beasley, J. P., Dickson, J. I., & Caldwell, W. D.(1988). Registration of four cotton germplasm lines with resistance to reniform and root-knot nematodes. Crop Science, 28, 199-200.

[15] Jones, J. E., Dickson, J. I., Aguillard, W., Caldwell, W. D., Moore, S. H., Hutchinson, R. L., et al. (1991). Registration of ‘LA 887’ cotton. Crop Science, 31, 1701.

[16] McClure, M. A., Ellis, K. C., & Nigh, E. L. (1974). Post-infection development and histopathology of Meloidogyne incognita in resistant cotton. Journal of Nematology, 1, 21-26.

[17] McPherson, G.R., Jenkins, J.N., Watson, C.E, and McCarty, J.C. (2004). Inheritance of root-knot nematode resistance in M-315 RNR and M78-RNR cotton. Journal of Cotton Science, 8, 154-161.

[18] Niu, C., D.J. Hinchliffe, R.G. Cantrell, C. Wang, P.A. Roberts, and J. Zhang. (2007). Identification of molecular markers associated with root-knot nematode resistance in upland cotton. Crop Science, 47, 951-960.

[19] Oakley, S. R. (1995). CPCSSD Acala C-225: A new nematode resistant Acala variety for California’s San Joaquin Valley. In: Proceedings of 1995 Beltwide Cotton Production Research Conference (p. 39). Memphis, TN: National Cotton Council of America.

[20] Ogallo, J.L., Goodell, P.B., Eckert, J., & Roberts, P.A. (1997). Evaluation of NemX, a new cultivar of cotton with high resistance to Meloidogyne incognita. Journal of Nematology, 29, 531-537.

[21] Ogallo, J.L., Goodell, P.B., Eckert, J., and Roberts, P.A. (1999) Management of root-knot nematodes with resistant cotton cv. NemX. Crop Science, 39, 418-421.


[22] Roberts, P.A., and Ulloa, M. (2010). Introgression of root-knot nematode resistance into tetraploid cottons. Crop Science, 50, 940-951.

[23] Robinson, A. F. & Percival, A. E. (1997). Resistance to Meloidogyne incognita raça 3 and Rotylenchulus reniformis in wild accessions of Gossypium hirsutum and G. barbadense from Mexico. Journal of Nematology, 29, 746-755.

[24] Robinson, A. F., Bridges, A. C., & Percival, E. (2004). New source of resistance to the reniform (Rotylenchus reniformis Linford and Oliveira) and root-knot (Meloidogyne incognita Kofoid &White, Chitwood) nematode in upland (Gossypium hirsutum L.) and Sea Island (G. barbadense L.) cotton. The Journal of Cotton Science, 8, 191-197.

[25] Shen, W., Van Becelaere, G., Kumar, P., Davis, R.F., May, O.L., and Chee, P. (2006). QTL mapping for resistance to root-knot nematodes in M-120 RNR Upland cotton line (Gosspypium hirsutum L.) of the Auburn 623 RNR source. Theoretical and Applied Genetics, 113, 1539-1549.

[26] Shen,X., He, Y., Lubbers, E.L., Davis, R.F., Nichols, R.L., and Chee, P.W. (2010). Fine mapping QMi-C11 a major QTL controlling root-knot nematode resistance in Upland cotton. Theoretical and Applied Genetics, 121, 1623-1631.

[27] Shepherd, R. L. (1974a). Registration of ‘Auburn 623 RNR’ cotton germplasm. Crop Science, 35, 373-375. [28] Shepherd, R. L. (1974b). Transgressive segregation for root-knot nematode resistance in cotton. Crop Science, 14, 872–875. [29] Shepherd, R. L. (1982). Genetic resistance and its residual effects for control of the root-knot nematode – Fusarium wilt

complex in cotton. Crop Science, 22, 1151-1155. [30] Shepherd, R. L. (1983). New sources of resistance to root-knot nematodes among primitive cottons. Crop Science, 23, 999-

1002. [31] Shepherd, R. L., McCarty, J. C., Jenkins, J. N., & Parrott, W. L. (1996). Registration of nine cotton gernplasm lines

resistant to root-knot nematode. Crop Science , 36, 820. [32] Starr, J. L., Koenning, S. R., Kirkpatrick, T. L., Robinson, A. F., Roberts, P. A., and Nichols, R. L. (2007). The future of

nematode management in cotton. Journal of Nematology, 39, 283-294. [33] Starr, J.L., Smith, C.W., Ripple, K., Zhou, E., Nichols, R.L., and Faske, T.R. (2011). Registration of TAM RKRNR-9 and

TAM RKRNR-12 germplasm lines of upland cotton resistant to reniform and root-knot nematodes. Journal of Plant Registrations, 5, 393-396.

[34] Ulloa, M., Wang, C., and Roberts, P. A. (2010). Gene action analysis by inheritance and quantitative trait loci mapping of resistance to root-knot nematodes in cotton. Plant Breeding, 129, 541-550.

[35] Wang, C. and Roberts, P.A. (2006). Development of AFLP and derived CAPS markers for root-knot nematode resistance in cotton. Euphytica, 152, 185-196.

[36] Wang, C., Ulloa, M., and Roberts, P.A. (2006). Identification and mapping of microsatellite markers linked to a root-knot nematode resistance gene (rkn1) in Acala NemX cotton. Theoretical and Applied Genetics, 112, 770-777.

[37] Wang C. Ulloa, M., and Roberts, P.A. (2008). A transgressive segregation factor (RKN2) in Gossypium barbadense for nematode resistance clusters with gene rkn1 in G. hirsutum. Molecular Genetics and Genomics, 279, 41-52.

[38] Williamsom, V. M., and Hussey, R. S. (1996). Nematode pathogenesis and resistance in plants. The Plant Cell, 8, 1735-1745.

[39] Westengen, O. T, Huamán, Z., and Heun, M. (2005). Genetic diversity and geographic pattern in early South American cotton domestication. Theoretical and Applied Genetics, 110, 392-402.

[40] Ynturi, P., Jenkins, J.J. MacCarty, J.C., Guttierrez, O.A., and Saha, S. (2006). Association of root-knot nematode resistance genes with simple sequence repeat markers on two cromosomes in cotton. Crop Breeding and Genetics, 46, 2670-674.

[41] Zhang, J. F., Waddell, C., Sengupta-Gopalan, C., Potenza, C., and Cantrell, R.G. (2007). Diallel analysis of root-knot nematode resistance based on galling index in upland cotton. Plant Breeding, 126, 164-168.

[42] Zhou, E., Wheeller, T. A., & Starr, J. L. (2000). Root galling and reproduction of Meloidogyne incognita isolates from Texas on resistant cotton genotypes. Journal of Nematology, 32, 513-518.

Predominance of Resistance Breaking Cotton Leaf Curl Burewala Virus (ClCuBuv)

in Northwestern India

Prem A. Rajagopalan1, Amruta Naik1, Prashanth Katturi1, Meera Kurulekar1 Ravi S. Kankanallu2 and Radhamani Anandalakshmi1

1Plant-Virus Interactions Lab, Mahyco Research Center, Maharashtra Hybrid Seeds Company Limited, Dawalwadi, Post Box no-76, Jalna, Maharashtra–431 203, India

2Vegetable Research Center, Maharashtra Hybrid Seeds Company Limited, Bettanagera Village, Huskur Post, Bangalore–562 123, India

Cotton leaf curl disease (CLCuD) is the most devastating among viral diseases of cotton Gossypium hirsutum (L.) in northwestern India (Varma and Malathi, 2003). Plants susceptible to the virus show up-ward and down-ward leaf curling,thickening of veins, enations on the leaf abaxial surface, overall stunting, and flower and fruit abortion leading to low productivity. CLCuD is caused by a group of geminivirus species from the genus Begomovirus, in the family Geminiviridae. Cotton infecting begomoviruses (CBVs) like the majority of Old World begomoviruses, are monopartite having genomes that consist of only one circular single-stranded DNA (ssDNA) molecule and are associated with betasatellite (Briddon et al. 2003) and frequently a third component known as alphasatellite (Briddon et al., 2004). The CBVs complex is transmitted by the whitefly Bemisia tabaci (Genn.)

Though CBVs was first reported from IARI, New Delhi, India in 1989, it was identified as the causal agent of severe epidemic outbreaks of the CLCuD in Punjab and adjacent SriGanganagar in 1994. Since then, CBVs has spread to all of the cotton growing regions of north westerns India, where it has become the limiting factor for cotton production in every season, causing up to 100% yield loss. The major begomoviruses associated with CLCuD are Cotton leaf curl Rajasthan virus (CLCuRV), Cotton leaf curl Multan virus (CLCuMuV) and Cotton leaf curl Kokhran virus (CLCuKoV).

During 2002, we commenced a comprehensive study to understand the distribution, diversity and biological characterization of CBVs in northwestern India. In surveys conducted during 2002-2005, we noticed predominance of CLCuRV in fields when compared to either CLCuMuV or CLCuKoV. The cotton hybrids and varieties which were developed and marketed by the different seed companies and public institutions were showing varying degrees of tolerance to different CBVs.

During our reconnaissance studies in the 2005 cropping season, some of the plants in farmer’s fields in SriGanganagar showed the severe symptoms in cotton cultivars which were earlier resistant to “Rajasthan strain’ (CLCuRV), Later we confirmed that the plants were infected by the e resistance breaking virus “Burewala strain” and now recognized as a distinct begomovirus species- ‘Cotton leaf curl Burewala virus’(CLCuBuV).

However, during 2009 -2010, severe and wide spread CLCuD was observed on cotton in the fields of Bathinda, Abohar, Fazilka, SriGanganagar, and the surrounding Punjab and Rajasthan states and causing yield loss even up to 100%. Most cotton cultivars previously resistant to CBVs were found to be severely affected

To identify the specific viral genotype(s) involved in the recent outbreak, begomovirus field isolates were collected from cotton fields and subjected to DNA sequencing. Partial sequences of 258, as well as full-length sequences of 30 complete virus genome sequences were determined and sequences were compared to those isolates from 2003-2008. Based on partial and full length genome sequences, it can be concluded that the new emergent, resistance-breaking strain, CLCuBuV has become established in northwestern India.

52

Predominance of Resistance Breaking Cotton Leaf Curl Burewala Virus 305

Nearly 93% (238 out of 258) of the samples were infected with CLCuBuV and full length characterization studies showed that this virus isolates are prevalent in three putative mutant forms. We have noticed two major variations when compared to place of origin of the mutant virus. Amrao et al. (2010) reported the prevalence of three C2 mutants in Vehari, Pakistan, but we were able to collect only one type of mutant in our surveys. Further Amrao et al. (2010) speculated that, C2 mutation is an escape mechanism in CLCuD resistant G.hirsutm lines. Interestingly, we have isolated CLCuBuV carrying intact C2, also from these tolerant lines. How these different mutant viruses are vectored by whiteflies and how the virus is thriving on different genotypes of cotton from one season to another need to be looked into for devising effective control measures to combat the spread of CLCuD

REFERENCES [1] Amrao L, Amin I, Shahid MS, Briddon RW, Mansoor S (2010a) Cotton leaf curl disease in resistant cotton is associated

with a single begomovirus that lacks an intact transcriptional activator protein. Virus Res 152:153–163 [2] Briddon RW (2003) Cotton leaf curl disease, a multi component begomovirus complex. Mol Plant Pathology 4:427–434 [3] Briddon RW, Bull SE, Amin I, Mansoor S, Bedford ID, Rishi N, Siwatch S, Zafar MY, Abdel-Salam AM, Markham PG,

(2004) Diversity of DNA1; a satellite-like molecule associated with monopartite begomovirus–DNA complexes. Virology 324:462–474

[4] Varma A, Malathi VG (2003) Emerging geminivirus problems: A serious threat to crop production. Annals of Applied Biology 142:145–164

world cotton research conference - 5 .session_2

Documents