work performed at - universidade nova de lisboa tania serra.pdfstrong negative effect on rice...
TRANSCRIPT
WORK PERFORMED AT:
GENOMICS OF PLANT STRESS LABORATORY
Instituto de Tecnologia Química e Biológica
Universidade Nova de Lisboa
Av. da República
2780-157 Oeiras
Portugal
SUPERVISORS:
Dr. Nelson José Madeira Saibo
Auxiliary Investigator at GPlantS laboratory (ITQB-UNL)
Prof. M. Margarida Oliveira
Head of GPlantS laboratory (ITQB-UNL)
Associated Professor with Aggregation at UNL
Aos meus pais,
por me amarem e ajudarem
incondicionalmente.
Science and art have that in common that
everyday things seem to them new and attractive.
Friedrich Nietzsche
(15th October 1844 - 25th August 1900)
vii
ACKNOWLEDGMENTS
To Nelson Saibo for being my PhD supervisor, for the help and
guidance during all this years, for all the brilliant ideas you gave
me and for always “pushing” me to give my best in everything I
do. Above all, thank you for allowing me to enter in the science
world and to believe in me and in my work.
To Prof. Margarida Oliveira for helping me to be a “scientist”
(almost). Thank you for accepting me in your lab when I was just
another student and for helping me grow up not only
“scientifically” but also personally. Moreover, thank you for always
find time to guide my work and to give me new ideas for all the
problems I encounter.
To Ana Paula Santos for the help with the microscope “world”,
especially with the confocal “monster”. Thank you for all the
advices and for always be available to help.
To Lisete Fernandes from IGC for all the help with the “EMSA saga”.
If it weren’t for your wonderful advices, for sure it would be even
more difficult to finish that part of the work.
To Laszlo Bogre from Royal Holloway (University of London) for
accepting me in his lab and teaching new techniques that helped
me finish my PhD.
To Tiago Lourenço for all the fruitful talks during my PhD and for the
several ideas that you gave me to overcome the million problems
I had during these years. Also thank you for noticing when
something was wrong and helping me to find a way out.
To Duarte Figueiredo for the “peace” you gave me during these
years and for helping me to unstress when everything seemed to
fall apart. Also, thank you for giving me the positive side of the
“bad” results and for giving me strength to carry on.
viii
To Pedro Barros for the companionship and the nice insights you
gave me. Thank you for always be willing to help. Also, I am really
thankful that you have worked with almond all this years, because
when we talked about our work problems, I always realized that
rice is a fairly easy plant to work with and all my problems may not
be that complicated.
To André Cordeiro for joining the lab when you did and for always be
ready to help whenever needed. If it weren’t for your help I would
probably had to work 24h a day to finish this thesis, so thank you
for working so hard and for doing all the work the best way
possible.
To Isabel Abreu for always be available to talk about everything and
for helping me realize that my work is actually not that bad. Thank
you for making difficult questions that “force” me to think outside
the box.
To Safina Khan for all the help during my staying in Royal Holloway,
not only for guiding me in the lab but also for making me feel
welcome and for the nice company and friendship. I’m saving a
nice bottle of wine for us to celebrate.
To Mafalda Rodrigues for helping me in a million things. From
proteins to plants, you always have some great idea. Also, thank
you for the companionship during the several long nights that we
spent in the lab.
To Sónia Negrão for all the “pet-talks” that truly helped me gain more
confident in my work. Also for helping me to have a more positive
thinking and to keep in mind that one day all the hard work will be
worth it.
To Diego Almeida for always having a nice topic to talk about that is
not related to work. Thank you for helping me “disconnect” from
work and for the nice ideas about travelling.
ix
To Helena Sapeta for the nice talks while we see if it rains outside
and for always be interested about how everything is going.
To all the members of the GPlantS lab, Cecília, Nuno, Alicja,
Paulinha, Liliana, “Joões”, Margarida and Filipa for making the lab
a really nice place to work at.
To Regina Menezes, Catarina Pimentel and Catarina Amaral for
always giving me good advices and for always being willing to
help.
To Ana Barbas for the useful advices during the first steps of the
“EMSA saga”. Thank you for the strength you gave me, it really
helped me carry on.
To Claudia Santos for introducing me to the difficulties of the
ubiquitin world.
To Forest Biotech group for always having everything that we miss in
the lab. Also thank you for the helpful advices and the nice
companionship during these years.
To Zé and Sandra for the help with the “EMSA saga”. Thank you for
introducing me to the “giraffe” and the nice things we can do with
it.
To Miguel Costa for teaching me about plant physiology and one of
the techniques that always intrigued me.
To Marta Alves for always asking how is everything going and for
caring about me and my work. Thank you for making me feel that
“yes, I can”.
To Inês and Mara for helping me let go work and realize that life
cannot be only dependent on work. Also thank you for the late
afternoons with the nice beer, good snacks and wonderful
company.
À minha Priminha, por teres sempre as palavras certas, no momento
certo para me arrancares dos “buracos” que vão aparecendo.
x
Obrigado por me fazeres sentir especial e por estares sempre
comigo nas coisas boas e menos boas. Obrigado por seres como
és.
Aos meus irmãos, pela força e apoio que me têm dado ao longo
destes anos. Obrigado por me contarem muitas “Estoínhas” em
pequenina que de certeza me inspiraram! Ao meu maninho e
padrinho, por estares sempre ao nosso lado, por fazeres tudo
para nos ajudar a alcançar os nosso sonhos e por puxares por
mim para alargar os meus horizontes e querer ser sempre
melhor. Se não fosse a tua ajuda ao longo destes anos, teria sido
muito mais difícil de atingir este patamar. À minha maninha Lena
por estares sempre pronta a ajudar, por te preocupares comigo e
por me fazeres sentir que posso contar contigo para tudo. À
minha maninha Célia pela boa disposição e por me fazeres rir
naqueles tempos difíceis. Obrigado por seres um exemplo para
mim de como é possível ser independente, chegar longe e ser
feliz.
Aos meus pais, por me acompanharem e ajudarem durante toda a
vida. Obrigado por acreditarem em mim e me darem força para
ser sempre melhor e para tentar ir sempre mais longe. Obrigado
por tirarem as pedras do caminho, mesmo antes de aparecerem.
Amo-vos muito.
Ao André, por tanta coisa... Por estares sempre ao meu lado, por me
dares animo para continuar, por compreenderes que por vezes
seja workaholic, por estares comigo nos mellhores momentos,
por me apoiares naqueles dias mais dificeis, enfim, por me
fazeres feliz. ILY
xi
The author of this thesis, Tânia Sofia Lobato Paulo Serra, hereby
declares to have had active participation in the following research
papers:
Ana Paula Santos, Tânia S. Serra, Duarte Figueiredo, Pedro Barros,
Tiago Lourenço, Subhash Chander, M. Margarida Oliveira and
Nelson J. M. Saibo. (2011) Transcription regulation of abiotic stress
responses in rice: a combined action of transcription factors and
epigenetic mechanisms. OMICS A Journal of Integrative Biology, 15
(12):839-57
Tânia S. Serra performed part of the review work and manuscript writing.
This manuscript includes part of the work described in Chapter I.
Duarte Figueiredo, Pedro Barros, André Cordeiro, Tânia S. Serra,
Tiago Lourenço, M. Margarida Oliveira and Nelson J. M. Saibo.
(2012) Seven Zinc Finger transcription factors are novel regulators of
the rice gene OsDREB1B. Journal Experimental Botany, Published
Online (doi: 10.1093/jxb/ers035)
Tânia Serra participated in the experimental work and manuscript writing.
Tânia S. Serra, Duarte Figueiredo, André Cordeiro, Tiago Lourenço,
Isabel A. Abreu, Alvaro Sebastián, Lisete Fernandes, Bruno
Contreras-Moreira, M. Margarida Oliveira and Nelson J. M. Saibo.
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may
regulate its gene expression under salt stress. (In preparation).
Tânia S. Serra participated in the experimental design, the laboratory work
and manuscript writing. This manuscript includes the work described in
Chapter II and III.
xii
Tânia S. Serra, André Cordeiro, Laszlo Bögre, M. Margarida Oliveira
and Nelson J. M. Saibo. OsEREBP1 encodes an AP2/ERF
transcription factor involved in high salinity, drought and ABA
responses. (In preparation)
Tânia S. Serra participated in the experimental design, the laboratory work
and manuscript writing. This manuscript includes the work described in
Chapter IV.
Tânia S. Serra, M. Margarida Oliveira and Nelson J. M. Saibo.
OsEREBP2 is a multifunctional AP2/ERF transcription factor
mediating abiotic stress and hormone signaling pathways. (In
preparation)
Tânia S. Serra participated in the experimental design, the laboratory work
and manuscript writing. This manuscript includes the work described in
Chapter V.
xiii
LIST OF ABBREVIATIONS
3-AT 3-amino-1,2,4-triazole
aa amino acid
ABA Abscisic Acid
AP2/ERF APETALA2/Ethylene Response Factor
ATP Adenosine Triphosphate
bp base pair
BLAST Basic Local Alignment Search Tool
CAMV35S Cauliflower Mosaic Virus 35S promoter
cDNA complementary DNA
ºC degree Celsius
dNTPs Deoxynucleotide Triphosphates
DNA Deoxyribonucleic Acid
dS DeciSiemens
DUF26 Domain of Unknown Function 26
EC Saturated Paste Extract
EDTA Ethylene Diamine Tetraacetic Acid
ERE Ethylene-Responsive Element
FAO Food Agriculture Organization
g relative centrifugal force
GFP Green Fuorescence Protein
GST Glutathione S-Transferase
GUS β-Glucuronidase
HA Hemagglutinin
h hour
kDa kiloDalton
kg kilogram
LUC Luciferase
Mb Mega base pair
xiv
MAPK Mitogen-Activated Kinase
µCi microCurie
µg microgram
µL microlitre
µm micrometer
µM micromolar
mL millilitre
mM millimolar
m35S minimal 35S promoter
min minute
M Molar
m meter
nm nanometer
Os Oryza sativa
PCR Polymerase Chain Reaction
PEG Polyethylene Glycol
RT-PCR Reverse Transcription – PCR
RLK Receptor Like-Kinase
RNA Ribonucleic Acid
RAM Root Apical Meristem
PTMs Post-Translational Modifications
s second
SAM Shoot Apical Meristem
SDS-PAGE Sodium Dodecyl Sulfate – Polyacrylamide
Gel Electrophoresis
SD Standard Deviation
TF Transcription Factor
T-DNA Transfer-DNA
wt wild-type
Y1H Yeast One-Hybrid
xv
SUMMARY
Rice (Oryza sativa L.) is cultivated worldwide and is the staple
food for more than one-half of the world population. Abiotic stress
conditions, such as high salinity, drought and low temperature have a
strong negative effect on rice production. High salinity severely
affects rice growth and reduces grain yield, as it induces late
flowering and lowers pollen viability. To cope with saline
environments, plants rely on the perception and transduction of
stress signals through specific response pathways, which activate
several adaptation mechanisms. Salt stress adaptation involves Na+
intracellular compartmentalization, synthesis of osmoprotectants and
restriction of Na+ accumulation in the shoots. Transcription factors
(TFs) play an important role in the modulation of stress responses. A
single TF regulates the expression of several stress-responsive
genes, allowing a fast and efficient response to stress conditions.
Therefore, a study of the transcriptional network regulating plant
stress responses may not only elucidate the mechanisms involved in
plant adaptation to stress, but also allow the identification of
candidate genes for the generation of stress tolerant crops.
The main goal of our study was to identify and characterize TFs in
rice involved in the stress-induced responses to high salinity. Initially,
we selected five genes reported in the literature as responsive to salt
stress and analyzed in detail their gene expression in rice seedlings
subjected to salt stress. Among the genes analyzed, we have
selected Oryza sativa Root Meander Curling (OsRMC), which
showed a high responsiveness to salt stress and is putatively
involved in the recognition of abiotic stress signals. Using the yeast
one-hybrid system to screen a salt-induced rice cDNA expression
library, two TFs were found to bind to the OsRMC promoter. These
xvi
TFs, OsEREBP1 and OsEREBP2, belong to the ERF subfamily and
were shown to interact with a GCC-like motif in the OsRMC gene
promoter. In addition, trans-activation assays showed that both TFs
negatively regulate OsRMC gene expression.
When we analyzed OsEREBP1 and OsEREBP2 gene expression
in rice seedlings that were subjected to high salinity, drought, ABA
and low temperature treatments, we observed that OsEREBP1
transcript level was not significantly affected by most stresses
applied. Therefore, we propose that under the conditions tested, this
TF is mainly regulated by post-translational modifications (PTMs). In
addition, under salt stress conditions, we observed an increased
OsEREBP1 protein level associated with higher protein stability,
which is in agreement with our hypothesis. The OsEREBP2
transcript level was differentially expressed in response to all the
treatments applied, suggesting that this TF is a multifunctional
protein with a role in several abiotic stress responses. Sub-cellular
localization studies in onion epidermal cells revealed that
OsEREBP1 is located exclusively in the nucleus, whereas
OsEREBP2 is dispersed throughout the cell.
OsEREBP1 and OsEREBP2 function in abiotic stress responses
were further analyzed in transgenic Arabidopsis plants over-
expressing the rice TFs. OsEREBP1-OX seeds displayed enhanced
sensitivity to high salinity during germination, but the root phenotype
and survival rate was affected similarly to wild-type by this treatment.
These data further supports the hypothesis that, under salt stress,
OsEREBP1 is mainly regulated by PTMs. This TF seems to be also
involved in ABA (Abscisic Acid) responses. OsEREBP1-OX seed
germination was more affected by ABA than wild-type and the roots
of transgenic plants were more sensitive to ABA inhibition. The
increased tolerance of the transgenic roots to PEG-induced water
xvii
deficit conditions indicated that OsEREBP1 plays also a role in
drought stress responses. On the other hand, OsEREBP2-OX plants
displayed a phenotype resembling abnormal responses to auxins
and/or cytokinins. The expression of auxin- and cytokinin-responsive
genes was altered in the transgenic plants, as well as the expression
of genes involved in the maintenance and function of the shoot
apical meristem (SAM). Therefore, we suggest that OsEREBP2
plays a role in developmental processes.
Complementation studies with Arabidopsis mutants for orthologs
of OsEREBP1 and OsEREBP2, rap2.2 and abr1, respectively,
revealed that OsEREBP1 and RAP2.2 may have different functions
in high salinity and drought stress responses. When rap2.2 seedlings
over-expressing OsEREBP1 were subjected to these stress
treatments, no root phenotype complementation was observed. In
contrast, OsEREBP2 heterologous expression rescued the abr1
germination phenotype under high salinity and ABA treatments,
suggesting that OsEREBP2 may have a similar function to ABR1.
This work allowed the identification of two novel transcription
factors with a role in rice abiotic stress responses. Their functional
characterization contributed to a better understanding of the
transcriptional networks activated in response to high salinity. In
addition, it provided new insights regarding TF involvement in the
integration of external signals in plant developmental programs.
xviii
xix
SUMÁRIO
O arroz (Oryza sativa L.) é cultivado em todo o mundo, sendo a
base da alimentação para mais de metade da população mundial. O
stress abiótico, como por exemplo a elevada salinidade, secura e
baixa temperatura exercem efeitos negativos na produção de arroz.
A elevada salinidade afeta severamente o crescimento do arroz e
reduz a produção de grão, pois provoca atrasos na floração
reduzindo ainda a viabilidade do pólen. A sobrevivência em solos
com elevada salinidade depende da perceção e transdução dos
sinais de stress, os quais, através das vias de sinalização
específicas, ativam vários mecanismos de adaptação. Estes
mecanismos incluem a compartimentação intracelular de Na+,
síntese de osmoprotectores e diminuição da acumulação de Na+ na
parte aérea da planta. Os fatores de transcrição (FTs)
desempenham um papel importante na modulação da resposta ao
stress, pois um único FT tem a capacidade de regular a expressão
de vários genes de resposta ao stress, permitindo uma resposta
rápida e eficiente. Assim, o estudo da regulação transcricional
envolvida na resposta ao stress, não só elucida os mecanismos de
adaptação das plantas ao stress, como pode também permitir a
identificação de genes candidatos para a produção de plantas mais
tolerantes.
O principal objetivo deste estudo foi identificar e caracterizar FTs
envolvidos na resposta do arroz ao stress provocado por elevada
salinidade. Inicialmente, foram selecionados cinco genes descritos
na literatura como sendo regulados pelo stress salino e a sua
expressão foi analisada em plantas sujeitas a tratamentos de
elevada salinidade. Entre os genes analisados, selecionámos o
Oryza sativa Root Meander Curling (OsRMC) para análise em maior
xx
detalhe, por apresentar uma elevada resposta ao stress salino e por
poder estar envolvido na perceção dos sinais de stress. Utilizando o
sistema de yeast one-hybrid, para fazer o rastreio de uma biblioteca
de expressão de cDNA enriquecida em genes de resposta ao stress
salino, foi-nos possível identificar dois FTs que se ligam ao promotor
do gene OsRMC. Provámos que estes dois FTs, OsEREBP1 e
OsEREBP2, pertencentes à subfamília ERF, se ligam
especificamente a um motivo GCC-like identificado no promotor do
gene OsRMC. Por outro lado, através de ensaios de transactivação
verificámos que os FTs regulam negativamente a expressão do
gene OsRMC.
A análise da expressão dos genes OsEREBP1 e OsEREBP2, em
plantas de arroz submetidas a tratamentos de elevada salinidade,
secura, ABA e baixa temperatura, revelou que o nível do transcrito
OsEREBP1 não é significativamente afetado pela maioria dos
tratamentos aplicadas. Assim, propomos que, sob as condições
analisadas, este FT deverá ser regulado principalmente por
modificações pós-traducionais (MPTs). De acordo com esta
hipótese, observámos que em condições de stress por elevada
salinidade ocorre uma maior acumulação da proteína OsEREBP1
devido ao aumento da sua estabilidade. Quanto ao gene
OsEREBP2, este revelou-se diferencialmente expresso em resposta
a todos os tratamentos realizados, o que sugere que a proteína
OsEREBP2 é multifuncional, estando envolvida na resposta a
diversas condições de stress abiótico. Através de estudos de
localização sub-celular, demonstrou-se que, em condições controlo,
a proteína OsEREBP1 está localizada exclusivamente no núcleo,
enquanto a proteína OsEREBP2 se encontra dispersa na célula.
A função do OsEREBP1 e do OsEREBP2 na resposta ao stress
abiótico foi também analisada em plantas de Arabidopsis a sobre-
xxi
expressar estes FTs de arroz (OsEREBP1-OX e OsEREBP2-
OX). As sementes das plantas OsEREBP1-OX apresentaram maior
sensibilidade ao tratamento com elevada salinidade durante a
germinação, mas o fenótipo da raiz e a taxa de sobrevivência ao
stress salino foi semelhante ao observado em plantas
selvagens. Estes resultados reforçam a hipótese de que o FT
OsEREBP1 é regulado maioritariamente por MPTs em resposta a
este stress. Foi também demonstrado que este FT pode estar
envolvido na resposta ao ácido abscísico (ABA) . A germinação das
sementes OsEREBP1-OX foi mais afetada pelo tratamento com ABA
do que as sementes selvagens. Além disso, na presença de ABA,
as plantas transgénicas OsEREBP1-OX apresentaram uma maior
inibição do crescimento da raiz comparativamente às plantas
selvagens. O aumento da tolerância das raízes observado quando
as plantas transgénicas foram submetidas a condições de défice
hídrico induzido por PEG, sugere que o OsEREBP1 pode também
estar envolvido na resposta à seca. As plantas OsEREBP2-OX
apresentaram um fenótipo que sugere a existência de uma resposta
anormal a auxinas e/ou citocininas. Verificámos que a expressão de
genes de resposta a auxinas e citocininas, bem como a expressão
de genes envolvidos na manutenção e função do meristema apical,
está afetada nas plantas transgénicas. Assim, propomos que o
OsEREBP2 esteja envolvido nos mecanismos reguladores do
desenvolvimento da planta.
Efetuámos também estudos de complementação nos mutantes
de Arabidopsis, rap2.2 e abr1, os quais correspondem aos ortólogos
de OsEREBP1 e OsEREBP2, respetivamente. Estes estudos
revelaram que OsEREBP1 e RAP2.2. têm funções diferentes na
resposta aos stresses por elevada salinidade e secura. Quando as
plantas rap2.2 a sobre-expressar o FT OsEREBP1 foram
xxii
submetidas a estes stresses, não se observou a reversão do
fenótipo da raiz observado no mutante rap2.2. Por outro lado, a
expressão heteróloga do OsEREBP2 permitiu a reversão do fenótipo
de germinação do mutante abr1, em condições de elevada
salinidade e em tratamentos com ABA, indicando que os FTs
OsEREBP2 e ABR1 têm funções semelhantes.
Este trabalho permitiu identificar e caracterizar dois novos fatores
de transcrição envolvidos na resposta do arroz a condições de
stress abiótico. A caracterização funcional destes FTs contribuiu
para uma melhor compreensão das vias transcricionais ativadas em
resposta ao stress por elevada salinidade. Além disso, este estudo
contribuiu para um maior conhecimento relativamente ao
envolvimento destes FTs na integração de sinais internos e externos
nos programas de desenvolvimento da planta.
xxiii
TABLE OF CONTENTS
Acknowledgments........................................................................ vii
List of Abbreviations ................................................................... xiii
Summary ....................................................................................... xv
Sumário ........................................................................................ xix
Chapter I ......................................................................................... 1
General Introduction and Research Objectives
Chapter II ...................................................................................... 53
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and
may regulate its gene expression under salt
Chapter III ..................................................................................... 85
Characterization of the OsEREBP1 and OsEREBP2 interaction
with the OsRMC promoter
Chapter IV ................................................................................... 115
OsEREBP1 encodes an AP2/ERF transcription factor involved
in high salinity, drought and ABA responses
Chapter V .................................................................................... 151
OsEREBP2 is a multifunctional AP2/ERF transcription factor
mediating abiotic stress and hormone signaling pathways
Chapter VI ................................................................................... 191
Final Discussion and Future Perspectives
xxiv
Chapter I
1
General Introduction and Research Objectives
Chapter I
General Introduction and Research Objectives
2
TABLE OF CONTENTS – CHAPTER I
Rice as a crop model plant ............................................................. 3
High salinity effects on plant growth and development ................... 5
High salinity effects on rice growth and development ................... 7
Perception and transduction of stress signals ................................ 8
Perception ...................................................................................10
Second messengers ....................................................................13
MAPKs ........................................................................................15
Transcription factors involved in abiotic stress responses .............19
MYB family ..................................................................................20
NAC family ..................................................................................22
bZIP family ..................................................................................24
AP2/ERF family ...........................................................................25
Plant mechanisms to cope with salt stress ....................................30
Research Objectives .....................................................................35
References ....................................................................................36
Chapter I
3
Rice as a crop model plant
Rice (Oryza sativa L.) is one of the oldest and most important
crops worldwide, being estimated that more than one-half of the
world population relies on this crop to survive (Molina et al. 2011).
The cultivated rice can be divided in two main subspecies, indica and
japonica, based on physiological and morphological features (Molina
et al. 2011; Ronald et al. 2008). Indica rice is mainly cultivated in
Asia, whereas japonica rice production occurs in Asia and also in
Africa, North America and Europe (Ronald et al. 2008). In Europe,
rice is mainly produced in Italy, Spain and Greece, which together
account for approximately 60% of total European rice production
(FAOSTAT data, 2010). In contrast, Portugal produces less than 4%
of the European production (170200 tones in 2010). However,
Portugal is the major consumer of milled rice in the European Union
(EU), with a consumption of 14.84 kg/person/year in 2007, followed
by Belgium and Spain with only 8.12 and 7.21 kg/person/year,
respectively (FAOSTAT data, 2007).
Rice consumption is expected to increase over the next decades
along with the world population growth. However, rice production is
becoming insufficient to fulfill the world demand for this cereal (Roy
et al. 2011). In addition to the increased world population, water
shortage, reduction of arable land and climate changes are affecting
rice production worldwide (Gujja and Thiyagarajan 2010). Therefore,
it is highly important to develop crops with higher yields and better
adapted to adverse environmental conditions. To achieve this goal
we need to increase the knowledge regarding the mechanisms
involved in plant growth and development and also in plant
responses to stress conditions. The study of model plants like
Arabidopsis and rice provides new valuable information that can be
General Introduction and Research Objectives
4
used to improve several crops. Arabidopsis is considered the
standard model organism for the study of plant biology, mainly due to
its small genome size, short generation time and simple
transformation methods (Buell and Last 2010; Koornneef and Meinke
2010). Additionally, the availability of its genome sequence, large
genomic resources and mutant collections, make this dicotyledon the
most studied plant species (Spannagl et al. 2011). Many basic
mechanisms involved in plant development and tolerance to biotic
and abiotic stresses are common to all plants. In most of the cases,
the genes identified in Arabidopsis can be directly used in
heterologous systems or as candidate genes to identify orthologs in
crops (Feuillet et al. 2011). However, the identified orthologs may
have alternative functions and, even when the basic mechanisms are
similar, the underlying pathways may diverge (Movahedi et al. 2011;
Rensink and Buell 2004). Therefore, the study of a crop model
organism may overcome these limitations. Rice belongs to the
Poaceae family which includes other agronomically important crops,
such as maize, wheat, barley and rye (Rensink and Buell 2004). The
high degree of conservation of phenotypic features and the
conserved synteny among the cereal genomes, promotes the study
of rice as a model crop. Additionally, rice has a small genome size
(390 Mb) compared to other cereals such as maize (2300 Mb),
barley (5100 Mb) and wheat (17000 Mb) (IRGSP 2005; Mayer et al.
2011; Santos et al. 2011).The availability of its complete genome
sequence and the development of very efficient transformation
protocols further prompt the adoption of rice as a model system. To
functionally characterize the sequenced genes, several tools are
being developed, including full-length cDNA collections, gene
expression profiling platforms and T-DNA insertional mutant libraries
(Rensink and Buell 2004; Ronald et al. 2008).
Chapter I
5
High salinity effects on plant growth and development
High salinity negatively affects crop productivity and quality
worldwide. The soil is considered to contain high salt concentration
when the electrical conductivity of the saturated paste extract (ECe)
is above 4 dS/m (≈ 40 mM NaCl) (Chinnusamy et al. 2005). Most
crops are glycophytes and thus sensitive to high salinity; however if
plants are gradually exposed to increasing salt concentration
(acclimation) they may acquire some degree of stress tolerance
(Negrao et al. 2011).
Plant responses to high salinity can be divided in two phases: the
initial rapid osmotic response and the slower ion-specific response
(Munns and Tester 2008). The osmotic response caused by salt
stress is mainly related to the effect of the salt that surrounds the
roots and is very similar to the drought stress response. Osmotic
stress decreases the rate of leaf growth through reduction of cell
elongation and cell division (Munns and Tester 2008). The rate of
leaf and root elongation decreases rapidly and is followed by a partial
recover to a reduced steady rate after a few hours of osmotic stress
(Munns 2002). Along the stress period, leaf production decreases
and the new leaves are smaller and thicker. Root growth is however
less affected than leaf growth. Increased stress severity can cause
leaf growth arrest; whereas roots can recover faster and maintain a
lower but steady growth rate (Hsiao and Xu 2000). Osmotic stress
induces stomatal closure to avoid water loss via transpiration. In this
process, the plant hormone abscisic acid (ABA) plays an important
role in the regulation of stomatal movement (Finkelstein et al. 2002).
Several stress conditions induce synthesis of ABA, which promotes
stomatal closure and inhibits its opening (Hubbard et al. 2010). ABA
induces depolarization of the guard cells plasma membrane, thus
General Introduction and Research Objectives
6
promoting the efflux of K+ and anions and removal of organic solutes
from the cell, which leads to reduced cellular turgor and rapid
stomatal closing (Hubbard et al. 2010; Kim et al. 2010). The stomatal
closure caused by osmotic stress results in reduced photosynthesis
rate, mainly due to lower CO2 assimilation. In addition, severe
osmotic stress results in decreased activity of several enzymes
involved in the photosynthetic metabolism (Saibo et al. 2009). The
decrease in photosynthesis rate leads to a higher formation of
reactive oxygen species (ROS) causing oxidative stress (Munns and
Tester 2008). ROS induce oxidative damage of lipids, proteins and
nucleic acids (Türkan and Demiral 2009). The osmotic stress effects
on photosynthesis depends on the intensity and duration of the
stress, leaf age and plant species (Chaves et al. 2009).
The continued exposure to high salinity leads to the ion-specific
phase of salt stress, characterized by the increase in the rate of
senescence of older leaves (Munns and Tester 2008). Sodium ions
enter plant roots by the apoplastic pathway and the symplastic
pathway through channels and transporters, and then enter in the
transpirational stream (Gao et al. 2007). Na+ and other ions are
transported from the roots to the shoots and accumulate in older
leaves, which have been transpiring the longest, leading to injuries
like tissue necrosis and eventually to their death (Munns 2002). The
ions accumulate in the vacuole and afterwards either in the cytosol or
in the cell wall, leading to inhibition of enzyme activity or cell
dehydration, respectively. In addition, high concentrations of Na+ in
the cell cause osmotic imbalance and membrane disorganization
(Mahajan and Tuteja 2005). The toxic effects of Na+ are also related
to the disruption of K+ homeostasis. This ion is essential for
maintenance of cellular turgor and stomatal movement and is a co-
factor for several enzymes, implying that cells need to maintain high
Chapter I
7
cytosol K+/Na+ ratios (Gao et al. 2007; Mahajan and Tuteja 2005).
Increased Na+ concentration in the soil decreases root K+ uptake
(Gao et al. 2007). Moreover, Na+ competes with K+ for intracellular
influx by nonselective transporters and may also compete for K+
binding sites (Bartels and Sunkar 2005; Mahajan and Tuteja 2005).
The severity of salt-induced injuries depends not only on the salinity
level but also on other environmental conditions like temperature and
on the genetic variations regarding the efficiency of stress tolerance
mechanisms (Munns 2002). The rate at which older leaves die and
new leaves are produced may determine plant survival. Increased
tissue necrosis will reduce the plant photosynthetic capacity and
therefore the carbohydrate levels required to develop younger
leaves, leading to a further reduction in growth rate (Munns and
Tester 2008). In addition, the photosynthetic processes are thought
to be affected by the accumulation of toxic ions in the leaf tissues
(Chaves et al. 2009). Continued exposure to stress for weeks or
months leads to lateral shoot inhibition, altered flowering time and
reduced seed production (Munns 2002).
High salinity effects on rice growth and development
Rice production is highly affected by abiotic stress conditions,
such as low temperature, drought and high salinity. In Portugal, rice
productivity is affected by low temperature mainly in the North region
(Mondego river bed) and by high salinity in the Center (Tejo and
Sorraia) and South regions (Sado). Rice yield decreases by 12% per
dS/m in soils with EC above 3 dS/m (Chinnusamy et al. 2005).
Among other cereals, rice is the most sensitive to salt stress,
whereas wheat is moderately tolerant and barley is the most tolerant
cereal (Munns and Tester 2008). Rice is differently affected by high
salinity depending on the growth stage: it displays some level of
General Introduction and Research Objectives
8
tolerance during germination and vegetative growth, and high
sensitivity at seedling and reproductive stage (Negrao et al. 2011).
The osmotic effect of salt stress was proposed to last only a few
hours or days due to leakage from rice roots, which allows higher
Na+ influx (Gao et al. 2007; Munns and Tester 2008). As described
for other plant species, rice growth is also affected under high
salinity. Reduced leaf growth has been reported for plants exposed
to prolonged salt stress conditions (see Negrão et al. (2011) and
references therein). Rice yield greatly decreases due to lower pollen
viability, reduced panicle length and delayed panicle emergence and
flowering (Moradi and Ismail 2007; Negrao et al. 2011). Plants
exposed to moderate stress (NaCl < 50 mM) display delayed
flowering and reduced seed yield, whether exposure to severe stress
(NaCl > 100 mM) may lead to plant death before maturity is reached.
Perception and transduction of stress signals
Plant response to adverse environmental conditions relies on the
perception of stress signals, generation of second messengers and
signal transduction through phosphorylation cascades (Hirayama
and Shinozaki 2010). These cascades will activate proteins involved
in the direct cell protection or in the regulation of the stress response,
ultimately leading to the physiological and biochemical modifications
necessary for plant survival (Xiong et al. 2002). Figure 1 illustrates
the generic signal transduction pathway of plant response to abiotic
stress conditions.
Chapter I
9
Figure 1. Regulatory network of stress responses to abiotic stress
conditions. Stress signals are initially perceived by sensors, such as
receptor-like kinases (RLKs). These proteins trigger the generation of
second messengers, which include calcium ions (Ca2+
) and reactive oxygen
species (ROS), to transduce the perceived stress signals. Variations in the
content and/or nature of second messengers in the cell lead to the
activation of signal transducers, such as mitogen-activated protein kinases
(MAPKs) and Ca2+
protein sensors like calcineurin B-like proteins (CBLs).
The targets of signal transducers include transcription factors (TFs) from
several families (e.g. bZIP and AP2/ERF), which will regulate the
expression of stress-responsive genes. The products of these genes
function in the direct cell protection (Functional proteins) or in the regulation
of the response processes (Regulatory proteins). The regulatory proteins
include TFs and signal transducers that are proposed to form positive and
negative feedback loops to strictly regulate stress responses. Figure
adapted from Hirayama et al (2010).
General Introduction and Research Objectives
10
Perception
The apoplast, which consists of the cell wall and the intercellular
spaces, is considered the bridge from the environment to the
protoplast (Pignocchi and Foyer 2003). It perceives environmental
changes and stress signals and then transfers them into the
protoplast to trigger a response. The apoplast matrix contains solutes
(e.g. amino acids, ions and sugars), proteins (e.g. extensins and
peroxidases) and cell-wall constituents (e.g. celluloses and
glycoproteins) (Pignocchi and Foyer 2003). Several reports indicate
that upon stress conditions the apoplast protein composition is
altered in both abundance and protein type (Bhushan et al. 2007;
Dani et al. 2005; Pandey et al. 2010). Proteins with signaling function
were shown to be differentially expressed in response to dehydration
(Bhushan et al. 2007), high salinity (Zhang et al. 2009b) and
pathogen elicitor (Casasoli et al. 2008). Some of the identified
proteins belong to the receptor-like kinase (RLK) group and were
implicated in plant development and defence processes, such as
meristem maintenance, plant morphology, hormone signaling, and
biotic and abiotic stress responses (Chen 2001; Gish and Clark
2011). RLKs are located in the plasma membrane and usually
contain an extracellular receptor domain, a transmembrane domain
and a cytosolic protein kinase domain. Several RLK classes were
discriminated based on similarity of domain structure and include the
wall-associated kinase (WAK), leucine-rich repeat (LRR)-RLK, S-
domain RLK (SRK) and the cysteine-rich RLK (CRK) class. The wall-
associated kinases (WAKs) contain an extracellular domain tightly
bound to the cell wall (Seifert and Blaukopf 2010). These RLKs are
thought to function as a signaling component between the cell wall
and the cytosol and are implicated in turgor maintenance, tolerance
Chapter I
11
to metals, pathogen resistance and probably in abiotic stress
responses (Morillo and Tax 2006; Seifert and Blaukopf 2010; Yan et
al. 2006). The LRR-RLKs and cysteine-rich RLKs are not bound to
the cell wall, however the proximity of the plasma membrane to the
apoplast due to turgor pressure suggests that any perturbation in the
apoplast is perceived by the plasma membrane (Monshausen and
Gilroy 2009; Seifert and Blaukopf 2010). The LRR-RLKs are the
largest RLK class comprising at least 200 and 309 members in
Arabidopsis and rice, respectively (Gish and Clark 2011; Sun and
Wang 2011). The best characterized LRR-RLKs were shown to be
involved in meristem regulation (CLAVATA (CLV) pathway) and
hormone signaling (brassinosteroid-insensitive-1 (BRI1) pathway)
(Gish and Clark 2011). Some members of this class were also
reported to be involved in abiotic stress responses. An LRR-RLK
from Medicago truncatula, Srlk, was reported to regulate the root
response to high salinity (de Lorenzo et al. 2009). Several LRR-RLKs
putatively involved in abiotic stress responses were identified through
a reverse genetic approach in Arabidopsis, but their function is still
unknown (ten Hove et al. 2011).
RLKs containing a cysteine-rich domain in their extracellular
regions include the S-domain (SRK) and the DUF26 (Domain of
Unknown Function 26)-domain (CRKs) proteins. These domains are
enriched in cysteines but are structurally distinct (Chen 2001). The S-
domain was initially identified in the Brassica S-receptor kinase
(SRK), which is involved in pollen recognition in the self-
incompatibility response (Gish and Clark 2011). Other S-domain
containing proteins were identified in Arabidopsis, ARK1 and ARK3,
and reported to have a putative role in biotic stress responses
(Haffani et al. 2004). The DUF26 domain is characterized by the
presence of four highly conserved cysteine residues that may
General Introduction and Research Objectives
12
mediate protein-protein interactions (Chen 2001). CRKs specific
function is unknown for most of the class members, but some
evidences suggest that they may have a role in biotic and abiotic
stress responses. Gene expression studies have indicated that
several CRKs are induced by pathogen infection and oxidative stress
(Gish and Clark 2011; Haffani et al. 2004; Wrzaczek et al. 2010).
Atypical forms of RLKs, named receptor-like proteins (RLPs) were
identified for several RLK classes (Chen 2001; Gish and Clark 2011).
These protein forms contain the same extracellular domain as RLKs,
but lack the transmembrane and the intracellular kinase domain
(secreted proteins) or only lack the intracellular kinase domain. Some
RLPs were reported to function independently of RLKs whereas
others act in combination with the RLK counterpart. The CLAVATA
system relies on the interaction between the LRR-RLP CLAVATA2
and the LRR-RLK CLAVATA1 to form a complex that will become
active after binding to the specific ligand CLAVATA3 (Rojo et al.
2002). The rice Root Meander Curling (OsRMC) gene encodes a
RLP from the CRK class involved in biotic and abiotic stress
responses. This RLP contains two DUF26-domains in the
extracellular region but lack the transmembrane and intracellular
kinase domains, suggesting that it is secreted (Jiang et al. 2007;
Zhang et al. 2009b). Protein localization studies indicated that
OsRMC is located in the apoplast and/or the plasma membrane
(Jiang et al. 2007; Zhang et al. 2009b). The presence of a signal
peptide with transmembrane character may explain the plasma
membrane location (Jiang et al. 2007). The OsRMC protein was
shown to accumulate in response to high salinity, pathogen
inoculation, jasmonic acid (JA) and wound stimuli (Kim et al. 2003;
Kim et al. 2004; Shen et al. 2003; Zhang et al. 2009b), while rice
knockdown lines displayed enhanced tolerance to high salinity
Chapter I
13
treatments at germination and adult stage (Zhang et al. 2009b). In
addition, salt-stress responsive genes were up-regulated in the
transgenic lines, suggesting that OsRMC negatively regulates the
response to high salinity through deregulation of gene expression.
These transgenic lines also displayed enhanced sensitivity to JA and
increased root coiling, indicating that OsRMC negatively regulates
root development and coiling processes mediated by JA (Jiang et al.
2007).
Second messengers
Signal perception leads to the generation of second messengers
like calcium (Ca2+) and reactive oxygen species (ROS), which
transduce the stress signal (Figure 1). A wide range of biotic and
abiotic stress signals cause transient elevation of cytosolic calcium
levels [Ca2+]cyt (Kim et al. 2009). However, each stress signal induces
a specific perturbation in the calcium levels, termed “Ca2+ signature”
that can vary in kinetics, magnitude and sub-cellular location (Tuteja
and Mahajan 2007). Elevation of [Ca2+]cyt can be due to influx from
the apoplast and/or from intracellular organelles, such as the vacuole
and the endoplasmic reticulum (ER). Calcium increase in the cytosol
is perceived by protein sensors such as the calmodulin (CaM), Ca2+-
dependent protein kinases (CPKs/CDPKs) and calcineurin B-like
proteins (CBLs) (DeFalco et al. 2010). CaMs bind to Ca2+ through
EF-hands and change conformation to directly interact with several
target proteins and modulate their activity/function. Several CaM
targets were identified and reported to be involved in various
processes, such as salt tolerance, hormone signaling and
transcriptional regulation (Reddy and Reddy 2004). CPKs also bind
to Ca2+ via EF-hands but contain a catalytic kinase domain and
regulate the target proteins through phosphorylation. A role in biotic
General Introduction and Research Objectives
14
and/or abiotic stress responses has been proposed for CPKs
identified in Arabidopsis, tobacco and rice (DeFalco et al. 2010).
OsCPK13 gene expression is induced by drought and high salinity
conditions and its over-expression in rice enhanced plant tolerance
to these stresses. Arabidopsis AtCPK23 was reported to be involved
in stomatal opening and its over-expression increased drought and
salt stress sensitivity. The CBLs have Ca2+-binding properties similar
to CaMs and are regulatory subunits for serine/threonine protein
kinases, named CBL-interacting protein kinases (CIPKs) (DeFalco et
al. 2010). The best characterized CBL-CIPK interaction is involved in
the salt-overly-sensitive (SOS) signaling pathway (Luan 2009). The
Arabidopsis calcium sensor SOS3 (CBL4) was shown to interact with
SOS2 (CIPK24) upon [Ca2+]cyt perturbations regulating its kinase
activity and targeting it to the plasma membrane (Luan 2009). The
SOS3-SOS2 complex regulates SOS1, a Na+/K+ exchanger located
in the plasma membrane, enhancing Na+ efflux and contributing to
Na+ ion homeostasis. CIPK24 was also reported to be targeted to the
vacuole membrane upon binding to CBL10 (Luan 2009). The precise
function of the CBL10-CIPK24 complex is unknown, however some
speculate that it may regulate a tonoplast Na+/H+ exchanger, NHX1,
involved in high salinity tolerance (DeFalco et al. 2010).
Biotic and abiotic stress conditions promote an increase in ROS
like hydrogen peroxide (H2O2) and superoxide (O2-), which induce
damages in cellular components and can lead to tissue necrosis
(Apel and Hirt 2004). To minimize the effect of ROS generation, cells
produce antioxidants (e.g. ascorbate and glutathione) and ROS-
scavenging enzymes (e.g. superoxide dismutase and ascorbate
peroxidase). Several reports suggest that apart from their toxic
effect, ROS are involved in specific signal transduction mechanisms
that regulate ROS homeostasis (Moller and Sweetlove 2010). The
Chapter I
15
identification of genes whose expression is regulated by specific
oxidative stress signals originated in different subcellular locations,
suggested that ROS have a signaling function (Moller and Sweetlove
2010). The specific mechanism of ROS signaling is still unknown but
several hypothesis have been proposed (Mittler et al. 2011; Moller
and Sweetlove 2010). Some authors argue that the ROS signal by
itself functions as a second messenger and the amplitude, frequency
and/or localization of the signal can trigger specific gene expression
patterns. Others suggest that peptides derived from oxidized proteins
may act as second messengers that trigger specific stress
responses. ROS accumulation caused by biotic and abiotic stress
conditions was shown to modulate the response to stress signals.
The increase in apoplastic ROS levels under water stress conditions
was shown to promote cell wall loosening in maize, allowing cell
elongation and ultimately stress adaptation (Zhu et al. 2007). In
addition, ROS accumulation was reported to activate cascades of
mitogen-activated protein kinases (MAPKs) (described below)
involved in biotic and abiotic stress responses (Mittler et al. 2011).
The Arabidopsis MEKK1-MKK1/2-MPK4/6 signaling cascade was
shown to participate in cold and salt stress responses and some
members are activated by ROS (Jaspers and Kangasjarvi 2010;
Mittler et al. 2011).
MAPKs
The mitogen-activated protein kinases (MAPK) function in signal
transduction cascades that amplify and integrate external stimuli into
the cell metabolic and transcriptional response mechanisms (Figure
1) (Rodriguez et al. 2010; Sinha et al. 2011). The basic MAPK
cascade involves the stimuli-mediated activation of a MAP kinase
kinase kinase (MEKK/MAP3K) which phosphorylates a MAP kinase
General Introduction and Research Objectives
16
kinase (MKK/MAP2K) that in turn activates a MAP kinase
(MPK/MAPK). MAPKs can phosphorylate several cytosolic and
nuclear targets, including other kinases, enzymes and TFs. MAP
kinase kinase kinase kinases (MAP4K) were also reported to be
involved in these cascades but function as adaptors between
upstream signals and the MAPK cascade itself. Based on the amino
acid sequences of the kinase domain, MEKKs can be divided into
two main groups: MEKK-like and RAF-like kinases that are similar to
mammalian MEKK and RAF1 proteins, respectively (Ichimura et al.
2002; Rodriguez et al. 2010). MEKK proteins from both groups were
reported to be involved in stress responses. AtMEKK1 gene
expression is induced by wound, high salinity, cold and drought
stress conditions and its activity is promoted by H2O2 (Pitzschke et
al. 2009). This MEKK was shown to be an upstream activator of the
MKK2-MPK4/6 cascade involved in Arabidopsis high salinity and
cold stress responses (Teige et al. 2004). In addition, AtMEKK1
interacts with MKK1, which is activated by H2O2 and phosphorylates
MPK4, suggesting a role of AtMEKK1 in ROS homeostasis
(Pitzschke et al. 2009). The rice putative RAF-like kinase DSM1 was
proposed to mediate ROS and drought stress signaling responses
(Ning et al. 2010). DSM1 over-expression increased rice tolerance to
drought stress, whereas dsm1 mutants displayed enhanced
sensitivity to this abiotic stress. In addition, the rice mutants were
more sensitive to oxidative stress suggesting a putative role in ROS
scavenging.
Arabidopsis and rice MKK proteins are classified into four groups
(A-D) according to their sequences and structures (Hamel et al.
2006). Only a few MKKs were characterized but all groups include
kinases involved in biotic and/or abiotic stress responses.
Arabidopsis MKK2 belongs to group A of MKKs and is activated by
Chapter I
17
cold and salt stress treatments (Teige et al. 2004). MKK2 over-
expression increased the transcript level of several stress-responsive
genes and enhanced plant tolerance to high salinity and freezing
conditions. MKK2 was reported to phosphorylate MPK4 and MPK6,
which are activated by several stresses, including pathogen infection,
and osmotic, cold and oxidative stress (Teige et al. 2004).
Arabidopsis MKKs from groups B (MKK3) and C (MKK4 and MKK5)
were reported to be mainly involved in biotic stress responses (Doczi
et al. 2007; Sinha et al. 2011). In rice, OsMKK4 from group C was
shown to mediate the response to arsenic stress (Sinha et al. 2011).
Arabidopsis MKK9 belongs to group D and was proposed to mediate
ABA and salt stress responses (Alzwiy and Morris 2007).
Plant MAPKs are classified in 4 groups (A-D) and contain either
TEY (group A-C) or TDY (group D) phosphorylation motifs in their
activation domain (Ichimura et al. 2002; Liu and Xue 2007). A
conserved C-terminal common docking (CD) domain was detected in
group A and B proteins and proposed to function as a docking site
for MKKs and protein substrates (Ichimura et al. 2002). Group C
proteins also display a CD domain but with modified residues.
MAPKs from group D lack a CD domain and contain an extended C-
terminal region compared to proteins from the other groups (Ichimura
et al. 2002). Several MAPKs were reported to have a role in biotic
and abiotic stress responses. Arabidopsis MPK4 (group B) and
MPK6 (group A) are activated by cold, salt, drought and wounding
(Teige et al. 2004). In rice, OsMAPK5 (group A) activity was shown
to be induced by pathogen infection and ABA, drought, high salinity
and cold stress treatments (Xiong and Yang 2003). In addition,
studies with rice plants over-expressing and silencing OsMAPK5
revealed that it positively regulates drought, salt and cold tolerance
and negatively modulates disease resistance. A role in pathogen
General Introduction and Research Objectives
18
signaling responses was assigned to the group C MAPK MPK7
(Doczi et al. 2007). This protein was shown to be activated and
stabilized by MKK3 which blocks its degradation. The MKK3-MPK7
module was proposed to regulate the expression of pathogenesis-
related (PR) genes upon activation by ROS.
The rice blast- and wounding-activated MAP kinase (OsBWMK1)
belongs to the group D of MAPKs and is encoded by three
alternative splice variants: OsBWMK1L, OsBWMK1M and
OsBWMK1S (Koo et al. 2007). The protein isoforms were shown to
have different gene expression profiles in response to biotic and
abiotic stress conditions. OsBWMK1M and OsBWMK1S gene
expression was shown to be up-regulated by H2O2, JA, salicylic acid
(SA), NaCl and fungal elicitors, whereas OsBWMK1L transcript level
was not altered by any of these treatments (Koo et al. 2007).
OsBWMK1S transcript level was also shown to be induced by other
biotic and abiotic stress conditions, such as wounding, ABA and
drought stress (Agrawal et al. 2003; He et al. 1999). The kinase
activity of this isoform was also reported to be induced by pathogen
signals and ROS (Cheong et al. 2003). According to Koo et al.
(2007) the three isoforms display different subcellular locations.
OsBWMK1S was mainly detected within the nucleus, whereas
OsBWMK1L and OsBWMK1M were predominantly located in the
cytosol. Upon treatment with H2O2 and SA, the OsBWMK1L isoform
was shown to be translocated into the nucleus. The OsBWMK1S
isoform role in biotic stress responses was further analyzed through
over-expression in tobacco plants (Cheong et al. 2003). The
transgenic plants displayed enhanced resistance to bacterial and
fungal pathogens and increased accumulation of PR transcripts. In
addition, OsBWMK1S was shown to phosphorylate the AP2/ERF TF
OsEREBP1, enhancing its DNA-binding activity to GCC box
Chapter I
19
elements. OsBWMK1L and OsBWMK1M isoforms were also
reported to phosphorylate OsEREBP1 in vitro (Koo et al. 2007).
Several putative MAPK targets have been identified in
Arabidopsis through protein microarrays (Feilner et al. 2005;
Popescu et al. 2009). These studies predicted that the same MAPK
can phosphorylate several targets, but some targets are modified by
a single MAPK. Thus, MAPKs with similar sequences display some
specificity towards its targets. The majority of the identified targets
are TFs putatively involved in development and stress responses
(Popescu et al. 2009). Several members from the MYB, bZIP,
AP2/ERF and WRKY TF families were predicted to be
phosphorylayed by MAPKs (Popescu et al. 2009).
Transcription factors involved in abiotic stress responses
Stress signals perceived by the cell are transduced and amplified
through phosphorylation cascades that target proteins directly
involved in cell protection or in the regulation of gene expression
(e.g. transcription factors) (Xiong et al. 2002). The products of these
genes can also promote the synthesis of hormones like abscisic acid
(ABA) that initiate a second round of signaling. Transcription factors
(TFs) are master regulatory proteins that can modulate the
expression of several target genes through interaction with the cis-
elements present in the gene promoters (Nakashima et al. 2009).
TFs involved in abiotic stress responses include members of the
MYB, NAC, bZIP and AP2/ERF families, which can function in both
ABA-dependent and ABA-independent signaling pathways (Agarwal
and Jha 2010; Shao et al. 2007). Members of other TF families are
also involved in abiotic stress responses, but they are much less
represented. Figure 2 illustrates the most relevant members of the
transcriptional network associated with abiotic stress responses.
General Introduction and Research Objectives
20
Figure 2. Transcriptional network of abiotic stress responses. Transcription
factors and post-translational modifying enzymes are represented in ovals
and circles, respectively. The triangles indicate post-translational
modifications. The green boxes indicate cis-elements or putative motifs
(question marks) identified in stress-responsive genes. The black dot
corresponds to SUMOylation modification of ICE1 by SIZ1. The dashed
black line represents competition between SIZ1 and HOS1 for binding to
ICE1. Figure adapted from Saibo et al. (2009) and Yamaguchi-Shinozaki
and Shinozaki (2006).
MYB family
Transcription factor proteins from the MYB family contain MYB
repeats (R) involved in DNA-binding and protein-protein interactions
(Feller et al. 2011). The number of tandem MYB repeats groups
these TFs in three subfamilies: R-MYB, R2R3-MYB and R1R2R3-
MYB that contain one, two, or three repeats, respectively. Several
MYB proteins have been implicated in abiotic stress responses (see
Chapter I
21
Feller et al. (2011) and references therein). In rice, several MYB
proteins were reported to be involved in cold stress responses.
MYBS3 transcript level is regulated by cold, high salinity and ABA,
and its over-expression in rice was shown to enhance plant tolerance
to cold (Su et al. 2010). OsMYB3R-2 was shown to play an important
role in cell-cycle regulation, but it is also involved in abiotic stress
responses (Ma et al. 2009). Its gene expression is induced under
cold, drought and high salinity, and OsMYB3R-2 over-expression in
rice enhanced plant cold tolerance (Ma et al. 2009). On the other
hand, when over-expressed in Arabidopsis, this TF improved
tolerance to drought and high salinity (Dai et al. 2007). OsMYB4 was
shown to be involved in both biotic and abiotic stress responses
(Vannini et al. 2006). The TF over-expression in heterologous
systems conferred tolerance to different stress conditions depending
on the plant host (Agarwal and Jha 2010; Park et al. 2010). The
increased stress tolerance was proposed to be related to the
OsMYB4 putative function in osmotic adjustment (Park et al. 2010).
Studies with rice plants over-expressing OsMYB4 revealed that the
increased cold tolerance can be related to reduce oxidative injuries
due to enhanced antioxidant capacity (Park et al. 2010). The
transcriptional activity of some MYB proteins was shown to be
dependent on the interaction with basic Helix-Loop-Helix (bHLH)
proteins from the MYC subgroup (Feller et al. 2011). AtMYC2 and
AtMYB2 were shown to interact with the MYCRS and MYBRS cis-
elements present in the promoter of the drought- and ABA-inducible
gene rd22 (Figure 2) (Abe et al. 2003). TF co-expression in
Arabidopsis protoplasts strongly activated rd22 transcription. In
addition, over-expression of both TFs increased ABA sensitivity and
the transcript level of several ABA-responsive genes. Arabidopsis
low temperature responses were also reported to depend on the
General Introduction and Research Objectives
22
cooperative interaction between MYB15 and ICE1 (Inducer of CBF
Expression 1) (Figure 2) (Agarwal et al. 2006a). ICE1 encodes a
MYC-type bHLH TF, which positively regulates CBF/DREB1 genes
expression and has an essential role in cold acclimation
(Chinnusamy et al. 2003). This TF was shown to down regulate the
gene expression of MYB15, which represses the transcription of
CBF/DREB1 genes (Mazzucotelli et al. 2008). Under cold stress
conditions, ICE1 TF is activated through phosphorylation and
SUMOylation by the SUMO E3 ligase SIZ1 (SAP and MIZ domain
protein) (Chinnusamy et al. 2007). ICE1 SUMOylation blocks its
proteosomal degradation mediated by the E3 Ubiquitin ligase HOS1
(High expression of Osmotically responsive gene 1) (Miura et al.
2007). The ICE1 active form increases the expression of
CBF/DREB1 genes and, thus, enhances plant tolerance to low
temperatures.
NAC family
NAC [NAM (No Apical Meristem), ATAF (Arabidopsis
Transcription Activation Factor), and CUC2 (Cup-shaped Cotyledon)]
proteins are characterized by a highly conserved N-terminal NAC
domain that binds to target DNA and a divergent region in the C-
terminal domain that regulates its transcriptional activity (Olsen et al.
2005). These proteins have been implicated in the regulation of
several processes, including developmental mechanisms and stress
responses (Olsen et al. 2005). Arabidopsis ATAF1 was reported to
be involved in both biotic and abiotic stress responses (Wu et al.
2009). Its gene transcripts accumulate in response to drought, high
salinity, ABA, JA, wounding and pathogen infection. Additionally,
ATAF1 over-expression enhanced tolerance to drought stress and
increased plant sensitivity to high salt, ABA, oxidative stress and
Chapter I
23
pathogen infection. Several NAC proteins were shown to regulate the
transcription of stress-responsive genes cooperatively with other
TFs. ANAC019, ANAC055 and ANAC072 interact with the zinc-finger
homeodomain (ZF-HD) protein ZFHD1 to regulate the drought-
dependent expression of ERD1 (Early Responsive to Drought 1)
(Figure 2) (Tran et al. 2007). Arabidopsis plants over-expressing both
NAC and ZFHD1 TFs displayed improved drought tolerance. In rice,
OsNAC5 was demonstrated to form homo- and heterodimers with
the NAC domains of OsNAC5, OsNAC6 and SNAC1 (Takasaki et al.
2010). Additionally, OsNAC5 and OsNAC6 transcriptionally activate
OsLEA3 (Late Embryogenesis Abundant group 3 protein), a stress-
inducible gene whose over-expression enhances rice drought
tolerance. Rice plants over-expressing OsNAC6 displayed improved
tolerance to drought, high salinity and blast disease, suggesting that
the TF is involved in both biotic and abiotic stress responses
(Nakashima et al. 2007). OsNAC10 function in abiotic stress
responses was revealed through its over-expression driven by a
constitutive and a root-specific promoter in rice (Jeong et al. 2010).
The transgenic plants displayed enhanced tolerance to drought, high
salinity and cold stress at the vegetative stage. In addition, OsNAC10
root-specific over-expression resulted in increased rice grain yield
under field drought conditions. ONAC045 was also shown to have an
important role in rice response to drought and high salinity (Zheng et
al. 2009). Its over-expression resulted in rice plants with enhanced
tolerance to this abiotic stress conditions. In both OsNAC10 and
ONAC045 transgenic plants the enhanced tolerance was associated
with the induction of stress-responsive genes (Jeong et al. 2010;
Zheng et al. 2009)
General Introduction and Research Objectives
24
bZIP family
The basic-region leucine zipper (bZIP) TFs contain a basic region
that interacts with the DNA and a leucine zipper involved in protein
homo- and heterodimerization (Jakoby et al. 2002). Several bZIP
proteins have been implicated in ABA-dependent abiotic stress
responses and are thus referred to as ABRE-binding (AREB)
proteins or ABRE-Binding Factors (ABFs). These proteins modulate
the expression of ABA-responsive genes through binding to the ABA
Responsive Element (ABRE; ACGT-core), a cis-element present in
their promoter region (Umezawa et al. 2010; Zhang et al. 2005).
However, the presence of one ABRE was shown to be insufficient to
activate ABA-dependent gene expression and an additional element
termed coupling element (CE) was shown to be required (Gomez-
Porras et al. 2007; Zhang et al. 2005). Two CEs (CE1 and CE3)
were identified in wheat and shown to form an ABA-responsive
complex. Additionally, ABREs themselves and the dehydration-
responsive element (DRE) were reported to function as CEs. bZIP
proteins were shown to interact with DNA as homo- or heterodimers
and the affinity to specific DNA sequences may be dependent on the
dimer formed (Siberil et al. 2001). Additionally, phosphorylation was
proposed to determine the DNA binding affinity and the formation of
specific dimers (Schutze et al. 2008). Rice bZIPs TRAB1 and OsVP1
were shown to directly interact and to putatively regulate the
expression of ABA-responsive genes (Hobo et al. 1999). TRAB1
directly binds to ABRE motifs and this interaction was enhanced
upon ABA-dependent phosphorylation (Kagaya et al. 2002).
Additionally, TRAB1 phosphorylation was shown to be triggered by
high salinity treatments (Kobayashi et al. 2005). Rice OSBZ8 activity
was also proposed to be regulated by phosphorylation, which may
Chapter I
25
promote the bZIP interaction with the promoter of several LEA genes
(RoyChoudhury et al. 2008). OSBZ8 transcripts were shown to
rapidly accumulate in response to ABA and to be present at higher
levels in salt-tolerant rice cultivars as compared to salt-sensitive ones
(Mukherjee et al. 2006). OsABF1 and OsABF2 also play a role in
abiotic stress responses. Their transcript levels are up regulated
under different stress conditions, including cold, drought and high
salinity, and the respective mutants showed enhanced sensitivity to
high salinity and drought stress (Hossain et al. 2010a; Hossain et al.
2010b). In Arabidopsis, AREB1 transcriptional activity was reported
to be dependent on ABA-mediated multisite phosphorylation
(Furihata et al. 2006). Over-expression of a constitutive active form
of AREB1 resulted in the expression of downstream genes involved
in drought stress tolerance, such as the LEA genes RD29B and
RAB18 (Fujita et al. 2005). The transgenic plants displayed ABA
hypersensitivity and enhanced drought tolerance.
AP2/ERF family
AP2/ERF (APETALA2/Ethylene Response Factor) TFs are
characterized by the highly conserved AP2 domain involved in TF
binding to DNA (Dietz et al. 2010; Santos et al. 2011). The origin of
these proteins in plants is proposed to result from horizontal transfer
of an HNN-AP2 endonuclease from bacteria or viruses (Magnani et
al. 2004). The plant AP2/ERF family is divided in five subfamilies,
AP2, RAV, ERF, DREB and ‘others’, according to the similarity of
their DNA binding domains (Sakuma et al. 2002). The AP2
(APETALA2) proteins contain two AP2 domains and are mainly
involved in plant development. The RAV (Related to ABI3/VP1)
proteins have a B3 domain apart from one AP2 domain, and can
interact with bipartite DNA motifs through both DNA-binding domains
General Introduction and Research Objectives
26
(Dietz et al. 2010; Swaminathan et al. 2008). Arabidopsis and pepper
RAV proteins have been implicated in stress responses. RAV1 and
RAV2 transcripts accumulated in Arabidopsis plants subjected to
several abiotic stress conditions (Woo et al. 2010). Over-expression
of CARAV1 from pepper in Arabidopsis greatly enhanced plant
resistance to pathogen infection and tolerance to osmotic stress
(Sohn et al. 2006). Members from the DREB (Dehydration-
Responsive Element Binding protein) and ERF (Ethylene
Responsive Factor) subfamilies are implicated in biotic and abiotic
stress responses. These proteins contain only one AP2 domain but
have different DNA binding specificity due to the amino acids in
position 14 and 19 (Sakuma et al. 2002). The 14th alanine and the
19th aspartic acid are conserved in the ERF proteins, whereas valine
and glutamic acid are conserved within DREB proteins. Although
both ERF and DREB TFs recognize the core sequence CCGNC,
their DNA-binding specificity is determined by the sequences that
surround this core motif. DREB proteins usually recognize the
dehydration responsive element (DRE; A/GCCGAC), whereas ERF
TFs preferentially interact with ERE (Ethylene-Responsive Element),
which contains a core sequence designated GCC box (AGCCGCC)
(Mizoi et al. 2012). Although ERE and DRE are considered the
optimal target sites for ERF and DREB proteins, respectively, several
studies indicate that members of these subfamilies can bind to either
cis-elements with different affinity levels and to sequences containing
variations of both core motifs (Fujimoto et al. 2000; Kizis et al. 2001).
Proteins from the DREB subfamily were reported to recognize cis-
elements similar to DRE, such as the C-repeat (CRT) and the Low-
Temperature-Responsive Element (LTRE) (Yamaguchi-Shinozaki
and Shinozaki 2005). TFs that bind to the CRT element were named
Chapter I
27
CRT-binding factors/DRE-binding proteins (CBF/DREB) (Baker et al.
1994; Jiang et al. 1996; Stockinger et al. 1997).
Proteins from the ERF subfamily were initially characterized as
regulators of ethylene signal transduction pathways, but their role in
biotic and abiotic stress responses has been shown in several plant
species (Xu et al. 2011). The identification of ERE cis-elements in
the promoter region of several pathogenesis-related (PR) genes,
suggested that ERF had a role in biotic stress responses (Dietz et al.
2010; Gutterson and Reuber 2004). Additionally, studies in
Arabidopsis, tobacco and tomato revealed that ERF over-expression
enhanced plant resistance to fungal and bacterial pathogens (Xu et
al. 2011). The involvement of ERF TFs in abiotic stress responses
was confirmed in several plant species (Xu et al. 2011). Tomato
JERF1 was shown to be regulated at transcriptional level by
ethylene, jasmonic acid, ABA and high salinity (Wu et al. 2007).
When over-expressed in tobacco JERF1 enhanced plant tolerance to
high salinity and cold stress through the transcriptional activation of
stress-responsive genes. JERF1 was also reported to interact with
multiple cis-acting elements, such as GCC box, DRE and CE1 and,
therefore, proposed to function in both ABA-dependent and ABA-
independent stress signaling pathways. GmERF3 from soybean was
shown to function in biotic and abiotic stress responses (Zhang et al.
2009a). When over-expressed in tobacco, it increased tolerance to
high salinity and drought stress. Additionally, the transgenic plants
displayed enhanced resistance to bacterial, fungal and viral
pathogens, suggesting that GmERF3 is also involved in biotic stress
responses. In rice, OsBIERF2, OsBIERF3 and SUB1A were reported
to be involved in abiotic stress responses. OsBIERF2 (also named
AP37 or OsERF3) gene expression was induced by high salinity and
drought stress, and its over-expression enhanced rice tolerance to
General Introduction and Research Objectives
28
both stress conditions and to low temperature at vegetative stage
(Oh et al. 2009). In addition, these transgenic plants showed
enhanced drought tolerance during the reproductive stage, leading to
an increased grain yield as compared to wild-type plants. OsBIERF3
(also named AP59) has a role in rice biotic and abiotic stress
responses. Tobacco plants over-expressing this TF showed
enhanced disease resistance against infection by virus and bacteria,
and increased drought and high salinity tolerance (Cao et al. 2005).
The SUB1A-1 allele was identified only in rice indica cultivars and
reported to contribute to the higher submergence tolerance observed
in these cultivars as compared to the japonica ones. Introgression of
SUB1A-1 in japonica cultivars enhanced rice tolerance to
submergence and drought stress (Fukao et al. 2011).
DREB proteins are mainly implicated in plant responses to abiotic
stress conditions. This subfamily was divided in two subclasses,
CBF/DREB1 and DREB2, due to their differential gene expression
pattern in Arabidopsis plants subjected to abiotic stress conditions
(Agarwal et al. 2006b). The fact that some genes are identified as
CBF and others as DREB, results from the fact that at the same time
two independent teams have characterized the same genes in
Arabidopsis (Liu et al. 1998; Stockinger et al. 1997). The
CBF/DREB1 subclass includes the CBF3/DREB1A, CBF1/DREB1B
and CBF2/DREB1C genes, which were up-regulated by low
temperatures but not by drought or high salt stress. Contrary, the
DREB2 genes, DREB2A and DREB2B, were only induced by
drought and high salt stress. Other members from the CBF/DREB1
subclass, such as the DREB1D and DREB1F, were identified and
reported to respond to drought and salt stress at transcriptional level,
suggesting cross-talk between the CBF/DREB1 and DREB2
pathways in response to these stress conditions (Nakashima et al.
Chapter I
29
2009). In Arabidopsis, the CBF/DREB1 regulon was proposed to be
regulated by the zinc-finger TF ZAT12 which reduces the expression
of CBF/DREB genes (Vogel et al. 2005). ZAT12 putative homologs
were identified in rice and barley, but their function in still unknown
(Skinner et al. 2006). The CBF/DREB1 regulon has an important role
in low temperature responses. Over-expression of CBF/DREB1
genes in Arabidopsis and other plant species, such as rice and
wheat, resulted in improved plant tolerance to low temperature but
also to salt and drought stress conditions (Nakashima et al. 2009; Xu
et al. 2011). In rice, OsDREB1A, OsDREB1B and OsDREB1F are
induced by drought, high salinity and cold stress (Dubouzet et al.
2003; Fukao et al. 2011; Gutha and Reddy 2008; Wang et al. 2008),
and their over-expression in Arabidopsis and rice improved tolerance
to those stresses in both species (Ito et al. 2006). OsDREB1A-OX
plants displayed increased content of osmoprotectants and activation
of several stress-responsive genes (Ito et al. 2006). Studies in
tobacco revealed that OsDREB1B is also involved in biotic stress
responses and radical scavenging processes (Gutha and Reddy
2008). Some rice DREB genes were shown to have a putative role in
ABA-dependent responses. OsDREB1F was induced by an ABA
treatment (Wang et al. 2008) and Arabidopsis plants over-expressing
OsDREB1D showed decreased sensitivity to ABA (Zhang et al.
2009c). DREB2 proteins have been identified in Arabidopsis and
several crop species, such as rice, wheat, barley and maize
(Matsukura et al. 2010). Under control conditions, Arabidopsis
DREB2A was shown to be regulated at post-translational level
through ubiquitination by DRIP1 and DRIP2 RING E3 ligases (Qin et
al. 2008). Over-expression of the DREB2A constitutively active form
resulted in enhanced tolerance to drought stress (Sakuma et al.
2006). DREB2 proteins from rice, barley, wheat and maize were also
General Introduction and Research Objectives
30
shown to be regulated by alternative splicing (Mizoi et al. 2012).
Under control conditions there is an accumulation of inactive
transcripts, whereas increased induction of active transcripts occurs
under stress. Over-expression of the OsDREB2B active form
improved Arabidopsis tolerance to drought and heat-shock stress
(Matsukura et al. 2010).
The coordinated action of TFs promotes the regulation of several
tolerance mechanisms that will allow plant adaptation to
environmental changes and ultimately its survival. The identification
and functional characterization of TFs from several plant species
contributes to a better understanding of the complexity of plant
responses to abiotic stress conditions.
Plant mechanisms to cope with salt stress
Plants have evolved sophisticated mechanisms to adapt their
growth and development to changes in the environment. The
response to high salinity involves mechanisms that occur at cellular
level, including intracellular compartmentation and damage repair,
and at whole plant level, mainly to control Na+ uptake and distribution
(Tester and Davenport 2003).
High salinity causes osmotic stress, which reduces cellular turgor
and leads to water loss. To cope with this adverse effect, plants have
developed several osmotic adjustment mechanisms (Chinnusamy et
al. 2005). One of these mechanisms, is the ion compartmentation in
the vacuole, which contributes to low Na+ concentrations in the
cytosol, promoting ion homeostasis and maintenance of cellular
turgor (Gao et al. 2008). AtNHX1 is a tonoplast Na+/H+ transporter,
which was shown to have an important function in salt stress
tolerance. Over-expression in Arabidopsis, tomato and Brassica
napus greatly enhanced plant tolerance to this abiotic stress (Tester
Chapter I
31
and Davenport 2003). Similarly, rice and maize plants over-
expressing the Na+/H+ antiporter OsNHX1 displayed improved salt
tolerance (Chen et al. 2007; Fukuda et al. 2004; Liu et al. 2010). In
addition, Na+/H+ antiporters were reported to display increased
activity in barley roots subjected to salt stress (Tester and Davenport
2003).
The accumulation of Na+ ions in the vacuole is accompanied by
increased amounts of K+ ions and organic solutes in the cytosol to
facilitate osmotic adjustment (Munns and Tester 2008; Tester and
Davenport 2003). Accumulation of organic solutes in the cytosol is
also required to prevent cell water loss due to high Na+
concentrations outside the cell (Negrao et al. 2011). The most
common include proline, trehalose and glycine betaine (Chinnusamy
et al. 2005). Besides their role in the osmotic adjustment, these
compounds have protective functions and therefore are usually
termed osmoprotectants (Tester and Davenport 2003). Proline
accumulation greatly increases in rice plants subjected to salt stress
and this accumulation is enhanced in tolerant rice genotypes
(Negrao et al. 2011). This metabolite is thought to contribute to
osmotic adjustment but also to function in ROS scavenging (Tester
and Davenport 2003; Türkan and Demiral 2009). Glycine betaine
was proposed to function as a chaperone, stabilizing quaternary
structures of proteins and therefore protecting important enzymes
like RUBISCO (Tester and Davenport 2003; Türkan and Demiral
2009). In addition, this osmoprotectant was reported to have a
putative function in the protection of mitochondrial electron transport
reactions under high salinity, extreme temperature or pH (Tester and
Davenport 2003; Türkan and Demiral 2009). Trehalose was also
proposed to stabilize protein and membrane structures. The
important role of glycine betaine in salt stress responses was shown
General Introduction and Research Objectives
32
through studies with Arabidopsis, rice, wheat and Brassica plants
over-producing this compound (Chinnusamy et al. 2005). Similarly,
rice plants over-producing trehalose displayed enhanced tolerance to
high salinity. This feature was proposed to be related to the
protective function of these compounds and not to their role in
osmotic adjustment (Chinnusamy et al. 2005).
High salinity causes damages in cellular structures and
components. Thereby, to reduce the salt-related deleterious effects,
cells synthesize several proteins with protective functions. LEA
proteins and heat-shock proteins (HSPs) are induced and
accumulate in response to drought, high salinity and extreme
temperature stress (Hussain et al. 2011). LEAs have the ability to
protect proteins from inactivation and aggregation and may also have
a function in membrane stabilization (Hand et al. 2011). The
dehydrins belong to the LEA protein family and were shown to be
involved in ROS scavenging. Over-expression of genes encoding
LEA proteins were reported to enhance plant stress tolerance, further
confirming their role in stress responses (Hussain et al. 2011).
Transgenic rice plants expressing the barley gene HVA1, which
encodes a LEA protein, displayed enhanced tolerance to drought
and high salinity. However, it is not clear if the transgenic plants have
increased tolerance to the osmotic or the ion-specific effect of salt
stress (Tester and Davenport 2003). HSPs function as molecular
chaperones, being responsible for protein folding, assembly,
translocation and degradation (Wang et al. 2004). Small HSPs
(sHSPs) are also involved in enzyme stabilization and in the
reactivation of inactive enzymes (Hussain et al. 2011). Studies in
Arabidopsis, tobacco and rice revealed that over-expression of
genes encoding HSPs or sHSPs greatly enhanced plant tolerance to
drought stress (see Hussain et al. (2011) and references therein).
Chapter I
33
The accumulation of ROS and the induced oxidative stress is a
consequence of high salinity and other abiotic stress conditions. To
minimize ROS effects, cells have efficient detoxification mechanisms,
including antioxidant or ROS-scavenging enzymes and non-
enzymatic antioxidants (Gao et al. 2008; Türkan and Demiral 2009).
The superoxide dismutase (SOD) and ascorbate peroxidase (APX)
are examples of ROS-scavenging enzymes. SOD catalyses the
dismutation of O2- to H2O2, whereas APX catalyses the conversion of
H2O2 to H2O (Apel and Hirt 2004). Non-enzymatic antioxidants
include ascorbic acid and glutathione, which also function in ROS
scavenging processes. Several studies suggest a correlation
between the efficiency of ROS detoxification and plant salt stress
tolerance (Türkan and Demiral 2009). High salinity was reported to
increase the activity or accumulation of antioxidant enzymes and
non-enzymatic antioxidants, respectively, but high variability was
found among different plant species and even between cultivars
(Ashraf 2009). Rice salt-tolerant cultivars were shown to display
higher accumulation of reduced ascorbic acid and enhanced activity
of antioxidant enzymes, as compared to a salt-sensitive cultivar
(Moradi and Ismail 2007). In addition, over-expression of genes
encoding antioxidant enzymes was shown to enhance plant salt
stress tolerance. Arabidopsis plants over-expressing a manganese-
SOD (Mn-SOD) displayed increased salt tolerance and increased
activity of other antioxidant enzymes (Gill and Tuteja 2010). Similarly,
enhanced salt tolerance was observed in Arabidopsis plants over-
expressing HvAPX1 or OsAPXa from barley and rice, respectively
(Gill and Tuteja 2010).
Salt stress response mechanisms that occur at whole plant level
are mainly related to the control of Na+ uptake and its distribution
within the plant (Tester and Davenport 2003). To restrict Na+
General Introduction and Research Objectives
34
accumulation in the shoot, plants can enhance the ion efflux to the
soil solution, reduce its initial entry in the plant, minimize ion entry
into the xylem stream, maximize its retrieval before reaching the
shoots and secrete it onto the surface of the leaf (Tester and
Davenport 2003). Exclusion of Na+ across the plasma membrane to
the soil solution was proposed to involve Na+/H+ antiporters (Hauser
and Horie 2010; Plett and Moller 2010). The SOS1 was suggested to
participate in this process at the epidermis of Arabidopsis root tips.
The initial entry of Na+ in the plant is mediated by Ca2+-sensitive and
insensitive processes (Plett and Moller 2010). Cyclic nucleotide-
gated channels (CNGCs) and glutamate-activated channels (GLRs)
are examples of non-selective cation channels (NSCCs) putatively
involved in Ca2+-sensitive Na+ influx. The OsCNGC1 gene was
shown to be differentially expressed in rice salt-sensitive and salt-
tolerant cultivars (Plett and Moller 2010). Tolerant cultivars displayed
decreased OsCNGC1 gene expression which was proposed to
explain the restricted Na+ influx detected in this cultivar. Enhanced
sensitivity to ionic stress caused by Na+ and K+ was detected in
Arabidopsis plants over-expressing AtGLR3;2, suggesting that this
transporter is involved in Na+ influx. Ca2+-insensitive Na+ influx was
proposed to occur through NSCCs and to involve members of the
high-affinity K+ (HKT) family, but their exact function is unknown
(Hauser and Horie 2010). The mechanisms involved in Na+ loading
into the xylem are also largely unknown. In Arabidopsis the SOS
pathway was proposed to be involved in the active efflux of Na+ to
the xylem under moderate Na+ concentrations (Tester and Davenport
2003). Removal of Na+ from the xylem before it reaches the shoots is
a common mechanism of salt tolerance among Arabidopsis and crop
species like rice and wheat (Hauser and Horie 2010). Members of
the HKT family were proposed to be involved in this process.
Chapter I
35
Arabidopsis AtHKT1;1 was shown to exclude Na+ from the xylem and
indirectly stimulate K+ loading, to maintain a high K+/Na+ ratio in
shoots (Hauser and Horie 2010). The AtHKT1;1 ortholog OsHKT1;5
from rice was reported to function in Na+ retrieval from xylem but its
role in K+ homeostasis was not confirmed (Hauser and Horie 2010).
Another mechanism to reduce Na+ concentration in the shoots is
through ion excretion by salt glands (modified trichomes) or bladders
(modified epidermal cells) (Munns and Tester 2008). However, this
specialized cell types are mainly present in halophytes (Munns
2002).
A better understanding of the molecular mechanisms underlying
tolerance to abiotic stress conditions may support the design of
improved strategies to apply in breeding programs not only for rice
but also for other crops.
Research Objectives
Many genes have been shown to play important roles in abiotic
stress responses in different plants. However, little is known about
their upstream regulation. In order to contribute to narrow this gap,
the main goal of this study was to identify and characterize
transcription factors (TFs) regulating a target gene selected for its
high response to salt stress. Therefore, this thesis started by
analyzing in detail different genes described in the literature as
responsive to high salinity. Their putative biological function as well
as expression profile under high salinity, were main criteria for
selection of the best candidate for follow up.
To identify the TFs binding to the target gene, we aimed to use an
yeast one-hybrid (Y1H) screening, using a salt-induced cDNA
expression library, also to be prepared during this study.
Electrophoretic mobility shift assays and transient expression assays
General Introduction and Research Objectives
36
in Arabidopsis protoplasts were planned to confirm the protein-DNA
interaction and to characterize the TFs transcriptional activity,
respectively.
For functional analysis of the novel TFs, transcription expression
patterns under abiotic stress conditions (e.g. high salinity, drought,
ABA and low temperature treatments) were designed. TF subcellular
localization was assessed by transient expression of the TF proteins
fused to GFP in onion epidermal cells and/or Arabidopsis
protoplasts. The biological function of the TFs was investigated
through over-expression in Arabidopsis plants, and further
characterized regarding seed germination rate, root growth and
survival rate under abiotic stress. In addition, Arabidopsis mutants for
genes homologous to the rice TFs have been complemented through
heterologous expression.
References
Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003)
Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as
transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78
Agarwal M, Hao Y, Kapoor A, Dong CH, Fujii H, Zheng X, Zhu JK (2006a) A
R2R3 type MYB transcription factor is involved in the cold regulation of
CBF genes and in acquired freezing tolerance. J Biol Chem 281: 37636-
37645
Agarwal PK, Agarwal P, Reddy MK, Sopory SK (2006b) Role of DREB
transcription factors in abiotic and biotic stress tolerance in plants. Plant
Cell Rep 25: 1263-1274
Agarwal PK, Jha B (2010) Transcription factors in plants and ABA
dependent and independent abiotic stress signalling. Biol Plantarum 54:
201-212
Agrawal GK, Tamogami S, Iwahashi H, Agrawal VP, Rakwal R (2003)
Transient regulation of jasmonic acid-inducible rice MAP kinase gene
Chapter I
37
(OsBWMK1) by diverse biotic and abiotic stresses. Plant Physiol
Biochem 41 355-361
Alzwiy IA, Morris PC (2007) A mutation in the Arabidopsis MAP kinase
kinase 9 gene results in enhanced seedling stress tolerance. Plant Sci
173: 302-308
Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative
stress, and signal transduction. Annu Rev Plant Biol 55: 373-399
Ashraf M (2009) Biotechnological approach of improving plant salt tolerance
using antioxidants as markers. Biotechnol Adv 27: 84-93
Baker SS, Wilhelm KS, Thomashow MF (1994) The 5'-region of Arabidopsis
thaliana cor15a has cis-acting elements that confer cold-, drought- and
ABA-regulated gene expression. Plant Mol Biol 24: 701-713
Bartels D, Sunkar R (2005) Drought and salt tolerance in plants. Crit Rev
Plant Sci 24: 23-58
Bhushan D, Pandey A, Choudhary MK, Datta A, Chakraborty S,
Chakraborty N (2007) Comparative proteomics analysis of differentially
expressed proteins in chickpea extracellular matrix during dehydration
stress. Mol Cell Proteomics 6: 1868-1884
Buell CR, Last RL (2010) Twenty-first century plant biology: impacts of the
Arabidopsis genome on plant biology and agriculture. Plant Physiol 154:
497-500
Cao YF, Wu YF, Zheng Z, Song FM (2005) Overexpression of the rice
EREBP-like gene OsBIERF3 enhances disease resistance and salt
tolerance in transgenic tobacco. Physiol Mol Plant Pathol 67: 202-211
Casasoli M, Spadoni S, Lilley KS, Cervone F, De Lorenzo G, Mattei B
(2008) Identification by 2-D DIGE of apoplastic proteins regulated by
oligogalacturonides in Arabidopsis thaliana. Proteomics 8: 1042-1054
Chaves MM, Flexas J, Pinheiro C (2009) Photosynthesis under drought and
salt stress: regulation mechanisms from whole plant to cell. Ann Bot 103:
551-560
Chen M, Chen Q-J, Niu X-G, Zhang R, Lin H-Q, Xu C-Y, Wang X-C, Wang
G-Y, Chen J (2007) Expression of OsNHX1 gene in maize confers salt
General Introduction and Research Objectives
38
tolerance and promotes plant growth in the field. Plant Soil Environ 53:
490-498
Chen Z (2001) A superfamily of proteins with novel cysteine-rich repeats.
Plant Physiol 126: 473-476
Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim JC,
Park BO, Koo SC, Yoon HW, Chung WS, Lim CO, Lee SY, Cho MJ
(2003) BWMK1, a rice mitogen-activated protein kinase, locates in the
nucleus and mediates pathogenesis-related gene expression by
activation of a transcription factor. Plant Physiol 132: 1961-1972
Chinnusamy V, Jagendorf A, Zhu J-K (2005) Understanding and improving
salt tolerance in plants. Crop Science 45: 437-448
Chinnusamy V, Ohta M, Kanrar S, Lee BH, Hong X, Agarwal M, Zhu JK
(2003) ICE1: a regulator of cold-induced transcriptome and freezing
tolerance in Arabidopsis. Genes Dev 17: 1043-1054
Chinnusamy V, Zhu J, Zhu JK (2007) Cold stress regulation of gene
expression in plants. Trends Plant Sci 12: 444-451
Dai X, Xu Y, Ma Q, Xu W, Wang T, Xue Y, Chong K (2007) Overexpression
of an R1R2R3 MYB gene, OsMYB3R-2, increases tolerance to freezing,
drought, and salt stress in transgenic Arabidopsis. Plant Physiol 143:
1739-1751
Dani V, Simon WJ, Duranti M, Croy RR (2005) Changes in the tobacco leaf
apoplast proteome in response to salt stress. Proteomics 5: 737-745
de Lorenzo L, Merchan F, Laporte P, Thompson R, Clarke J, Sousa C,
Crespi M (2009) A novel plant leucine-rich repeat receptor kinase
regulates the response of Medicago truncatula roots to salt stress. Plant
Cell 21: 668-680
DeFalco TA, Bender KW, Snedden WA (2010) Breaking the code: Ca2+
sensors in plant signalling. Biochem J 425: 27-40
Dietz KJ, Vogel MO, Viehhauser A (2010) AP2/EREBP transcription factors
are part of gene regulatory networks and integrate metabolic, hormonal
and environmental signals in stress acclimation and retrograde
signalling. Protoplasma 245: 3-14
Chapter I
39
Doczi R, Brader G, Pettko-Szandtner A, Rajh I, Djamei A, Pitzschke A,
Teige M, Hirt H (2007) The Arabidopsis mitogen-activated protein kinase
kinase MKK3 is upstream of group C mitogen-activated protein kinases
and participates in pathogen signaling. Plant Cell 19: 3266-3279
Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, Seki M,
Shinozaki K, Yamaguchi-Shinozaki K (2003) OsDREB genes in rice,
Oryza sativa L., encode transcription activators that function in drought-,
high-salt- and cold-responsive gene expression. Plant J 33: 751-763
Feilner T, Hultschig C, Lee J, Meyer S, Immink RG, Koenig A, Possling A,
Seitz H, Beveridge A, Scheel D, Cahill DJ, Lehrach H, Kreutzberger J,
Kersten B (2005) High throughput identification of potential Arabidopsis
mitogen-activated protein kinases substrates. Mol Cell Proteomics 4:
1558-1568
Feller A, Machemer K, Braun EL, Grotewold E (2011) Evolutionary and
comparative analysis of MYB and bHLH plant transcription factors. Plant
J 66: 94-116
Feuillet C, Leach JE, Rogers J, Schnable PS, Eversole K (2011) Crop
genome sequencing: lessons and rationales. Trends Plant Sci 16: 77-88
Finkelstein RR, Gampala SS, Rock CD (2002) Abscisic acid signaling in
seeds and seedlings. Plant Cell 14 Suppl: S15-45
Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000)
Arabidopsis ethylene-responsive element binding factors act as
transcriptional activators or repressors of GCC box-mediated gene
expression. Plant Cell 12: 393-404
Fujita Y, Fujita M, Satoh R, Maruyama K, Parvez MM, Seki M, Hiratsu K,
Ohme-Takagi M, Shinozaki K, Yamaguchi-Shinozaki K (2005) AREB1 is
a transcription activator of novel ABRE-dependent ABA signaling that
enhances drought stress tolerance in Arabidopsis. Plant Cell 17: 3470-
3488
Fukao T, Yeung E, Bailey-Serres J (2011) The submergence tolerance
regulator SUB1A mediates crosstalk between submergence and drought
tolerance in rice. Plant Cell 23: 412-427
General Introduction and Research Objectives
40
Fukuda A, Nakamura A, Tagiri A, Tanaka H, Miyao A, Hirochika H, Tanaka
Y (2004) Function, intracellular localization and the importance in salt
tolerance of a vacuolar Na(+)/H(+) antiporter from rice. Plant Cell Physiol
45: 146-159
Furihata T, Maruyama K, Fujita Y, Umezawa T, Yoshida R, Shinozaki K,
Yamaguchi-Shinozaki K (2006) Abscisic acid-dependent multisite
phosphorylation regulates the activity of a transcription activator AREB1.
Proc Natl Acad Sci USA 103: 1988-1993
Gao JP, Chao DY, Lin HX (2007) Understanding abiotic stress tolerance
mechanisms: recent studies on stress response in rice. J Integr Plant
Biol 49: 742-750
Gao JP, Chao DY, Lin HX (2008) Toward understanding molecular
mechanisms of abiotic stress responses in rice. Rice 1: 36-51
Gill SS, Tuteja N (2010) Reactive oxygen species and antioxidant
machinery in abiotic stress tolerance in crop plants. Plant Physiol
Biochem 48: 909-930
Gish LA, Clark SE (2011) The RLK/Pelle family of kinases. Plant J 66: 117-
127
Gomez-Porras JL, Riano-Pachon DM, Dreyer I, Mayer JE, Mueller-Roeber
B (2007) Genome-wide analysis of ABA-responsive elements ABRE and
CE3 reveals divergent patterns in Arabidopsis and rice. BMC Genomics
8: 260
Gujja B, Thiyagarajan TM (2010) Producing more with less: exploring farm-
based approaches to improve productivity and providing options to
farmers in adapting to climate change. International Rice Research
Institute (IRRI) Limited Proceedings Series: 1-7
Gutha LR, Reddy AR (2008) Rice DREB1B promoter shows distinct stress-
specific responses, and the overexpression of cDNA in tobacco confers
improved abiotic and biotic stress tolerance. Plant Mol Biol 68: 533-555
Gutterson N, Reuber TL (2004) Regulation of disease resistance pathways
by AP2/ERF transcription factors. Curr Opin Plant Biol 7: 465-471
Haffani Y, Silva N, Goring D (2004) Receptor kinase signaling in plants. Can
J Bot 82: 1-15
Chapter I
41
Hamel LP, Nicole MC, Sritubtim S, Morency MJ, Ellis M, Ehlting J, Beaudoin
N, Barbazuk B, Klessig D, Lee J, Martin G, Mundy J, Ohashi Y, Scheel
D, Sheen J, Xing T, Zhang S, Seguin A, Ellis BE (2006) Ancient signals:
comparative genomics of plant MAPK and MAPKK gene families. Trends
Plant Sci 11: 192-198
Hand SC, Menze MA, Toner M, Boswell L, Moore D (2011) LEA Proteins
During Water Stress: Not Just for Plants Anymore. Annu Rev Physiol 73:
115-134
Hauser F, Horie T (2010) A conserved primary salt tolerance mechanism
mediated by HKT transporters: a mechanism for sodium exclusion and
maintenance of high K(+)/Na(+) ratio in leaves during salinity stress.
Plant Cell Environ 33: 552-565
He C, Fong SH, Yang D, Wang GL (1999) BWMK1, a novel MAP kinase
induced by fungal infection and mechanical wounding in rice. Mol Plant
Microbe Interact 12: 1064-1073
Hirayama T, Shinozaki K (2010) Research on plant abiotic stress responses
in the post-genome era: past, present and future. Plant J 61: 1041-1052
Hobo T, Kowyama Y, Hattori T (1999) A bZIP factor, TRAB1, interacts with
VP1 and mediates abscisic acid-induced transcription. Proc Natl Acad
Sci USA 96: 15348-15353
Hossain MA, Cho JI, Han M, Ahn CH, Jeon JS, An G, Park PB (2010a) The
ABRE-binding bZIP transcription factor OsABF2 is a positive regulator of
abiotic stress and ABA signaling in rice. J Plant Physiol 167: 1512-1520
Hossain MA, Lee Y, Cho JI, Ahn CH, Lee SK, Jeon JS, Kang H, Lee CH, An
G, Park PB (2010b) The bZIP transcription factor OsABF1 is an ABA
responsive element binding factor that enhances abiotic stress signaling
in rice. Plant Mol Biol 72: 557-566
Hsiao TC, Xu LK (2000) Sensitivity of growth of roots versus leaves to water
stress: biophysical analysis and relation to water transport. J Exp Bot 51:
1595-1616
Hubbard KE, Nishimura N, Hitomi K, Getzoff ED, Schroeder JI (2010) Early
abscisic acid signal transduction mechanisms: newly discovered
components and newly emerging questions. Genes Dev 24: 1695-1708
General Introduction and Research Objectives
42
Hussain SS, Iqbal MT, Arif MA, Amjad M (2011) Beyond osmolytes and
transcription factors: drought tolerance in plants via protective proteins
and aquaporins. Biol Plantarum 55: 401-413
Ichimura K, Shinozaki K, Tena G, Sheen J, Henry Y, Champion A, Kreis M,
Zhang SQ, Hirt H, Wilson C, Heberle-Bors E, Ellis BE, Morris PC, Innes
RW, Jr E, Scheel D, Klessig DF, Machida Y, Mundy J, Ohashi Y, Walker
JC, Grp M (2002) Mitogen-activated protein kinase cascades in plants: a
new nomenclature. Trends Plant Sci 7: 301-308
IRGSP IRGSP (2005) The map-based sequence of the rice genome. Nature
436: 793-800
Ito Y, Katsura K, Maruyama K, Taji T, Kobayashi M, Seki M, Shinozaki K,
Yamaguchi-Shinozaki K (2006) Functional analysis of rice DREB1/CBF-
type transcription factors involved in cold-responsive gene expression in
transgenic rice. Plant Cell Physiol 47: 141-153
Jakoby M, Weisshaar B, Droge-Laser W, Vicente-Carbajosa J, Tiedemann
J, Kroj T, Parcy F (2002) bZIP transcription factors in Arabidopsis.
Trends Plant Sci 7: 106-111
Jaspers P, Kangasjarvi J (2010) Reactive oxygen species in abiotic stress
signaling. Physiol Plant 138: 405-413
Jeong JS, Kim YS, Baek KH, Jung H, Ha SH, Do Choi Y, Kim M, Reuzeau
C, Kim JK (2010) Root-specific expression of OsNAC10 improves
drought tolerance and grain yield in rice under field drought conditions.
Plant Physiol 153: 185-197
Jiang C, Iu B, Singh J (1996) Requirement of a CCGAC cis-acting element
for cold induction of the BN115 gene from winter Brassica napus. Plant
Mol Biol 30: 679-684
Jiang J, Li J, Xu Y, Han Y, Bai Y, Zhou G, Lou Y, Xu Z, Chong K (2007)
RNAi knockdown of Oryza sativa root meander curling gene led to
altered root development and coiling which were mediated by jasmonic
acid signalling in rice. Plant Cell Environ 30: 690-699
Kagaya Y, Hobo T, Murata M, Ban A, Hattori T (2002) Abscisic acid-induced
transcription is mediated by phosphorylation of an abscisic acid
response element binding factor, TRAB1. Plant Cell 14: 3177-3189
Chapter I
43
Kim MC, Chung WS, Yun DJ, Cho MJ (2009) Calcium and calmodulin-
mediated regulation of gene expression in plants. Mol Plant 2: 13-21
Kim ST, Cho KS, Yu S, Kim SG, Hong JC, Han CD, Bae DW, Nam MH,
Kang KY (2003) Proteomic analysis of differentially expressed proteins
induced by rice blast fungus and elicitor in suspension-cultured rice cells.
Proteomics 3: 2368-2378
Kim ST, Kim SG, Hwang DH, Kang SY, Kim HJ, Lee BH, Lee JJ, Kang KY
(2004) Proteomic analysis of pathogen-responsive proteins from rice
leaves induced by rice blast fungus, Magnaporthe grisea. Proteomics 4:
3569-3578
Kim TH, Bohmer M, Hu H, Nishimura N, Schroeder JI (2010) Guard cell
signal transduction network: advances in understanding abscisic acid,
CO2, and Ca2+
signaling. Annu Rev Plant Biol 61: 561-591
Kizis D, Lumbreras V, Pages M (2001) Role of AP2/EREBP transcription
factors in gene regulation during abiotic stress. FEBS Lett 498: 187-189
Kobayashi Y, Murata M, Minami H, Yamamoto S, Kagaya Y, Hobo T,
Yamamoto A, Hattori T (2005) Abscisic acid-activated SNRK2 protein
kinases function in the gene-regulation pathway of ABA signal
transduction by phosphorylating ABA response element-binding factors.
Plant J 44: 939-949
Koo SC, Yoon HW, Kim CY, Moon BC, Cheong YH, Han HJ, Lee SM, Kang
KY, Kim MC, Lee SY, Chung WS, Cho MJ (2007) Alternative splicing of
the OsBWMK1 gene generates three transcript variants showing
differential subcellular localizations. Biochem Bioph Res Co 360: 188-
193
Koornneef M, Meinke D (2010) The development of Arabidopsis as a model
plant. Plant J 61: 909-921
Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K,
Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with
an EREBP/AP2 DNA binding domain separate two cellular signal
transduction pathways in drought- and low-temperature-responsive gene
expression, respectively, in Arabidopsis. Plant Cell 10: 1391-1406
General Introduction and Research Objectives
44
Liu Q, Xue Q (2007) Computational identification and phylogenetic analysis
of the MAPK gene family in Oryza sativa. Plant Physiol Biochem 45: 6-
14
Liu S, Zheng L, Xue Y, Zhang Q, Wang L, Shou H (2010) Overexpression of
OsVP1 and OsNHX1 increases tolerance to drought and salinity in rice.
J Plant Biol 53: 444-452
Luan S (2009) The CBL-CIPK network in plant calcium signaling. Trends
Plant Sci 14: 37-42
Ma Q, Dai X, Xu Y, Guo J, Liu Y, Chen N, Xiao J, Zhang D, Xu Z, Zhang X,
Chong K (2009) Enhanced tolerance to chilling stress in OsMYB3R-2
transgenic rice is mediated by alteration in cell cycle and ectopic
expression of stress genes. Plant Physiol 150: 244-256
Magnani E, Sjolander K, Hake S (2004) From endonucleases to
transcription factors: evolution of the AP2 DNA binding domain in plants.
Plant Cell 16: 2265-2277
Mahajan S, Tuteja N (2005) Cold, salinity and drought stresses: an
overview. Arch Biochem Biophys 444: 139-158
Matsukura S, Mizoi J, Yoshida T, Todaka D, Ito Y, Maruyama K, Shinozaki
K, Yamaguchi-Shinozaki K (2010) Comprehensive analysis of rice
DREB2-type genes that encode transcription factors involved in the
expression of abiotic stress-responsive genes. Mol Genet Genomics
283: 185-196
Mayer KF, Martis M, Hedley PE, Simkova H, Liu H, Morris JA, Steuernagel
B, Taudien S, Roessner S, Gundlach H, Kubalakova M, Suchankova P,
Murat F, Felder M, Nussbaumer T, Graner A, Salse J, Endo T, Sakai H,
Tanaka T, Itoh T, Sato K, Platzer M, Matsumoto T, Scholz U, Dolezel J,
Waugh R, Stein N (2011) Unlocking the barley genome by chromosomal
and comparative genomics. Plant Cell 23: 1249-1263
Mazzucotelli E, Mastrangelo AM, Crosatti C, Guerra D, Stanca AM,
Cattivelli L (2008) Abiotic stress response in plants: when post-
transcriptional and post-translational regulations control transcription.
Plant Sci 174: 420-431
Chapter I
45
Mittler R, Vanderauwera S, Suzuki N, Miller G, Tognetti VB, Vandepoele K,
Gollery M, Shulaev V, Van Breusegem F (2011) ROS signaling: the new
wave? Trends Plant Sci 16: 300-309
Miura K, Jin JB, Hasegawa PM (2007) Sumoylation, a post-translational
regulatory process in plants. Curr Opin Plant Biol 10: 495-502
Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K (2012) AP2/ERF family
transcription factors in plant abiotic stress responses. Biochim Biophys
Acta 1819: 86-96
Molina J, Sikora M, Garud N, Flowers JM, Rubinstein S, Reynolds A, Huang
P, Jackson S, Schaal BA, Bustamante CD, Boyko AR, Purugganan MD
(2011) Molecular evidence for a single evolutionary origin of
domesticated rice. Proc Natl Acad Sci USA 108: 8351-8356
Moller IM, Sweetlove LJ (2010) ROS signalling-specificity is required.
Trends Plant Sci 15: 370-374
Monshausen GB, Gilroy S (2009) Feeling green: mechanosensing in plants.
Trends Cell Biol 19: 228-235
Moradi F, Ismail AM (2007) Responses of photosynthesis, chlorophyll
fluorescence and ROS-scavenging systems to salt stress during
seedling and reproductive stages in rice. Ann Bot (Lond) 99: 1161-1173
Morillo SA, Tax FE (2006) Functional analysis of receptor-like kinases in
monocots and dicots. Curr Opin Plant Biol 9: 460-469
Movahedi S, Van de Peer Y, Vandepoele K (2011) Comparative network
analysis reveals that tissue specificity and gene function are important
factors influencing the mode of expression evolution in Arabidopsis and
rice. Plant Physiol 156: 1316-1330
Mukherjee K, Choudhury AR, Gupta B, Gupta S, Sengupta DN (2006) An
ABRE-binding factor, OSBZ8, is highly expressed in salt tolerant
cultivars than in salt sensitive cultivars of indica rice. BMC Plant Biol 6:
18
Munns R (2002) Comparative physiology of salt and water stress. Plant Cell
Environ 25: 239-250
Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annu Rev
Plant Biol 59: 651-681
General Introduction and Research Objectives
46
Nakashima K, Ito Y, Yamaguchi-Shinozaki K (2009) Transcriptional
regulatory networks in response to abiotic stresses in Arabidopsis and
grasses. Plant Physiol 149: 88-95
Nakashima K, Tran LS, Van Nguyen D, Fujita M, Maruyama K, Todaka D,
Ito Y, Hayashi N, Shinozaki K, Yamaguchi-Shinozaki K (2007)
Functional analysis of a NAC-type transcription factor OsNAC6 involved
in abiotic and biotic stress-responsive gene expression in rice. Plant J
51: 617-630
Negrao S, Courtois B, Ahmadi N, Abreu I, Saibo N, Oliveira MM (2011)
Recent Updates on Salinity Stress in Rice: From Physiological to
Molecular Responses. Critical Reviews in Plant Sciences 30: 329-377
Ning J, Li X, Hicks LM, Xiong L (2010) A Raf-like MAPKKK gene DSM1
mediates drought resistance through reactive oxygen species
scavenging in rice. Plant Physiol 152: 876-890
Oh SJ, Kim YS, Kwon CW, Park HK, Jeong JS, Kim JK (2009)
Overexpression of the transcription factor AP37 in rice improves grain
yield under drought conditions. Plant Physiol 150: 1368-1379
Olsen AN, Ernst HA, Leggio LL, Skriver K (2005) NAC transcription factors:
structurally distinct, functionally diverse. Trends Plant Sci 10: 79-87
Pandey A, Rajamani U, Verma J, Subba P, Chakraborty N, Datta A,
Chakraborty S (2010) Identification of extracellular matrix proteins of rice
(Oryza sativa L.) involved in dehydration-responsive network: a
proteomic approach. J Proteome Res 9: 3443-3464
Park MR, Yun KY, Mohanty B, Herath V, Xu F, Wijaya E, Bajic VB, Yun SJ,
De Los Reyes BG (2010) Supra-optimal expression of the cold-regulated
OsMyb4 transcription factor in transgenic rice changes the complexity of
transcriptional network with major effects on stress tolerance and panicle
development. Plant Cell Environ 33: 2209-2230
Pignocchi C, Foyer CH (2003) Apoplastic ascorbate metabolism and its role
in the regulation of cell signalling. Curr Opin Plant Biol 6: 379-389
Pitzschke A, Djamei A, Bitton F, Hirt H (2009) A major role of the MEKK1-
MKK1/2-MPK4 pathway in ROS signalling. Mol Plant 2: 120-137
Chapter I
47
Plett DC, Moller IS (2010) Na(+) transport in glycophytic plants: what we
know and would like to know. Plant Cell Environ 33: 612-626
Popescu SC, Popescu GV, Bachan S, Zhang Z, Gerstein M, Snyder M,
Dinesh-Kumar SP (2009) MAPK target networks in Arabidopsis thaliana
revealed using functional protein microarrays. Genes Dev 23: 80-92
Qin F, Sakuma Y, Tran LS, Maruyama K, Kidokoro S, Fujita Y, Fujita M,
Umezawa T, Sawano Y, Miyazono K, Tanokura M, Shinozaki K,
Yamaguchi-Shinozaki K (2008) Arabidopsis DREB2A-interacting
proteins function as RING E3 ligases and negatively regulate plant
drought stress-responsive gene expression. Plant Cell 20: 1693-1707
Reddy VS, Reddy AS (2004) Proteomics of calcium-signaling components
in plants. Phytochemistry 65: 1745-1776
Rensink WA, Buell CR (2004) Arabidopsis to rice. Applying knowledge from
a weed to enhance our understanding of a crop species. Plant Physiol
135: 622-629
Rodriguez MC, Petersen M, Mundy J (2010) Mitogen-activated protein
kinase signaling in plants. Annu Rev Plant Biol 61: 621-649
Rojo E, Sharma VK, Kovaleva V, Raikhel NV, Fletcher JC (2002) CLV3 is
localized to the extracellular space, where it activates the Arabidopsis
CLAVATA stem cell signaling pathway. Plant Cell 14: 969-977
Ronald PC, Jung KH, An GH (2008) Towards a better bowl of rice:
assigning function to tens of thousands of rice genes. Nat Rev Genet 9:
91-101
Roy P, Orikasa T, Okadome H, Nakamura N, Shiina T (2011) Processing
conditions, rice properties, health and environment. Int J Environ Res
Public Health 8: 1957-1976
RoyChoudhury A, Gupta B, Sengupta DN (2008) Trans-acting factor
designated OSBZ8 interacts with both typical abscisic acid responsive
elements as well as abscisic acid responsive element-like sequences in
the vegetative tissues of indica rice cultivars. Plant Cell Rep 27: 779-794
Saibo NJ, Lourenco T, Oliveira MM (2009) Transcription factors and
regulation of photosynthetic and related metabolism under
environmental stresses. Ann Bot 103: 609-623
General Introduction and Research Objectives
48
Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki
K (2002) DNA-binding specificity of the ERF/AP2 domain of Arabidopsis
DREBs, transcription factors involved in dehydration- and cold-inducible
gene expression. Biochem Biophys Res Commun 290: 998-1009
Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K,
Yamaguchi-Shinozaki K (2006) Functional analysis of an Arabidopsis
transcription factor, DREB2A, involved in drought-responsive gene
expression. Plant Cell 18: 1292-1309
Santos AP, Serra T, Figueiredo DD, Barros P, Lourenco T, Chander S,
Oliveira MM, Saibo NJ (2011) Transcription regulation of abiotic stress
responses in rice: a combined action of transcription factors and
epigenetic mechanisms. OMICS 15: 839-857
Schutze K, Harter K, Chaban C (2008) Post-translational regulation of plant
bZIP factors. Trends Plant Sci 13: 247-255
Seifert GJ, Blaukopf C (2010) Irritable walls: the plant extracellular matrix
and signaling. Plant Physiol 153: 467-478
Shao HB, Guo QJ, Chu LY, Zhao XN, Su ZL, Hu YC, Cheng JF (2007)
Understanding molecular mechanism of higher plant plasticity under
abiotic stress. Colloids Surf B Biointerfaces 54: 37-45
Shen S, Jing Y, Kuang T (2003) Proteomics approach to identify wound-
response related proteins from rice leaf sheath. Proteomics 3: 527-535
Siberil Y, Doireau P, Gantet P (2001) Plant bZIP G-box binding factors.
Modular structure and activation mechanisms. Eur J Biochem 268: 5655-
5666
Sinha AK, Jaggi M, Raghuram B, Tuteja N (2011) Mitogen-activated protein
kinase signaling in plants under abiotic stress. Plant Signal Behav 6:
196-203
Skinner J, Szucs P, von Zitzewitz J, Marquez-Cedillo L, Filichkin T,
Stockinger EJ, Thomashow MF, Chen THH, Hayes PM (2006) Mapping
of barley homologs to genes that regulate low temperature tolerance in
Arabidopsis. Theor Appl Genet 112: 832-842
Sohn KH, Lee SC, Jung HW, Hong JK, Hwang BK (2006) Expression and
functional roles of the pepper pathogen-induced transcription factor
Chapter I
49
RAV1 in bacterial disease resistance, and drought and salt stress
tolerance. Plant Mol Biol 61: 897-915
Spannagl M, Mayer K, Durner J, Haberer G, Frohlich A (2011) Exploring the
genomes: from Arabidopsis to crops. J Plant Physiol 168: 3-8
Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana
CBF1 encodes an AP2 domain-containing transcriptional activator that
binds to the C-repeat/DRE, a cis-acting DNA regulatory element that
stimulates transcription in response to low temperature and water deficit.
Proc Natl Acad Sci USA 94: 1035-1040
Su CF, Wang YC, Hsieh TH, Lu CA, Tseng TH, Yu SM (2010) A novel
MYBS3-dependent pathway confers cold tolerance in rice. Plant Physiol
153: 145-158
Sun X, Wang GL (2011) Genome-wide identification, characterization and
phylogenetic analysis of the rice LRR-kinases. PLoS ONE 6: e16079
Swaminathan K, Peterson K, Jack T (2008) The plant B3 superfamily.
Trends Plant Sci 13: 647-655
Takasaki H, Maruyama K, Kidokoro S, Ito Y, Fujita Y, Shinozaki K,
Yamaguchi-Shinozaki K, Nakashima K (2010) The abiotic stress-
responsive NAC-type transcription factor OsNAC5 regulates stress-
inducible genes and stress tolerance in rice. Mol Genet Genomics 284:
173-183
Teige M, Scheikl E, Eulgem T, Doczi R, Ichimura K, Shinozaki K, Dangl JL,
Hirt H (2004) The MKK2 pathway mediates cold and salt stress signaling
in Arabidopsis. Mol Cell 15: 141-152
ten Hove CA, Bochdanovits Z, Jansweijer VM, Koning FG, Berke L,
Sanchez-Perez GF, Scheres B, Heidstra R (2011) Probing the roles of
LRR RLK genes in Arabidopsis thaliana roots using a custom T-DNA
insertion set. Plant Mol Biol 76: 69-83
Tester M, Davenport R (2003) Na+ tolerance and Na
+ transport in higher
plants. Ann Bot 91: 503-527
Tran LS, Nakashima K, Sakuma Y, Osakabe Y, Qin F, Simpson SD,
Maruyama K, Fujita Y, Shinozaki K, Yamaguchi-Shinozaki K (2007) Co-
expression of the stress-inducible zinc finger homeodomain ZFHD1 and
General Introduction and Research Objectives
50
NAC transcription factors enhances expression of the ERD1 gene in
Arabidopsis. Plant J 49: 46-63
Türkan I, Demiral T (2009) Recent developments in understanding salinity
tolerance. Env Exp Bot 67: 2–9
Tuteja N, Mahajan S (2007) Calcium signaling network in plants: an
overview. Plant Signal Behav 2: 79-85
Umezawa T, Nakashima K, Miyakawa T, Kuromori T, Tanokura M,
Shinozaki K, Yamaguchi-Shinozaki K (2010) Molecular basis of the core
regulatory network in ABA responses: sensing, signaling and transport.
Plant Cell Physiol 51: 1821-1839
Vannini C, Iriti M, Bracale M, Locatelli F, Faoro F, Croce P, Pirona R, Di
Maro A, Coraggio I, Genga A (2006) The ectopic expression of the rice
Osmyb4 gene in Arabidopsis increases tolerance to abiotic,
environmental and biotic stresses. Physiol Mol Plant Pathol 69: 26-42
Vogel JT, Zarka DG, Van Buskirk HA, Fowler SG, Thomashow MF (2005)
Roles of the CBF2 and ZAT12 transcription factors in configuring the low
temperature transcriptome of Arabidopsis. Plant J 41: 195-211
Wang Q, Guan Y, Wu Y, Chen H, Chen F, Chu C (2008) Overexpression of
a rice OsDREB1F gene increases salt, drought, and low temperature
tolerance in both Arabidopsis and rice. Plant Mol Biol 67: 589-602
Wang W, Vinocur B, Shoseyov O, Altman A (2004) Role of plant heat-shock
proteins and molecular chaperones in the abiotic stress response.
Trends Plant Sci 9: 244-252
Woo HR, Kim JH, Kim J, Lee U, Song IJ, Lee HY, Nam HG, Lim PO (2010)
The RAV1 transcription factor positively regulates leaf senescence in
Arabidopsis. J Exp Bot 61: 3947-3957
Wrzaczek M, Brosche M, Salojarvi J, Kangasjarvi S, Idanheimo N,
Mersmann S, Robatzek S, Karpinski S, Karpinska B, Kangasjarvi J
(2010) Transcriptional regulation of the CRK/DUF26 group of receptor-
like protein kinases by ozone and plant hormones in Arabidopsis. BMC
Plant Biol 10: 95
Wu L, Chen X, Ren H, Zhang Z, Zhang H, Wang J, Wang XC, Huang R
(2007) ERF protein JERF1 that transcriptionally modulates the
Chapter I
51
expression of abscisic acid biosynthesis-related gene enhances the
tolerance under salinity and cold in tobacco. Planta 226: 815-825
Wu Y, Deng Z, Lai J, Zhang Y, Yang C, Yin B, Zhao Q, Zhang L, Li Y, Xie Q
(2009) Dual function of Arabidopsis ATAF1 in abiotic and biotic stress
responses. Cell Res 19: 1279-1290
Xiong L, Schumaker KS, Zhu JK (2002) Cell signaling during cold, drought,
and salt stress. Plant Cell 14 Suppl: S165-183
Xiong L, Yang Y (2003) Disease resistance and abiotic stress tolerance in
rice are inversely modulated by an abscisic acid-inducible mitogen-
activated protein kinase. Plant Cell 15: 745-759
Xu ZS, Chen M, Li LC, Ma YZ (2011) Functions and application of the
AP2/ERF transcription factor family in crop improvement. J Integr Plant
Biol 53: 570-585
Yamaguchi-Shinozaki K, Shinozaki K (2005) Organization of cis-acting
regulatory elements in osmotic- and cold-stress-responsive promoters.
Trends Plant Sci 10: 88-94
Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcriptional regulatory
networks in cellular responses and tolerance to dehydration and cold
stresses. Annu Rev Plant Biol 57: 781-803
Yan SP, Zhang QY, Tang ZC, Su WA, Sun WN (2006) Comparative
proteomic analysis provides new insights into chilling stress responses in
rice. Mol Cell Proteomics 5: 484-496
Zhang G, Chen M, Li L, Xu Z, Chen X, Guo J, Ma Y (2009a)
Overexpression of the soybean GmERF3 gene, an AP2/ERF type
transcription factor for increased tolerances to salt, drought, and
diseases in transgenic tobacco. J Exp Bot 60: 3781-3796
Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2009b) Identification
of an apoplastic protein involved in the initial phase of salt stress
response in rice root by two-dimensional electrophoresis. Plant Physiol
149: 916-928
Zhang W, Ruan J, Ho TH, You Y, Yu T, Quatrano RS (2005) Cis-regulatory
element based targeted gene finding: genome-wide identification of
General Introduction and Research Objectives
52
abscisic acid- and abiotic stress-responsive genes in Arabidopsis
thaliana. Bioinformatics 21: 3074-3081
Zhang Y, Chen C, Jin XF, Xiong AS, Peng RH, Hong YH, Yao QH, Chen
JM (2009c) Expression of a rice DREB1 gene, OsDREB1D, enhances
cold and high-salt tolerance in transgenic Arabidopsis. Bmb Rep 42:
486-492
Zheng X, Chen B, Lu G, Han B (2009) Overexpression of a NAC
transcription factor enhances rice drought and salt tolerance. Biochem
Biophys Res Commun 379: 985-989
Zhu J, Alvarez S, Marsh EL, Lenoble ME, Cho IJ, Sivaguru M, Chen S,
Nguyen HT, Wu Y, Schachtman DP, Sharp RE (2007) Cell wall
proteome in the maize primary root elongation zone. II. Region-specific
changes in water soluble and lightly ionically bound proteins under water
deficit. Plant Physiol 145: 1533-1548
Chapter II
53
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter
and may regulate its gene expression under salt
Chapter II
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
54
TABLE OF CONTENTS – CHAPTER II
Abstract .........................................................................................55
Introduction ...................................................................................56
Material and Methods ...................................................................59
Plant material and stress treatments .............................................59
Semi-quantitative reverse transcription-PCR (RT-PCR) analysis .........................................................................................60
cDNA expression library construction ............................................61
Generation of yeast bait strains .....................................................61
Yeast one-hybrid screening and validation ....................................62
Results ...........................................................................................63
Expression analysis of salt stress responsive genes .....................63
Identification of transcription factors binding to the OsRMC gene promoter ...............................................................................64
Protein and phylogenetic analysis of OsEREBP1 and OsEREBP2 ...................................................................................66
OsEREBP1 and OsEREBP2 gene expression under different abiotic stresses .............................................................................69
Discussion .....................................................................................71
Acknowledgments ........................................................................77
References ....................................................................................77
Chapter II
55
ABSTRACT
High salinity causes remarkable losses in rice productivity
worldwide mainly because it inhibits growth and reduces grain yield.
To cope with environmental changes, plants evolved several
adaptive mechanisms, which involve the regulation of many stress-
responsive genes. Among these, we have chosen OSBZ8, OsNAC6,
OsNHX1 and OsRMC to study their gene expression in rice
seedlings subjected to high salinity. The OsNAC6, OSBZ8 and
OsNHX1 gene expression increased, reaching a maximum after 2
hours of treatment. The OsRMC transcript, which was not detected in
control conditions, was highly induced by salt treatment and showed
a stress-dose-dependent pattern. OsRMC encodes a receptor-like
kinase described as a negative regulator of salt stress responses in
rice. To investigate how OsRMC is regulated in response to high
salinity, a salt-induced rice cDNA expression library was constructed
and subsequently screened using the OsRMC promoter as bait.
Thereby, two transcription factors, OsEREBP1 and OsEREBP2,
belonging to the AP2/ERF family were identified as binding to the
OsRMC promoter. The identified TFs were characterized regarding
their gene expression under different abiotic stress conditions. This
study revealed that OsEREBP1 transcript level is not significantly
affected by salt, ABA or severe cold (5ºC) and is only slightly
regulated by drought and moderate cold, suggesting that its
regulation by abiotic stress involves mainly post-translational
modifications. On the other hand, the OsEREBP2 transcript level
increased after cold, drought and high salinity treatments, indicating
that OsEREBP2 may play a central role mediating the response to
different abiotic stresses.
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
56
INTRODUCTION
Plants undergo several types of abiotic stress conditions, such as
drought, cold and high salinity, throughout their life cycle. Soil salinity
causes high losses in crop productivity worldwide mainly because it
inhibits growth and grain yield (Hasegawa et al. 2000; Pardo 2010;
Wankhade et al. 2010). To minimize the deleterious effects of salt
stress, plants need to coordinate several adaptation mechanisms
that occur at the cellular and molecular levels (Munns and Tester
2008). Cellular adaptations include the vacuolar compartmentation of
Na+ through vacuolar Na+/H+ transporters (Tester and Davenport
2003). The exclusion of excessive Na+ from the cytosol allows the
maintenance of ion homeostasis, preventing Na+-specific damage in
plant tissues leading to, among others, photosynthesis inhibition
(Hauser and Horie 2010). Na+ transport to the vacuole is
accompanied by adaptive changes at the molecular level, such as
the synthesis and accumulation of osmoprotectants in the cytosol
(Hasegawa et al. 2000; Tester and Davenport 2003; Xiong et al.
2002). Osmoprotectans, such as proline and trehalose, are involved
in the maintenance of the cell osmotic balance but also in the
scavenging of reactive oxygen species and protection of cellular
structures (Sahi et al. 2006; Tester and Davenport 2003).
Adaptation mechanisms rely on the perception and transduction
of stress signals from the environment. Stress signals can be initially
perceived by apoplast molecules, such as peptides and enzymes,
which will lead to the activation of specific signaling pathways in the
cell (Sattelmacher 2001; Zhang et al. 2009a). The rice Root Meander
Curling (OsRMC) gene was described as an apoplast protein
belonging to the DUF26 group of Receptor-Like Kinases (RLKs)
(Jiang et al. 2007; Zhang et al. 2009a). This protein was predicted to
Chapter II
57
have a receptor domain containing a Cysteine-Rich Repeat (CRR),
but no kinase or transmembrane domain, suggesting that this protein
is secreted (Chen 2001; Jiang et al. 2007). Some secreted proteins
have been described as putative ligands for receptor-like kinases in
Arabidopsis (Rojo et al. 2002), Brassicaceae (Dixit et al. 2000) and
tomato (Tang et al. 2002). The CLAVATA pathway in Arabidopsis is
one of the best characterized signaling pathways involving the
binding of a ligand (CLV3) to a receptor complex (CLV1/CLV2)
(Jeong et al. 1999; Rojo et al. 2002). The interaction between CLV3
and CLV1/CLV2 is required for the formation of the active receptor
complex involved in the regulation of meristem development. In
Brassicaceae, a cysteine-rich protein, SCR, was shown to be a
ligand for the stigma-expressed S-locus receptor kinase SRK
involved in the self-incompatibility response (Dixit et al. 2000;
Kachroo et al. 2002). Although the cysteine-rich region of SCR and
SRK is structurally distinct from the CRR domain present in OsRMC,
this apoplastic protein may be a ligand for CRR receptor-like kinases
(CRKs) regulating abiotic stress responses (Chen 2001). The role of
OsRMC in the salt stress response was previously described using
rice knockdown lines. These lines showed improved salt tolerance
associated with induction of stress-responsive genes, indicating that
OsRMC is a negative regulator of rice salt stress response (Zhang et
al. 2009a).
The regulation of abiotic stress responses relies on the ability of
transcription factors (TFs) to coordinate the expression of stress-
responsive genes (Agarwal and Jha 2010; Saibo et al. 2009). The
NAC (NAM, ATAF1,2 and CUC2), AREB (ABA Responsive Element
Binding protein) and AP2/ERF (APETALA2/Ethylene Response
Factor) families of transcription factors were shown to be highly
involved in the salt stress tolerance mechanisms (Negrão et al. 2011;
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
58
Roychoudhury et al. 2008; Takasaki et al. 2010; Wu et al. 2007).
NAC transcription factors regulate the expression of several genes
related to abiotic stress response, floral development, growth and
hormone signaling (Kikuchi et al. 2000; Kim et al. 2007; Ooka et al.
2003). NAC proteins with a role in abiotic stress responses include
the Arabidopsis AtNAC2 and the rice SNAC1, OsNAC5, OsNAC6
and OsNAC10 (He et al. 2005; Hu et al. 2006; Jeong et al. 2010;
Nakashima et al. 2007; Takasaki et al. 2010). Enhanced salt
tolerance was observed in Arabidopsis and rice plants over-
expressing these TFs. Several members of the AREB family regulate
the ABA-dependent stress signal transduction pathway (Agarwal and
Jha 2010). These bZIP TFs were shown to interact with the cis-
element ABRE (ABA-Responsive Element) present in the promoter
region of genes coding for various Late-Embryogenesis Abundant
(LEA) proteins (Chinnusamy et al. 2005; Yoshida et al. 2010). LEA
proteins are known to function as protection molecules, probably
acting as chaperones to prevent protein misfolding or denaturation
during stress (Bartels and Sunkar 2005; Xiong and Zhu 2002). The
AP2/ERF protein family is characterized by the presence of the AP2
DNA binding domain (Dietz et al. 2010; Okamuro et al. 1997). The
subfamily AP2 contains two AP2 domains and functions mainly in the
regulation of plant development (Okamuro et al. 1997; Zhao et al.
2006). On the other hand, the subfamilies DREB (Dehydration-
Responsive Element-Binding protein) and ERF (Ethylene-
Responsive Factor) have only a single DNA binding domain and are
involved in biotic and abiotic stress responses (Dietz et al. 2010;
Gutterson and Reuber 2004). Over-expression of genes from these
subfamilies, such as OsBIERF3 and OsDREB1D, in tobacco and
Arabidopsis, respectively, were shown to highly increase plant salt
tolerance (Cao et al. 2005; Zhang et al. 2009b).
Chapter II
59
Rice is among the most important food crops worldwide and its
productivity is highly affected by high salinity, which causes reduced
growth and grain yield. This crop shows higher sensitivity to
increases in soil salinity compared to others such as durum bread
wheat and barley (Munns and Tester 2008). Understanding the
molecular mechanisms underlying salt stress response in rice may
provide useful tools to improve its tolerance. In this work, we have
investigated the expression of the rice salt-responsive genes OSBZ8,
OsNAC6, OsNHX1 and OsRMC under salt stress conditions. Based
on this analysis, we have found OsRMC as the gene with the most
stress-dependent expression profile. The study of OsRMC
transcriptional regulation allowed us to identify and characterize two
transcription factors that bind to the OsRMC promoter and may be
associated with its salt stress response.
MATERIAL AND METHODS
Plant material and stress treatments
Rice (Oryza sativa L. cv. Nipponbare) seeds were submerged for
30 min at 50ºC in 0.1% Benlate, washed with sterile water and
disinfected with 70% ethanol for 1 min and with a solution of 2%
sodium hypochlorite containing 0.02% Tween 20 for 30 min. After
washing six times with sterile water, the seeds were germinated in
the darkness for 3 days at 28ºC in Petri dishes containing 3MM
paper pieces soaked in sterile water. Germinated seeds were
transferred to glass tubes containing Yoshida’s medium (Yoshida et
al. 1976) and grown under a 12 h photoperiod (500 μE m-2 s-1)
regime. The cDNA expression library and the expression analysis of
salt-responsive genes were performed with RNA extracted from 14
days-old rice seedlings transferred to Yoshida’s medium
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
60
supplemented with 100 mM or 200 mM NaCl. Samples were
collected after 0, 2, 5, 12 and 24 hours of treatment, frozen in liquid
nitrogen and kept at -80ºC until RNA extraction. The expression
pattern of the novel TF genes identified was performed using 14
days-old seedlings subjected to drought, cold (5ºC and 10ºC), salt or
ABA treatments. For the drought treatment, seedlings were left to dry
on paper towels in the flow chamber. The salt and ABA treatments
were performed using Yoshida’s medium supplemented with 200 mM
NaCl or 100 µM ABA, respectively. Shoot and root samples were
separated prior to freezing in liquid nitrogen and storage at -80ºC.
Semi-quantitative reverse transcription-PCR (RT-PCR) analysis
The gene expression analysis of the salt-responsive genes
OSBZ8 (LOC_Os01g46970), OsNAC6 (LOC_Os01g66120),
OsNHX1 (LOC_Os07g47100) and OsRMC (LOC_Os04g25650), was
performed using the total RNA purified to construct the cDNA
expression library (see below). Reverse transcription was performed
with 1 µg total RNA using an oligo-(dT)12-18 primer and the
SuperscriptII reverse transcriptase (Invitrogen, CA, USA) following
the manufacturer’s instructions. The gene expression profile of the
novel TFs identified was obtained using total RNA extracted from rice
seedlings, using the RNeasy Plant Mini kit (Qiagen, Courtaboeuf,
France). The cDNA first strand was synthesized from 1 µg total RNA
and according to the instructions from the Transcriptor High Fidelity
cDNA Synthesis Kit (Roche, Basel, Switzerland). PCR reactions
were performed using the gene specific primers described in Table 1.
The OsACT1 (LOC_Os03g50885) and OsUBC (LOC_Os02g42314)
genes were used as internal controls.
Chapter II
61
cDNA expression library construction
Total RNA was isolated from a pool of five rice seedlings
subjected to 2, 5, 12 and 24 h of treatment with 100 and 200 mM
NaCl, using the TRIzol method described by the manufacturer
(Invitrogen, CA, USA). After mRNA purification with the PolyATtract
mRNA Isolation System III (Promega, Wisconsin, USA), cDNA was
synthesized according to the HybriZAP-2.1XR cDNA synthesis kit
manual (Stratagene, CA, USA). The cDNA expression library was
constructed into the HybriZAP-2.1 vector according to the
manufacturer’s instructions. To verify the average size of the cDNA
inserts, PCR amplification was performed from 20 individual plaques
using the HybriZAP primers described in Table 1. After in vivo
excision and amplification of the excised phagemid, the cDNA library
was used to transform the yeast bait strains.
Generation of yeast bait strains
Yeast strain Y187 (Clontech, USA) was used to generate different
strains containing fragments of the OsRMC promoter as bait. The
OsRMC promoter region was defined as the 2120 bp sequence
upstream of the start codon. The promoter was divided in six
overlapping fragments with 300 to 500 bp, which were inserted in the
yeast integrative vector pINT1-HIS3 (Ouwerkerk and Meijer 2001) as
a NotI-XbaI or XbaI-SpeI fragment. The NcoI-SacI fragment of this
construct, containing the PDC6 sequences necessary for
homologous recombination, was used to transform Y187 cells. The
APT1 marker gene and the OsRMC promoter fragments are
upstream of the HIS3 reporter gene. The obtained yeast bait strains
were selected on YAPD medium containing 0.2 mM G418 (Duchefa
Biochemie B.V., Netherlands). Because some DNA promoter
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
62
sequences allow leaky expression of the HIS3 reporter gene, leading
to some background growth in medium lacking histidine, a 3-amino-
1,2,4-triazole (3-AT) titration was performed. 3-AT is a competitive
inhibitor of the yeast His3 enzyme and will suppress its activity
(Ouwerkerk and Meijer 2001). To assess the putative HIS3 leaky
expression, the bait strains were titrated in complete minimal medium
(CM) lacking histidine and containing up to 25 mM 3-AT. Yeast
transformations were performed by the lithium acetate polyethylene
glycol method as described by Ouwerkerk et al. (2001).
Yeast one-hybrid screening and validation
Yeast bait strains were transformed with 1 µg of cDNA library.
Transformation efficiency was assessed on CM medium without
leucine, using 100- and 1000-fold dilutions of transformation
reactions. Putative positive clones were selected on CM medium
containing 5 mM 3-AT and lacking leucine and histidine. The
identified clones were re-streaked on selective medium to confirm
growth. Direct PCR on the yeast colonies was performed to amplify
the cDNA insert, using specific primers for the library plasmid. Library
plasmid DNA was recovered from these colonies and amplified in
Escherichia coli. To validate the DNA-protein interaction in yeast, the
plasmid DNA was retransformed into the yeast bait strain. To know
whether the isolated clones encode transcription factors, the plasmid
DNA was sequenced and the results were analyzed with BLAST
programs.
Chapter II
63
Table 1. Oligonucleotide sequences used in the yeast one-hybrid and gene
expression studies.
Primer name Primer sequence 5´- 3´
OSBZ8-Fw AAAGGTAAAAGATCAAAGTTAGAAGG
OSBZ8-Rv CTCTGGTCTGGCGACTGATG
OsNAC6-Fw TTTTTAAACAGAAACAGGAAAGCTA
OsNAC6-Rv CCCCTCCTCCAGGACATC
OsNHX1-Fw GCCATGGAGGAAGATGAACA
OsNHX1-Rv GCAAACCATGCCATACCATT
OsRMC-Fw GTTCGACATCACGCTGGA
OsRMC-Rv ATAATCCGGTTACAGCTTAGATAGAT
HybriZAP-Fw CCCCACCAAACCCAAAAAAAG
HybriZAP-Rv GTTGAAGTGAACTTGCG
OsEREBP1-Fw TGCAGCTTCTTCAGCACTGT
OsEREBP1-Rv ACTTCGAGGAGTTCGAGGTG
OsEREBP2-Fw GTACCTGCGCTACCAGATGC
OsEREBP2-Rv CATCTCCGTCTCTCCGTCTC
OsACT1-Fw GTCGCACTTCATGATGGAGTTG
OsACT1-Rv CATGCTATCCCTCGTCTCGAC
OsUBC-Fw CAAAATTTTCCACCCGAATG
OsUBC-Rv ATCACATGAATCAGCCATGC
RESULTS
Expression analysis of salt stress responsive genes
The expression of the salt-responsive genes OSBZ8, OsNAC6,
OsNHX1 and OsRMC was analyzed through RT-PCR in rice
seedlings subjected to high salinity treatments: 100 mM and 200 mM
NaCl (Figure 1). The transcript level of OSBZ8, OsNAC6 and
OsNHX1 was increased after 2 h under 100 mM NaCl and it
decreased thereafter. OsRMC transcript level was not detected
under control conditions, but greatly increased under salt stress. In
the presence of 100 mM NaCl, the OsRMC transcript level was
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
64
detected 2 h after treatment increasing thereafter up to 24 hours.
When the seedlings were subjected to 200 mM NaCl, the transcript
accumulation, followed the same trend, but was higher (OSBZ8,
OsNHX1 and OsRMC) or maintained at high level for longer
(OsNAC6), showing a clear stress-dose-dependent response.
OsRMC was selected for further studies due to its high
responsiveness to salt stress and its putative role as a negative
regulator of rice salt stress response.
Figure 1. Expression analysis of the salt stress responsive genes OSBZ8,
OsNAC6, OsNHX1 and OsRMC in response to high salinity conditions. RT-
PCR reactions were performed with cDNA prepared from 1 µg of total RNA
isolated from 14 days-old rice seedlings subjected to high salinity (100 or
200 mM NaCl) during 0, 2, 5, 12 or 24 hours. Gene used as internal control:
OsACT1. The Image J program was used to determine the normalized gene
expression ratio.
Identification of transcription factors binding to the OsRMC gene
promoter
The yeast one-hybrid (Y1H) system was used to identify the TFs
that bind to the OsRMC promoter. Initially, it was necessary to
construct both the library and the yeast bait strains containing
fragments of the OsRMC promoter upstream the HIS3 reporter gene.
In order to have enrichment in salt stress responsive genes, the
Chapter II
65
library was prepared from rice seedlings subjected to salt stress.
After constructing this library and to assess the average length of the
cDNA inserts, PCR amplification was performed using 20 individual
phage plaques (Figure 2). The size range of the inserts was 750-
1500 bp and the average length was close to 1000 bp. The rice
cDNAs were cloned in fusion with the GAL4 activation domain, so
that all proteins expressed could function as activators. Six yeast bait
strains carrying the OsRMC promoter fragments illustrated in Figure
3 were constructed.
Figure 2. Analysis of the inserts present in the salt-induced rice cDNA
expression library. Twenty plaques were randomly picked from the cDNA
expression library and analyzed by PCR, using the HybriZAP primers
described in Table 1.
Figure 3. Schematic representation of the OsRMC promoter fragments (F1-
F6) used to prepare the yeast bait strains. The OsRMC promoter region
was defined as the 2120 bp sequence upstream the translation start codon
(ATG).
Using the Y1H system, 3-7 million clones from the salt-induced
cDNA expression library were screened for each of the six yeast bait
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
66
strains, resulting in a total of 115 positive clones identified. The
putative positive clones were re-streaked in selective medium, to
validate growth, and then analyzed by direct PCR. Twenty-five
clones did not grow after re-streak and from the clones with high to
moderate growth on selective medium, 42 did not amplify a cDNA
insert. Library plasmid DNA was isolated only from the yeast clones
with high growth on selective medium and from which a cDNA insert
could be amplified. After plasmid amplification in bacteria, the inserts
were sequenced and a BLAST analysis was performed to identify the
genes. Six clones were confirmed to be false positives containing, for
example, an insert encoding a ribosomal protein and an
endopeptidase. Obtaining false positives was previously described
as a limitation of the yeast one-hybrid system (Chen and Shin 2008;
Ouwerkerk and Meijer 2001). The analyses of the remaining 42
clones, led to the identification of two TFs belonging to the AP2/ERF
family and interacting with fragment 3 of the OsRMC promoter:
OsEREBP1 and OsEREBP2. OsEREBP1 gene was found in 38
clones while OsEREBP2 was only found in four. To further validate
the DNA-protein interaction, the plasmid DNA was retransformed into
the yeast bait strain. High growth on selective medium was observed
for the yeast bait strain transformed with each of the identified TFs.
Protein and phylogenetic analysis of OsEREBP1 and OsEREBP2
The nucleotide sequence analysis revealed that OsEREBP1
contained an open reading frame of 1098 bp and encoded a protein
of 365 amino acids with a predicted molecular mass of 40.1 kDa and
pI of 4.79. Analysis of deduced amino acid sequence showed that
the protein contained a single AP2 DNA-binding domain (120-175
aa) and a potential nuclear localization sequence (NLS) (Figure 4).
Chapter II
67
Figure 4. Alignment of deduced amino acid sequences of OsEREBP1,
OsEREBP2 and other proteins from the AP2/ERF family of transcription
factors using the Clustal W program and the Genedoc software. The
sequences shown are: OsEREBP1 (Q6K7E6), OsEREBP2 (Q5N965),
OsERF1 (Q0JB99), OsERF3 (Q9LRF3), AtERF2 (O80338), AtERF3
(O80339), AtERF4 (O80340), AtERF5 (O80341), AtERF6 (Q8VZ91),
AtRAP2-2 (Q9LUM4), AtRAP2-6 (Q7G1L2), ABR1 (Q9FGF8), JERF3
(Q6TXK7), NtERF2 (Q40479), NtERF5 (Q5Y836), Pti4 (B5AIC2), ZmERF1
(Q6DKU6), AtDREB1A (Q9M0L0), AtDREB1B (P93835), AtDREB1C
(Q9SYS6), AtDREB2A (O82132), AtDREB2B (O82133), OsDREB1A
(Q64MA1), OsDREB1B (Q3T5N4), OsDREB1C (Q9LWV3), OsDREB1D
(Q6J1A5), OsDREB2 (Q0JQF7), ZmDREB2A (Q1ESI9), AtAPETALA2
(P47927), OsAP2-1 (Q2MGU2). Residues in black are 100% conserved and
in grey are 80% conserved. Dashes indicate gaps in the amino acid
sequences. The line shows the conserved AP2 DNA binding domain. The
squares indicate the nuclear localization signal (NLS) predicted for
OsEREBP1 and OsEREBP2 by the PSORT program.
The OsEREBP2 gene sequence contains an open reading frame
of 1056 bp encoding a 351 amino acids long protein. The deduced
protein has a predicted molecular mass of 36.3 kDa and pI of 6.18.
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
68
Similarly to OsEREBP1, the amino acid sequence contained one
AP2 domain (130-185 aa) and a NLS (Figure 4).
Figure 5. Phylogenetic analysis of the deduced amino acid sequences of
OsEREBP1, OsEREBP2 and the AP2/ERF proteins described in Figure 4.
The bootstrapped tree was produced by Clustal W with 1000 repetitions.
The predicted amino acid sequences of OsEREBP1 and
OsEREBP2 were aligned with known members of the AP2/ERF
family of TFs (Figure 4). The results showed that these proteins
shared high homology in the AP2 DNA-binding domain with other
family members from rice, Arabidopsis, maize, tomato, potato and
tobacco.
Chapter II
69
To further analyze the phylogenetic relationship of OsEREBP1
and OsEREBP2 with AP2/ERF proteins, a phylogenetic tree was
constructed based on their predicted amino acid sequences (Figure
5). This analysis revealed that both TFs are grouping in the ERF
subfamily of transcription factors and are distant from the DREB
subfamily. Interestingly, OsEREBP1 and OsEREBP2 are located in
different subgroups inside the ERF family.
OsEREBP1 and OsEREBP2 gene expression under different abiotic
stresses
To investigate whether OsEREBP1 and OsEREBP2 were
regulated at transcriptional level by abiotic stress conditions, a gene
expression analysis was performed in rice seedlings subjected to
different treatments (salt, drought, cold and ABA). Figure 6 shows
that OsEREBP1 gene expression was not significantly and
reproducibly altered under control conditions in both shoots and roots
during the analyzed period. Similarly, no significant changes in the
transcript accumulation were observed in roots and shoots of
seedlings treated with salt, severe cold (5ºC) and ABA. In roots, an
accumulation of OsEREBP1 transcript was observed after 2, 5 and
10 h at 10ºC. Drought stress response was weak and opposite in
shoots and roots. In shoots, the OsEREBP1 transcript level
increased slightly and transiently, reaching a peak 40 min after
beginning of treatment, while in roots the transcript level started to
decrease 10 min after drought stress.
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
70
Figure 6. Analysis of OsEREBP1 and OsEREBP2 gene expression in
response to different abiotic stress conditions. RT-PCR reactions were
performed with cDNA prepared from 1 µg of total RNA extracted from
shoots and roots of 14 days-old rice seedlings (cv. Nipponbare) subjected
(or not) to salt (200 mM), drought, cold (5ºC, 10ºC) and ABA (100 µM).
OsEREBP1 was amplified with 25 cycles, except for shoot samples under
control, 5ºC and ABA treatments (20 cycles). OsEREBP2 was amplified
with 30 cycles, except for shoot samples under drought stress (25 cycles).
Internal controls: OsACT1 and OsUBC (ubiquitin-conjugase). OsACT1 was
amplified using 25 cycles or 20 cycles for the root samples under salt and
5ºC. OsUBC reactions were performed with 23, 25 or 30 cycles for root
samples under 10ºC, ABA and drought, respectively.
OsEREBP2 gene expression analysis revealed that its
transcription is significantly induced in response to salt, drought, ABA
and both cold treatments (Figure 6). In roots, the transcript
accumulation in response to salt was visible within 20 min, reaching
the maximum at 1-2 h treatment and then decreasing to the level of
the untreated plants. A similar pattern was observed in shoots.
Chapter II
71
Drought stress enhanced OsEREBP2 transcript accumulation also
after 20 min exposure to stress in both shoots and roots. This
increase in transcript abundance was observed up to 40 min
treatment and was followed by a gradual decrease in gene
expression. Under cold stress, the transcript level of OsEREBP2
increased in shoots and roots at both temperatures tested. In both
shoots and roots, the increase in OsEREBP2 expression occurred
earlier at 10ºC (within 1-2 h) than at 5ºC (only after 5 h). In addition,
at 10ºC the maximum transcript level was reached within 5 to 10 h
treatment, while at 5ºC it required at least 24 h. Under ABA
treatment, the TF transcript accumulation was visible in both shoots
and roots within 1 h, rapidly decreasing thereafter to the level of the
untreated plants.
DISCUSSION
High salinity induces changes in the expression of several genes
being estimated that the transcription level of approx. 8% of all genes
is affected by this abiotic stress (Chao et al. 2005; Rabbani et al.
2003; Tester and Davenport 2003). To assess the transcription
regulation of selected salt stress responsive genes, an initial gene
expression analysis was performed on rice seedlings subjected to
high salinity conditions. The genes under study were chosen based
on their function. The products of these genes are involved in
transcriptional regulation (OSBZ8 and OsNAC6), Na+ detoxification
(OsNHX1) and signal perception (OsRMC).
OSBZ8 transcript level increased 2 h after applying the salt
treatments and decreased thereafter. This gene codes for an ABRE-
binding factor, whose expression was described as being highly
induced upon 6 h of treatment with 200 mM NaCl (Nakagawa et al.
1996). This study was however performed in suspension-cultured
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
72
rice cells in which the salt effect may be stronger and less transient
than in rice seedlings. The putative involvement of OSBZ8 in salt
stress responses was also previously addressed in a study using
several cultivars. This study showed that OSBZ8 is expressed at a
higher level in salt-tolerant cultivars as compared to sensitive ones
(Mukherjee et al. 2006), thus indicating that OSBZ8 may be involved
in the plant responses leading to salt tolerance. OSBZ8 was also
described as a regulator of LEA proteins, such as Rab16A and Osem
(Mukherjee et al. 2006; Roychoudhury et al. 2008).
OsNAC6 gene expression was also induced under high salinity
conditions, as previously described (Nakashima et al. 2007; Ohnishi
et al. 2005). OsNAC6 function in abiotic stress responses was shown
through its over-expression in rice. The transgenic plants exhibit
increased tolerance to high salt and drought stress (Nakashima et al.
2007). Furthermore, OsNAC6 was shown to interact with the
CATGTG motif present in the promoter region of a late-
embryogenesis abundant protein, OsLEA3 whose over-expression
improved rice drought tolerance under field conditions (Takasaki et
al. 2010; Xiao et al. 2007).
The analysis of OsNHX1 gene expression revealed that its
transcription is enhanced by high salinity in a stress-dose dependent
manner, as previously described (Fukuda et al. 2004). OsNHX1
encodes a vacuolar Na+/H+ antiporter involved in the Na+
compartmentation in the vacuole (Fukuda et al. 2004; Fukuda et al.
1999). The important role of OsNHX1 in salt tolerance was
demonstrated by studies in rice and maize which have shown that
plants over-expressing OsNHX1 displayed reduced salt-related
deleterious effects comparing to wild type plants, suggesting an
improved salt tolerance (Chen et al. 2007; Fukuda et al. 2004; Liu et
al. 2010).
Chapter II
73
OsRMC transcript level increased in response to high salinity. At
100 mM NaCl a reduced accumulation was detected after 2 h and 5
h treatment, suggesting that OsRMC is involved in the late stage
response to high salinity. A stronger and earlier transcript
accumulation was detected under severe stress conditions,
indicating that OsRMC gene expression regulation is stress-dose-
dependent. The observed transcript accumulation is well correlated
with the described increase in the protein level in plants treated with
200 mM NaCl (Zhang et al. 2009a). In untreated plants OsRMC
transcript level was absent or not detectable by RT-PCR, which
correlates with previous studies on protein level indicating that
OsRMC is present in low amounts under non stress conditions
(Rabbani et al. 2003; Zhang et al. 2009a). OsRMC encodes an
apoplast protein described as a negative regulator of salt stress
response (Zhang et al. 2009a). In Arabidopsis, other genes induced
by high-salinity have been described as negative regulators of salt
stress response (Tran et al. 2007). For instance, AHK2, which is
induced by drought and salt stress, encodes a receptor histidine
kinase characterized as a negative regulator. ahk2 mutants showed
enhanced tolerance to drought and salt stress associated with the
accumulation of several stress-responsive genes. Stress responses
involve the induction of several genes whose products, when present
in high amounts, can have adverse effects on plant development.
Therefore, plants need to have mechanisms to finely regulate the
burst of expression occurring upon environmental changes (Kazan
2006; Mito et al. 2010; Tieman et al. 2000). OsRMC may act as a
fine tuner of salt stress responses by repressing the induction of salt-
responsive genes whose products can induce damages to cellular
components. Its high responsiveness to high salinity and the reduced
knowledge available about the function of salt stress negative
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
74
regulators lead us to further analyze OsRMC involvement in this
abiotic stress condition through a detailed study of its transcriptional
regulation.
The two transcription factors, OsEREBP1 and OsEREBP2,
identified as binding to the fragment 3 of OsRMC promoter contain
one AP2-DNA binding domain indicating that they belong to the
AP2/ERF family of TFs. Both TFs share high homology within the
AP2-DNA binding domain with other known members of the
AP2/ERF family and are more closely related to the ERF subfamily.
The classification of OsEREBP1 and OsEREBP2 as ERF
transcription factors was previously described from a bioinformatic
analysis (Nakano et al. 2006). OsEREBP1 was shown to belong to
the CMVII group which includes proteins involved in abiotic stress
response, like the JERF3 whose over-expression enhanced salt
stress tolerance in tomato (Wang et al. 2004). OsEREBP2 was
predicted to belong to the group Xa due to the presence of a CMX-1-
like motif in the amino acid sequence. The ABR1 protein from
Arabidopsis also belongs to the Xa group and was shown to be
involved in the ABA-dependent osmotic stress response. In
agreement with this classification, the phylogenetic analysis showed
that OsEREBP1 groups with JERF3 and OsEREBP2 is a close
relative to ABR1. Together, these data show that, although
OsEREBP1 and OsEREBP2 belong to the same ERF subfamily of
TFs, they are phylogenetically distant from each other and may have
different roles mediating OsRMC gene expression levels.
The AP2/ERF family of TFs has been shown to play a role in the
response to several abiotic stress conditions (Agarwal and Jha 2010;
Dietz et al. 2010; Nakano et al. 2006). To assess the transcriptional
regulation of OsEREBP1 and OsEREBP2 by abiotic stress
conditions, the expression of these genes was analyzed in rice
Chapter II
75
seedlings subjected to salt, drought, cold and ABA treatments.
OsEREBP1 gene expression was not significantly affected under
control, high salinity, severe cold (5ºC) and ABA. An increased
transcript accumulation was detected in roots after 2, 5 and 10 h of
cold treatment at 10ºC, whereas no significant difference was
observed in shoots. The OsEREBP1 gene expression in the japonica
cultivar CT6748-8-CA-17 was previously shown to be induced upon
cold exposure (10ºC) (Cheng et al. 2007). The response to drought
stress was weak and opposite in shoots and roots. A weak increase
in OsEREBP1 transcript was observed in shoots, while in roots a
down-regulation was detected. Only a few genes were reported to
have opposite responses to abiotic stress in roots and shoots. In
Limonium bicolor, a gene encoding a lipid transfer protein
(EH795199) was shown to be induced in roots and down-regulated in
shoots upon saline-alkali stress (Wang et al. 2008). In Setaria italica,
a putative protease inhibitor encoding gene revealed the same
expression pattern in response to drought stress treatment (Zhang et
al. 2007). These results suggest that OsEREBP1 may be regulated
at transcriptional level by drought and moderate cold temperatures.
On the contrary, the regulation of this TF under salt and severe cold
(5ºC) conditions may be mainly dependent on post-translational
modifications.
OsEREBP2 gene expression was shown to be induced in
response to salt, drought, ABA and cold stress treatments in both
shoots and roots. Curiously, OsEREBP2 response to moderate cold
(10ºC) occurred earlier than the response to severe cold (5ºC).
Previous studies suggested that rice response to moderate and
severe cold involves two different signaling pathways (Wen et al.
2002). Thus, OsEREBP2 may be involved in both pathways and its
gene expression induction may depend on the severity of the stress.
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
76
OsEREBP2 transcript accumulation by salt and drought was shown
to occur earlier than the induction by cold. Being rapidly induced by
these stresses, OsEREBP2 may be involved in the early responses
to osmotic stress. Moreover, given that induction of OsEREBP2 only
occurs 1 h after ABA treatment we suggest that the TF regulation by
osmotic stress is not ABA dependent. ERF proteins with a putative
role in the early responses of the osmotic stress were also identified
in tomato (Huang et al. 2004), wheat (Xu et al. 2007) and tobacco
(Park et al. 2001) and its over-expression enhanced tolerance to this
abiotic stress. In rice, OsBIERF1 and OsBIERF4 were also shown to
be rapidly induced (within 1 hour) by salt and drought treatments
(Cao et al. 2006). Our results indicate that OsEREBP2 can be
considered as a multifunctional TF putatively involved in several
stress responses in rice. Several TFs belonging to the AP2/ERF
family have been reported as such (Hu et al. 2010; Shao et al. 2007).
In tomato, JERF1 gene expression was shown to be induced in
response to salt, ABA and ethylene (Zhang et al. 2004). Over-
expression of this ERF protein in tobacco enhanced the plant
tolerance to high salinity and low temperature, indicating an
important role in both abiotic stress conditions (Wu et al. 2007).
In this work, we have shown that OsRMC gene expression is
highly induced by high salinity conditions and this regulation is
stress-dose-dependent. In addition, we identified two transcription
factors, OsEREBP1 and OsEREBP2, which bind to the OsRMC
promoter. The analysis of gene expression in response to abiotic
stress conditions revealed that OsEREBP1 may be mainly regulated
at a post-translational level. On the other hand, OsEREBP2 gene
expression may encode a multifunctional protein. Further
characterization of these TFs, namely using their mutants or
Chapter II
77
silencing lines, will provide new insights on their role in the salt stress
response in rice.
ACKNOWLEDGMENTS
Tânia Serra carried out the experimental work with the
collaboration of Duarte Figueiredo who contributed to the abiotic
stress assays. The planning of the research work and discussion of
results was performed by Tânia Serra, Nelson Saibo and M.
Margarida Oliveira. In addition, we would like to ackowledge Dr.
Pieter Ouwerkerk and Tiago Lourenço for the advices regarding the
Y1H system.
REFERENCES
Agarwal PK, Jha B (2010) Transcription factors in plants and ABA
dependent and independent abiotic stress signalling. Biol Plantarum 54:
201-212
Bartels D, Sunkar R (2005) Drought and salt tolerance in plants. Crit Rev
Plant Sci 24: 23-58
Cao Y, Song F, Goodman RM, Zheng Z (2006) Molecular characterization
of four rice genes encoding ethylene-responsive transcriptional factors
and their expressions in response to biotic and abiotic stress. J Plant
Physiol 163: 1167-1178
Cao YF, Wu YF, Zheng Z, Song FM (2005) Overexpression of the rice
EREBP-like gene OsBIERF3 enhances disease resistance and salt
tolerance in transgenic tobacco. Physiol Mol Plant Pathol 67: 202-211
Chao DY, Luo YH, Shi M, Luo D, Lin HX (2005) Salt-responsive genes in
rice revealed by cDNA microarray analysis. Cell Research 15: 796-810
Chen G, Shin JA (2008) AhR/Arnt:XRE interaction: turning false negatives
into true positives in the modified yeast one-hybrid assay. Anal Biochem
382: 101-106
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
78
Chen M, Chen Q-J, Niu X-G, Zhang R, Lin H-Q, Xu C-Y, Wang X-C, Wang
G-Y, Chen J (2007) Expression of OsNHX1 gene in maize confers salt
tolerance and promotes plant growth in the field. Plant Soil Environ 53:
490-498
Chen Z (2001) A superfamily of proteins with novel cysteine-rich repeats.
Plant Physiol 126: 473-476
Cheng C, Yun KY, Ressom HW, Mohanty B, Bajic VB, Jia Y, Yun SJ, de los
Reyes BG (2007) An early response regulatory cluster induced by low
temperature and hydrogen peroxide in seedlings of chilling-tolerant
japonica rice. BMC Genomics 8: 175
Chinnusamy V, Jagendorf A, Zhu J-K (2005) Understanding and improving
salt tolerance in plants. Crop Science 45: 437-448
Dietz KJ, Vogel MO, Viehhauser A (2010) AP2/EREBP transcription factors
are part of gene regulatory networks and integrate metabolic, hormonal
and environmental signals in stress acclimation and retrograde
signalling. Protoplasma 245: 3-14
Dixit R, Nasrallah ME, Nasrallah JB (2000) Post-transcriptional maturation
of the S receptor kinase of Brassica correlates with co-expression of the
S-locus glycoprotein in the stigmas of two Brassica strains and in
transgenic tobacco plants. Plant Physiol 124: 297-311
Fukuda A, Nakamura A, Tagiri A, Tanaka H, Miyao A, Hirochika H, Tanaka
Y (2004) Function, intracellular localization and the importance in salt
tolerance of a vacuolar Na(+)/H(+) antiporter from rice. Plant Cell Physiol
45: 146-159
Fukuda A, Nakamura A, Tanaka Y (1999) Molecular cloning and expression
of the Na+/H
+ exchanger gene in Oryza sativa. Biochim Biophys Acta
1446: 149-155
Gutterson N, Reuber TL (2004) Regulation of disease resistance pathways
by AP2/ERF transcription factors. Curr Opin Plant Biol 7: 465-471
Hasegawa PM, Bressan RA, Zhu JK, Bohnert HJ (2000) Plant Cellular and
Molecular Responses to High Salinity. Annu Rev Plant Physiol Plant Mol
Biol 51: 463-499
Chapter II
79
Hauser F, Horie T (2010) A conserved primary salt tolerance mechanism
mediated by HKT transporters: a mechanism for sodium exclusion and
maintenance of high K(+)/Na(+) ratio in leaves during salinity stress.
Plant Cell Environ 33: 552-565
He XJ, Mu RL, Cao WH, Zhang ZG, Zhang JS, Chen SY (2005) AtNAC2, a
transcription factor downstream of ethylene and auxin signaling
pathways, is involved in salt stress response and lateral root
development. Plant J 44: 903-916
Hu H, Dai M, Yao J, Xiao B, Li X, Zhang Q, Xiong L (2006) Overexpressing
a NAM, ATAF, and CUC (NAC) transcription factor enhances drought
resistance and salt tolerance in rice. Proc Natl Acad Sci USA 103:
12987-12992
Hu XJ, Zhang ZB, Xu P, Fu ZY, Hu SB, Song WY (2010) Multifunctional
genes: the cross-talk among the regulation networks of abiotic stress
responses. Biol Plantarum 54: 213-223
Huang Z, Zhang Z, Zhang X, Zhang H, Huang D, Huang R (2004) Tomato
TERF1 modulates ethylene response and enhances osmotic stress
tolerance by activating expression of downstream genes. FEBS Lett 573:
110-116
Jeong JS, Kim YS, Baek KH, Jung H, Ha SH, Do Choi Y, Kim M, Reuzeau
C, Kim JK (2010) Root-specific expression of OsNAC10 improves
drought tolerance and grain yield in rice under field drought conditions.
Plant Physiol 153: 185-197
Jeong S, Trotochaud AE, Clark SE (1999) The Arabidopsis CLAVATA2
gene encodes a receptor-like protein required for the stability of the
CLAVATA1 receptor-like kinase. Plant Cell 11: 1925-1934
Jiang J, Li J, Xu Y, Han Y, Bai Y, Zhou G, Lou Y, Xu Z, Chong K (2007)
RNAi knockdown of Oryza sativa root meander curling gene led to
altered root development and coiling which were mediated by jasmonic
acid signalling in rice. Plant Cell Environ 30: 690-699
Kachroo A, Nasrallah ME, Nasrallah JB (2002) Self-incompatibility in the
Brassicaceae: receptor-ligand signaling and cell-to-cell communication.
Plant Cell 14 Suppl: S227-238
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
80
Kazan K (2006) Negative regulation of defence and stress genes by EAR-
motif-containing repressors. Trends Plant Sci 11: 109-112
Kikuchi K, Ueguchi-Tanaka M, Yoshida KT, Nagato Y, Matsusoka M, Hirano
HY (2000) Molecular analysis of the NAC gene family in rice. Mol Gen
Genet 262: 1047-1051
Kim SY, Kim SG, Kim YS, Seo PJ, Bae M, Yoon HK, Park CM (2007)
Exploring membrane-associated NAC transcription factors in
Arabidopsis: implications for membrane biology in genome regulation.
Nucleic Acids Res 35: 203-213
Liu S, Zheng L, Xue Y, Zhang Q, Wang L, Shou H (2010) Overexpression of
OsVP1 and OsNHX1 increases tolerance to drought and salinity in rice.
J Plant Biol 53: 444-452
Mito T, Seki M, Shinozaki K, Ohme-Takagi M, Matsui K (2010) Generation
of chimeric repressors that confer salt tolerance in Arabidopsis and rice.
Plant Biotechnol J
Mukherjee K, Choudhury AR, Gupta B, Gupta S, Sengupta DN (2006) An
ABRE-binding factor, OSBZ8, is highly expressed in salt tolerant
cultivars than in salt sensitive cultivars of indica rice. BMC Plant Biol 6:
18
Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annu Rev
Plant Biol 59: 651-681
Nakagawa H, Ohmiya K, Hattori T (1996) A rice bZIP protein, designated
OSBZ8, is rapidly induced by abscisic acid. Plant J 9: 217-227
Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of
the ERF gene family in Arabidopsis and rice. Plant Physiol 140: 411-432
Nakashima K, Tran LS, Van Nguyen D, Fujita M, Maruyama K, Todaka D,
Ito Y, Hayashi N, Shinozaki K, Yamaguchi-Shinozaki K (2007)
Functional analysis of a NAC-type transcription factor OsNAC6 involved
in abiotic and biotic stress-responsive gene expression in rice. Plant J
51: 617-630
Negrao S, Courtois B, Ahmadi N, Abreu I, Saibo N, Oliveira MM (2011)
Recent Updates on Salinity Stress in Rice: From Physiological to
Molecular Responses. Critical Reviews in Plant Sciences 30: 329-377
Chapter II
81
Ohnishi T, Sugahara S, Yamada T, Kikuchi K, Yoshiba Y, Hirano HY,
Tsutsumi N (2005) OsNAC6, a member of the NAC gene family, is
induced by various stresses in rice. Genes Genet Syst 80: 135-139
Okamuro JK, Caster B, Villarroel R, Van Montagu M, Jofuku KD (1997) The
AP2 domain of APETALA2 defines a large new family of DNA binding
proteins in Arabidopsis. Proc Natl Acad Sci USA 94: 7076-7081
Ooka H, Satoh K, Doi K, Nagata T, Otomo Y, Murakami K, Matsubara K,
Osato N, Kawai J, Carninci P, Hayashizaki Y, Suzuki K, Kojima K,
Takahara Y, Yamamoto K, Kikuchi S (2003) Comprehensive analysis of
NAC family genes in Oryza sativa and Arabidopsis thaliana. DNA Res
10: 239-247
Ouwerkerk PBF, Meijer AH (2001) Yeast One-Hybrid screening for DNA-
protein interactions. Curr Protoc Mol Biol: 12.12.11-12.12.22
Pardo JM (2010) Biotechnology of water and salinity stress tolerance. Curr
Opin Biotech 21: 185-196
Park JM, Park CJ, Lee SB, Ham BK, Shin R, Paek KH (2001)
Overexpression of the tobacco Tsi1 gene encoding an EREBP/AP2-type
transcription factor enhances resistance against pathogen attack and
osmotic stress in tobacco. Plant Cell 13: 1035-1046
Rabbani MA, Maruyama K, Abe H, Khan MA, Katsura K, Ito Y, Yoshiwara
K, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Monitoring
expression profiles of rice genes under cold, drought, and high-salinity
stresses and abscisic acid application using cDNA microarray and RNA
gel-blot analyses. Plant Physiol 133: 1755-1767
Rojo E, Sharma VK, Kovaleva V, Raikhel NV, Fletcher JC (2002) CLV3 is
localized to the extracellular space, where it activates the Arabidopsis
CLAVATA stem cell signaling pathway. Plant Cell 14: 969-977
RoyChoudhury A, Gupta B, Sengupta DN (2008) Trans-acting factor
designated OSBZ8 interacts with both typical abscisic acid responsive
elements as well as abscisic acid responsive element-like sequences in
the vegetative tissues of indica rice cultivars. Plant Cell Rep 27: 779-794
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
82
Sahi C, Singh A, Blumwald E, Grover A (2006) Beyond osmolytes and
transporters: novel plant salt-stress tolerance-related genes from
transcriptional profiling data. Physiol Plant 127: 1-9
Saibo NJ, Lourenco T, Oliveira MM (2009) Transcription factors and
regulation of photosynthetic and related metabolism under
environmental stresses. Ann Bot 103: 609-623
Sattelmacher B (2001) The apoplast and its significance for plant mineral
nutrition. New Phytol 149: 167-192
Shao HB, Guo QJ, Chu LY, Zhao XN, Su ZL, Hu YC, Cheng JF (2007)
Understanding molecular mechanism of higher plant plasticity under
abiotic stress. Colloids Surf B Biointerfaces 54: 37-45
Takasaki H, Maruyama K, Kidokoro S, Ito Y, Fujita Y, Shinozaki K,
Yamaguchi-Shinozaki K, Nakashima K (2010) The abiotic stress-
responsive NAC-type transcription factor OsNAC5 regulates stress-
inducible genes and stress tolerance in rice. Mol Genet Genomics 284:
173-183
Tang W, Ezcurra I, Muschietti J, McCormick S (2002) A cysteine-rich
extracellular protein, LAT52, interacts with the extracellular domain of
the pollen receptor kinase LePRK2. Plant Cell 14: 2277-2287
Tester M, Davenport R (2003) Na+ tolerance and Na
+ transport in higher
plants. Ann Bot 91: 503-527
Tieman DM, Taylor MG, Ciardi JA, Klee HJ (2000) The tomato ethylene
receptors NR and LeETR4 are negative regulators of ethylene response
and exhibit functional compensation within a multigene family. Proc Natl
Acad Sci USA 97: 5663-5668
Tran LS, Urao T, Qin F, Maruyama K, Kakimoto T, Shinozaki K,
Yamaguchi-Shinozaki K (2007) Functional analysis of AHK1/ATHK1 and
cytokinin receptor histidine kinases in response to abscisic acid, drought,
and salt stress in Arabidopsis. Proc Natl Acad Sci USA 104: 20623-
20628
Wang H, Huang Z, Chen Q, Zhang Z, Zhang H, Wu Y, Huang D, Huang R
(2004) Ectopic overexpression of tomato JERF3 in tobacco activates
Chapter II
83
downstream gene expression and enhances salt tolerance. Plant Mol
Biol 55: 183-192
Wang Y, Ma H, Liu G, Zhang D, Ban Q, Zhang G, Xu C, Yang C (2008)
Generation and analysis of expressed sequence tags from a NaHCO3-
treated Limonium bicolor cDNA library. Plant Physiol Biochem 46: 977-
986
Wankhade SD, Bahaji A, Mateu-Andres I, Cornejo MJ (2010) Phenotypic
indicators of NaCl tolerance levels in rice seedlings: variations in
development and leaf anatomy. Acta Physiologiae Plantarum 32: 1161-
1169
Wen JQ, Oono K, Imai R (2002) Two novel mitogen-activated protein
signaling components, OsMEK1 and OsMAP1, are involved in a
moderate low-temperature signaling pathway in rice. Plant Physiol 129:
1880-1891
Wu L, Chen X, Ren H, Zhang Z, Zhang H, Wang J, Wang XC, Huang R
(2007) ERF protein JERF1 that transcriptionally modulates the
expression of abscisic acid biosynthesis-related gene enhances the
tolerance under salinity and cold in tobacco. Planta 226: 815-825
Xiao B, Huang Y, Tang N, Xiong L (2007) Over-expression of a LEA gene in
rice improves drought resistance under the field conditions. Theor Appl
Genet 115: 35-46
Xiong L, Lee H, Ishitani M, Zhu JK (2002) Regulation of osmotic stress-
responsive gene expression by the LOS6/ABA1 locus in Arabidopsis. J
Biol Chem 277: 8588-8596
Xiong L, Zhu JK (2002) Molecular and genetic aspects of plant responses to
osmotic stress. Plant Cell Environ 25: 131-139
Xu ZS, Xia LQ, Chen M, Cheng XG, Zhang RY, Li LC, Zhao YX, Lu Y, Ni
ZY, Liu L, Qiu ZG, Ma YZ (2007) Isolation and molecular
characterization of the Triticum aestivum L. ethylene-responsive factor 1
(TaERF1) that increases multiple stress tolerance. Plant Mol Biol 65:
719-732
OsEREBP1 and OsEREBP2 bind to the OsRMC promoter and may regulate its gene expression under salt
84
Yoshida S, Foorno DA, Cock JH, Gomez KA (eds) (1976) Laboratory
manual for physiological studies of rice. International Rice Research
Institute, Los Banos, Philippines
Yoshida T, Fujita Y, Sayama H, Kidokoro S, Maruyama K, Mizoi J,
Shinozaki K, Yamaguchi-Shinozaki K (2010) AREB1, AREB2, and ABF3
are master transcription factors that cooperatively regulate ABRE-
dependent ABA signaling involved in drought stress tolerance and
require ABA for full activation. Plant J 61: 672-685
Zhang H, Huang Z, Xie B, Chen Q, Tian X, Zhang X, Lu X, Huang D, Huang
R (2004) The ethylene-, jasmonate-, abscisic acid- and NaCl-responsive
tomato transcription factor JERF1 modulates expression of GCC box-
containing genes and salt tolerance in tobacco. Planta 220: 262-270
Zhang J, Liu T, Fu J, Zhu Y, Jia J, Zheng J, Zhao Y, Zhang Y, Wang G
(2007) Construction and application of EST library from Setaria italica in
response to dehydration stress. Genomics 90: 121-131
Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2009a) Identification
of an apoplastic protein involved in the initial phase of salt stress
response in rice root by two-dimensional electrophoresis. Plant Physiol
149: 916-928
Zhang Y, Chen C, Jin XF, Xiong AS, Peng RH, Hong YH, Yao QH, Chen
JM (2009b) Expression of a rice DREB1 gene, OsDREB1D, enhances
cold and high-salt tolerance in transgenic Arabidopsis. Bmb Rep 42:
486-492
Zhao LF, Xu SB, Chai TY, Wang T (2006) OsAP2-1, an AP2-like gene from
Oryza sativa, is required for flower development and male fertility. Sex
Plant Reprod 19: 197-206
Chapter III
85
Characterization of the OsEREBP1 and OsEREBP2
interaction with the OsRMC promoter
Chapter III
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
86
TABLE OF CONTENTS – CHAPTER III
Abstract .........................................................................................87
Introduction ...................................................................................88
Material and Methods ...................................................................91
Identification of TF-binding sites in OsRMC gene promoter ...........91
Construction of plasmids ...............................................................92
Production of recombinant proteins ...............................................93
Measurement of OsBWMK1 phosphorylation activity ....................94
Electrophoretic mobility shift assay (EMSA) ..................................95
Transient expression assays in Arabidopsis protoplasts ................96
Results ...........................................................................................98
Identification of putative cis-elements in OsRMC gene promoter........................................................................................98
Both OsEREBPs bind to a GCC-like motif in OsRMC promoter .. 100
OsEREBP1 and OsEREBP2 act as transcriptional repressors. ... 107
Discussion ................................................................................... 107
Acknowledgments ...................................................................... 109
References .................................................................................. 110
Chapter III
87
ABSTRACT
The AP2/ERF family of transcription factors (TFs) includes
proteins involved in several plant developmental processes and also
in biotic and abiotic stress responses. The ERF subfamily is
characterized by the presence of one highly conserved AP2-DNA
binding domain that binds with high affinity to the ERE sequence
(core motif GCC box). However, several ERF proteins are known to
interact with GCC-like motifs and even to DRE sequences, usually
recognized by DREB proteins. A bioinformatic analysis of
OsEREBP1 and OsEREBP2 protein sequences indicated that the
amino acid residues involved in the DNA-binding interface are
conserved in both TFs and in other ERF proteins. This study also
allowed the identification of two GCC-like DNA-binding sites, S1 and
S2, for OsEREBP1 and OsEREBP2 in the OsRMC gene promoter.
EMSA experiments showed that both OsEREBP1 and OsEREBP2
bind to S1 and a synthetic sequence containing tandem GCC-box
motifs, but not to S2. The OsEREBP1-GCC box complex revealed a
slower migration in the gel, suggesting that homodimers bind to the
GCC box motif. The OsEREBP1-DNA interaction analysis was also
performed in the presence of the MAPK OsBWMK1, however, only a
weak difference in DNA-binding activity was observed in the tested
conditions. In agreement, we were not able to detect the OsEREBP1
phosphorylated form in the in vitro kinase experiments. Trans-
activation assays in Arabidopsis protoplasts revealed that
OsEREBP1 and OsEREBP2 act as transcriptional repressors and
may therefore function as repressors of the OsRMC gene
expression.
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
88
INTRODUCTION
AP2/ERF (APETALA2/Ethylene Response Factor) transcription
factors (TFs) have been identified and extensively studied in several
plant species, such as Arabidopsis, rice, maize and tobacco (Dietz et
al. 2010). Proteins from this family are characterized by the presence
of the conserved AP2 DNA-binding domain.
Regulatory proteins from the AP2/ERF family can be classified in
five subfamilies: AP2, RAV, ERF, DREB and “others”, according to
the similarity of the DNA-binding domains (Sakuma et al. 2002). AP2
proteins contain two AP2 DNA-binding domains and are key
developmental regulators in reproductive and vegetative organs
(Dietz et al. 2010). Proteins with one AP2 domain and an additional
B3 DNA-binding domain are classified in the RAV subfamily.
Members from this subfamily are implicated in several physiological
and developmental processes, but may also have a role in biotic and
abiotic stress responses (Swaminathan et al. 2008; Woo et al. 2010).
ERF and DREB family proteins contain a single AP2 domain and are
described as regulators of biotic and abiotic stress responses,
although some members also have a function in plant development
(Mizoi et al. 2011; Shukla et al. 2006).
ERF and DREB regulatory proteins can be distinguished by their
DNA binding specificity (Sakuma et al. 2002). DREB proteins interact
with DRE (Dehydration-Responsive Element) and DRE-like cis-
elements usually present in the promoter of abiotic stress-responsive
genes (Busk et al. 1997; Yamaguchi-Shinozaki and Shinozaki 2005).
The DRE-like elements include the CRT (C-Repeat) and the LTRE
(Low-Temperature-Responsive Element), which contain the DRE
core sequence, A/GCCGAC (Yamaguchi-Shinozaki and Shinozaki
2005). Other DRE-like elements contain variations of the DRE core
Chapter III
89
sequence, such as the DRE1 (ACCGAGA) identified in the promoter
sequence of the maize rab17 gene (Busk et al. 1997; Kizis et al.
2001). ERF proteins usually bind to the ERE (Ethylene-Responsive
Element), which contains a core sequence designated as GCC box
(AGCCGCC) (Mizoi et al. 2011). This sequence was identified in the
promoter of several Pathogenesis-Related (PR) genes, thereby ERF-
dependent regulation is often related to biotic stress responses
(Dietz et al. 2010; Gutterson and Reuber 2004). The GCC box was
shown to be the optimal target site for several ERFs; however some
of these have shown binding flexibility, interacting with variants of
this sequence (Fujimoto et al. 2000). Although several reports
indicate that DREB and ERF proteins interact specifically with DRE
or ERE sequences, respectively, a few proteins were described to be
able to bind to both cis-elements. TINY, which belongs to the DREB
subfamily, was shown to interact with DRE and ERE sequences with
similar affinity (Sun et al. 2008). Similarly, the tomato ERF protein
JERF1 was also reported to bind to both motifs, suggesting a
possible cross-talk between DRE- and ERE-regulated responses
(Dietz et al. 2010; Zhang et al. 2004).
The three-dimensional structure of the AP2 domain from the
AtERF1 revealed that it consists of a three-stranded anti-parallel β-
sheet and one α-helix (Allen et al. 1998). The AP2 domain was
shown to interact directly with DNA through specific residues in the
β-sheet that are conserved between DREB and ERF proteins (Allen
et al. 1998). The ability to recognize different cis-elements was
reported to be related to differences in the residues that surround the
conserved DNA interacting sequences (Sakuma et al. 2002).
Additional studies showed that the AP2 domain of DREB and ERF
proteins differs in two aa that are conserved within each group of
regulatory proteins. In DREBs the 14th and 19th positions are
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
90
occupied by valine (Val-14) and glutamic acid (Glu-19), respectively,
whereas alanine and aspartic acid occupy the corresponding
positions in the ERFs AP2 domain (Sakuma et al. 2002). The Val-14
and Glu-19 were reported to be essential for specific binding to DRE
sequences (Sakuma et al. 2002). The detailed mechanism of protein
binding to ERE is not fully characterized. The serine in the 15th
position was reported to be crucial for TINY interaction with the ERE
sequence, however several ERF proteins do not contain this aa
suggesting that other aa may contribute to the ERE recognition (Sun
et al. 2008). An alanine in position 37 (Ala37) was also reported to be
involved in DNA binding or in the stability of the AP2 domain (Liu et
al. 2006).
OsEREBP1 and OsEREBP2 encode ERF transcription factors
with a putative role in biotic and abiotic stress responses.
OsEREBP1 was previously reported to be phosphorylated in vitro
and in vivo by a MAPK, OsBWMK1, involved in biotic stress
responses (Cheong et al. 2003). OsBWMK1 was also shown to
enhance the TF DNA-binding activity to the GCC box motif. In
addition, its over-expression enhanced rice resistance to bacterial
infection (Seo et al. 2011). OsEREBP2 transcripts were shown to
accumulate in rice plants treated with a functional analog of salicylic
acid, benzothiadiazole (Shimono et al. 2007). Given that salicylic
acid (SA) mediates plant response against pathogens, OsEREBP2
may be involved in rice response to pathogen infection. OsEREBP1
and OsEREBP2 may also be involved in abiotic stress responses.
OsEREBP1 gene expression was regulated by moderate cold (10ºC)
(Cheng et al. 2007) and drought stress (Chapter 2). OsEREBP2
gene expression was shown to be highly induced by different abiotic
stresses (Chapter 2). In addition, both proteins bind to the promoter
of the OsRMC gene, a negative regulator of rice salt stress
Chapter III
91
responses (Zhang et al. 2009). The silencing of OsRMC, which
encodes a protein from the DUF26 group of Receptor-Like Kinases
(RLKs), was demonstrated to enhance salt tolerance and to increase
the expression of stress-responsive genes (Jiang et al. 2007; Zhang
et al. 2009). In chapter 2, it was suggested that OsEREBP1 and
OsEREBP2 are involved in the regulation of OsRMC gene
expression in response to salt stress.
In this study, we confirmed that both OsEREBP1 and OsEREBP2
bind directly and specifically to the OsRMC gene promoter.
OsEREBP1 and OsEREBP2 interact with the same GCC-like motif
and the trans-activation assays revealed that both TFs function as
transcriptional repressors.
MATERIAL AND METHODS
Identification of TF-binding sites in OsRMC gene promoter
In order to identify cis-elements related to abiotic stress
responses, we have used the PlantPAN database. This analysis was
performed for the OsRMC promoter region ranging from -1260 bp to
-613 bp, which includes the fragment 3 (-1160 bp to -613 bp)
(Chapter 2). Additionally, the footprintDB and 3D-footprint databases
(http://floresta.eead.csic.es/footprintdb and http://floresta.eead.csic.
es/3dfootprint) were scanned with OsEREBP1 and OsEREBP2
protein sequences to identify DNA-binding proteins that bind to
similar DNA motifs and to define the interface amino acid residues
that putatively interact with DNA (Contreras-Moreira 2010; Steffens
et al. 2004). Two such proteins were selected, ERF-4 (At3g15210.1)
and AtERF1A (At4g17500, http://floresta.eead.csic.es/3dfootprint/
complexes/1gcc_A. html) and their corresponding position weight
matrices (PWMs), which capture their binding specificity, scanned
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
92
along the OsRMC promoter. The search for significant matches
within the promoter sequence was performed with the software
matrix-scan, with default parameters (Turatsinze et al. 2008). Several
putative OsEREBP1 and OsEREBP2 cis-elements were identified in
fragment 3 of OsRMC promoter.
Construction of plasmids
For the transient expression assays in Arabidopsis protoplasts,
we have used as reporter the plasmid pLUCm35GUS (Figueiredo et
al. 2012). To construct the reporter plasmid pLUCm35GUS-pRMC,
which contains the fragment 3 (Chapter 2) of the OsRMC promoter,
we have amplified fragment 3 with the primers pRMCF3-Fw and -Rv
(Table 1) and cloned it in SalI-PstI. To construct the effector plasmids
over-expressing OsEREBP1 (LOC_Os02g54160) and OsEREBP2
(LOC_Os01g64790), the respective coding sequences were PCR
amplified from cDNA, using gene specific primers containing
Gateway adapters, GW-OsEREBP1-Fw/-Rv and GW-OsEREBP2-
Fw/-Rv (Table 1) and the PhusionTM high-fidelity DNA polymerase
(Finnzymes, Vantaa, Finland). To amplify the OsEREBP2 sequence,
the reaction needed to be supplemented with 1 M betaine and 2.5%
DMSO. The coding sequences amplified were cloned into the entry
vector pDONR221 with the BP recombinase, according to the
manufacturer’s instructions (Invitrogen, CA, USA), to obtain
pENTRY-OsEREBP1 and pENTRY-OsEREBP2. The OsEREBP1
fragment was afterwards transferred to the binary vector pH7WGF2
through LR recombination. The region containing the
35S::GFP::OsEREBP1 fragment was removed from the binary vector
through XbaI-HindIII restriction and cloned into the pGREEN0029
vector to obtain the 35S::OsEREBP1 plasmid. The 35S::OsEREBP2
effector plasmid was obtained by LR recombination of the pENTRY-
Chapter III
93
OsEREBP2 with the pEarleyGate201 vector following the
manufacturer’s instructions.
For recombinant protein expression in E. coli, OsEREBP1,
OsEREBP2 and OsBWMK1 (LOC_Os06g49430.2) coding
sequences were amplified with the GX-OsEREBP1-Fw/-Rv, GX-
OsEREBP2-Fw/-Rv or PET-OsBWMK1-Fw/-Rv primers (Table 1),
respectively, and the PhusionTM high-fidelity DNA polymerase
(Finnzymes, Vantaa, Finland) according to the manufacturer’s
instructions. The OsEREBP1 and OsEREBP2 fragments were
cloned in frame with the GST tag as an EcoRI-XhoI fragment into the
pGEX-4T-1 vector. The OsBWMK1 fragment was cloned in frame
with the His tag in the pET200/D-TOPO vector according to the
manufacturer’s instructions.
Production of recombinant proteins
The E. coli Rosetta strain was transformed with the pGEX-4T-1
vector alone or pGEX-4T-1 containing the OsEREBP1 and
OsEREBP2 coding sequences. Cells were grown in TB broth until
the OD600 reached ≈ 0.5. Afterwards, isopropyl β-D-thiogalactoside
(IPTG) was added to a final concentration of 0.4 mM, and the culture
was further incubated for 1-2 h at 28ºC. Cells were harvested by
centrifugation at 3500 x g for 20 min at 4ºC and lysed by passing 2
times through a French Press at 900 psi. Cell debris was removed by
sedimentation at 16600 x g for 45 min at 4ºC. The GST-fusion
proteins were purified in a 1 ml GSTrap HP (GE Healthcare, UK) with
a flow rate of 1 ml/min according to the manufacturer’s instruction.
For OsBWMK1 over-expression, Rosetta strain was transformed
with the pET200/D-TOPO vector containing the coding sequence
and grown in TB broth. When OD600 reached ≈ 0.5, protein
production was induced with IPTG 0.4 mM and the culture was
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
94
grown for 2 h at 28ºC. Cells were harvested through centrifugation as
described above and lysed in 20 mM phosphate buffer pH 7.5,
containing 0.5 M NaCl, 10 mM imidazole, 50 µg/ml lysozyme, 100
mM PMSF, 5 µg/mL DNase and 10 µM MgCl2. Cell debris was
removed by centrifugation at ≈ 27000 x g for 40 min at 4ºC and the
obtained supernatant was filtrated with a 0.45 µm MillexR GV low
protein binding filter (Millipore, Billerica, USA). The filtered lysate was
loaded at 5 ml/min onto a 5 ml Ni containing HiTrap IMAC HP (GE
Healthcare, UK) column, pre-equilibrated with 20 mM phosphate
buffer pH 7.5, containing 0.5 M NaCl and 10 mM imidazole. The His-
tagged protein was eluted with the same buffer, but containing 0.25
M of imidazole. The OsBWMK1 tag protein was further purified in a
gel-filtration column (Hiprep 26/60 Sephacryl S-200 HR, GE
Healthcare, UK) with 20 mM phosphate pH 7.5, 200 mM NaCl, 5%
glycerol, 1 mM DTT, and 1 mM Na2EDTA pH 8. Protein-containing
fractions were pooled and protein was concentrated in an Amicon
ultracell 10,000 MWCO (Millipore, Billerica, USA).
For immunoblots and Coomassie Brilliant Blue staining, 3-30 µg of
purified GST-fusion proteins or 1.7 µg His-OsBWMK1 tag protein
and Rosetta total protein extract were resolved on SDS-PAGE gels
containing 10% polyacrylamide. Proteins were stained with
Coomassie Brilliant Blue or transferred to PVDF membranes. The
membranes were probed with anti-GST (abm, NBS Biologicals, UK)
or anti-HIS (GE Healthcare, UK) mouse monoclonal antibody and an
anti-mouse horseradish peroxidase-conjugated antibody according to
the manufacturer’s instructions.
Measurement of OsBWMK1 phosphorylation activity
The reactions were conducted at ≈ 22ºC for 20 min in 20 µL
reaction volume containing 20 mM Tris-HCl pH 8, 1 mM DTT, 10 mM
Chapter III
95
MgCl2, 0.1 mM ATP, 5 µCi [γ-32P]ATP and 1.7 µg or 2.5 µg of
purified OsBWMK1. To analyze OsEREBP1 phosphorylation, the
reaction was performed with approximately 3 µg of purified TF. The
reactions were terminated by boiling in SDS sample buffer and
resolved in SDS-PAGE gels containing 10% polyacrylamide. Gels
were dried on Whatman 3MM paper and exposed to X-ray film
(Amersham, GE Healthcare, UK).
Electrophoretic mobility shift assay (EMSA)
DNA probes were generated by annealing oligonucleotide pairs,
S1-Fw/-Rv, S1M-Fw/-Rv, S2-Fw/-Rv, S2M-Fw/-Rv or GCC-Fw/-Rv
(Supplementary Table 1), in a PCR machine with the advanced
protocol described in Pierce Tech Tip #45 (“Anneal complementary
pairs of oligonucleotides”, www.piercenet.com) and the annealing
temperatures 52ºC, 46ºC, 58ºC and 54ºC, respectively. The
reactions were performed in the presence of 10 mM Tris-HCl pH 8,
50 mM NaCl and 1 mM Na2EDTA pH 8. Probes were labeled with [α-
32P]ATP using the DNA polymerase I/Klenow fragment (3’->5’ exo-)
(NEB, USA) following the manufacturer’s instructions. The DNA-
binding reaction was performed in a volume of 10 µL, which
contained 50 fmol of labeled probe, 0.002 µM poly(dI/dC), binding
buffer (25 mM HEPES pH 7.5, 40 mM KCl and 0.1 mM Na2EDTA pH
8) and 3 µg of purified GST-OsEREBP1, 6 µg GST-OsEREBP2, 30
µg GST tag or 300 µg untransformed Rosetta total protein extract. In
some experiments, 1.7 µg of purified OsBWMK1 was added together
with 100 µM ATP. Competition reactions were performed with 500-
fold molar excess of unlabeled probe. The reactions were incubated
for 30 min in a water bath at ≈ 22ºC and loaded onto native 5%
polyacrylamide gel (37.5:1). Electrophoresis was run at 200 V for 2 h
with 0.5 x TBE (50 mM Tris-HCl pH 8, 50 mM boric acid, 1 mM
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
96
Na2EDTA pH 8) at approximately 22ºC. Gels were dried on Whatman
3MM paper and exposed to X-ray film (Amersham, GE Healthcare,
UK).
Transient expression assays in Arabidopsis protoplasts
Arabidopsis protoplasts were isolated as previously described
(Anthony et al. 2004). Briefly, 3-day-old Arabidopsis cells were
incubated with an enzyme solution containing 1% cellulase and 0.2%
macerozyme for 3-4 h. After washing, the protoplasts were isolated
by centrifugation with a sucrose solution. Approximately 3 x 105
protoplasts were transfected with 3 µg of reporter plasmid and 6 or 8
µg of effector plasmid 35S::OsEREBP1 or 35S::OsEREBP2,
respectively, to obtain a molar ratio 1:3. The transfections were
performed in triplicate and cells were incubated 48 h at 22ºC in the
darkness in medium containing 0.2 µM 2.4-Dichlorophenoxyacetic
acid (2.4-D). After harvesting, the cells were lysed through
ressuspension in 100 mM K2PO4, 1 mM Na2EDTA pH 8, 7 mM 2-
mercaptoethanol, 1% Triton X-100 and 10% glycerol, and two freeze-
thaw cycles (-20ºC, 22ºC). The cell debris was sedimented at 17000
x g for 2 min and the cleared lysate was stored at -80ºC. For the
GUS quantification assay, 20 µL of cleared lysate was incubated with
0.5 µL 50 mM MUG (4-methylumbelliferyl-β-D-glucuronide) in
triplicate at 37ºC in the darkness for 1 h. The reaction was stopped
by adding 180 µL 200 mM Na2CO3 and the fluorescence signal was
detected using a spectrofluorimeter (Fluoromax-4 with Micromax
plate reader, Horiba, Portugal) with excitation at 365 nm, emission at
455 nm and a slit of 1.5 nm.
Chapter III
97
Table 1. Oligonucleotide sequences used in the cloning procedures and
recombinant protein expression. The underlined region of the primer
corresponds to adapter sequences and the remaining region is specific to
the target DNA.
Primer name Primer sequence 5´- 3´
GW-OsEREBP1-Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTACAAGCAATCCACCACTGCA
GW-OsEREBP1-Rv GGGGACCACTTTGTACAAGAAAGCTGGGTTGCCTCCCAATCTCCAATAG
pRMCF3-Fw ATCTGCAGCTTGACGAGCAGGCATAGGT
pRMCF3-Rv ATGTCGACTGCCTGCGTTCTATGGTCTG
GW-OsEREBP2-Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTATATGACGGTGGCGGGGGCGTCGGAGCT
GW-OsEREBP2-Rv GGGGACCACTTTGTACAAGAAAGCTGGGTGGACAGAATCCGGCGGCTACTGCGTGTGC
GX-OsEREBP1-Fw ATATGAATTCATGTGCGGCGGCGCCATCATCC
GX-OsEREBP1-Rv ATATCTCGAGGAATTCCTCAATAGAAATCGCTAACGGGCAT
GX-OsEREBP2-Fw ATATGAATTCATGACGGTGGCGGGGGCGTCGGAGCT
GX-OsEREBP2-Rv ATATCTCGAGGGACAGAATCCGGCGGCTACTGCGTGTGC
PET-OsBWMK1-Fw CACCATGGGGGGAGGGGGCACGCT
PET-OsBWMK1-Rv ATCATCGTCATCGTTGTGCATTAGGAGTGC
S1-Fw GCTTGACGAGCAGGCATAGGTATATTTG
S1-Rv TCGACAAATATACCTATGCCTGCTCGTCAAGCTGCA
S1M-Fw TTCTTGACTATCATTCATAGGTATATTT
S1M-Rv TTAAATATACCTATGAATGATAGTCAAG
S2-Fw GCGCATCCAATGGCAGCACTGGTTCCTAG
S2-Rv TCGACTAGGAACCAGTGCTGCCATTGGATGCGCTGCA
S2M-Fw TTCGCATCCAATTTCATCACTGGTTCCTA
S2M-Rv TTTAGGAACCAGTGATGAAATTGGATGCG
GCC-Fw GCATAAGAGCCGCCACTAAAATAAGACCGATCAAATAAGAGCCGCCATG
GCC-Rv TCGACATGGCGGCTCTTATTTGATCGGTCTTATTTTAGTGGCGGCTCTTATGCTGCA
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
98
The luciferase assay was performed through addition of 150 µL of
LUC reagent (20 mM tricine pH 7.8, 5 mM MgCl2, 0.1 mM Na2EDTA
pH 8, 3.3 mM DTT and 2 mM ATP) and 75 µL of 1.5 mM luciferine to
20 µL of cleared lysate. The light intensity was measured for 10 s in
a luminometer (Berthold MicroLumatPlus LB96V, Germany).
Transcriptional activity was calculated as a GUS/LUC ratio.
RESULTS
Identification of putative cis-elements in OsRMC gene promoter
In order to determine where OsEREBP1 and OsEREBP2 bind to
the OsRMC gene promoter, we have used the PlantPAN database to
identify cis-elements related to abiotic stress responses present
within the region ranging from -1260 bp to -613 bp (Figure 1). This
promoter region is contained in the fragment 3 (-1160 bp to -613 bp),
which was used as bait for the Y1H screening (Chapter 2).
Figure 1. Putative abiotic stress-related cis-elements present in the OsRMC
gene promoter. The promoter region -1260 bp to -613 bp upstream the
translation start codon (ATG) was scanned using the PlantPAN database.
The symbol N used in the sequence corresponds to G/A/T/C.
Chapter III
99
We have identified, within the targeted promoter region, four
ABRE (ABA Responsive Element) sequences with the core motif
ACGT. These cis-elements are present in the promoter of several
ABA-responsive genes (Umezawa et al. 2010), suggesting that
OsRMC gene expression is regulated by ABA. The Dehydration-
Responsive Element (DRE) and the Low-Temperature-Responsive
Element (LTRE) also found in our sequence are usually recognized
by Dehydration-Responsive Element Binding (DREB) proteins, which
are well known regulators of abiotic stress responses (Yamaguchi-
Shinozaki and Shinozaki 2005). In addition, we found three MYB-
recognition motifs. Several MYB proteins have also been shown to
function in abiotic stress responses (Dubos et al. 2010). However,
given that no GCC box motifs (known ERF binding sites) were
predicted with the former analysis, a more detailed bioinformatics
approach was performed to identify OsEREBP1 and OsEREBP2
DNA-binding sites in the OsRMC gene promoter. Initially, the
footprintDB database was interrogated to identify similar DNA-
binding proteins that bind to known regulatory motifs and to define
the amino acid residues that shape the DNA-binding interface. This
search revealed a high homology with ERF proteins detected at the
level of the AP2 domain (Figure 2A), confirming that both proteins
belong to the ERF subfamily of TFs. It also showed that the interface
amino acid residues involved in DNA-binding interface were
conserved with other ERF proteins, suggesting that OsEREBP1 and
OsEREBP2 recognize similar DNA motifs (Figure 2A). Position
weight matrices (PWMs) of proteins ERF-4 and AtERF1A were used
to predict putative cis-elements within the OsRMC promoter. Two of
these sites were predicted by both PWMs (S1 and S2, with P-values
of 2.9e-05 and 1.5e-03, respectively) and were selected for further
analysis (Figure 2B).
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
100
Figure 2. Analysis of the OsEREBP1 and OsEREBP2 AP2 domain and the
GCC-like boxes in the OsRMC promoter. (A) Alignment of OsEREBP1 and
OsEREBP2 with AtERF1A (At4g17500) protein sequence, obtained after
querying the footprintDB database, to spot the amino acid residues
putatively involved in DNA binding interface. The arrows indicate the
conserved amino acid residues involved in DNA-binding interface, inferred
from the Protein Data Bank entry 1GCC (Allen et al. 1998). The numbers
represent the residues position in the protein sequence. (B) DNA
sequences used in the EMSA assays. In bold are the predicted OsEREBP1
and OsEREBP2 DNA-binding sites (S1 and S2) identified as GCC-like
boxes in fragment 3 of the OsRMC promoter. S1M and S2M are mutated
forms of site S1 and S2, respectively. Point mutations are underlined. The
sequence containing the GCC box motif in tandem was described by
Cheong et al. (2003). The numbers represent the position in the promoter
upstream the ATG start codon of the OsRMC gene.
Both OsEREBPs bind to a GCC-like motif in OsRMC promoter
Electrophoretic mobility shift assays (EMSAs) were performed to
check whether OsEREBP1 and OsEREBP2 proteins interact with the
predicted DNA-binding sites S1 and S2, and also with a synthetic
probe containing the GCC box motif (Cheong et al. 2003) (Figure
2B). Both TFs were produced as GST-fusion proteins and purified by
Chapter III
101
affinity chromatography (Figure 3). In addition to the predicted bands
for our proteins, other bands were detected and assumed to be
products of degradation of the fusion proteins or eventually
contaminant proteins from bacteria. To confirm that the DNA-binding
activity detected in the EMSA assays was not related to the
interaction of contaminant proteins with the DNA fragments, we
included a control reaction by using the total protein extract from
bacteria.
Figure 4 shows that both OsEREBP1 and OsEREBP2 interact
with the probe S1 and the TF-DNA complexes formed migrate
similarly. No DNA-binding activity was detected for the GST protein
and only unspecific binding was detected with the total protein
extract from bacteria. When the specificity of the TFs-DNA
interaction was analyzed through competition experiments, using
500-fold excess of unlabeled S1, an efficient challenge with the cold-
probe was observed for both TFs. In contrast, when the competition
was performed with the mutated probe S1M (Figure 4), the specific
binding was enhanced, probably due to higher unspecific binding to
unlabeled S1M.
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
102
Figure 3. Production and purification of recombinant proteins GST-
OsEREBP1, GST-OsEREBP2 and His-OsBWMK1. The recombinant
proteins were produced in Rosetta strain and purified by affinity
chromatography. Three to thirty micro grams of GST-OsEREBP1 (3 µg),
GST-OsEREBP2 (6 µg), GST tag (30 µg) and 1.7 µg of His-OsBWMK1
were separated in an SDS-PAGE gel along with 300 µg or 55 µg,
respectively, of bacteria total protein extract (cell extract). Proteins were
stained with Coomassie Brilliant Blue (A, C) or transferred to PVDF
membranes and probed with anti-GST (B) or anti-His (D) mouse
monoclonal antibody. (E) OsBWMK1 activity was measure through
incubation of 2.5 µg of purified protein with 5 µCi [γ-32
P]ATP and with or
without 3 µg of purified GST-OsEREBP1. Expected band sizes: GST-
OsEREBP1 – 67 kDa; GST-OsEREBP2 – 63 kDa; GST – 27 kDa and His-
OsBWMK1 – 70 kDa. The arrow indicates the expected band for each
assay.
Chapter III
103
The DNA-binding activity of both TFs was also assessed for the
probe S2, but no signal was detected (data not shown). To confirm
that the TFs do not bind to this probe, a competition reaction was
prepared, using the labeled probe S1 together with 500-fold excess
of unlabeled probe S2. As shown in Figure 5, TFs’ binding to S1 was
not affected by S2 presence.
Figure 4. Analysis of the DNA-binding specificity of OsEREBP1 and
OsEREBP2 to the S1 sequence present in the OsRMC gene promoter.
EMSA was carried out with 32
P-labeled S1 probe incubated with GST,
bacteria total protein extract (Cell Extract) and purified proteins GST-
OsEREBP1 and GST-OsEREBP2. Binding reactions contained no (-) or a
500-fold molar excess (+) of unlabeled S1 or S1M probe. For OsEREBP1,
OsBWMK1 and 100 µM ATP reactions were also tested. The arrow
indicates a specific band shift. The asterisk indicates non-specific signal.
Details of the EMSAs are described in Material and Methods.
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
104
Figure 5. Analysis of the DNA-binding specificity of OsEREBP1 and
OsEREBP2 to the site S1 of OsRMC gene promoter sequence. EMSA was
performed with 32
P-labeled S1 probe incubated with GST, bacteria total
protein extract (Cell Extract) and purified proteins GST-OsEREBP1 and
GST-OsEREBP2. Binding reactions contained no (-) or a 500-fold molar
excess (+) of unlabeled S1, S1M, S2 or GCC probe. The arrow indicates a
specific band shift. The asterisk indicates non-specific signal. Details of the
EMSAs are described in Material and Methods.
OsEREBP1 was previously reported to be phosphorylated by the
OsBWMK1 MAPK and this modification enhanced OsEREBP1 DNA-
binding activity to the GCC box motif (Cheong et al. 2003). Thereby,
OsBWMK1 was also produced and its activity was confirmed by an in
vitro kinase assay (Figure 3). No significant difference in OsEREBP1
DNA-binding activity was detected when the TF was incubated with
OsBWMK1 and the probe S1 (Figure 4). EMSAs were also
Chapter III
105
performed with a sequence containing two tandem repeats of the
GCC box motif (Cheong et al. 2003).
Figure 6. Analysis of the DNA-binding specificity of OsEREBP1 and
OsEREBP2 to the GCC probe described by Cheong et al. (2003). EMSA
was performed with 32
P-labeled GCC probe incubated with GST, bacteria
total protein extract (Cell Extract) and purified proteins GST-OsEREBP1
and GST-OsEREBP2. An assay control was performed with a 500-fold
molar excess of unlabeled GCC probe. OsBWMK1 and 100 µM ATP were
also tested for OsEREBP1. The arrow indicates a specific band shift. The
asterisks indicate non-specific signal. Details of the EMSAs are described in
Material and Methods.
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
106
Figure 6 shows that OsEREBP1 and OsEREBP2 bind to the
synthetic probe and the interaction specificity was confirmed through
competition with 500-fold excess of unlabeled GCC probe. However,
only a weak enhancement in OsEREBP1-DNA binding activity was
detected when the protein was incubated with OsBWMK1 and ATP.
Curiously, the migration of OsEREBP1-DNA complex seems to be
slower than that of the OsEREBP2-DNA, opposite to what was
observed when the TFs interact with the S1 probe (Figure 4).
Figure 7. Transcriptional activity of OsEREBP1 and OsEREBP2 proteins.
(A) Illustrated plasmids used for the transient expression assays. The
pLUCm35GUS-pRMC plasmid contains the GUS reporter gene driven by
the fragment 3 of the OsRMC promoter and the minimal CaMV35S
promoter. (B) GUS and LUC activities were measured in Arabidopsis
protoplasts transfected with the reporter plasmid, pLUCm35GUS-pRMC or
pLUCm35GUS and the effector plasmid, 35S::OsEREBP1 or
35S::OsEREBP2 in a molar ratio 1:3. Transcriptional activity was calculated
as a GUS/LUC ratio. Bars indicate GUS/LUC ratio ± SD after 48 h
protoplast incubation. Data are means ± SD of three replicates.
Chapter III
107
The putative phosphorylation of OsEREBP2 by OsBWMK1 was
not assessed since any MAPK phosphorylation sites were predicted
in OsEREBP2 protein sequence.
OsEREBP1 and OsEREBP2 act as transcriptional repressors.
To assess the TFs transcriptional activity, transient expression
assays were performed in Arabidopsis protoplasts. These protoplasts
were transfected with the reporter plasmid pLUCm35GUS-pRMC
alone or in combination with the effector plasmids 35S::OsEREBP1
or 35S::OsEREBP2. As shown in Figure 7, the expression of the
GUS reporter gene was repressed when each effector plasmid was
co-transfected with the reporter plasmid, thus revealing that
OsEREBP1 and OsEREBP2 negatively regulate OsRMC gene
expression.
DISCUSSION
Several ERF proteins were shown to interact with the cis-element
ERE (Ethylene-Responsive Element), which contains the core
sequence designated GCC box (AGCCGCC) (Mizoi et al. 2011). This
sequence was shown to be the target cis-element for several ERFs;
however some TF proteins display binding flexibility and are able to
interact with variants of this sequence (Fujimoto et al. 2000). To
further characterize the TFs interaction with OsRMC gene promoter,
EMSA experiments were performed with two predicted GCC-like
motifs, S1 and S2, and the synthetic sequence containing two
tandem repeats of the canonical GCC box (Cheong et al. 2003). It
was shown that both OsEREBP1 and OsEREBP2 bind to either S1
or GCC box, but none of them binds to S2. In addition, the
OsEREBP1-GCC box complex displayed a slower migration than the
OsEREBP2-GCC box complex. This difference was not detected
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
108
when the TFs were incubated with S1, in which the TF-DNA
complexes migrate similarly. This result suggests that two
OsEREBP1 molecules bind to the GCC box tandem repeats as a
dimer or the TF binding may induce the recruitment of other TF
molecule to adjacent sites (Garvie and Wolberger 2001). OsEREBP1
cooperative binding was not detected in the EMSAs with S1,
probably because this sequence only contains one GCC-like motif.
Cooperative binding has been described for other regulatory
proteins. The Arabidopsis XERO2 dehydrin gene expression was
shown to be regulated by ABA and cold through combinatorial TF
binding (Chung and Parish 2008). Two Dehydration-Responsive
Elements/C-Repeat elements (DRE/CRT) which are binding sites for
DREB proteins were shown to be required for XERO2 gene
expression induced by cold stress. In addition, the regulation of
PDF1.2 gene expression by jasmonate and ethylene was reported to
depend on the activity of two GCC box motifs (Zarei et al. 2011).
Transient expression assays revealed that the AP2/ERF protein
ORA59 displays enhanced transactivation activity when both GCC
box motifs are present. In tobacco the AP2/ERF protein Tsi1 recruits
and interacts with the Zn-finger protein Tsip1 to cooperatively
promote the transcriptional activation of stress-responsive genes
(Ham et al. 2006). The formation of AP2/ERF dimers was reported
for CRF proteins but their biological function is still unknown
(Cutcliffe et al. 2011).
OsEREBP1 and OsEREBP2 transcriptional activity suggests that
OsEREBP1 and OsEREBP2 negatively regulate OsRMC gene
expression. Opposite results were obtained by Cheong et al. (2003),
who reported that OsEREBP1 functions as a transcriptional activator
when it interacts with GCC box sequences. Previous studies suggest
that TF proteins can function as both activators and repressors
Chapter III
109
(Bossi et al. 2009; Mena et al. 2002). The barley BPBF gene
encodes a DOF TF that induces gene expression in developing
endosperm and has a repressor activity upon germination (Mena et
al. 2002). During germination the TF was proposed to compete with
other transcriptional activators for DNA-binding or to interact with
other TFs that regulate the same target gene. ABI4 encodes an
AP2/ERF protein with a dual function in sugar signaling (Bossi et al.
2009). The authors suggest that the TF transcriptional activity is
dependent on the sequences that surround the ABI4-binding site or
on the binding of other factors. OsEREBP1 may also display different
transcriptional activity depending on the DNA-binding motifs present
in the target gene promoter sequence. The cooperative binding effect
suggested by the EMSA results also indicates that the presence of
additional DNA-binding motifs may interfere with the TF function.
In this work, we have shown that the OsEREBP1 and OsEREBP2
TFs bind to the same GCC-like motif in the OsRMC gene promoter
and function as transcriptional repressors. In addition, we show that
both TFs interact with a synthetic probe containing the GCC box
motif. Moreover, we propose that OsEREBP1 may be involved in
cooperative binding. The TF may bind to the GCC box motif as a
dimer or two TF proteins bind to the tandem GCC box motifs.
ACKNOWLEDGMENTS
Tânia Serra carried out the experimental work with the collaboration
of André Cordeiro who contributed to the protein production and
purification and the transactivation assays and Isabel Abreu who
contributed to the protein purification. The planning of the research
work and discussion of results was performed by Tânia Serra, Lisete
Fernandes, Nelson Saibo and M. Margarida Oliveira. In addition, we
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
110
would like to acknowledge Álvaro Sebastian and Bruno Contreras-
Moreira who contributed to the bioinformatic analysis.
REFERENCES
Allen MD, Yamasaki K, Ohme-Takagi M, Tateno M, Suzuki M (1998) A
novel mode of DNA recognition by a beta-sheet revealed by the solution
structure of the GCC-box binding domain in complex with DNA. EMBO J
17: 5484-5496
Anthony RG, Henriques R, Helfer A, Meszaros T, Rios G, Testerink C,
Munnik T, Deak M, Koncz C, Bogre L (2004) A protein kinase target of a
PDK1 signalling pathway is involved in root hair growth in Arabidopsis.
EMBO J 23: 572-581
Bossi F, Cordoba E, Dupre P, Mendoza MS, Roman CS, Leon P (2009) The
Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as a central
transcription activator of the expression of its own gene, and for the
induction of ABI5 and SBE2.2 genes during sugar signaling. Plant J 59:
359-374
Busk PK, Jensen AB, Pages M (1997) Regulatory elements in vivo in the
promoter of the abscisic acid responsive gene rab17 from maize. Plant J
11: 1285-1295
Cheng C, Yun KY, Ressom HW, Mohanty B, Bajic VB, Jia Y, Yun SJ, de los
Reyes BG (2007) An early response regulatory cluster induced by low
temperature and hydrogen peroxide in seedlings of chilling-tolerant
japonica rice. BMC Genomics 8: 175
Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim JC,
Park BO, Koo SC, Yoon HW, Chung WS, Lim CO, Lee SY, Cho MJ
(2003) BWMK1, a rice mitogen-activated protein kinase, locates in the
nucleus and mediates pathogenesis-related gene expression by
activation of a transcription factor. Plant Physiol 132: 1961-1972
Chung S, Parish RW (2008) Combinatorial interactions of multiple cis-
elements regulating the induction of the Arabidopsis XERO2 dehydrin
gene by abscisic acid and cold. Plant J 54: 15-29
Chapter III
111
Contreras-Moreira B (2010) 3D-footprint: a database for the structural
analysis of protein-DNA complexes. Nucleic Acids Res 38: D91-97
Cutcliffe JW, Hellmann E, Heyl A, Rashotte AM (2011) CRFs form protein-
protein interactions with each other and with members of the cytokinin
signalling pathway in Arabidopsis via the CRF domain. J Exp Bot 62:
4995-5002
Dietz KJ, Vogel MO, Viehhauser A (2010) AP2/EREBP transcription factors
are part of gene regulatory networks and integrate metabolic, hormonal
and environmental signals in stress acclimation and retrograde
signalling. Protoplasma 245: 3-14
Dubos C, Stracke R, Grotewold E, Weisshaar B, Martin C, Lepiniec L
(2010) MYB transcription factors in Arabidopsis. Trends Plant Sci 15:
573-581
Figueiredo D, Barros P, Cordeiro A, Serra TS, Lourenco T, Chander S,
Oliveira MM, Saibo NJM (2012) Seven zinc-finger transcription factors
are novel regulators of the stress responsive gene OsDREB1B. J Exp
Bot: 1-14
Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000)
Arabidopsis ethylene-responsive element binding factors act as
transcriptional activators or repressors of GCC box-mediated gene
expression. Plant Cell 12: 393-404
Garvie CW, Wolberger C (2001) Recognition of specific DNA sequences.
Mol Cell 8: 937-946
Gutterson N, Reuber TL (2004) Regulation of disease resistance pathways
by AP2/ERF transcription factors. Curr Opin Plant Biol 7: 465-471
Ham BK, Park JM, Lee SB, Kim MJ, Lee IJ, Kim KJ, Kwon CS, Paek KH
(2006) Tobacco Tsip1, a DnaJ-type Zn finger protein, is recruited to and
potentiates Tsi1-mediated transcriptional activation. Plant Cell 18: 2005-
2020
Jiang J, Li J, Xu Y, Han Y, Bai Y, Zhou G, Lou Y, Xu Z, Chong K (2007)
RNAi knockdown of Oryza sativa root meander curling gene led to
altered root development and coiling which were mediated by jasmonic
acid signalling in rice. Plant Cell Environ 30: 690-699
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
112
Kizis D, Lumbreras V, Pages M (2001) Role of AP2/EREBP transcription
factors in gene regulation during abiotic stress. FEBS Lett 498: 187-189
Liu Y, Zhao TJ, Liu JM, Liu WQ, Liu Q, Yan YB, Zhou HM (2006) The
conserved Ala37 in the ERF/AP2 domain is essential for binding with the
DRE element and the GCC box. FEBS Lett 580: 1303-1308
Mena M, Cejudo FJ, Isabel-Lamoneda I, Carbonero P (2002) A role for the
DOF transcription factor BPBF in the regulation of gibberellin-responsive
genes in barley aleurone. Plant Physiol 130: 111-119
Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K (2012) AP2/ERF family
transcription factors in plant abiotic stress responses. Biochim Biophys
Acta 1819: 86-96
Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki
K (2002) DNA-binding specificity of the ERF/AP2 domain of Arabidopsis
DREBs, transcription factors involved in dehydration- and cold-inducible
gene expression. Biochem Biophys Res Commun 290: 998-1009
Seo YS, Chern M, Bartley LE, Han M, Jung KH, Lee I, Walia H, Richter T,
Xu X, Cao P, Bai W, Ramanan R, Amonpant F, Arul L, Canlas PE, Ruan
R, Park CJ, Chen X, Hwang S, Jeon JS, Ronald PC (2011) Towards
establishment of a rice stress response interactome. PLoS Genet 7:
e1002020
Shimono M, Sugano S, Nakayama A, Jiang CJ, Ono K, Toki S, Takatsuji H
(2007) Rice WRKY45 plays a crucial role in benzothiadiazole-inducible
blast resistance. Plant Cell 19: 2064-2076
Shukla RK, Raha S, Tripathi V, Chattopadhyay D (2006) Expression of
CAP2, an APETALA2-family transcription factor from chickpea,
enhances growth and tolerance to dehydration and salt stress in
transgenic tobacco. Plant Physiol 142: 113-123
Steffens NO, Galuschka C, Schindler M, Bulow L, Hehl R (2004) AthaMap:
an online resource for in silico transcription factor binding sites in the
Arabidopsis thaliana genome. Nucleic Acids Res 32: D368-372
Sun S, Yu JP, Chen F, Zhao TJ, Fang XH, Li YQ, Sui SF (2008) TINY, a
dehydration-responsive element (DRE)-binding protein-like transcription
Chapter III
113
factor connecting the DRE- and ethylene-responsive element-mediated
signaling pathways in Arabidopsis. J Biol Chem 283: 6261-6271
Swaminathan K, Peterson K, Jack T (2008) The plant B3 superfamily.
Trends Plant Sci 13: 647-655
Turatsinze JV, Thomas-Chollier M, Defrance M, van Helden J (2008) Using
RSAT to scan genome sequences for transcription factor binding sites
and cis-regulatory modules. Nat Protoc 3: 1578-1588
Umezawa T, Nakashima K, Miyakawa T, Kuromori T, Tanokura M,
Shinozaki K, Yamaguchi-Shinozaki K (2010) Molecular basis of the core
regulatory network in ABA responses: sensing, signaling and transport.
Plant Cell Physiol 51: 1821-1839
Woo HR, Kim JH, Kim J, Lee U, Song IJ, Lee HY, Nam HG, Lim PO (2010)
The RAV1 transcription factor positively regulates leaf senescence in
Arabidopsis. J Exp Bot 61: 3947-3957
Yamaguchi-Shinozaki K, Shinozaki K (2005) Organization of cis-acting
regulatory elements in osmotic- and cold-stress-responsive promoters.
Trends Plant Sci 10: 88-94
Zarei A, Korbes AP, Younessi P, Montiel G, Champion A, Memelink J
(2011) Two GCC boxes and AP2/ERF-domain transcription factor
ORA59 in jasmonate/ethylene-mediated activation of the PDF1.2
promoter in Arabidopsis. Plant Mol Biol 75: 321-331
Zhang H, Huang Z, Xie B, Chen Q, Tian X, Zhang X, Lu X, Huang D, Huang
R (2004) The ethylene-, jasmonate-, abscisic acid- and NaCl-responsive
tomato transcription factor JERF1 modulates expression of GCC box-
containing genes and salt tolerance in tobacco. Planta 220: 262-270
Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2009) Identification
of an apoplastic protein involved in the initial phase of salt stress
response in rice root by two-dimensional electrophoresis. Plant Physiol
149: 916-928
Characterization of the OsEREBP1 and OsEREBP2 interaction with the OsRMC promoter
114
Chapter IV
115
OsEREBP1 encodes an AP2/ERF transcription factor
involved in high salinity, drought and ABA responses
Chapter IV
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
116
TABLE OF CONTENTS – CHAPTER IV
Abstract ....................................................................................... 117
Introduction ................................................................................. 118
Material and Methods ................................................................. 120
Plant material and growth conditions ........................................... 120
Plasmid construction ................................................................... 121
OsEREBP1 subcellular localization ............................................. 122
Arabidopsis protoplast transfection and treatments ..................... 123
Protein extraction and immunoblot analysis ................................ 123
Analysis of protein kinase activity ................................................ 124
Arabidopsis plant transformation ................................................. 125
Semi-quantitative reverse transcription-PCR (RT-PCR) analysis ....................................................................................... 125
Analysis of stress tolerance in transgenic plants ......................... 125
Complementation of the rap2.2 Arabidopsis mutant .................... 126
Results ......................................................................................... 127
OsEREBP1 locates in the nucleus .............................................. 127
High salinity increases OsEREBP1 abundance through increased protein synthesis and stability ..................................... 128
High salinity does not affect the kinase activity of the OsBWMK1 protein encoded by the OsBWMK1S transcript ......... 130
OsEREBP1 functional analysis in transgenic plants .................... 131
Complementation studies in rap2.2 mutants ................................ 135
Discussion ................................................................................... 136
Acknowledgments ...................................................................... 143
References .................................................................................. 143
Chapter IV
117
ABSTRACT
Drought and high salinity cause great losses in crop productivity
worldwide. In order to cope with these adverse environmental
conditions, plants have evolved several strategies, which rely on the
perception of stress stimuli, signal transduction and regulation of
stress-responsive genes. Transcription factors (TFs) can control the
expression of several genes and play a crucial role in stress
responses. OsEREBP1 encodes an AP2/ERF family TF that binds to
the OsRMC promoter and is putatively involved in biotic and abiotic
stress responses in rice. We have shown that high salinity induces
OsEREBP1 protein accumulation, through increase in both protein
synthesis and protein stability. OsEREBP1 was previously reported
to be phosphorylated by the OsBWMK1. However, our in vitro kinase
assays revealed that OsBWMK1 kinase activity is not affected by
high salinity, suggesting that the increase in the TF stability does not
involve phosphorylation by this MAPK. The analysis of Arabidopsis
plants over-expressing OsEREBP1 further supports its role in abiotic
stress responses. OsEREBP1-OX Arabidopsis seeds displayed
increased sensitivity to high salinity and ABA during germination. The
ABA hypersensitivity was also observed in root growth assays, but
the increased sensitivity to high salinity was neither observed for root
growth nor in survival studies. Root growth assays indicated that
OsEREBP1-OX seedlings are more tolerant to water deficit.
However, when OsEREBP1-OX and wt seedlings were subjected to
water deficit conditions, no significant differences in survival rate
were observed. Complementation assays with rap2.2 mutants
showed that OsEREBP1 and RAP2.2 must have different functions
in abiotic stress responses.
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
118
INTRODUCTION
Drought and high salinity are major adverse environmental factors
that reduce the yield of several staple food crops, such as rice.
Therefore, the continuous worldwide reduction of water resources
and the increase in soil salinization will further limit crop productivity
(Newton et al. 2011; Pardo 2010). To respond to adverse
environmental conditions plants have developed mechanisms that
promote the physiological and biochemical modifications necessary
for plant adaptation and survival. The perception of the
environmental stress stimuli promotes the activation of signal
transduction pathways that induce changes in gene expression
(Knight and Knight 2001; Mahajan and Tuteja 2005). The products of
stress-inducible genes may have a direct function in cell protection
(the case of detoxification enzymes), or in the regulation of gene
expression and signal transduction (Yamaguchi-Shinozaki and
Shinozaki 2006). Transcription factors (TFs) are master regulators of
the stress signaling network, due to their ability to control the
expression of several target genes (Nakashima et al. 2009). This
feature makes the TFs good candidates for genetic engineering
programs, since their over-expression can lead to enhanced
tolerance to multiple stress conditions (Bhatnagar-Mathur et al. 2008;
Century et al. 2008; Vij and Tyagi 2007). TFs implicated in abiotic
stress responses have been identified in several plant species and
include members of the AP2/ERF, bZIP, NAC and MYB families
(Agarwal and Jha 2010; Saibo et al. 2009; Santos et al. 2011).
The AP2/ERF (APETALA2/Ethylene Response Factor) proteins
comprise a superfamily of TFs identified in plants and
microorganisms (Magnani et al. 2004). These regulatory proteins
contain either one or two AP2-DNA binding domains and are
Chapter IV
119
involved in plant development and stress-related responses (Dietz et
al. 2010). OsEREBP1 contains one AP2-DNA binding domain and
belongs to the CMVII group of ERF proteins (Cheong et al. 2003;
Nakano et al. 2006). This ERF group includes many proteins
involved in biotic and abiotic stress responses. For instance, the
Arabidopsis RAP2.2 and rice SUB1A were shown to have a role in
submergence tolerance (Hinz et al. 2010; Jung et al. 2010) and the
CaPF1 from pepper was found to confer pathogen and freezing
tolerance when over-expressed in Arabidopsis (Yi et al. 2004).
Several studies revealed that OsEREBP1 is involved in both biotic
and abiotic stress responses. OsEREBP1 was initially identified as a
putative target of OsBWMK1 (rice Blast- and Wounding-activated
MAP Kinase), a MAPK involved in rice defense responses (Cheong
et al. 2003). OsBWMK1 alternative splicing generates three
transcript variants OsBWMK1L, OsBWMK1M and OsBWMK1S and
the encoded proteins were shown to phosphorylate OsEREBP1 (Koo
et al. 2007). The OsBWMK1S encoded protein phosphorylates the
TF and greatly increases its DNA-binding activity to the GCC box
motif usually present in the promoter of stress-responsive genes
(Cheong et al. 2003; Seo et al. 2011). OsEREBP1 function in biotic
stress responses was also analyzed in rice plants over-expressing
the TF (Seo et al. 2011). The transgenic plants displayed enhanced
resistance to infection by the bacteria Xanthomonas oryzae pv.
oryzae (Xoo).
The role of OsEREBP1 as a putative regulator of abiotic stress
responses was suggested by gene expression studies. Microarray
analysis revealed that the TF gene expression is induced under
moderate cold (10ºC) (Cheng et al. 2007). In addition, the TF
transcript level was transiently induced in shoots and down-regulated
in roots of rice plants subjected to drought stress (Chapter 2).
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
120
OsEREBP1 may also have a role in high salinity responses.
Although no significant changes in gene expression were reported
under salt stress, the TF was shown (Chapter 3) to modulate the
expression of OsRMC (rice Root Meander Curling), a negative
regulator of salt stress responses. The TF directly interacts with the
OsRMC promoter and negatively regulates its gene expression
(Chapters 2 and 3). OsRMC encodes a receptor-like kinase (RLK)
whose expression is induced in response to high salinity in a stress-
dose-dependent manner (Chapter 2). In addition, OsRMC
knockdown lines showed improved tolerance to salt stress conditions
and increased expression of stress-responsive genes (Zhang et al.
2009).
In this study, we further characterized the function of OsEREBP1
in biotic and abiotic stress responses. The OsEREBP1 protein level
was shown to be strictly regulated by salt stress through synthesis
and stability of the protein. Transgenic Arabidopsis plants revealed
that OsEREBP1 is also involved in drought and ABA responses.
MATERIAL AND METHODS
Plant material and growth conditions
Arabidopsis thaliana (ecotype Columbia (Col-0)) and rap2.2
mutant (SALK_079603.40.60.x) plants were grown in the
greenhouse under long-day conditions (16 h/8 h light/dark cycle) to
the flowering stage for plant transformation. Seeds were surface-
sterilized in a solution of 1.5% sodium hypochlorite containing 0.1%
Tween-20 for 10 min and rinsed six times with sterile water. After
stratification at 4ºC for 3 d in darkness, the seeds were sown and
germinated in a growth chamber at 22ºC, under a 16 h photoperiod
(40 µmol m-2 s-1). Seven-day-old seedlings, similar in size, grown on
Chapter IV
121
half-strength Murashige and Skoog (MS) medium, were used in the
root growth studies. Survival assays were performed with 14-day-old
seedlings grown on half-strength MS medium.
Plasmid construction
The full-length OsEREBP1 (LOC_Os02g54160) and OsBWMK1S
(LOC_Os06g49430.2) sequences were isolated from cDNA prepared
from total RNA of 14 days-old rice seedlings as described in Chapter
2. The OsEREBP1 fragment was obtained through amplification with
the PhusionTM high-fidelity DNA polymerase (Finnzymes, Vantaa,
Finland) and the GW-OsEREBP1-Fw/-Rv primers containing
Gateway adapters (Table 1). The insert was cloned into the
pDONR221 vector with the Gateway BP recombinase (Invitrogen,
CA, USA) according to the manufacturer’s instructions. The plasmid
was confirmed by sequencing. To obtain the 35S::GFP::OsEREBP1
and the HA::OsEREBP1 plasmids, LR recombination (Invitrogen, CA,
USA) reactions were performed with the binary vectors pH7WGF2
and pEarleyGate201, respectively, following the manufacturer’s
instructions. The OsBWMK1S fragment was isolated with the
PrimeSTAR HS DNA polymerase (Takara, Shiga, Japan) and the
OsBWMK1-Fw/-Rv primers containing NcoI and NotI recognition
sequences (Table 1). The obtained PCR product was cloned into the
pGEM-T Easy Vector (Promega, Wisconsin, USA) according to the
manufacturer’s instructions and sequenced. The NcoI-NotI fragment
containing the OsBWMK1S insert was excised from the pGEM-T
Easy Vector and cloned into the pRT100 vector to obtain the
OsBWMK1::HA plasmid. The GFP::OsEREBP1 construct was
prepared to perform studies in Arabidopsis protoplasts. The region
containing the 35S::GFP::OsEREBP1 fragment was removed from
the pH7WGF2-OsEREBP1 through restriction with XbaI-HindIII and
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
122
cloned into the pGREEN0029 vector. The plasmids AtMAPK8::HA,
AtMAPK16::HA and AtMAPK18::HA which allow over-expression of
the MAPKs in Arabidopsis protoplasts were previously prepared by
colleagues at L. Bögre lab.
Table 1. Oligonucleotide sequences used for the cloning procedures and
gene expression studies. The underlined region of the primer corresponds
to adapter sequences and the remaining region is specific to the target
DNA.
Primer name Primer sequence 5´- 3´
GW-OsEREBP1-Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTACAAGCAATCCACCACTGCA
GW-OsEREBP1-Rv GGGGACCACTTTGTACAAGAAAGCTGGGTTGCCTCCCAATCTCCAATAG
OsBWMK1-Fw GGCCATGGAGTTCTTCACTGAGTATGGA
OsBWMK1-Rv GGGCGGCCGCAGGAGTGCATCCTGGAGACTT
RAP2.2-Fw TCCCTCCGCGTCACTAACGA
RAP2.2-Rv GCTAAACAAGTTTGGGGGTACAAAACA
Actin-Fw GGCGATGAAGCTCAATCCAAACG
Actin-Rv GGTCACGACCAGCAAGATCAAGACG
OsEREBP1 subcellular localization
Onion epidermal cells were bombarded with 1.5 or 1.6 µg of
35S::GFP::OsEREBP1 or 35S::GFP (pH7WGF2 vector) plasmids,
respectively. Plasmid DNA was precipitated onto 1 µm gold particles
using spermidine (0.1 M) and CaCl2 (2.5 M). The tissues were
bombarded with DNA-coated particles using a particle gun device
(PDS-1000/He, Bio-Rad, CA, USA). The transformed tissues were
incubated overnight under dark on filter paper soaked in sterile
water. The tissues were stained with DAPI (17 µM) and observed
with a Nikon TE300 microscope.
Chapter IV
123
Arabidopsis protoplast transfection and treatments
Protoplast isolation from Arabidopsis suspension cells (Col-0
ecotype) and polyethylene glycol-mediated transfection were
performed as described in Chapter 3. Approximately 3 x 105
protoplasts were transfected with 2-10 µg of plasmid DNA and
incubated 24 to 48 h in medium containing 0.2 µM 2.4-
Dichlorophenoxyacetic acid (2.4-D). Before harvesting, the
transfected protoplasts were subjected to a salt treatment (280 mM
NaCl) for 10 min (Teige et al. 2004) or maintained under control
conditions. In a separate experiment, the transfected protoplasts
under control and high salt conditions were simultaneously treated
with cycloheximide (100 µM) to block protein synthesis (Magyar et al.
2005) and harvested after 0, 15, 30, 60, 120 and 240 min. The
transfected protoplasts were collected by centrifugation and stored at
-80ºC.
Protein extraction and immunoblot analysis
Total protein was extracted from transfected protoplasts as
previously described (Teige et al. 2004) with minor modifications.
Cell pellets were ressuspended in homogenization buffer (Lacus
buffer) containing 25 mM Tris-HCl pH 7.5, 10 mM MgCl2, 15 mM
EGTA, 75 mM NaCl, 1 mM NaF, 0.5 mM NaVO3, 15 mM β-
glycerolphosphate, 0.1% Tween-20, 1 mM DTT, 15 mM ρ-
nitrophenylphosphate, 0.5 mM phenylmethylsulfonyl fluoride (PMSF)
and 1x complete protease inhibitor cocktail (Roche, Basel,
Switzerland). After removal of the cell debris by centrifugation, the
total protein concentration was determined by the Bradford protein
assay (Bio-Rad, CA, USA). For immunoblots, equal amounts of total
protein extracts were resolved on SDS-PAGE gels containing 10%
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
124
polyacrylamide and transferred to PVDF membranes. The
membranes were probed with anti-HA or anti-GFP mouse
monoclonal antibody and an anti-mouse horseradish peroxidase-
conjugated antibody according to the manufacturer’s instructions
(Roche, Basel, Switzerland). A loading control was performed with
Coomassie Brilliant Blue staining or an anti-Actin antibody (Santa
Cruz Biotechnology, CA, USA).
Analysis of protein kinase activity
Immunoprecipitation and in vitro kinase assay were performed as
previously described with some modifications (Bogre et al. 1999). For
immunoprecipitation, 5 µL of anti-HA antibody (Roche, Basel,
Switzerland) were added to 50 µg of protein extracts. After 1 h of
constant rolling, 15 µL of protein G beads was added from a 50%
protein G-Sepharose suspension. The tubes were rotated for 3 h,
and the beads were then washed three times with 500 µL of wash
buffer (50 mM Tris-HCl pH 7.5, 250 mM NaCl, 5 mM EGTA, 5 mM
Na2EDTA pH 8, 0.1% Tween-20, 5 mM NaF, 0.1% Nonidet P-40,
and 0.5 mM PMSF) and once with kinase buffer (20 mM HEPES pH
7.5, 15 mM MgCl2, 5 mM EGTA, and 1 mM DTT). The buffer was
aspirated with a needle and the kinase reaction was performed on
the beads. The reaction was conducted at approximately 22ºC for 30
min with 15 µL kinase buffer supplemented with 0.1 mM ATP, 2 µCi
[γ-32P]-ATP, and 10 µg of myelin basic protein (MBP) as artificial
phosphorylation substrate. The reaction was terminated by boiling in
SDS sample buffer and resolved in SDS-PAGE gels containing
12.5% polyacrylamide. Gels were dried on Whatman 3MM paper and
analyzed by autoradiography. All the reactions were performed in
triplicate.
Chapter IV
125
Arabidopsis plant transformation
Arabidopsis plants (ecotype Col-0) were transformed via the
floral-dip method as previously described (Clough and Bent 1998).
An Agrobacterium (strain LBA4404) culture containing the
HA::OsEREBP1 plasmid was used for Col-0 transformation. T0
seeds were surface-sterilized, stratified and screened on MS plates
containing 1% sucrose, 2.6 mM MES buffer, 0.1 mM BASTA and 0.2
mM cefotaxime. Ten resistant OsEREBP1-OX seedlings (T1) were
transplanted to soil and grown in the greenhouse to produce seeds.
DNA was isolated from these plants through the QuickExtractTM Plant
DNA Extraction Solution (Epicentre, Madison, USA) according to the
manufacturer’s instructions. The presence of the transgene was
confirmed by PCR with the GW-OsEREBP1-Fw/-Rv primers (Table
1). Homozygous plants (T2) were selected for transgene expression
analysis by RT-PCR and OsEREBP1-OX T2 and T3 seeds were
used for the stress tolerance assays.
Semi-quantitative reverse transcription-PCR (RT-PCR) analysis
Total RNA was isolated using the RNeasy Plant Mini kit (Qiagen,
Courtaboeuf, France). cDNA was synthesized from 0.5-1 µg of total
RNA using the Transcriptor High Fidelity cDNA Synthesis kit (Roche,
Base Switzerland) according to the manufacturer’s instructions. PCR
reactions were performed using the gene specific primers described
in Table 1. Actin (At2g37620) gene was used as internal control.
Analysis of stress tolerance in transgenic plants
For germination rate analysis, approximately 40 seeds from wt
and OsEREBP1-OX lines were plated in triplicate on half-strength
MS medium supplemented or not with 100 mM NaCl or 1 µM ABA.
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
126
Seeds were stratified and incubated at 22ºC under long-day
conditions. Germination (emergence of the radicle) was scored daily
for 6 days. Two independent replicates were performed for each
treatment. Survival rate was evaluated through transfer of 14-day-old
seedlings to half-strength MS medium supplemented with NaCl (150
mM and 200 mM) or PEG (7.5%). Shoot photographs were taken 11
d after transfer. For root growth assays, 7-day-old seedlings were
transferred to half-strength MS medium supplemented with ABA (1
and 10 µM), NaCl (100 mM and 150 mM) or PEG (5% and 10%).
The plates were placed vertically in a rack and photographs were
taken 11 d after transfer to medium containing ABA, PEG or NaCl.
Root growth ratios were obtained by analysis of photographs with the
Image J software and determined as the length at a given time point
minus the initial length (root length after seedling transfer). Relative
root growth was calculated as the mean of the root growth in stress-
treated seedlings divided by the mean of the root growth in control
conditions obtained for wt or each transgenic line. The total number
of plants used in the root growth studies is described in Table 2.
Complementation of the rap2.2 Arabidopsis mutant
The rap2.2 T-DNA insertion mutant (SALK_079603.40.60.x) was
obtained from the Nottingham Arabidopsis Stock Centre (NASC,
Loughborough, UK). Homozygous mutant plants were isolated and
suppression of gene expression was confirmed by RT-PCR analysis.
For complementation studies, homozygous mutant plants were
transformed with Agrobacterium (strain LBA4404) carrying
HA::OsEREBP1 by the floral-dip method (Clough and Bent 1998).
Homozygous plants (T2) were obtained as previously described and
analyzed for transgene expression. rap2.2 mutant complementation
was assessed through the study of root growth under abiotic stress
Chapter IV
127
conditions. The root growth assays were performed with 7-day-old
seedlings as previously described and photographs were taken 11 or
15 days after transfer to medium containing 100 mM NaCl or 5%
PEG, respectively. The total number of plants used in the root growth
studies is described in Table 2.
Table 2. Total number of plants used to calculate root growth in seedlings
treated with NaCl, ABA and PEG. L2 and L3 are OsEREBP1-OX lines and
L4, L5 and L6 are rap2.2/OsEREBP1 complemented lines.
Control NaCl Control 1 µM ABA
Control 10 µM ABA
Control PEG
Col-0 9 24 27 32 9 25 7 15
L2 13 21 10 13 13 24 17 24
L3 11 21 8 14 11 23 17 22
Col-0 9 17 - - - - 19 36
rap2.2 13 18 - - - - 16 25
L4 4 - - - - - 14 20
L5 20 24 - - - - 17 19
L8 8 22 - - - - 17 16
RESULTS
OsEREBP1 locates in the nucleus
OsEREBP1 subcellular localization was analyzed through
transient expression of 35S::GFP::OsEREBP1 in onion epidermal
cells. The green fluorescent signal was detected exclusively in the
nucleus (Figure 1). The cells were stained with DAPI, which
confirmed the nuclear localization of the GFP-OsEREBP1 fusion
protein (Figure 1).
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
128
Figure 1. Analysis of OsEREBP1 cellular localization. Onion epidermal cells
were bombarded with 35S::GFP::OsEREBP1 and 35S::GFP, stained with
DAPI and photographed under different light fields. Merged images were
prepared with the Image J software. Scale bars ≈ 100 µm.
High salinity increases OsEREBP1 abundance through increased
protein synthesis and stability
To investigate whether high salinity could have an effect on
OsEREBP1 protein level, Arabidopsis protoplasts were transfected
with the GFP::OsEREBP1 plasmid and after 24 h were subjected to
a salt treatment (280 mM NaCl) for 10 min. Total protein analysis
revealed that two forms of OsEREBP1 are recognized by the anti-
GFP antibody under both control and high salt conditions (Figure
2A). Moreover, both protein forms showed a molecular mass higher
than expected. The molecular mass of GFP-OsEREBP1 fusion
protein was estimated as 72 kDa based on the predicted aa
sequence, but the detected forms were close to 78 and 85 kDa. The
Chapter IV
129
protein form with 78 kDa was considered as corresponding to the
GFP-OsEREBP1 fusion protein.
Figure 2. Effect of high salinity on OsEREBP1 protein accumulation, as
assessed by Western-blot with anti-GFP antibody, on Arabidopsis
protoplasts transfected with GFP::OsEREBP1 or 35S::GFP. (A) Protoplasts
treated with a salt solution (280 mM NaCl) for 10 min. (B) Protoplasts
treated with 100 µM cycloheximide (CHX) and subjected or not to a salt
treatment (280 mM NaCl). The protoplasts were harvested at the time
points indicated. Coomassie Brilliant Blue staining (A) or an anti-Actin
antibody (B) was used as loading control. Cells were either transfected with
GFP::OsEREBP1 (10 µg) or with 35S::GFP (2 µg in A, or 5 µg in B).
The observed increase in OsEREBP1 protein level under salt
stress conditions may be due to increased protein stability or higher
protein synthesis. To investigate these hypothesis, Arabidopsis
protoplasts over-expressing the TF under control and salt stress
conditions were treated with cycloheximide (100 µM) to block de
novo protein synthesis (Figure 2B). In cells maintained at control
conditions, GFP-OsEREBP1 levels rapidly decreased becoming
undetectable at 1 h treatment. Under high salinity, the protein level
slightly increased after 15 min treatment and afterwards it gradually
decreased. However, the fusion protein was still detected after 4 h
treatment. The slight reduction in protein level indicates that high
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
130
salinity promoted OsEREBP1 protein synthesis. However, the
presence of protein during all the treatment suggests that
OsEREBP1 stability was much enhanced under salt stress
conditions.
High salinity does not affect the kinase activity of the OsBWMK1
protein encoded by the OsBWMK1S transcript
OsEREBP1 was previously reported to be phosphorylated by the
protein form encoded by the OsBWMK1S transcript (Cheong et al.
2003). Moreover, the OsBWMK1S transcript was shown to
accumulate in response to high salinity (Agrawal et al. 2003b). To
assess if the kinase activity of the OsBWMK1 protein encoded by the
OsBWMK1S transcript is affected by high salinity, in vitro kinase
assays were performed in Arabidopsis protoplasts. No different
kinase activity or protein levels were detected (Figure 3). To identify
Arabidopsis MAPKs able to phosphorylate OsEREBP1, the kinase
activity of the group D MAPKs AtMAPK8, AtMAPK16 and
AtMAPK18, was also analyzed. The MAPKs whose activity is
regulated by this abiotic stress, would be silenced in Arabidopsis
protoplasts. Moreover, transactivation assays should be able to
elucidate if the interaction between OsEREBP1 and the OsRMC
promoter is regulated by phosphorylation (this assay, however, was
not yet performed due to time limitations). Only AtMAPK16 revealed
a significant increase in kinase activity under high salt treatment. The
difference in kinase activity observed in control and salt stress
conditions was confirmed through quantification of band intensity
with the Image J software.
Chapter IV
131
Figure 3. MAPKs activity under control and high salinity conditions. The
MAPKs activity was measured through in vitro kinase assays using 50 µg
total protein from Arabidopsis cells transfected with 5 µg of each MAPK
construct. Protoplasts were treated with 280 mM NaCl for 10 min or
maintained in control conditions. MAPK protein quantification was
performed on the previous samples by Western-blot with anti-HA antibody.
OsEREBP1 functional analysis in transgenic plants
OsEREBP1 was shown to be regulated by drought and salt stress
conditions at transcriptional (Chapter 2) or post-translational level,
respectively. To further characterize the TF role in these abiotic
stress responses, Arabidopsis plants over-expressing OsEREBP1
(OsEREBP1-OX) were generated. Three independent homozygous
lines (L1, L2 and L3) with high expression of the transgene (Figure
4A) were selected for the following studies. The germination rate was
measured for wt and transgenic seeds under control, high salinity
and ABA treatments (Figures 4B-4D). As shown in Figure 4B, under
control conditions, the germination rate of the three transgenic lines
was lower (80%) than the observed in wt plants (96%). However, no
significant delay in germination was observed. On the contrary, salt
treatment induced a significant delay in germination of the transgenic
seeds (Figure 4C). Approximately 90% of wt seeds germinated within
3 d, whereas the germination rate for the transgenic seeds was
between 20% and 55%. A slight delay in germination was also
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
132
detected in transgenic seeds subjected to ABA. The seed
germination rate of OsEREBP1-OX lines, evaluated 6 days after ABA
treatment was significantly lower than that observed for wt plants.
These results indicate that OsEREBP1-OX greatly increases seed
sensitivity to high salinity and causes a slight increase in ABA
sensitivity.
Figure 4. OsEREBP1 over-expression in Arabidopsis induces a delay in
seed germination under salt and ABA treatments. (A) RT-PCR analysis of
OsEREBP1 expression level in transgenic and wt (Col-0) plants. Total RNA
was isolated from plants with the second pair of leaves well expanded.
Internal control: Actin. (B), (C) and (D) Germination rate analysis of
transgenic and wt seeds sown on half-strength MS medium without (B) or
with 100 mM NaCl (C) or with 1 µM ABA (D). The percentage of seeds
germinated was recorded during 6 days. Data are means ± SD (n ≈ 100).
OsEREBP1 function in abiotic stress responses was also
analyzed through survival rate and root growth studies with wt and
transgenic seedlings subjected to stress treatments. Survival rate
assays were performed with 14-day-old seedlings transferred to
medium supplemented with NaCl (150 and 200 mM) and PEG
Chapter IV
133
(7.5%). No significant differences in survival rate were detected in
seedlings subjected to both stress treatments (Figure 5). The
transgenic seedlings treated with 200 mM NaCl displayed a survival
rate similar to wt and were completely dried 1 day after transfer.
Figure 5. OsEREBP1-OX (L1-L3) and wild type (Col-0) Arabidopsis
seedlings grown under high salinity and water deficit induced by PEG, as
compared to control conditions. Fourteen-day-old seedlings were
transferred to half-strength MS medium with or without 7.5% PEG, or with
150 mM NaCl. Photographs were taken 11 days after transfer.
Root growth assays were performed with 7-day-old seedlings
transferred to medium containing ABA (1 or 10 µM), NaCl (100 or
150 mM) or PEG (5 or 10%). These assays were not performed with
plants L1 due to their low seed germination. Root growth was
considered as the root length of each seedling minus the initial length
measured immediately after transfer. A high variability in root growth
was detected for all seedlings analyzed, thus the relative root growth
was calculated as the ratio between the mean root growth of stress-
treated seedlings and the mean growth of wt or each transgenic line
under control conditions (Figure 6). No significant difference in root
phenotype was detected between wt and the transgenic seedlings
under 100 mM NaCl treatment. In addition, treatment with 1 µM ABA
did not significantly affect root growth of both wt and L2 transgenic
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
134
seedlings, but did affect the growth of L3 roots. At higher ABA
concentration (10 µM ABA), the root growth of both wt and
transgenic seedlings (L2 and L3) was significantly affected and the
transgenic seedlings displayed enhanced sensitivity to ABA
inhibition. Water deficit induced by PEG revealed that the transgenic
plants are less affected at the root level by this abiotic stress, as
compared to wt. The root growth was also analyzed in seedlings
treated with 150 mM NaCl and 10% PEG, however all seedlings
were completely dried 1 day after transfer.
Figure 6. Analysis of root growth in OsEREBP1-OX seedlings subjected to
high salinity, ABA and water deficit induced by PEG. Seven-day-old
seedlings were transferred to half-strength MS medium with or without 100
mM NaCl, 1 or 10 µM ABA and 5% PEG. Photographs were taken 11 days
after transfer to medium containing ABA, PEG or NaCl. Error bars represent
standard error. Total number of plants is described in Table 2. Asterisks (*)
indicate significant differences (P<0.05) relative to wt (Col-0).
Chapter IV
135
Complementation studies in rap2.2 mutants
OsEREBP1 and RAP2.2 belong to the CMVII group of ERF
proteins and share high aa sequence identity (87%) within the AP2-
DNA binding domain. To determine whether OsEREBP1 is
functionally similar to the RAP2.2 gene from Arabidopsis, a rap2.2
mutant line was transformed with the HA::OsEREBP1 construct. The
suppression of rap2.2 gene expression and the transgene
expression in homozygous rap2.2/OsEREBP1 complemented lines
was confirmed by RT-PCR (Figure 7A).
Figure 7. Analysis of gene expression and root growth of
rap2.2/OsEREBP1 complemented seedlings. (A) RT-PCR analysis of
rap2.2 mutants, wt and complemented lines (L4, L5 and L8). Total RNA was
extracted from plants with the second pair of leaves well expanded. Internal
control: Actin. (B) Root growth assays with 7-day-old seedlings subjected to
100 mM NaCl and 5% PEG. Photographs were taken 11 or 15 days after
transfer to NaCl-containing medium or PEG-containing medium,
respectively. Total number of plants is described in Table 2. Asterisks (*)
indicate significant differences (P<0.05) relative to wt (Col-0).
Root growth studies were performed to assess the root phenotype
of rap2.2 mutants and rap2.2/OsEREBP1 complemented lines grown
under high salinity (100 mM NaCl) and water deficit induced by PEG
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
136
(5%) (Figure 7B). When the Arabidopsis seedlings were grown under
100 mM NaCl treatment, no significant difference in root growth was
detected between wt, the rap2.2 mutant and the transgenic seedlings
L5. However, a significant decrease in root growth was observed for
the seedlings L8 when compared with wt. When the seedlings were
subjected to water deficit induced by PEG, the root growth of rap2.2
was 13.5% higher than wt, indicating that rap2.2 mutant is more
tolerant to water deficit. Nevertheless, under the same stress
conditions, all rap2.2/OsEREBP1 lines also showed enhanced root
growth as compared to wt (16-32%). Therefore, we conclude that
OsEREBP1 over-expression does not rescue the mutant phenotype
under the applied stress treatments.
DISCUSSION
Proteins must be targeted to, or retained in, the correct subcellular
compartment to ensure their biological function. Transcription factors
are characterized by the presence of a nuclear localization signal
(NLS) that allows their transport into the nucleus after being
synthesized (Krause and Krupinska 2009; Liu et al. 1999).
OsEREBP1 contains a NLS (Chapter 2) and our cellular localization
studies revealed that this TF is indeed located in the nucleus.
The transcription of genes with an important role in plant salt
stress response is not always induced by high salinity treatments
(Xiong and Zhua 2002). Studies in rice have shown that the
OsEREBP1 transcript level does not change under high salinity
treatment, suggesting a regulation at post-translational level under
this abiotic stress condition (Chapter 2). In fact, OsEREBP1 protein
level increased under salt stress. Two protein forms were detected,
with 78 and 85 kDa, but only the one with 78 kDa was considered to
correspond to the GFP-OsEREBP1 fusion protein (with an estimated
Chapter IV
137
molecular mass of 72 kDa). The discrepancy from the expected
molecular weight may be due to some protein anomalous migration.
The fusion protein was predicted to have an acidic isoelectric point
(pI 5.1) and a high negative net charge (-17.5) at pH 7.0. The
anomalous migration of proteins with high acidic residue content in
SDS-PAGE gels has been previously described (Alves et al. 2004;
Stumpo et al. 1989). The slow migration in the gel may be related to
a low binding of SDS to the protein due to the acidic residues,
causing insufficient protein denaturation (Alves et al. 2004; Graceffa
et al. 1992). The 85 kDa band may represent a post-translationally
modified variant of OsEREBP1. Previous reports revealed that the
TF is phosphorylated by OsBWMK1 (Cheong et al. 2003). Moreover,
an aa sequence analysis using the NetPhos program predicted the
existence of 20 serine and threonine putative phosphorylation sites.
Therefore, the upper band detected may correspond to a highly
phosphorylated form of OsEREBP1. Although the difference in
molecular weight between the unmodified and modified protein is
relatively high (13 kDa), such difference has been reported for the
highly phosphorylated protein PsRBR1 from pea (Mori et al. 2008).
PsRBR1 was identified in axillary buds and the aa sequence analysis
predicted the existence of 16 phosphorylation sites. The protein was
found in the non-phosphorylated form (114 kDa), and in the lower-
and higher-molecular mass phosphorylated forms with 140 and 150
kDa, respectively (Mori et al. 2008). The detected upper band may
also correspond to a SUMOylated form of OsEREBP1. The
prediction programs SUMOplot and SUMOsp2.0 identified a putative
SUMOylation site (K193 position) with high score. In addition, the
difference in molecular weight between the upper and lower band (13
kDa) corresponds approximately to the molecular weight of the
Arabidopsis SUMO protein (14 kDa) (Kurepa et al. 2003). Several
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
138
components of the SUMOylation system have been identified in rice
and Arabidopsis, suggesting that the conjugation mechanism is
present in both plant species (Karlson and Chaikam 2010; Kurepa et
al. 2003). A proteome-wide screen in Arabidopsis allowed the
identification of several putative SUMO substrates (Elrouby and
Coupland 2010). Studies in rice and Arabidopsis also revealed that
under abiotic stress conditions there is an accumulation of SUMO
conjugates, pointing for a role of SUMOylation in plant stress
responses (Kurepa et al. 2003; Park et al. 2010).
OsEREBP1 protein accumulation under salt stress was shown to
be related to increased protein synthesis and protein stability. A
slight increase in protein level was observed at 15 min stress
treatment, suggesting that the effect of salt on the TF protein
synthesis is stronger and faster than the repression of de novo
synthesis induced by cycloheximide. Protein stability can be
promoted by post-translational modifications (PTMs), such as
phosphorylation and SUMOylation. The increase in TF stability
through these PTMs was reported in Arabidopsis (Mazzucotelli et al.
2008; Miura and Hasegawa 2010; Rodriguez et al. 2010). The
phosphorylation of bHLH TF SPEECHLESS (SPCH) by MPK6
increased its protein activity and stability (Rodriguez et al. 2010).
Similarly, the conjugation of SUMO to ABI5 promotes its stability and
protects the TF from proteasome-dependent degradation (Miura and
Hasegawa 2010). The exact mechanism responsible for the
increased OsEREBP1 protein stability under salt stress is still
unknown. Nevertheless, the obtained results suggest that two
OsEREBP1 protein forms are present in Arabidopsis cells and one of
the forms corresponds to a post-translational modified protein form.
We have shown that OsEREBP1 protein stability is putatively
regulated by PTMs in high salinity conditions. In addition, other
Chapter IV
139
researchers have previously reported that this TF is phosphorylated
by the protein forms encoded by OsBWMK1L, OsBWMK1M and
OsBWMK1S (Koo et al. 2007). A gene expression analysis indicated
that only OsBWMK1M and OsBWMK1S transcripts are regulated by
stress conditions (Agrawal et al. 2003b). According to these authors,
a strong up-regulation of OsBWMK1S transcript level was detected
under high salt treatment. However, our studies revealed that the
kinase activity of this protein form was not significantly affected by
high salinity, suggesting that OsEREBP1 post-translational regulation
by high salt does not involve this protein form. Further studies need
to be performed to investigate if the other OsBWMK1 protein forms
are involved in the TF regulation under these stress conditions.
OsBWMK1 belongs to the group D of MAPKs characterized by the
presence of an extended C-terminal region, a TDY motif in the
activation loop and the lack of a common docking (CD) domain
(Ichimura et al. 2002; Xue and Liu 2007). The Arabidopsis group D
MAPKs AtMAPK8, AtMAPK16 and AtMAPK18 were analyzed
regarding their kinase activity under salt stress and only AtMAPK16
displayed enhanced activity. A few reports describe the putative
involvement of MAPKs from group D in plant abiotic stress
responses (Agrawal et al. 2003a; Agrawal et al. 2003b; Jammes et
al. 2009; Shi et al. 2011). AtMAPK9 and AtMAPK12 were shown to
function as positive regulators of ABA signaling in guard cells
(Jammes et al. 2009). The cotton GhMPK16 gene expression was
shown to be induced by salt, mannitol and ABA, and its over-
expression reduced drought tolerance in transgenic Arabidopsis (Shi
et al. 2011).
The functional analysis of OsEREBP1-OX plants revealed a role
in high salinity, drought and ABA responses. OsEREBP1-OX over-
expressing plants displayed hypersensitivity to high salinity
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
140
treatments at germination level, whereas no significant differences in
plant survival and root growth were detected at the seedling stage.
This result may be related to the proposed regulation of this TF at
post-translational level under salt stress. Previous reports suggest
that over-expression of TFs regulated at post-translational level may
display a wt phenotype under abiotic stress conditions. DREB2A and
OsDREB2A from Arabidopsis and rice, respectively, were reported to
be stress-responsive genes, but their over-expression in Arabidopsis
only induced little phenotypic alterations (Dubouzet et al. 2003;
Sakuma et al. 2006). DREB2A was shown to be unstable under
normal growth conditions and to stably accumulate when a negative
regulatory domain is deleted from its gene sequence (Sakuma et al.
2006). Over-expression of the DREB2A constitutive active form
resulted in enhanced tolerance to drought stress (Sakuma et al.
2006). In addition, the protein instability under normal growth
conditions was shown to be related to its ubiquitination by DRIP1 and
DRIP2 RING E3 ligases (Qin et al. 2008). OsEREBP1 in silico
analysis predicted that the TF protein sequence contains 8 putative
ubiquitination sites (BDM-PUB program). Thus, OsEREBP1 may be
degraded under normal growth conditions through ubiquitination and
the lack of phenotypic alterations under high salinity treatments may
be due to low OsEREBP1 protein levels in the transgenic seedlings.
Conversely, the effect of salt stress on OsEREBP1-OX seed
germination may partially result from the slight increase in ABA
sensitivity. Abiotic stress conditions, such as high salinity, induce
ABA production, which increases sensitivity to salt during
germination (Xiong and Zhua 2002). OsEREBP1 gene expression
was reported not to be altered by ABA treatments (Chapter 2); but
this TF may be regulated by the hormone through PTMs. The
involvement in hormone responses of genes that are not regulated
Chapter IV
141
by ABA at transcriptional level, has been previously described (Fujita
et al. 2011). AtERF7 gene expression proved to be unaffected by
ABA, but knockdown lines displayed increased sensitivity to the
hormone during germination (Song et al. 2005). The AtERF7-
mediated regulation of ABA response was reported to involve the TF
phosphorylation by PKS3, a protein kinase described as a negative
regulator of ABA responses (Song et al. 2005).
OsEREBP1 putative involvement in ABA responses was further
analyzed through root growth analyses of ABA-treated OsEREBP1-
OX seedlings. Low ABA concentration (1 µM) was shown to affect
root growth of one transgenic line (L3), whereas a higher ABA
concentration (10 µM) affected root growth of all OsEREBP1-OX
seedlings. These results suggest that the transgenic plants are more
sensitive to the ABA inhibitory effect, which is in agreement with the
observed ABA hypersensitivity of the transgenic seeds. These
results suggest that OsEREBP1 have a role in ABA responses.
Gene expression studies revealed that OsEREBP1 is regulated
by drought stress conditions (Chapter 2). To confirm the function of
this gene in the response to water deficit, OsEREBP1-OX seedlings
were treated with PEG. Such treatments are reported to mimic the
conditions imposed by soil drying, which cause water removal from
the cell wall and the protoplast (Verslues et al. 2006). The transgenic
plants L2 and L3 displayed enhanced root growth as compared to wt,
suggesting a role of OsEREBP1 in plant tolerance to drought stress
conditions. However, plant survival was not affected by the PEG
treatment, which may indicate a developmental stage-dependent
function of OsEREBP1 in drought stress responses. Several
adaptation processes to low water availability, such as stomatal
regulation, root growth and compatible solutes accumulation are
regulated by ABA (Verslues et al. 2006). Given that OsEREBP1 may
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
142
play a role in ABA responses, the OsEREBP1 function in drought
stress may be ABA-dependent.
OsEREBP1 and RAP2.2 belong to the CMVII group of ERF
proteins and share high aa sequence identity (87%) within the AP2-
DNA binding domain, but little identity (38%) when considering the
full length aa sequence. The minor homology between AP2/ERF
proteins outside the conserved DNA binding domain has been
previously reported (Gutterson and Reuber 2004). RAP2.2 was
characterized as a putative ortholog of rice SUB1A, an ERF protein
known to play an important function in submergence and drought
stress tolerance (Fukao et al. 2011; Hinz et al. 2010). Despite the low
homology (38%) between SUB1A and RAP2.2, the Arabidopsis
protein was shown to also function in response to hypoxia (Hinz et al.
2010). To investigate whether RAP2.2 and OsEREBP1 have similar
functions in abiotic stress response, rap2.2 mutant lines over-
expressing OsEREBP1 were generated. Root growth assays
revealed that rap2.2 seedlings are less affected by drought stress
compared to wt, suggesting that RAP2.2 negatively regulates the
response to this abiotic stress condition. However, no phenotypic
complementation was observed when seedlings were subjected to
water deficit induced by PEG, indicating that OsEREBP1 role in
drought stress responses differs from that of RAP2.2. This was an
expected result, as, in contrast to RAP2.2, OsEREBP1 was shown
(this study) to act as a positive regulator of drought stress. No root
phenotype complementation was detected under high salinity
treatments, suggesting that RAP2.2. and OsEREBP1 have different
functions in response to salt stress.
This study demonstrated that OsEREBP1 is involved in abiotic
stress responses, namely salt and drought stress, and that its
Chapter IV
143
function is associated with ABA signaling. Given that OsEREBP1 is
known to bind to the promoter of OsRMC, a salt-induced gene, it
would be important to investigate how OsRMC is regulated by salt
stress in the absence of OsEREBP1. In addition, it would be
interesting to identify other genes regulated by OsEREBP1
ACKNOWLEDGMENTS
Tânia Serra carried out the experimental work with the
collaboration of André Cordeiro, who contributed to the studies with
the Arabidopsis transgenic plants. The planning of the research work
and discussion of results was performed by Tânia Serra, Laszlo
Bögre, Nelson Saibo and M. Margarida Oliveira. We would like to
acknowledge Laszlo Bögre lab for providing the Arabidopsis cell
culture and the MAPKs constructs.
REFERENCES
Agarwal PK, Jha B (2010) Transcription factors in plants and ABA
dependent and independent abiotic stress signalling. Biol Plantarum 54:
201-212
Agrawal GK, Agrawal SK, Shibato J, Iwahashi H, Rakwal R (2003a) Novel
rice MAP kinases OsMSRMK3 and OsWJUMK1 involved in
encountering diverse environmental stresses and developmental
regulation. Biochem Biophys Res Commun 300: 775-783
Agrawal GK, Tamogami S, Iwahashi H, Agrawal VP, Rakwal R (2003b)
Transient regulation of jasmonic acid-inducible rice MAP kinase gene
(OsBWMK1) by diverse biotic and abiotic stresses. Plant Physiol
Biochem 41 355-361
Alves VS, Pimenta DC, Sattlegger E, Castilho BA (2004) Biophysical
characterization of Gir2, a highly acidic protein of Saccharomyces
cerevisiae with anomalous electrophoretic behavior. Biochem Biophys
Res Commun 314: 229-234
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
144
Bhatnagar-Mathur P, Vadez V, Sharma KK (2008) Transgenic approaches
for abiotic stress tolerance in plants: retrospect and prospects. Plant Cell
Rep 27: 411-424
Bogre L, Calderini O, Binarova P, Mattauch M, Till S, Kiegerl S, Jonak C,
Pollaschek C, Barker P, Huskisson NS, Hirt H, Heberle-Bors E (1999) A
MAP kinase is activated late in plant mitosis and becomes localized to
the plane of cell division. Plant Cell 11: 101-113
Century K, Reuber TL, Ratcliffe OJ (2008) Regulating the regulators: the
future prospects for transcription-factor-based agricultural biotechnology
products. Plant Physiol 147: 20-29
Cheng C, Yun KY, Ressom HW, Mohanty B, Bajic VB, Jia Y, Yun SJ, de los
Reyes BG (2007) An early response regulatory cluster induced by low
temperature and hydrogen peroxide in seedlings of chilling-tolerant
japonica rice. BMC Genomics 8: 175
Cheong YH, Moon BC, Kim JK, Kim CY, Kim MC, Kim IH, Park CY, Kim JC,
Park BO, Koo SC, Yoon HW, Chung WS, Lim CO, Lee SY, Cho MJ
(2003) BWMK1, a rice mitogen-activated protein kinase, locates in the
nucleus and mediates pathogenesis-related gene expression by
activation of a transcription factor. Plant Physiol 132: 1961-1972
Clough SJ, Bent AF (1998) Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J
16: 735-743
Dietz KJ, Vogel MO, Viehhauser A (2010) AP2/EREBP transcription factors
are part of gene regulatory networks and integrate metabolic, hormonal
and environmental signals in stress acclimation and retrograde
signalling. Protoplasma 245: 3-14
Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, Seki M,
Shinozaki K, Yamaguchi-Shinozaki K (2003) OsDREB genes in rice,
Oryza sativa L., encode transcription activators that function in drought-,
high-salt- and cold-responsive gene expression. Plant J 33: 751-763
Elrouby N, Coupland G (2010) Proteome-wide screens for small ubiquitin-
like modifier (SUMO) substrates identify Arabidopsis proteins implicated
Chapter IV
145
in diverse biological processes. Proc Natl Acad Sci USA 107: 17415-
17420
Fujita Y, Fujita M, Shinozaki K, Yamaguchi-Shinozaki K (2011) ABA-
mediated transcriptional regulation in response to osmotic stress in
plants. J Plant Res 124: 509-525
Fukao T, Yeung E, Bailey-Serres J (2011) The submergence tolerance
regulator SUB1A mediates crosstalk between submergence and drought
tolerance in rice. Plant Cell 23: 412-427
Graceffa P, Jancso A, Mabuchi K (1992) Modification of acidic residues
normalizes sodium dodecyl sulfate-polyacrylamide gel electrophoresis of
caldesmon and other proteins that migrate anomalously. Arch Biochem
Biophys 297: 46-51
Gutterson N, Reuber TL (2004) Regulation of disease resistance pathways
by AP2/ERF transcription factors. Curr Opin Plant Biol 7: 465-471
Hinz M, Wilson IW, Yang J, Buerstenbinder K, Llewellyn D, Dennis ES,
Sauter M, Dolferus R (2010) Arabidopsis RAP2.2: an ethylene response
transcription factor that is important for hypoxia survival. Plant Physiol
153: 757-772
Ichimura K, Shinozaki K, Tena G, Sheen J, Henry Y, Champion A, Kreis M,
Zhang SQ, Hirt H, Wilson C, Heberle-Bors E, Ellis BE, Morris PC, Innes
RW, Jr E, Scheel D, Klessig DF, Machida Y, Mundy J, Ohashi Y, Walker
JC, Grp M (2002) Mitogen-activated protein kinase cascades in plants: a
new nomenclature. Trends Plant Sci 7: 301-308
Jammes F, Song C, Shin D, Munemasa S, Takeda K, Gu D, Cho D, Lee S,
Giordo R, Sritubtim S, Leonhardt N, Ellis BE, Murata Y, Kwak JM (2009)
MAP kinases MPK9 and MPK12 are preferentially expressed in guard
cells and positively regulate ROS-mediated ABA signaling. Proc Natl
Acad Sci USA 106: 20520-20525
Jung KH, Seo YS, Walia H, Cao P, Fukao T, Canlas PE, Amonpant F,
Bailey-Serres J, Ronald PC (2010) The submergence tolerance
regulator Sub1A mediates stress-responsive expression of AP2/ERF
transcription factors. Plant Physiol 152: 1674-1692
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
146
Karlson DT, Chaikam V (2010) Response and transcriptional regulation of
rice SUMOylation system during development and stress conditions.
Bmb Rep 43: 103-109
Knight H, Knight MR (2001) Abiotic stress signalling pathways: specificity
and cross-talk. Trends Plant Sci 6: 262-267
Koo SC, Yoon HW, Kim CY, Moon BC, Cheong YH, Han HJ, Lee SM, Kang
KY, Kim MC, Lee SY, Chung WS, Cho MJ (2007) Alternative splicing of
the OsBWMK1 gene generates three transcript variants showing
differential subcellular localizations. Biochem Bioph Res Co 360: 188-
193
Krause K, Krupinska K (2009) Nuclear regulators with a second home in
organelles. Trends Plant Sci 14: 194-199
Kurepa J, Walker JM, Smalle J, Gosink MM, Davis SJ, Durham TL, Sung
DY, Vierstra RD (2003) The small ubiquitin-like modifier (SUMO) protein
modification system in Arabidopsis. Accumulation of SUMO1 and -2
conjugates is increased by stress. J Biol Chem 278: 6862-6872
Liu LS, White MJ, MacRae TH (1999) Transcription factors and their genes
in higher plants - Functional domains, evolution and regulation. Eur J
Biochem 262: 247-257
Magnani E, Sjolander K, Hake S (2004) From endonucleases to
transcription factors: evolution of the AP2 DNA binding domain in plants.
Plant Cell 16: 2265-2277
Magyar Z, De Veylder L, Atanassova A, Bako L, Inze D, Bogre L (2005) The
role of the Arabidopsis E2FB transcription factor in regulating auxin-
dependent cell division. Plant Cell 17: 2527-2541
Mahajan S, Tuteja N (2005) Cold, salinity and drought stresses: an
overview. Arch Biochem Biophys 444: 139-158
Mazzucotelli E, Mastrangelo AM, Crosatti C, Guerra D, Stanca AM,
Cattivelli L (2008) Abiotic stress response in plants: when post-
transcriptional and post-translational regulations control transcription.
Plant Sci 174: 420-431
Miura K, Hasegawa PM (2010) Sumoylation and other ubiquitin-like post-
translational modifications in plants. Trends Cell Biol 20: 223-232
Chapter IV
147
Mori H, Shimizu-Sato S, Ike Y (2008) PsRBR1 encodes a pea
retinoblastoma-related protein that is phosphorylated in axillary buds
during dormancy-to-growth transition. Plant Mol Biol 66: 125-135
Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of
the ERF gene family in Arabidopsis and rice. Plant Physiol 140: 411-432
Nakashima K, Ito Y, Yamaguchi-Shinozaki K (2009) Transcriptional
regulatory networks in response to abiotic stresses in Arabidopsis and
grasses. Plant Physiol 149: 88-95
Newton AC, Johnson SN, Gregory PJ (2011) Implications of climate change
for diseases, crop yields and food security. Euphytica 179: 3-18
Pardo JM (2010) Biotechnology of water and salinity stress tolerance. Curr
Opin Biotech 21: 185-196
Park HC, Kim H, Koo SC, Park HJ, Cheong MS, Hong H, Baek D, Chung
WS, Kim DH, Bressan RA, Lee SY, Bohnert HJ, Yun DJ (2010)
Functional characterization of the SIZ/PIAS-type SUMO E3 ligases,
OsSIZ1 and OsSIZ2 in rice. Plant Cell Environ 33: 1923-1934
Qin F, Sakuma Y, Tran LS, Maruyama K, Kidokoro S, Fujita Y, Fujita M,
Umezawa T, Sawano Y, Miyazono K, Tanokura M, Shinozaki K,
Yamaguchi-Shinozaki K (2008) Arabidopsis DREB2A-interacting
proteins function as RING E3 ligases and negatively regulate plant
drought stress-responsive gene expression. Plant Cell 20: 1693-1707
Rodriguez MC, Petersen M, Mundy J (2010) Mitogen-activated protein
kinase signaling in plants. Annu Rev Plant Biol 61: 621-649
Saibo NJ, Lourenco T, Oliveira MM (2009) Transcription factors and
regulation of photosynthetic and related metabolism under
environmental stresses. Ann Bot 103: 609-623
Sakuma Y, Maruyama K, Osakabe Y, Qin F, Seki M, Shinozaki K,
Yamaguchi-Shinozaki K (2006) Functional analysis of an Arabidopsis
transcription factor, DREB2A, involved in drought-responsive gene
expression. Plant Cell 18: 1292-1309
Santos AP, Serra T, Figueiredo DD, Barros P, Lourenco T, Chander S,
Oliveira MM, Saibo NJ (2011) Transcription regulation of abiotic stress
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
148
responses in rice: a combined action of transcription factors and
epigenetic mechanisms. OMICS 15: 839-857
Seo YS, Chern M, Bartley LE, Han M, Jung KH, Lee I, Walia H, Richter T,
Xu X, Cao P, Bai W, Ramanan R, Amonpant F, Arul L, Canlas PE, Ruan
R, Park CJ, Chen X, Hwang S, Jeon JS, Ronald PC (2011) Towards
establishment of a rice stress response interactome. PLoS Genet 7:
e1002020
Shi J, Zhang L, An H, Wu C, Guo X (2011) GhMPK16, a novel stress-
responsive group D MAPK gene from cotton, is involved in disease
resistance and drought sensitivity. BMC Mol Biol 12: 22
Song CP, Agarwal M, Ohta M, Guo Y, Halfter U, Wang P, Zhu JK (2005)
Role of an Arabidopsis AP2/EREBP-type transcriptional repressor in
abscisic acid and drought stress responses. Plant Cell 17: 2384-2396
Stumpo DJ, Graff JM, Albert KA, Greengard P, Blackshear PJ (1989)
Molecular cloning, characterization, and expression of a cDNA encoding
the "80- to 87-kDa" myristoylated alanine-rich C kinase substrate: a
major cellular substrate for protein kinase C. Proc Natl Acad Sci USA 86:
4012-4016
Teige M, Scheikl E, Eulgem T, Doczi R, Ichimura K, Shinozaki K, Dangl JL,
Hirt H (2004) The MKK2 pathway mediates cold and salt stress signaling
in Arabidopsis. Mol Cell 15: 141-152
Verslues PE, Agarwal M, Katiyar-Agarwal S, Zhu J, Zhu JK (2006) Methods
and concepts in quantifying resistance to drought, salt and freezing,
abiotic stresses that affect plant water status. Plant J 45: 523-539
Vij S, Tyagi AK (2007) Emerging trends in the functional genomics of the
abiotic stress response in crop plants. Plant Biotechnol J 5: 361-380
Xiong L, Zhua J-K (2002) Salt tolerance. The Arabidopsis Book The
American Society of Plant Biologists
Xue QZ, Liu QP (2007) Computational identification and phylogenetic
analysis of the MAPK gene family in Oryza sativa. Plant Physiol
Biochem 45: 6-14
Chapter IV
149
Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcriptional regulatory
networks in cellular responses and tolerance to dehydration and cold
stresses. Annu Rev Plant Biol 57: 781-803
Yi SY, Kim JH, Joung YH, Lee S, Kim WT, Yu SH, Choi D (2004) The
pepper transcription factor CaPF1 confers pathogen and freezing
tolerance in Arabidopsis. Plant Physiol 136: 2862-2874
Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2009) Identification
of an apoplastic protein involved in the initial phase of salt stress
response in rice root by two-dimensional electrophoresis. Plant Physiol
149: 916-928
OsEREBP1 encodes an AP2/ERF transcription factor involved in high salinity, drought and ABA responses
150
Chapter V
151
OsEREBP2 is a multifunctional AP2/ERF transcription
factor mediating abiotic stress and hormone signaling
pathways
Chapter V
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
152
TABLE OF CONTENTS – CHAPTER V
Abstract ....................................................................................... 153
Introduction ................................................................................. 154
Material and Methods ................................................................. 157
Plant material and growth conditions ........................................... 157
Construction of plasmids ............................................................. 158
OsEREBP2 subcellular localization ............................................. 159
Arabidopsis transformation and abr1 complementation assays ... 160
Gene expression analysis by semi-quantitative reverse transcription-PCR (RT-PCR) ....................................................... 162
Results ......................................................................................... 162
OsEREBP2 is dispersed throughout the cell ............................... 162
Arabidopsis plants over-expressing OsEREBP2 show a hormone-related phenotype ........................................................ 165
OsEREBP2 over-expression modulates the expression of genes involved in plant development and hormone signaling ...... 166
OsEREBP2 gene promoter region contains cis-elements involved in ABA-, auxin- and cytokinin- responsiveness .............. 168
OsEREBP2 and ABR1 have similar functions ............................. 170
Discussion ................................................................................... 172
Acknowledgments ...................................................................... 181
References .................................................................................. 181
Chapter V
153
ABSTRACT
Plant growth and development are highly affected by different
abiotic stresses, leading to high losses in crop productivity. The
integration of stress responses with developmental programs
involves several transcription factors (TFs) that can function as
integrators of internal and external stimuli. OsEREBP2 encodes a
multifunctional TF that belongs to the AP2/ERF family and it was
previously described as a putative regulator of high salinity, drought,
cold and ABA responses in rice. Using a transient expression assay,
we have shown that, under high salinity, GFP::OsEREBP2, in
addition to the nucleus, also accumulates in spot-like structures
dispersed within the cell. In addition, Arabidopsis plants over-
expressing OsEREBP2 revealed that this regulatory protein may
have a role in hormone mediated plant developmental processes.
The transgenic plants showed abnormal phenotype responses to
auxin and/or cytokinin and deregulation of genes involved in the
primary responses to these hormones. Moreover, in these transgenic
plants, genes involved in the maintenance and function of the shoot
apical meristem (SAM) were also up-regulated, suggesting a role for
OsEREBP2 in the SAM developmental processes. The identification
of several cis-elements responsive to cytokinins, auxins and ABA at
the promoter of OsEREBP2 further indicated that the expression of
this gene may be regulated by these hormones. Complementation
studies revealed that OsEREBP2 heterologous expression can
rescue the abr1 germination phenotype both under high salinity and
ABA treatments, suggesting a function similar to that of ABR1.
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
154
INTRODUCTION
Plants are continuously exposed to changes in the environment
which can negatively affect their growth and development, resulting
in significant reductions in crop yield worldwide (Ahuja et al. 2010).
To cope with adverse environmental conditions, plants adjust their
growth and development according to external stimuli (Peleg and
Blumwald 2011). High salinity and drought stress conditions are well
known to cause growth retardation, affecting particularly leaf growth
and shoot development (Munns and Tester 2008). Moreover, low
temperatures severely affect reproductive development, causing
pollen and ovule infertility and decreasing the rate of seed filling,
ultimately leading to lower grain yield (Nayyar et al. 2010).
Plant hormones are involved in the integration of environmental
signals in the endogenous developmental programs (Jaillais and
Chory 2010; Santner and Estelle 2009). Among others, abscisic acid
(ABA), cytokinins and auxins are hormones with a direct or indirect
role in abiotic stress responses (Peleg and Blumwald 2011). ABA
plays important roles in several developmental processes and
adaptive stress responses (Raghavendra et al. 2010). This hormone
is involved in the regulation of seed development and stomatal
aperture (Hubbard et al. 2010; Raghavendra et al. 2010; Xue-Xuan
et al. 2010). ABA is synthesized in response to several stress
conditions and is able to coordinate the expression of several stress-
responsive genes (Hubbard et al. 2010; Xue-Xuan et al. 2010).
Drought and high salinity result in high ABA levels, which will
promote stomatal closure and accumulation of osmoprotectants,
enabling plants to adapt to water deficit conditions (Hubbard et al.
2010; Raghavendra et al. 2010). Cold stress also induces ABA
accumulation but to a lower level (Xue-Xuan et al. 2010). The ABA
Chapter V
155
role in cold stress responses is not fully understood, however, it has
been suggested to be related with freezing tolerance, which involves
the induction of drought stress-responsive genes (Mahajan and
Tuteja 2005; Xue-Xuan et al. 2010). Auxins and cytokinins are
master regulators of plant development and mutually regulate their
signaling pathways and metabolism (Moubayidin et al. 2009). These
hormones can regulate the biosynthesis of each other in order to
maintain optimal hormone levels for developmental and
environmental responses (Jones et al. 2010). Auxins are involved in
root and shoot architecture, flower organ development and in abiotic
stress responses (Chapman and Estelle 2009; Zhang et al. 2009b).
Environmental signals were shown to differentially regulate auxin
biosynthesis depending on the plant species (Acharya and Assmann
2009; Zhao 2010). In rice, auxin concentration decreases under
drought stress, promoting the expression of LEA (Late
Embryogenesis Abundant) genes involved in drought tolerance
acquisition (Zhang et al. 2009b). Cytokinins are regulators of leaf
senescence, apical dominance, shoot differentiation and root
proliferation (Hirose et al. 2007; Hirose et al. 2008; Kudo et al. 2010).
This hormone has also been described as a negative regulator of
abiotic stress responses, probably through the repression of stress-
responsive genes (Nishiyama et al. 2011). Cytokinin production was
shown to decrease in response to water deficit conditions and this
decrease enhances ABA sensitivity, thus leading to enhanced
tolerance to stress conditions (Nishiyama et al. 2011; Rivero et al.
2009).
The coordination of hormone and abiotic stress signaling
pathways allows a balance between plant development and the
response to stress stimuli (Peleg and Blumwald 2011). The
integration of internal and external stimuli responses was suggested
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
156
to occur at transcriptome level, rather than by cross-talk during signal
transduction, and the transcription factors (TFs) may be the key
integrators of these responses (Jaillais and Chory 2010). PIF4
encodes a bHLH (basic Helix-Loop-Helix) TF protein involved in plant
responses to light and high temperature (Duek and Fankhauser
2005; Koini et al. 2009). Studies with the pif4 mutant revealed that
this TF may be a regulator of the auxin-mediated signaling pathway
controlling the developmental adaptations that occur under high
temperature conditions (Koini et al. 2009). The AP2/ERF family of
TFs comprises proteins involved in biotic and abiotic stress
responses, but also in hormone regulation (Dietz et al. 2010). The
presence of the highly conserved AP2 DNA-binding domain
characterizes these regulatory proteins. A member of this family,
CAP2, was identified in chickpea and shown to be induced by
drought, high salinity, ABA and auxin treatments (Shukla et al. 2006).
In addition, tobacco plants over-expressing CAP2 displayed
improved tolerance to drought and salt stress conditions, as well as
higher levels of auxin-responsive genes, in comparison with wt
plants. Therefore, this regulatory protein was proposed to be
involved in both abiotic stress and auxin signaling pathways.
OsEREBP2 is an AP2/ERF protein with a single AP2 DNA-binding
domain and predicted to belong to the Xa group of ERF proteins due
to the presence of a CMX-1-like motif (Chapter 2) (Nakano et al.
2006). OsEREBP2 gene expression was shown to be highly induced
by cold (5ºC and 10ºC), drought, high salinity, and ABA treatment,
indicating that this TF modulates rice responses to different abiotic
stress conditions (Chapter 2). In addition, OsEREBP2 was shown to
bind to the promoter and regulate the expression of OsRMC (rice
Root Meander Curling) (Chapters 2 and 3). OsRMC encodes a
receptor-like kinase that functions as a negative regulator of salt
Chapter V
157
stress responses (Zhang et al. 2009a). OsRMC knockdown lines
displayed enhanced tolerance to high salinity conditions and higher
levels of transcripts from stress-responsive genes. OsEREBP2 was
also proposed to be involved in biotic stress responses due to the
observed transcript up-regulation in rice plants treated with a
functional analog of salicylic acid, benzothiadiazole (Shimono et al.
2007). Given that salicylic acid (SA) mediates plant response against
pathogens, OsEREBP2 may be involved in rice response to
pathogen infection.
The Arabidopsis ABR1 is an OsEREBP2 orthologue. It is also
member of the Xa group of ERF proteins and it was shown to be
involved in biotic and abiotic stress responses, as well as in hormone
signaling pathways. ABR1 transcript levels accumulated under cold,
high salinity, drought and ABA treatments (Pandey et al. 2005). In
addition, knock-out mutants displayed hypersensitivity to osmotic
stress induced by high salinity and mannitol, and increased
expression of ABA-regulated genes (Pandey et al. 2005). The mutant
also showed enhanced susceptibility to pathogen infection (Hwang
and Choi 2011).
OsEREBP2 has been described as a multifunctional protein with a
putative role in biotic and abiotic stress responses. This study
revealed that OsEREBP2 may play a role in hormonal signaling and
plant development. In addition, it showed that OsEREBP2 may have
a similar function to the ABR1 gene from Arabidopsis.
MATERIAL AND METHODS
Plant material and growth conditions
Arabidopsis thaliana ecotype Columbia (Col-0) and the abr1
mutant (SALK_012151) were used in this study. Seedlings were
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
158
germinated and grown in the greenhouse under long-day conditions
(16 h/8 h, light/dark) until reaching the flowering stage for plant
transformation. Seeds were surface-sterilized in a solution of 1.5%
sodium hypochloride containing 0.1% Tween-20 as described in
Chapter 4 and stratified at 4ºC for 3 d. After sown in Murashige and
Skoog (MS) medium containing 1% sucrose and 2.6 mM MES buffer,
the seeds were transferred to a growth chamber at 22ºC and 40
µmol m-2 s-1 of light. Transgenic plants over-expressing OsEREBP2
were not transferred to soil due to the abnormal phenotype observed
and were then maintained in the described growth medium.
Construction of plasmids
OsEREBP2 coding sequence was isolated from rice cDNA
prepared as described in Chapter 2. Total RNA was extracted from
14 days-old seedlings with the RNeasy Plant Mini kit (Qiagen,
Courtaboeuf, France) and cDNA was synthesized following the
instructions of the Transcriptor High Fidelity cDNA Synthesis kit
(Roche, Basel, Switzerland). OsEREBP2 sequence was amplified
with the PhusionTM high-fidelity DNA polymerase (Finnzymes,
Vantaa, Finland) in the presence of 1 M Betaine and 2.5% DMSO,
using the GW-OsEREBP2-Fw/-Rv primers (Table 1). The amplified
fragment was cloned into the entry vector pDONR221 with the BP
recombinase and subsequently transferred to the destination vectors
through the LR recombinase, according to the manufacturer’s
instructions (Invitrogen, CA, USA). The destination vectors
pH7WGF2 and pEarleyGate201 were used to obtain the
GFP::OsEREBP2 and the 35S::HA::OsEREBP2 constructs,
respectively. To generate the construct for phenotypic
complementation, the CaMV35S promoter was removed from the
35S::HA::OsEREBP2 construct through restriction with EcoRI-XhoI
Chapter V
159
and replaced by the ABR1 promoter (2453 bp upstream the start
codon). The ABR1 promoter fragment was isolated from Col-0
genomic DNA extracted with the QuickExtractTM Plant DNA
Extraction Solution (Epicentre, Madison, USA) following the
manufacturer’s instructions. Amplification was performed with the
PhusionTM high-fidelity DNA polymerase and the specific primers
ProABR-Fw/-Rv (Table 1). The ProABR::OsEREBP2 construct was
sequenced with ProABR-Fw/-Rv and the internal primers
ProABRmid-Fw/-Rv (Table 1).
OsEREBP2 subcellular localization
Onion epidermis cell layers were bombarded with 1 µm gold
microparticles coated with 1.6 or 1.2 µg of 35S::GFP (pH7WGF2
vector) or GFP::OsEREBP2 constructs, respectively. DNA-coating
was performed with spermidine (0.1 M) and CaCl2 (2.5 M) and the
prepared particles were bombarded using a particle gun-mediated
system (PSD-1000/HE, Bio-Rad, CA, USA). Bombarded tissues
were then incubated overnight under dark conditions on filter paper
soaked in sterile water. The epidermal cell layers were incubated
with or without 500 mM NaCl solution and stained with DAPI (17 µM)
(Sigma-Aldrich, Gillingham Dorset, UK). Images were taken with a
Nikon TE300 microscope under different light fields. OsEREBP2
subcellular localization was also analyzed in Arabidopsis protoplasts.
Protoplast isolation from Arabidopsis suspension cells (Col-0
ecotype) was performed as described in Chapter 3. The protoplasts
were transfected with 5 µg 35S::GFP or 8 µg GFP::OsEREBP2 by
the polyethylene glycol-mediated process previously described
(Chapter 3) and incubated overnight in the dark at 22ºC. Protoplast
samples were also treated with 500 mM NaCl. Confocal optical
section stacks were collected with a Leica TCS SP inverted laser
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
160
scanning confocal microscope (Leica Heidelberg GmbH, Mannheim,
Germany) equipped with a krypton and an argon laser. The
microscopy data was recorded and then transferred to the Image J
software and composite using Adobe Photoshop.
Arabidopsis transformation and abr1 complementation assays
Agrobacterium-mediated transformation of Arabidopsis plants
(ecotype Col-0) was carried out by the floral dip method (Clough and
Bent 1998). Col-0 plants were transformed using an Agrobacterium
(strain LBA4404) culture containing the 35S::HA::OsEREBP2
construct. The seeds were sown on MS medium containing 1%
sucrose, 2.6 mM MES buffer, 0.1 mM BASTA and 0.2 mM
cefotaxime and the transformed seedlings (survivors) were
transferred to MS medium supplemented with 1% sucrose and 2.6
mM MES buffer. Transgene expression was analyzed by semi-
quantitative RT-PCR. The Arabidopsis knockout mutant abr1
(SALK_012151) was obtained from the Nottingham Arabidopsis
Stock Centre (NASC, Loughborough, UK). Homozygous mutant
plants were isolated and the suppression of ABR1 expression was
confirmed by RT-PCR with the ABR1-Fw/-Rv primers (Table 1). To
obtain abr1/OsEREBP2 transgenic plants, homozygous mutant
plants were transformed with an Agrobacterium culture carrying the
35S::HA::OsEREBP2 or the ProABR::HA::OsEREBP2 constructs by
the floral dip method. ABR::OsEREBP2 homozygous plants (T2)
were obtained as described in Chapter 4. T0 seeds were screened in
selective medium and ten T1 resistant seedlings were transferred to
soil to produce seeds. The transgene expression was analyzed with
the GW-OsEREBP2-Fw/-Rv primers. Phenotypic complementation of
the abr1 mutant was analyzed through seed germination studies
performed as described in Chapter 4. Approximately 40 seeds from
Chapter V
161
wt, abr1 mutants and ABR::OsEREBP2 plants were plated in
triplicate on MS medium with or without 150 mM NaCl or 0.7 µM
ABA. Germination (emergence of radicles) was scored daily for 6
days.
Table 1. Oligonucleotide sequences used for the cloning procedures and
gene expression studies. The underlined region corresponds to the
Gateway recombination sequences and the remaining region is specific to
the target DNA.
Primer name Primer sequence 5´- 3´
GW-OsEREBP2-Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTATATGACGGTGGCGGGGGCGTCGGAGCT
GW-OsEREBP2-Rv GGGGACCACTTTGTACAAGAAAGCTGGGTGGACAGAATCCGGCGGCTACTGCGTGTGC
PEPINO/PAS2-Fw TGCTCAGACTGCCGCCGTTC
PEPINO/PAS2-Rv CGCTGGTGATACCGGTAGGGT
KNAT2-Fw GGCTAGGGATCGAAGAAGCGGC
KNAT2-Rv TGGCTGTCATCCGCTGCTATGT
ARR5-Fw CTACTCTTCTTGATATGGCTGAG
ARR5-Rv TATCGTACGTGGAATCTGATAAAC
IAA4-Fw ATGGAAAAAGTTGATGTTTATGATGAGCT
IAA4-Rv AAGACCACCACAACCTAAACCTTTAACTTC
ABR1-Fw GCGGTGAAGGTAGCGGAGAA
ABR1-Rv TGTCGAACGTACCGAGCCAA
ProABR1-Fw ATGAATTCGTGGCCACAGTTTCCAGAAT
ProABR1-Rv ATCTCGAGCAAAACCCTCCTTCTAAATCCTC
ProABR1mid -Fw AATCTGCGACTTTTTAACAATACGA
ProABR1mid -Rv TTCGCCCGAATCGAGTCTAATA
Actin-Fw GGCGATGAAGCTCAATCCAAACG
Actin-Rv GGTCACGACCAGCAAGATCAAGACG
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
162
Gene expression analysis by semi-quantitative reverse transcription-
PCR (RT-PCR)
Total RNA was extracted according to the instructions of the
RNeasy Plant Mini kit (Qiagen, Courtaboeuf, France). cDNA was
synthesized from 0.5-1 µg of total RNA using the Transcriptor High
Fidelity cDNA Synthesis kit (Roche, Base Switzerland) following the
manufacturer’s instructions. PCR reactions were performed with
gene specific primers for PEPINO/PAS2 (At5g10480), KNAT2
(At1g70510), ARR5 (At3g48100) and IAA4 (At5g43700) (Table 1).
Controls were carried out with primers for Actin (At2g37620) (Table
1).
RESULTS
OsEREBP2 is dispersed throughout the cell
To assess OsEREBP2 subcellular localization, onion epidermal
cells were bombarded with the GFP::OsEREBP2 construct and
incubated under dark conditions. The TF was mainly localized in the
nucleus, while the GFP protein was dispersed between the nucleus
and the cytosol (Figure 1).
Chapter V
163
Figure 1. Cellular localization of OsEREBP2. Onion epidermal tissues were
bombarded with the indicated constructs. After bombardment the tissues
were incubated overnight under dark conditions and stained with DAPI.
Photographs were taken under different light fields and merged images
were prepared in the Image J software Scale bars ≈ 100 µm.
The subcellular distribution of OsEREBP2 was also analyzed in
Arabidopsis protoplasts transfected with the GFP::OsEREBP2
construct. Under control conditions, the fusion protein was
predominantly localized in the nucleus being also observed a few
spots in the cytosol (Figure 2A). Under salt stress, OsEREBP2 was
strongly located in the nucleus and many spot-like structures were
dispersed within the cell (Figure 2D).
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
164
Figure 2. OsEREBP2 cellular localization in Arabidopsis protoplasts
transfected with plasmids expressing the fusion protein GFP::OsEREBP2
(A-F) or the GFP protein (G-L). Fluorescence images were taken with a
confocal laser scanning microscope. Confocal image stacks were recorded
with a section spacing of 1 µm and projections of consecutive confocal
sections are shown. GFP fluorescence was excited with the argon laser
(488 nm) and detected at 512 nm to 520 nm (A, D, G, J). Bright field images
are shown in B, E, H, K. Merged images (C, F, I, L) were prepared with the
Image J software. Scale bars = 5 µm.
Chapter V
165
Arabidopsis plants over-expressing OsEREBP2 show a hormone-
related phenotype
To characterize OsEREBP2 biological function, Arabidopsis
plants over-expressing the TF (OsEREBP2-OX-L1 to L5) were
generated and studied. The gene expression analysis confirmed that
the five independent lines had high expression of the transgene
(Figure 4). The transgenic seedlings displayed a relatively normal
phenotype during the first 20 days after germination (Figures 3D,
3E). The plants were afterwards transferred to growth medium,
without selection, instead of soil due to the abnormal phenotypes
observed. Forty-three days after germination, L1 cultures displayed
several narrow leaves and short roots (Figure 3A). Callus-like tissues
and vitreous leaves were continuously formed during the following
months (Figure 3F). The cultures of L1, propagated in hormone-free
medium, were composed of a mixture of green and white calli and
were not able to form roots. By month 13 the cultures were
considered dead due to the brownish appearance of the callus-like
structures and the lack of new leaves. The transgenic cultures L2
and L3 displayed a more severe phenotype (Figures 3B, 3C), which
is correlated with the higher level of OsEREBP2 (Figure 4). After
germination the seedlings de-differentiate into callus-like tissues and
did not form leaves or roots. Fifty days after germination these
tissues exhibited a brownish appearance and were not able to
propagate in hormone-free medium. OsEREBP2-OX cultures L4
displayed a phenotype similar to L1 with callus-like tissues, several
leaves and few roots (Figure 3G). The leaves were less vitreous than
in the L1 and the callus-like tissues also propagated in hormone-free
medium. Stems and flowers developed ectopically from the callus-
like tissues (L4) 251 days after germination (Figure 3I). Two seeds
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
166
were able to mature although the majority of the flowers were sterile.
The seeds were germinated and the seedlings developed several
leaves and short stems with several flowers. The cultures L5 showed
a bushy rosette composed of leaves with a relatively normal shape
(Figure 3H). De-differentiation to callus-like tissues with a brownish
appearance was observed 120 days after germination and no new
leaves were formed during the following weeks.
Figure 3. Phenotype of Arabidopsis plants over-expressing OsEREBP2.
Lines: L1 (A, F), L2 (B), L3 (C), L4 (D, G, I), L5 (E, H). Plants were
photographed 43 days (A-C), 20 days (D, E), 329 days (F), 222 days (G),
59 days (H) and 251 days (I) after germination. Scale bars ≈ 30 mm.
OsEREBP2 over-expression modulates the expression of genes
involved in plant development and hormone signaling
To investigate the putative role of OsEREBP2 in plant
development and hormone signaling, the expression patterns of
specific genes was analyzed in OsEREBP2-OX plants. The
PEPINO/PAS2 gene expression was analyzed due to the high
similarity between the phenotype of OsEREBP2-OX plants and the
PEPINO/PAS2 mutants (Torres-Ruiz et al. 2002). All the transgenic
Chapter V
167
plants showed a clear decrease in PEPINO/PAS2 transcript level as
compared to wt (Col-0) (Figure 4). The KNAT2 gene encodes a class
I KNOX protein involved in plant development (Pautot et al. 2001). A
higher accumulation of the KNAT2 transcript was detected in the
transgenic lines L1-L4, but no correlation was observed between the
KNAT2 and OsEREBP2 transcript levels (Figure 4).
Figure 4. Expression analysis in wt (Col-0) and OsEREBP2-OX plants.
Total RNA was isolated from 43 (L1-L3) or 110 (L4, L5) days-old transgenic
plants and from wt plants with the second pair of leaves well expanded. RT-
PCR was performed with the primers indicated in Table 1. Actin was used
as internal control. The Image J program was used to determine the
normalized gene expression ratio.
The shoot and root phenotype of OsEREBP2-OX plants suggests
a deregulation of auxin and/or cytokinin responses. To characterize
OsEREBP2 role in hormone signaling, the expression pattern of
genes involved in cytokinin and auxin primary responses was
analyzed. ARR5 encodes a type-A ARR implicated in cytokinin
primary responses (To et al. 2007). Most transgenic plants showed a
decrease in ARR5 transcript as compared to wt. A lower level of
ARR5 transcript was observed in L2 and L3 transgenic plants, which
correlates with the highest OsEREBP2 transcript level, and the
strongest phenotype (Figure 4). The deregulation of ARR5
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
168
expression indicates that OsEREBP2 may have a role in cytokinin
primary responses. To characterize OsEREBP2 role in auxin primary
responses, the expression pattern of the Aux/IAA (AUXIN/INDOLE-3-
ACETIC ACID) gene IAA4 was analyzed (Figure 4). A significant
decrease in IAA4 gene expression was detected in all transgenic
compared to wt plants (Figure 4). The decrease of IAA4 transcript
accumulation in L2 and L3, correlated with the plant phenotype and
OsEREBP2 expression level, suggests that OsEREBP2 promotes
auxin responses through repression of IAA4. In fact, two Ethylene-
Responsive Elements (EREs) were identified in the IAA4 promoter,
suggesting that OsEREBP2 directly regulates IAA4 gene expression.
OsEREBP2 gene promoter region contains cis-elements involved in
ABA-, auxin- and cytokinin- responsiveness
The OsEREBP2 promoter region was analyzed to identify putative
cis-elements involved in transcriptional regulation by cytokinins,
auxins and ABA (Figure 5). To identify these regulatory sequences,
we have used PLACE and PlantPAN databases and sequences
reported in the literature. Considering as gene promoter the 2000 bp
upstream the start codon (ATG), 13 putative cytokinin-responsive
ARR-binding elements, with a consensus sequence (A/C/G/T)GATT,
were identified. These sequences were reported to be binding sites
for two type-B ARRs, ARR1 and ARR2, involved in Arabidopsis
cytokinin responses (Choi et al. 2010; Sakai et al. 2000; Sakai et al.
2001). In addition, two putative ARR10-binding elements, with the
consensus sequence AGAT(C/T/A)(C/T/A)(T/G)(A/C/TG), were
identified. ARR10 encodes a type-B ARR shown to recognize the
core sequence AGATT and to be involved in cytokinin signal
transduction pathways (Hosoda et al. 2002; Ishida et al. 2008). One
cytokinin-enhanced protein binding element TATTAG (Du et al.
Chapter V
169
2007) was identified. This element was reported to be crucial for the
activation of cytokinin-responsive genes in cucumber (Fusada et al.
2005). The ARR-binding elements identified in OsEREBP2 promoter
were also reported to be present in the promoter of several rice type-
A RRs with a putative role in cytokinin responses (Du et al. 2007; Ito
and Kurata 2006; Jain et al. 2006). In addition, auxin-related
sequences with the consensus TGTCNC or GNGACA (Kepinski and
Leyser 2002) were also identified within the OsEREBP2 promoter
region, indicating a putative regulation by auxins. The core motifs
TGTC and GACA were shown to be required for the binding of
Arabidopsis ARFs to the promoter of auxin-responsive genes
(Chapman and Estelle 2009). In rice, OsARF1 was reported to bind
to this core sequence in the promoter of the CROWN ROOTLESS5
(CRL5) gene, which is induced by auxins and encodes an AP2/ERF
TF (Kitomi et al. 2011).
ABA-dependent gene regulation usually requires the presence of
ABA-Responsive Elements (ABREs) and coupling elements (CE)
within the gene promoter (Hubbard et al. 2010; Zhang et al. 2005).
The ABRE core motif ACGT is highly conserved, but the flanking
sequences vary significantly. In contrast, the CEs are poorly
conserved and can be substituted by other functional elements, such
as ABREs themselves and Dehydration-Responsive Element (DRE).
The OsEREBP2 promoter region contains two ABRE sequences with
the core motif ACGT and one ABRE-related sequence (Kaplan et al.
2006). The gap between the ABRE sequences is within the
previously predicted distance for functional ABRE-ABRE pairs
(Gomez-Porras et al. 2007). This is consistent with the fact that
OsEREBP2 gene expression is regulated by ABA (Chapter 2).
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
170
Figure 5. Hormone-related cis-elements identified in the OsEREBP2 gene
promoter. The promoter region was defined as the 2000 bp sequence
upstream the translation start codon (ATG). The search for regulatory
sequences was performed using the PLACE and PlantPAN databases and
regulatory elements reported in the literature. ABA-Responsive Element
(ABRE), Arabidopsis Response Regulator (ARR). The symbols used in the
sequences correspond to: N = G/A/T/C, M = A/C, H = A/C/T, K = G/T, Y =
T/C and B = G/T/C.
OsEREBP2 and ABR1 have similar functions
OsEREBP2 and ABR1 belong to the Xa group of ERF proteins
due to the presence of the CMX-1 motif in the aa sequence (Nakano
et al. 2006). These proteins share only 44% aa identity over the full
aa sequence, but a much higher homology (89%) within the AP2
domain. Limited conservation outside the AP2 domain was
previously described, and several rice and Arabidopsis AP2/ERF
proteins with low homology were considered as functional homologs
(Dubouzet et al. 2003; Gutterson and Reuber 2004). To assess
Chapter V
171
whether OsEREBP2 and ABR1 have similar functions, homozygous
abr1 mutant plants were transformed with the OsEREBP2 transgene
driven by the Arabidopsis ABR1 promoter. The rice TF was initially
over-expressed (using the CaMV35S promoter) in the abr1 mutant,
but no transgenic plants were obtained. Thus, a construct that
allowed the transgene expression driven by the ABR1 endogenous
promoter was prepared and used to transform the abr1 mutants.
Only one homozygous ABR::OsEREBP2 transgenic line was
obtained (Figure 6A). The phenotype complementation was
assessed through seed germination studies in MS medium
containing either 150 mM NaCl or 0.7 µM ABA. In control conditions,
no significant differences in seed germination rate were observed
between wt, abr1 mutants and the ABR::OsEREBP2 transgenic
seeds (Figure 6B). Under high salinity and ABA treatments, abr1
seed germination was inhibited (Figures 6C, 6D), confirming the
previously described hypersensitivity of the abr1 mutant to these
treatments (Pandey et al. 2005). On the other hand, the
ABR::OsEREBP2 seeds showed a seed germination rate similar to
wt under both treatments. After 2 days in 150 mM NaCl, only 11% of
the abr1 seeds had germinated, in contrast to 60% of wt and 44% of
ABR::OsEREBP2 (Figure 6C). After 2 days in 0.7 µM ABA,
approximately 50% of wt and ABR::OsEREBP2 seeds had
germinated, whereas only 18% of mutant seeds germinated (Figure
6D). These results indicate that OsEREBP2 gene expression
rescued the abr1 seed germination phenotype.
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
172
Figure 6. Analysis of gene expression and germination rate of
ABR::OsEREBP2 transgenic seeds. (A) OsEREBP2 and ABR1 gene
expression analysis in wt (Col-0), abr1 mutants and the ABR::OsEREBP2
transgenic line. Total RNA was extracted from plants with the second pair of
leaves well expanded. Actin gene expression was used as internal control.
Germination rate analysis on MS medium without (B) or with 150 mM NaCl
(C) or 0.7 µM ABA (D). The percentage of seeds germinated was recorded
during 6 days. Data are means ± SD (n ≈ 100).
DISCUSSION
Plants undergo developmental programs and respond to external
signals through the activation and repression of specific genes. The
transcription factors (TFs) involved, after being synthesized in the
cytosol, need to be translocated into the nucleus to exert their
function (Gill 2003). The presence of a nuclear localization signal
(NLS) in their protein sequence ensures that they can be transported
to the nucleus. OsEREBP2 was shown to contain a NLS sequence
(Chapter 2), indicating that the protein can be transported into the
nucleus. Our results indicated that, under control conditions,
Chapter V
173
OsEREBP2 is mainly localized in the nucleus and, under high salinity
conditions, besides a strong accumulation in the nucleus also appear
to concentrate in spot-like structures in the cytosol. The spot-like
pattern under salt stress suggests an accumulation of OsEREBP2 in
subcellular organelles in response to this stress. A bioinformatic
analysis (PredictProtein and iPSORT software) of OsEREBP2
protein sequence indicated that besides the predicted NLS, the TF
may contain a mitochondrial and/or chloroplast target signal.
Thereby, this TF may be targeted to both the nucleus and the
mitochondrial and/or chloroplast in response to high salinity. Several
TFs have been predicted to be targeted to the nucleus and the
mitochondria or chloroplast in Arabidopsis and rice (Schwacke et al.
2007). The AP2/ERF family was among the families with more TFs
predicted to contain two target sequences. However, only a few TFs
have been characterized regarding their dual intracellular localization
in nuclei and mitochondria/chloroplast (Krause and Krupinska 2009).
APL1 encodes a MYB TF involved in developmental processes,
shown to be targeted to both nuclei and mitochondria (Bonke et al.
2003; Carrie et al. 2009). In barley, the Whirly1 TF was detected in
nuclei and chloroplasts within the same cell (Grabowski et al. 2008).
Protein target to different cell compartments is thought to be
regulated by developmental or environmental signals (Schwacke et
al. 2007; Silva-Filho 2003; Yogev and Pines 2011). In animals, a
fraction of the TF p53 is translocated from the nucleus to the
mitochondria in response to death stimulus such as hypoxia and
induces cell apoptosis (Sansome et al. 2001). In plants, a few TFs
bound with organelle membranes were shown to be translocated to
the nucleus in response to stress conditions (Krause and Krupinska
2009). The DnaJ-type Zn finger Tsip1 was shown to be bound to
chloroplast surface, but under treatment with salicylic acid it
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
174
dissociates from it and forms a complex with the AP2/ERF TF Tsi1
(Ham et al. 2006). The Tsip1-Tsi1 complex accumulates in the
nucleus and induces several stress-responsive genes. Dual protein
targeting is thought to be an important mechanism which allows
communication between the nucleus and the organelles in response
to biotic and abiotic stress conditions (Schwacke et al. 2007). We
suggest that OsEREBP2 has a function in such mechanisms;
however, this must be further investigated.
OsEREBP2 biological function was analyzed in Arabidopsis plants
over-expressing this TF. OsEREBP2-OX plants displayed abnormal
shoot and root phenotype, and de-differentiated into callus-like
structures in hormone free medium. Cell de-diferentiation and
proliferation may be related to an imbalance auxin/cytokinin ratio or
to impaired responses to these hormones (Frank et al. 2000; Harrar
et al. 2003). The phenotype of OsEREBP2-OX plants is similar to the
reported for Arabidopsis mutants with abnormal responses to auxin
and cytokinin. The pasticcino (pas) mutants displayed bushy
rosettes, ectopic shoots and tissue de-differentiation to callus-like
structures after germination in hormone-free medium (Faure et al.
1998). Although no significant difference in hormone content was
detected in these mutants, they revealed higher sensitivity to
cytokinins (Faure et al. 1998). Gene expression studies revealed that
the pas mutants have higher competence for cell division due to
deregulation of cytokinin and auxin primary response genes (Harrar
et al. 2003). PASTICCINO (PAS) genes PAS1, PEPINO/PAS2 and
PAS3 were shown to regulate cell division and differentiation through
the control of the amplitude of cytokinin and auxin responses (Harrar
et al. 2003). In addition, the encoded proteins were reported to have
important roles in very-long-chain fatty acids (VLCFA) synthesis
(Bach et al. 2008; Baud et al. 2004; Roudier et al. 2010). VLCFA are
Chapter V
175
components of plant seeds, cuticular waxes and sphingolipids that
are membrane constituents and signaling molecules (Bach and
Faure 2010). Modifications in VLCFA nature or levels affect several
plant development processes, through deregulation of
organogenesis and alterations in cell size, division and differentiation
(Bach and Faure 2010).
The similarities between the phenotypes of pas mutants and the
OsEREBP2-OX plants suggest that OsEREBP2 interferes with PAS-
mediated pathways or with PAS gene expression regulation. In fact,
OsEREBP2-OX plants tend to have reduced PEPINO/PAS2
transcript levels as compared to wt. The down regulation of
PEPINO/PAS2 gene expression appears to be correlated with the
increased OsEREBP2 transcript level and, at least partially, with the
phenotype severity of the transgenic lines. Our results suggest that
OsEREBP2 negatively regulates PEPINO/PAS2 gene expression.
PEPINO/PAS2 encodes an anti-phosphatase that may function in the
control of cell proliferation by direct binding to substrates preventing
their de-phosphorylation by phosphatases (Torres-Ruiz et al. 2002).
In addition, PEPINO/PAS2 was shown to function as a hydroxyl fatty
acyl CoA dehydratase in the elongation steps of the VLCFAs
synthesis (Bach et al. 2008). Its activity in this biosynthetic pathway
was characterized as essential for plant development, but the
specific role of PAS-mediated VLCFA pathway is still unclear (Bach
et al. 2008). A BLAST analysis revealed that rice has proteins with
high homology to PEPINO/PAS2, but their function is not yet
characterized (Torres-Ruiz et al. 2002). The rice VLCFA pathway is
also poorly understood, although studies with rice mutants suggested
that VLCFA pathways have an important role in rice shoot
development (Ito et al. 2011). oni1 mutants displayed short leaves
and fused organs and were not able to reach the reproductive stage.
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
176
ONION1 (ONI1) encodes a fatty acid elongase involved in VLCFA
synthesis and shown to be necessary for normal shoot development
(Ito et al. 2011). Therefore, the role of VLCFA synthesis in plant
development may be at least partially conserved in Arabidopsis and
rice and OsEREBP2 may function in rice developmental processes
involving the regulation of VLCFA pathways mediated by PAS
orthologues.
OsEREBP2-OX plants phenotype may also be related to defects
in the root apical meristem (RAM) and the shoot apical meristem
(SAM), which can be caused by abnormal responses to auxins
and/or cytokinins. Primary roots result from cell division in the root
apical meristem (RAM) and subsequent cell expansion and
differentiation (Stahl and Simon 2010). Auxins promote and maintain
stem cell activity, whereas cytokinins promote cell differentiation
(Stahl and Simon 2010). Thus, the deregulation of hormone content
or responses can induce defects in the RAM function that may lead
to abnormal root phenotypes. Similarly, the shoot architecture can be
affected by SAM abnormal auxins and/or cytokinins content or
responses (Itoh et al. 2000). High levels of cytokinins are detected in
the central zone of the SAM to promote stem-cell proliferation and
inhibit their differentiation. In contrast, auxin triggers organ primordial
initiation through repression of cytokinin biosynthesis in the
peripheral zone of the SAM (Su et al. 2011). In addition, the proper
pattern of leaf initiation is greatly influenced by the SAM shape and
organization. The enlargement of SAM affects the rate of leaf
production and changes in SAM organization can alter leaf
morphogenesis (Itoh et al. 2000). Class I KNOX (Knotted1-like
homeobox) proteins are homeodomain TFs with important functions
in the SAM (Hay and Tsiantis 2010). KNOX gene expression is
activated in the central region of the SAM to prevent cell
Chapter V
177
differentiation and maintain the stem cell activity, whereas it is
repressed in the periphery of the SAM where organs are initiated to
allow their formation (Scofield and Murray 2006). The KNAT2 gene
encodes a class I KNOX protein expressed during embryogenesis in
the base of the SAM and repressed when leaf primordia are initiated
(Hay and Tsiantis 2010; Pautot et al. 2001). This protein was shown
to mediate cytokinin and ethylene function in the SAM (Hamant et al.
2002). Misexpression of KNAT2 in the meristem was reported to
affect leaf cell expansion and differentiation, leading to malformed
leaves (Scofield and Murray 2006). KNAT2 gene expression was up-
regulated in the five OsEREBP2-OX plants as compared to wt. No
correlation was observed between the KNAT2 and either OsEREBP2
transcript levels or the severity of the phenotype; nevertheless the
higher accumulation of KNAT2 suggests that the transgenic plants
are affected in the SAM function. Studies in Arabidopsis and rice
reported the noncorrelation between the phenotype severity and the
expression levels of KNOX genes (Ito et al. 2001; Ito et al. 2009).
The studies suggest that the phenotype severity is related to the
amount of protein accumulation, which may not correlate with the
KNOX transcript level. The obtained results are in agreement with
the increased accumulation of KNAT2 transcripts reported in pas
mutants (Harrar et al. 2003). In these mutants, KNAT2 was shown to
be expressed in a larger zone of the meristem, as compared to wt,
allowing the ectopic formation of shoots (Harrar et al. 2003).
Similarly, OsEREBP2-OX abnormal shoot phenotype may be related
to deregulation of KNAT2 gene expression. KNOX genes have been
identified in rice and reported to have a role in the SAM function
(Reiser et al. 2000). Based on sequence similarity and expression
pattern, OSH6 was considered to be a rice orthologue of KNAT2
(Hay and Tsiantis 2010). OSH6 transcripts were detected in the base
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
178
of the SAM and OSH6 was shown to have a putative role in SAM
maintenance and leaf development (Ito et al. 2001; Ito et al. 2009).
Thus, OsEREBP2 may have a role in the SAM development through
the regulation of KNOX gene expression.
To further characterize OsEREBP2 role in cytokinin responses,
the ARR5 gene expression was analyzed in the OsEREBP2-OX
plants. ARR5 encodes a type-A ARR highly induced by cytokinins
(To et al. 2007). Type-A ARRs function as repressors to reduce
cytokinin responses. Reduced ARR5 transcript levels were detected
in most OsEREBP2-OX plants, suggesting that OsEREBP2 is
affecting cytokinin signaling pathways. Down-regulation of type-A
ARRs (ARR4, ARR5 and ARR6) was detected in BOLITA/ESR2
over-expressing lines (Ikeda et al. 2006). The Arabidopsis
BOLITA/ESR2 gene encodes a DORNROESCHEN-LIKE (DRNL)
protein belonging to the ERF subfamily of TFs (Pereira et al. 2006).
Its over-expression induces de-differentiation of true leaves to callus-
like tissues and defects in the root system (Ikeda et al. 2006; Pereira
et al. 2006). Similarly to OsEREBP2-OX plants, the callus-like
tissues proliferated in hormone-free medium and some gave rise to
leaves, stems and flowers. Based on gene expression analysis,
BOLITA/ESR2 was reported to have a putative function in cell
proliferation and differentiation, as well as in auxin and cytokinin
hormone signaling pathways (Pereira et al. 2006). ARR5 transcript
level was lower in BOLITA/ESR2-OX plants with severe phenotypes
as observed in OsEREBP2-OX plants. The reduced expression of
type-A ARRs was proposed to be related to the higher expression of
AHP6 and/or AtCKX7 genes in BOLITA/ESR2 transgenic plants
(Ikeda et al. 2006). AHP6 encodes an Arabidopsis histidine
phosphotransfer (AHP)-like protein (Mahonen et al. 2006; Muller and
Sheen 2007). Phosphotransfer proteins (AHPs) function as
Chapter V
179
intermediates in cytokinin responses that transfer the phosphoryl
group from the cytokinin receptors to nuclear Arabidopsis type-B
response regulators (ARRs) (Kieber et al. 2010). The type-B ARRs
and the cytokinin response factors (CRFs) regulate the cytokinin
primary response genes, which include type-A ARRs (Rashotte et al.
2006). AHP6 do not display phosphotransfer activity because it lacks
the conserved histidine residue required to accept the phosphoryl
group from the receptors (Mahonen et al. 2006; Muller and Sheen
2007). The inhibitory effect of AHP6 in cytokinin signaling was
suggested to involve competition with other AHPs for interaction with
hormone receptors or ARR proteins (Muller and Sheen 2007). The
phosphotransfer mechanism involved in cytokinin signal transduction
was shown to be putatively conserved in Arabidopsis and rice (Ito
and Kurata 2006). Orthologues of cytokinin receptors, histidine
phosphotransfer (HPt) proteins, and type-A and type-B response
regulators (RRs) were identified in rice, but their function in the
hormone signaling is not fully understood (Ito and Kurata 2006).
Three HPt proteins that lack the conserved histidine residue were
identified in the rice genome (OHP3, OHP4 and OHP5), and
therefore rice may have a functional orthologue of AHP6 (Ito and
Kurata 2006). The AtCKX7 gene encodes a cytokinin
oxidase/dehydrogenase enzyme involved in the irreversible
degradation of cytokinins (Schmulling et al. 2003a). CKX enzymes
were identified in maize and wheat, and shown to have a putative
role in seed development (Schmulling et al. 2003b). In rice, OsCKX2
was proposed to regulate grain production through the control of
cytokinin transport to the meristem, thus influencing the meristem
size and/or flower number (Werner et al. 2006).
OsEREBP2 putative role in auxin responses was assessed
through the analysis of the IAA4 gene expression in the OsEREBP2-
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
180
OX plants. Aux/IAA proteins function as auxin-response inhibitors
that form heterodimers with AUXIN RESPONSE FACTORs (ARFs)
to prevent the activation of auxin-responsive genes (Moubayidin et
al. 2009). Reduced IAA4 transcript level was detected in the
OsEREBP2-OX plants compared to wt, suggesting that the rice TF is
interfering with auxin responses. Down-regulation of IAA4 and IAA1
gene expression was reported in the pas mutants under normal
growth conditions (Harrar et al. 2003). Aux/IAA transcript level
increased upon auxin treatment, but the amplitude of response was
lower than the observed in wt plants, suggesting that the mutants
have a reduced primary response to auxin (Harrar et al. 2003). In
rice, several Aux/IAA and ARF proteins were identified and shown to
have a role in auxin responses and plant development (Nakamura et
al. 2006; Wang et al. 2007; Xiong et al. 2009). OsIAA3 gene
expression was highly induced by auxin and gain-of-function mutants
displayed several developmental defects, such as reduced crown
root formation and abnormal leaf formation (Nakamura et al. 2006).
Gene expression studies also revealed that several Aux/IAA and
ARF proteins may also be involved in abiotic stress responses,
suggesting a cross-talk between auxin and abiotic stress signaling
pathways in rice (Jain and Khurana 2009; Xiong et al. 2009).
Taken together these results suggest that OsEREBP2 has a role
in plant development processes mediated by cytokinins and auxins.
Moreover, the TF putative function in abiotic stress responses
indicates that it can function as a coordinator of the developmental
adjustments required for plant adaptation to changes in
environmental conditions. The identification of cis-elements known to
confer regulation by cytokinin, auxin and ABA, suggests that
OsEREBP2 gene expression is regulated by these hormones, further
implicating the TF in plant developmental processes.
Chapter V
181
OsEREBP2 and ABR1 belong to the Xa group of ERF proteins
and have a putative role in abiotic stress responses (Chapter 2)
(Pandey et al. 2005). The transcript level of both genes is induced in
response to ABA, low temperature, high salinity and drought stress
treatments. To confirm whether these TFs have a similar function,
abr1 mutants were transformed to express OsEREBP2 under the
control of the ABR1 promoter. Thereby, we showed that OsEREBP2
may have a similar function to ABR1. Further studies need to be
performed to confirm that OsEREBP2 can also function as an ABA
repressor. Nevertheless, the described regulation of the TF gene
expression by ABA, the identification of ABA-regulated cis-elements
in the promoter region and the observed mutant seed phenotype
rescue indicates that OsEREBP2 has a role in ABA responses.
In the present study, we have shown that salt stress induces
OsEREBP2 accumulation in spot-like structures which may
colocalize with mitochondria or chloroplasts. In addition, we have
shown that OsEREBP2 plays an important role in plant
developmental processes and hormone signaling pathways. We
suggest that OsEREBP2 may be an integrator of the external stimuli
into the plant developmental programs.
ACKNOWLEDGMENTS
Tânia Serra carried out the experimental work. The planning of
the research work and discussion of results was performed by Tânia
Serra, Ana Paula Santos, M. Margarida Oliveira and Nelson Saibo.
REFERENCES
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
182
Acharya BR, Assmann SM (2009) Hormone interactions in stomatal
function. Plant Mol Biol 69: 451-462
Ahuja I, de Vos RC, Bones AM, Hall RD (2010) Plant molecular stress
responses face climate change. Trends Plant Sci 15: 664-674
Bach L, Faure JD (2010) Role of very-long-chain fatty acids in plant
development, when chain length does matter. Comptes Rendus Biol
333: 361-370
Bach L, Michaelson LV, Haslam R, Bellec Y, Gissot L, Marion J, Da Costa
M, Boutin JP, Miquel M, Tellier F, Domergue F, Markham JE, Beaudoin
F, Napier JA, Faure JD (2008) The very-long-chain hydroxy fatty acyl-
CoA dehydratase PASTICCINO2 is essential and limiting for plant
development. Proc Natl Acad Sci USA 105: 14727-14731
Baud S, Bellec Y, Miquel M, Bellini C, Caboche M, Lepiniec L, Faure JD,
Rochat C (2004) gurke and pasticcino3 mutants affected in embryo
development are impaired in acetyl-CoA carboxylase. EMBO Rep 5:
515-520
Bonke M, Thitamadee S, Mahonen AP, Hauser MT, Helariutta Y (2003) APL
regulates vascular tissue identity in Arabidopsis. Nature 426: 181-186
Carrie C, Kuhn K, Murcha MW, Duncan O, Small ID, O'Toole N, Whelan J
(2009) Approaches to defining dual-targeted proteins in Arabidopsis.
Plant J 57: 1128-1139
Chapman EJ, Estelle M (2009) Mechanism of auxin-regulated gene
expression in plants. Annu Rev Genet 43: 265-285
Choi J, Huh SU, Kojima M, Sakakibara H, Paek KH, Hwang I (2010) The
cytokinin-activated transcription factor ARR2 promotes plant immunity
via TGA3/NPR1-dependent salicylic acid signaling in Arabidopsis. Dev
Cell 19: 284-295
Clough SJ, Bent AF (1998) Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J
16: 735-743
Dietz KJ, Vogel MO, Viehhauser A (2010) AP2/EREBP transcription factors
are part of gene regulatory networks and integrate metabolic, hormonal
Chapter V
183
and environmental signals in stress acclimation and retrograde
signalling. Protoplasma 245: 3-14
Du L, Jiao F, Chu J, Jin G, Chen M, Wu P (2007) The two-component signal
system in rice (Oryza sativa L.): a genome-wide study of cytokinin signal
perception and transduction. Genomics 89: 697-707
Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, Seki M,
Shinozaki K, Yamaguchi-Shinozaki K (2003) OsDREB genes in rice,
Oryza sativa L., encode transcription activators that function in drought-,
high-salt- and cold-responsive gene expression. Plant J 33: 751-763
Duek PD, Fankhauser C (2005) bHLH class transcription factors take centre
stage in phytochrome signalling. Trends Plant Sci 10: 51-54
Faure JD, Vittorioso P, Santoni V, Fraisier V, Prinsen E, Barlier I, Van
Onckelen H, Caboche M, Bellini C (1998) The PASTICCINO genes of
Arabidopsis thaliana are involved in the control of cell division and
differentiation. Development 125: 909-918
Frank M, Rupp HM, Prinsen E, Motyka V, Van Onckelen H, Schmulling T
(2000) Hormone autotrophic growth and differentiation identifies mutant
lines of Arabidopsis with altered cytokinin and auxin content or signaling.
Plant Physiol 122: 721-729
Fusada N, Masuda T, Kuroda H, Shimada H, Ohta H, Takamiya K (2005)
Identification of a novel cis-element exhibiting cytokinin-dependent
protein binding in vitro in the 5'-region of NADPH-protochlorophyllide
oxidoreductase gene in cucumber. Plant Mol Biol 59: 631-645
Gill G (2003) Post-translational modification by the small ubiquitin-related
modifier SUMO has big effects on transcription factor activity. Curr Opin
Genet Dev 13: 108-113
Gomez-Porras JL, Riano-Pachon DM, Dreyer I, Mayer JE, Mueller-Roeber
B (2007) Genome-wide analysis of ABA-responsive elements ABRE and
CE3 reveals divergent patterns in Arabidopsis and rice. BMC Genomics
8: 260
Grabowski E, Miao Y, Mulisch M, Krupinska K (2008) Single-stranded DNA-
binding protein Whirly1 in barley leaves is located in plastids and the
nucleus of the same cell. Plant Physiol 147: 1800-1804
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
184
Gutterson N, Reuber TL (2004) Regulation of disease resistance pathways
by AP2/ERF transcription factors. Curr Opin Plant Biol 7: 465-471
Ham BK, Park JM, Lee SB, Kim MJ, Lee IJ, Kim KJ, Kwon CS, Paek KH
(2006) Tobacco Tsip1, a DnaJ-type Zn finger protein, is recruited to and
potentiates Tsi1-mediated transcriptional activation. Plant Cell 18: 2005-
2020
Hamant O, Nogue F, Belles-Boix E, Jublot D, Grandjean O, Traas J, Pautot
V (2002) The KNAT2 homeodomain protein interacts with ethylene and
cytokinin signaling. Plant Physiol 130: 657-665
Harrar Y, Bellec Y, Bellini C, Faure JD (2003) Hormonal control of cell
proliferation requires PASTICCINO genes. Plant Physiol 132: 1217-1227
Hay A, Tsiantis M (2010) KNOX genes: versatile regulators of plant
development and diversity. Development 137: 3153-3165
Hirose N, Makita N, Kojima M, Kamada-Nobusada T, Sakakibara H (2007)
Overexpression of a type-A response regulator alters rice morphology
and cytokinin metabolism. Plant Cell Physiol 48: 523-539
Hirose N, Takei K, Kuroha T, Kamada-Nobusada T, Hayashi H, Sakakibara
H (2008) Regulation of cytokinin biosynthesis, compartmentalization and
translocation. J Exp Bot 59: 75-83
Hosoda K, Imamura A, Katoh E, Hatta T, Tachiki M, Yamada H, Mizuno T,
Yamazaki T (2002) Molecular structure of the GARP family of plant Myb-
related DNA binding motifs of the Arabidopsis response regulators. Plant
Cell 14: 2015-2029
Hubbard KE, Nishimura N, Hitomi K, Getzoff ED, Schroeder JI (2010) Early
abscisic acid signal transduction mechanisms: newly discovered
components and newly emerging questions. Genes Dev 24: 1695-1708
Hwang BK, Choi DS (2011) Proteomics and functional analyses of pepper
abscisic acid-responsive 1 (ABR1), which is involved in cell death and
defense signaling. Plant Cell 23: 823-842
Ikeda Y, Banno H, Niu QW, Howell SH, Chua NH (2006) The ENHANCER
OF SHOOT REGENERATION 2 gene in Arabidopsis regulates CUP-
SHAPED COTYLEDON 1 at the transcriptional level and controls
cotyledon development. Plant Cell Physiol 47: 1443-1456
Chapter V
185
Ishida K, Yamashino T, Yokoyama A, Mizuno T (2008) Three type-B
response regulators, ARR1, ARR10 and ARR12, play essential but
redundant roles in cytokinin signal transduction throughout the life cycle
of Arabidopsis thaliana. Plant Cell Physiol 49: 47-57
Ito Y, Eiguchi M, Kurata N (2001) KNOX homeobox genes are sufficient in
maintaining cultured cells in an undifferentiated state in rice. Genesis 30:
231-238
Ito Y, Kimura F, Hirakata K, Tsuda K, Takasugi T, Eiguchi M, Nakagawa K,
Kurata N (2011) Fatty acid elongase is required for shoot development in
rice. Plant J 66: 680-688
Ito Y, Kurata N (2006) Identification and characterization of cytokinin-
signalling gene families in rice. Gene 382: 57-65
Ito Y, Tsuda K, Yamaki S, Miyao A, Hirochika H, Kurata N (2009) Isolation
and mapping of three rice mutants that showed ectopic expression of
KNOX genes in leaves. Plant Sci 177: 131-135
Itoh JI, Kitano H, Matsuoka M, Nagato Y (2000) Shoot organization genes
regulate shoot apical meristem organization and the pattern of leaf
primordium initiation in rice. Plant Cell 12: 2161-2174
Jaillais Y, Chory J (2010) Unraveling the paradoxes of plant hormone
signaling integration. Nat Struct Mol Biol 17: 642-645
Jain M, Khurana JP (2009) Transcript profiling reveals diverse roles of
auxin-responsive genes during reproductive development and abiotic
stress in rice. FEBS J 276: 3148-3162
Jain M, Tyagi AK, Khurana JP (2006) Molecular characterization and
differential expression of cytokinin-responsive type-A response
regulators in rice (Oryza sativa). BMC Plant Biol 6: 1
Jones B, Gunneras SA, Petersson SV, Tarkowski P, Graham N, May S,
Dolezal K, Sandberg G, Ljung K (2010) Cytokinin regulation of auxin
synthesis in Arabidopsis involves a homeostatic feedback loop regulated
via auxin and cytokinin signal transduction. Plant Cell 22: 2956-2969
Kaplan B, Davydov O, Knight H, Galon Y, Knight MR, Fluhr R, Fromm H
(2006) Rapid transcriptome changes induced by cytosolic Ca2+
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
186
transients reveal ABRE-related sequences as Ca2+
-responsive cis-
elements in Arabidopsis. Plant Cell 18: 2733-2748
Kepinski S, Leyser O (2002) Ubiquitination and auxin signaling: a degrading
story. Plant Cell 14 Suppl: S81-95
Kieber JJ, Argueso CT, Raines T (2010) Cytokinin signaling and
transcriptional networks. Curr Opin Plant Biol 13: 533-539
Kitomi Y, Ito H, Hobo T, Aya K, Kitano H, Inukai Y (2011) The auxin
responsive AP2/ERF transcription factor CROWN ROOTLESS5 is
involved in crown root initiation in rice through the induction of OsRR1, a
type-A response regulator of cytokinin signaling. Plant J 67: 472-484
Koini MA, Alvey L, Allen T, Tilley CA, Harberd NP, Whitelam GC, Franklin
KA (2009) High temperature-mediated adaptations in plant architecture
require the bHLH transcription factor PIF4. Curr Biol 19: 408-413
Krause K, Krupinska K (2009) Nuclear regulators with a second home in
organelles. Trends Plant Sci 14: 194-199
Kudo T, Kiba T, Sakakibara H (2010) Metabolism and long-distance
translocation of cytokinins. J Integr Plant Biol 52: 53-60
Mahajan S, Tuteja N (2005) Cold, salinity and drought stresses: an
overview. Arch Biochem Biophys 444: 139-158
Mahonen AP, Bishopp A, Higuchi M, Nieminen KM, Kinoshita K,
Tormakangas K, Ikeda Y, Oka A, Kakimoto T, Helariutta Y (2006)
Cytokinin signaling and its inhibitor AHP6 regulate cell fate during
vascular development. Science 311: 94-98
Moubayidin L, Di Mambro R, Sabatini S (2009) Cytokinin-auxin crosstalk.
Trends Plant Sci 14: 557-562
Muller B, Sheen J (2007) Advances in cytokinin signaling. Science 318: 68-
69
Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annu Rev
Plant Biol 59: 651-681
Nakamura A, Umemura I, Gomi K, Hasegawa Y, Kitano H, Sazuka T,
Matsuoka M (2006) Production and characterization of auxin-insensitive
rice by overexpression of a mutagenized rice IAA protein. Plant J 46:
297-306
Chapter V
187
Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of
the ERF gene family in Arabidopsis and rice. Plant Physiol 140: 411-432
Nayyar H, Thakur P, Kumar S, Malik JA, Berger JD (2010) Cold stress
effects on reproductive development in grain crops: An overview. Env
Exp Bot 67: 429-443
Nishiyama R, Watanabe Y, Fujita Y, Le DT, Kojima M, Werner T, Vankova
R, Yamaguchi-Shinozaki K, Shinozaki K, Kakimoto T, Sakakibara H,
Schmulling T, Tran LS (2011) Analysis of cytokinin mutants and
regulation of cytokinin metabolic genes reveals important regulatory
roles of cytokinins in drought, salt and abscisic acid responses, and
abscisic acid biosynthesis. Plant Cell 23: 2169-2183
Pandey GK, Grant JJ, Cheong YH, Kim BG, Li L, Luan S (2005) ABR1, an
APETALA2-domain transcription factor that functions as a repressor of
ABA response in Arabidopsis. Plant Physiol 139: 1185-1193
Pautot W, Dockx J, Hamant O, Kronenberger J, Grandjean O, Jublot D,
Traas J (2001) KNAT2: evidence for a link between knotted-like genes
and carpel development. Plant Cell 13: 1719-1734
Peleg Z, Blumwald E (2011) Hormone balance and abiotic stress tolerance
in crop plants. Curr Opin Plant Biol 14: 290-295
Pereira A, Marsch-Martinez N, Greco R, Becker JD, Dixit S, Bergervoet
JHW, Karaba A, de Folter S (2006) BOLITA, an Arabidopsis AP2/ERF-
like transcription factor that affects cell expansion and
proliferation/differentiation pathways. Plant Mol Biol 62: 825-843
Raghavendra AS, Gonugunta VK, Christmann A, Grill E (2010) ABA
perception and signalling. Trends Plant Sci 15: 395-401
Rashotte AM, Mason MG, Hutchison CE, Ferreira FJ, Schaller GE, Kieber
JJ (2006) A subset of Arabidopsis AP2 transcription factors mediates
cytokinin responses in concert with a two-component pathway. Proc Natl
Acad Sci USA 103: 11081-11085
Reiser L, Sanchez-Baracaldo P, Hake S (2000) Knots in the family tree:
evolutionary relationships and functions of knox homeobox genes. Plant
Mol Biol 42: 151-166
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
188
Rivero RM, Shulaev V, Blumwald E (2009) Cytokinin-dependent
photorespiration and the protection of photosynthesis during water
deficit. Plant Physiol 150: 1530-1540
Roudier F, Gissot L, Beaudoin F, Haslam R, Michaelson L, Marion J, Molino
D, Lima A, Bach L, Morin H, Tellier F, Palauqui JC, Bellec Y, Renne C,
Miquel M, Dacosta M, Vignard J, Rochat C, Markham JE, Moreau P,
Napier J, Faure JD (2010) Very-long-chain fatty acids are involved in
polar auxin transport and developmental patterning in Arabidopsis. Plant
Cell 22: 364-375
Sakai H, Aoyama T, Oka A (2000) Arabidopsis ARR1 and ARR2 response
regulators operate as transcriptional activators. Plant J 24: 703-711
Sakai H, Honma T, Aoyama T, Sato S, Kato T, Tabata S, Oka A (2001)
ARR1, a transcription factor for genes immediately responsive to
cytokinins. Science 294: 1519-1521
Sansome C, Zaika A, Marchenko ND, Moll UM (2001) Hypoxia death
stimulus induces translocation of p53 protein to mitochondria. Detection
by immunofluorescence on whole cells. FEBS Lett 488: 110-115
Santner A, Estelle M (2009) Recent advances and emerging trends in plant
hormone signalling. Nature 459: 1071-1078
Schmulling T, Werner T, Motyka V, Laucou V, Smets R, Van Onckelen H
(2003a) Cytokinin-deficient transgenic Arabidopsis plants show multiple
developmental alterations indicating opposite functions of cytokinins in
the regulation of shoot and root meristem activity. Plant Cell 15: 2532-
2550
Schmulling T, Werner T, Riefler M, Krupkova E, Bartrina y Manns I (2003b)
Structure and function of cytokinin oxidase/dehydrogenase genes of
maize, rice, Arabidopsis and other species. J Plant Res 116: 241-252
Schwacke R, Fischer K, Ketelsen B, Krupinska K, Krause K (2007)
Comparative survey of plastid and mitochondrial targeting properties of
transcription factors in Arabidopsis and rice. Mol Genet Genomics 277:
631-646
Scofield S, Murray JA (2006) KNOX gene function in plant stem cell niches.
Plant Mol Biol 60: 929-946
Chapter V
189
Shimono M, Sugano S, Nakayama A, Jiang CJ, Ono K, Toki S, Takatsuji H
(2007) Rice WRKY45 plays a crucial role in benzothiadiazole-inducible
blast resistance. Plant Cell 19: 2064-2076
Shukla RK, Raha S, Tripathi V, Chattopadhyay D (2006) Expression of
CAP2, an APETALA2-family transcription factor from chickpea,
enhances growth and tolerance to dehydration and salt stress in
transgenic tobacco. Plant Physiol 142: 113-123
Silva-Filho MC (2003) One ticket for multiple destinations: dual targeting of
proteins to distinct subcellular locations. Current Opinion in Plant Biology
6: 589-595
Stahl Y, Simon R (2010) Plant primary meristems: shared functions and
regulatory mechanisms. Curr Opin Plant Biol 13: 53-58
Su YH, Liu YB, Zhang XS (2011) Auxin-cytokinin interaction regulates
meristem development. Mol Plant 4: 616-625
To JP, Deruere J, Maxwell BB, Morris VF, Hutchison CE, Ferreira FJ,
Schaller GE, Kieber JJ (2007) Cytokinin regulates type-A Arabidopsis
Response Regulator activity and protein stability via two-component
phosphorelay. Plant Cell 19: 3901-3914
Torres-Ruiz RA, Haberer G, Erschadi S (2002) The Arabidopsis gene
PEPINO/PASTICCINO2 is required for proliferation control of
meristematic and non-meristematic cells and encodes a putative anti-
phosphatase. Dev Genes Evol 212: 542-550
Wang D, Pei K, Fu Y, Sun Z, Li S, Liu H, Tang K, Han B, Tao Y (2007)
Genome-wide analysis of the auxin response factors (ARF) gene family
in rice (Oryza sativa). Gene 394: 13-24
Werner T, Köllmer I, Bartrina I, Holst K, Schmülling T (2006) New insights
into the biology of cytokinin degradation. Plant Biol 8: 371-381
Xiong LZ, Song YL, Wang L (2009) Comprehensive expression profiling
analysis of OsIAA gene family in developmental processes and in
response to phytohormone and stress treatments. Planta 229: 577-591
Xue-Xuan X, Hong-Bo S, Yuan-Yuan M, Gang X, Jun-Na S, Dong-Gang G,
Cheng-Jiang R (2010) Biotechnological implications from abscisic acid
(ABA) roles in cold stress and leaf senescence as an important signal for
OsEREBP2 is a multifunctional AP2/ERF transcription factor mediating abiotic stress and hormone signaling pathways
190
improving plant sustainable survival under abiotic-stressed conditions.
Crit Rev Biotechnol 30: 222-230
Yogev O, Pines O (2011) Dual targeting of mitochondrial proteins:
Mechanism, regulation and function. Bba-Biomembranes 1808: 1012-
1020
Zhang L, Tian LH, Zhao JF, Song Y, Zhang CJ, Guo Y (2009a) Identification
of an apoplastic protein involved in the initial phase of salt stress
response in rice root by two-dimensional electrophoresis. Plant Physiol
149: 916-928
Zhang SW, Li CH, Cao J, Zhang YC, Zhang SQ, Xia YF, Sun DY, Sun Y
(2009b) Altered architecture and enhanced drought tolerance in rice via
the down-regulation of indole-3-acetic acid by TLD1/OsGH3.13
activation. Plant Physiol 151: 1889-1901
Zhang W, Ruan J, Ho TH, You Y, Yu T, Quatrano RS (2005) Cis-regulatory
element based targeted gene finding: genome-wide identification of
abscisic acid- and abiotic stress-responsive genes in Arabidopsis
thaliana. Bioinformatics 21: 3074-3081
Zhao Y (2010) Auxin biosynthesis and its role in plant development. Annu
Rev Plant Biol 61: 49-64
Chapter VI
191
Final Discussion and Future Perspectives
Chapter VI
Final Discussion and Future Perspectives
192
Rice is a salt-sensitive plant with high commercial value and
closely related to other very important crop species such as wheat,
barley and maize. The study of rice stress adaptation mechanisms
may help to improve rice cultivars as well as other crops. In this
thesis, we have studied the transcriptional regulation of the rice Root
Meander Curling (OsRMC) gene. OsRMC was selected among other
salt stress responsive genes not only because of its high induction by
salinity (Chapter 2), but also for its role as negative regulator of salt
stress response as well as putative role in stress signal perception.
The perception and transduction of stress signals is crucial to
activate the mechanisms responsible for plant survival under stress.
The perception of salt stress signals is thought to involve plasma
membrane proteins, such as receptor-like kinases and calcium
sensors, but no specific protein has been identified as a salt stress
sensor.
The role of salt stress negative regulators is also largely unknown.
Abiotic stress conditions induce the expression of several genes
whose products lead to adverse effects on plant development.
OsRMC was suggested as repressor of the expression of salt stress-
responsive genes, thereby fine-tuning plant responses to salt stress.
The study of OsRMC gene expression regulation may therefore
provide new insights on the high salinity stress response in this
species.
Aiming to identify transcription factors (TFs) regulating OsRMC
gene expression, a salt-induced cDNA expression library was
constructed and screened using the yeast one-hybrid system
(Chapter 2). This library became an important genetic tool for
identification of either protein-DNA or protein-protein interactions
involved in salt stress responses. Two TFs OsEREBP1 and
OsEREBP2, belonging to the ERF subfamily, were shown to directly
Chapter VI
193
bind to the same GCC-like DNA-motif present in the promoter of
OsRMC and to negatively regulate its gene expression (Chapter 3).
Both TFs were also shown to interact with a synthetic probe
containing two tandem repeats of the GCC box motif. OsEREBP1
was proposed to bind DNA, alone or in combination with itself or
other regulatory proteins and to function as an activator or repressor
depending on the adjacent DNA-motifs. DRE-like and MYB
recognition cis-elements were found near the GCC-like motif in the
OsRMC promoter (Chapter 3). Previous studies have suggested that
the combination of cis-elements can affect gene expression
regulation. If so, OsEREBP1 may bind cooperatively to the GCC-like
and DRE-like motifs to modulate OsRMC gene expression. This
effect, however, was not observed in our transient expression
assays, likely because no DRE-like motif is present near the S1 site
in the DNA fragment 3 of OsRMC promoter used in the reporter
plasmid. To confirm this hypothesis, it would be interesting to
perform transient expression assays using a reporter plasmid
carrying both cis-elements in the promoter fragment. Mutations in
any of these DNA motifs could confirm the relevance of the
combinatorial interaction in the regulation of OsRMC gene
expression. Additionally, electrophoretic mobility shift assays
(EMSAs) should be performed with the same DNA probes to confirm
the formation of a slower migrating OsEREBP1–DNA complex. The
identification of a MYB-recognition motif (MYBR) near the GCC-like
motif suggests that OsEREBP1 regulates OsRMC gene expression
cooperatively with MYB proteins. OsRMC regulation may occur
through TFs independent binding or dimerization. The yeast two-
hybrid system can be used to identify proteins interacting with
OsEREBP1 and to assess its putative homodimerization. The results
obtained must be further confirmed by bimolecular fluorescence
Final Discussion and Future Perspectives
194
complementation (BiFC). Additionally, the biological function of the
homo- or heterodimers may be assessed by transient expression
assays and EMSAs can be performed with fragments of the OsRMC
promoter containing the specific cis-elements. The yeast two-hybrid
screening may also allow the identification of proteins that regulate
the TF at post-translational level. OsEREBP1 was previously shown
to be phosphorylated by the MAPK OsBWMK1 and this modification
enhanced the TF binding to DNA. It would however be interesting to
identify new proteins interacting with OsEREBP1.
The subcellular localization studies revealed that OsEREBP1
locates in the nucleus, whereas OsEREBP2 is mainly located in the
nucleus under control conditions and accumulates in spot-like
structures under salt stress (Chapters 4 and 5). The prediction of a
mitochondria and/or chloroplast target signal in OsEREBP2 protein
sequence suggests that this TF locates in these cell structures. To
confirm if the spot-like structures correspond to mitochondria,
transient expression assays should be performed using a fluorescent
marker, such as the MitoTracker Red. The TF localization in
chloroplasts should be assessed through the observation of the
chlorophyll autofluorescence. These results should be
complemented with transient expression assays using OsEREBP2
protein forms mutated in the NLS and/or the predicted mitochondria
and/or chloroplast target signal. OsEREBP2 was shown to have a
putative role in drought, cold and hormone responses (Chapters 2
and 5); therefore, it would also be interesting to analyze the TF
localization in response to these stimuli. The results obtained should
also be confirmed through studies with Arabidopsis plants over-
expressing OsEREBP2 fused to GFP. Analyses of plant roots
exposed to high salinity and other stimuli may confirm the results
obtained with Arabidopsis protoplasts.
Chapter VI
195
The role of OsEREBP1 in abiotic stress responses was initially
analyzed through its transcriptional regulation by salt, drought, cold
(10ºC and 5ºC) and ABA treatments (Chapter 2). OsEREBP1
transcript level was only slightly affected by drought and moderate
cold, suggesting that OsEREBP1 protein level is mainly regulated by
post-translational modifications. Indeed, we observed that under high
salinity OsEREBP1 protein level increased due to both higher protein
synthesis and enhanced protein stability (Chapter 4). OsEREBP1
protein stability under salt stress may involve post-translational
modifications, namely phosphorylation and SUMOylation. The
described OsEREBP1 phosphorylation by OsBWMK1 prompted us
to determine the MAPK kinase activity under high salinity.
OsBWMK1 encodes three alternatively spliced transcripts,
OsBWMK1L, OsBWMK1M and OsBWMK1S, but only one
(OsBWMK1S) was shown to increase the transcript level under salt
stress. Therefore, the kinase activity of the OsBWMK1S encoded
protein was assessed, but no significant difference was detected
between control and salt stress treatments (Chapter 4). The kinase
activity of the protein forms encoded by the other OsBWMK1
transcripts should also be determined through in vitro kinase assays.
Additionally, to confirm whether the higher OsEREBP1 protein
stability is dependent on its phosphorylation state, we should perform
experiments with Arabidopsis protoplasts subjected to salt stress
treatments and over-expressing the TF mutated in the putative
phosphorylation sites. In silico studies showed that OsEREBP1 has a
putative SUMOylation site with high score. Given that protein
modification by SUMOylation was reported to increase protein
stability, we should test this modification by carrying out in vitro
SUMOylation assays with the wild-type (wt) protein and a protein
form mutated in the predicted SUMOylation site. The protein level of
Final Discussion and Future Perspectives
196
both forms should be also analyzed through over-expression in
Arabidopsis protoplasts in control and salt stress conditions.
OsEREBP1 functional characterization was evaluated in
Arabidopsis plants over-expressing the TF (Chapter 4). OsEREBP1-
OX plants displayed enhanced sensitivity to salt stress during
germination, whereas no significant differences in root phenotype
and plant survival were detected at seedling stage. We propose here
that under high salinity this TF is mainly regulated by post-
translational modifications and that the effect observed during
germination partially results from a slight increase in ABA sensitivity.
The lack of a stress-related phenotype in OX-OsEREBP1 plants may
be due to the low protein levels (maintained through protein turnover)
under control conditions. The OsEREBP1 protein level should be
analyzed in transgenic vs wild type Arabidopsis plants. The
identification of putative ubiquitination sites in OsEREBP1 sequence
suggests that this protein is degraded through the proteasome.
Recently, at GPlantS, we have confirmed by yeast two-hybrid and
BiFC, that OsEREBP1 and OsEREBP2 interact with the rice E3
ubiquitin ligase OsHOS1 (data not shown). Degradation assays with
total protein extracts from rice wt and RNAi plants silencing
OsHOS1, revealed that OsEREBP1 and OsEREBP2 degradation
involves the proteasome. To complement these results, in vitro
ubiquitination assays should also be performed. Additionally,
OsEREBP1-OX and wt plants should be treated with MG132 to block
the proteasome for TF protein quantification by Western blot. To
further characterize the OsEREBP1 turnover modulated by salt
stress, studies involving ubiquitination and over-expression of a form
mutated in the predicted ubiquitination residues should be
conducted.
Chapter VI
197
Treatments of OsEREBP1-OX plants with ABA revealed that seed
germination is slightly affected by this hormone and seedling root
growth is more affected than wt. Because no difference in
OsEREBP1 transcript levels was detected in rice seedlings subjected
to ABA treatments (Chapter 2), we proposed that the regulation of
this TF is ABA-induced at post-translational level. Therefore, it would
be interesting to study the ABA role on OsEREBP1 protein synthesis
and stability. Arabidopsis protoplasts over-expressing OsEREBP1
and treated with ABA and cycloheximide should be analyzed. In
addition, Arabidopsis plants over-expressing different forms of the
OsEREBP1 protein (mutated in ubiquitination, phosphorylation or
SUMOylation sites, depending on previous results) and subjected to
ABA treatments could provide new insights regarding the TF role in
ABA responses.
OsEREBP1 function in drought stress responses is proposed to
vary with the plant developmental stage. Transgenic seedlings
showed enhanced root growth, whereas no different seedling
survival was observed after PEG-induced water deficit conditions.
Although PEG is considered to mimic the conditions imposed by soil
dehydration, survival studies in soil should be performed to truly
evaluate OsEREBP1 role in drought stress responses. The analysis
of the TF gene expression and protein levels at different stages of
rice development and with plants subjected to drought stress may
also provide new insights regarding the TF function.
To complement and confirm the results obtained in Arabidopsis,
further studies should be performed with OsEREBP1 mutants or rice
silencing/over-expressing lines. These plants should be analyzed
regarding their phenotype under high salinity, drought stress and
ABA treatments. In addition, a genome-wide transcriptional profile
Final Discussion and Future Perspectives
198
analysis of these plants would allow the identification of OsEREBP1
target genes and further elucidate the TF function.
OsEREBP2 encodes a multifunctional protein putatively involved
in high salinity, ABA, drought and low temperature responses.
OsEREBP2 transcript levels transiently accumulated in rice plants
subjected to those abiotic stress conditions (Chapter 2). To further
investigate the function of OsEREBP2 in abiotic stress responses,
we generated Arabidopsis plants over-expressing this TF (Chapter
5). The transgenic plants displayed abnormal shoot and root
phenotypes and de-differentiated into callus-like tissues in hormone
free medium. The observed phenotype was proposed to be related to
abnormal responses to auxin and/or cytokinins. Additionally, we
observed deregulation of genes involved in very-long-chain fatty acid
synthesis and in the shoot apical meristem (SAM) maintenance and
function. These results indicated that OsEREBP2 is involved in plant
developmental processes. The abnormal phenotype hinders the
generation of homozygous plants and characterization under abiotic
stress conditions. This limitation could be overcome by having TF
expression driven by an inducible promoter such as a steroid-
inducible promoter. Those transgenic plants could then be subjected
to abiotic stress and hormone treatments for phenotypic evaluation.
Microscopic analysis of the SAM structure may provide further
insights into OsEREBP2 function in plant development. Additionally,
the levels of cytokinins and auxins should be measured in the
transgenic plants to confirm whether OsEREBP2 is affecting
hormone synthesis. To complement and confirm the obtained results,
studies with rice OsEREBP2 mutants or silencing/over-expressing
lines must be performed.
ERF proteins were initially characterized as regulators of ethylene
signal transduction pathways. Given that ethylene is a regulator of
Chapter VI
199
several processes in plant growth and development, it would also be
interesting to evaluate OsEREBP1 and OsEREBP2 gene expression
in response to ethylene.
Several ERF proteins have been implicated in biotic stress
responses due to their binding to the cis-element GCC box, which is
usually present in the promoter of pathogenesis-responsive genes.
The OsEREBP1 role in biotic stress responses was confirmed
through the observation that OsEREBP1-OX rice plants show
enhanced resistance to bacterial infection (Seo et al. 2011). The fact
that OsEREBP1 is regulated by OsBWMK1, involved in rice defense
responses, further supports the OsEREBP1 function in biotic stress
signaling pathways. OsEREBP2 showed an enhanced transcript
accumulation in rice plants treated with a functional analog of
salicylic acid (Shimono et al. 2007). Therefore, it was proposed to
have a role in biotic stress responses. OsRMC was previously
characterized as a negative regulator of jasmonic acid responses, a
hormone highly associated to biotic stress signaling. Therefore,
OsEREBP1 and OsEREBP2 may modulate the OsRMC gene
expression in response to biotic stress stimuli. The analysis of
OsEREBP1 and OsEREBP2 mutants or silencing lines should
provide new insights regarding this subject. The transcript profile of
these plants may also reveal new TF targets with a role in biotic
stress responses.
The study of the transcriptional network involved in abiotic stress
responses allowed the identification of candidate genes, potentially
useful in breeding programs. TFs are excellent candidates for the
generation of tolerant plants, mainly because they can modulate the
expression of a wide range of target genes and lead to the activation
of the mechanisms necessary for plant adaptation to stress
conditions. The identification and characterization of two ERF
Final Discussion and Future Perspectives
200
proteins with a functional role in abiotic stress responses provides
new knowledge regarding rice transcriptional networks. Further
studies need to be performed to deeply depict the function of the
identified TFs. Nevertheless, they may be considered good
candidates for the generation of improved crops through
conventional molecular breeding and/or genetic engineering
approaches.
REFERENCES
Seo YS, Chern M, Bartley LE, Han M, Jung KH, Lee I, Walia H, Richter T,
Xu X, Cao P, Bai W, Ramanan R, Amonpant F, Arul L, Canlas PE, Ruan
R, Park CJ, Chen X, Hwang S, Jeon JS, Ronald PC (2011) Towards
establishment of a rice stress response interactome. PLoS Genet 7:
e1002020
Shimono M, Sugano S, Nakayama A, Jiang CJ, Ono K, Toki S, Takatsuji H
(2007) Rice WRKY45 plays a crucial role in benzothiadiazole-inducible
blast resistance. Plant Cell 19: 2064-2076
This work was supported by a PhD fellowship (Ref.
SFRH/BD/31011/2006) awarded to Tânia Serra and the research
projects POCI/BIA_BCM/56063/2004, PEst-OE/EBQ/LA0004/2011
and PTDC/BIA_BCM/099836/2008.