How Genetic Tests Work - Molecular (sequence, target, array), Biochemical & Cytogenetics

Contents

[hide]

1 Understanding Genetic Testing

2 Uses of Genetic Testing

3 Types of Genetic Testing

3.1 Cytogenetic Testing

3.2 Biochemical Testing

3.3 Molecular Testing

4 Limitations to Genetic Testing

5 See Also

6 References

7 External Links

[edit] Understanding Genetic Testing

Genetic testing involves examining a person’s DNA, found in blood or other tissues, for some abnormality linked to a disease or condition. DNA is actually a chemical alphabet composed of four units that make up all of the genes, or genetic material, found inside our cells. Genes are important for the body’s normal development and functioning. Each gene is unique due to the order of the four DNA units (see DNA).

When a mistake happens affecting part or all of the gene, this can result in an abnormal function or change in the body, leading to disease. The mistake can be fairly large or very small, and different types of genetic tests are used to identify the specific gene abnormality (see Genes and Their Properties).

1

The most common type of genetic testing is Newborn Screening. Almost every baby born in the United States has a blood sample tested for abnormal or missing genes or proteins. Early detection can allow the doctor to prescribe drugs or to place the baby on a specific diet in order to prevent or reduce the severity of a disease. Another type of testing, known as carrier testing, can help determine the risk of parents passing on a mutation to their child. Predictive or predispositional genetic testing can determine the risk of a healthy person developing a disease in the future. Finally, genetic tests can be used to look for gene abnormalities in persons suspected of having a genetic disease based on symptoms or family history.

Genetic testing is not always 100 percent accurate. Even when a genetic test positively detects a mutation, the test usually cannot determine when or what symptoms of the disease may show, which symptoms will occur first, how severe the disease will be, or how the disease will progress over time. If a test is negative, an individual may still be at risk for a disease. Therefore, it is important to speak to a health professional such as a genetic counselor to help you understand the benefits and risks of genetic testing and to answer any questions you may have before and after testing.

Genetic counselors are health professionals trained in the areas of medical genetics and counseling. Genetic counselors are trained to help persons as they consider testing, when they receive the results, and in the weeks and months afterward.

When deciding whether or not to have a genetic test for you or your child, several issues should be considered. In addition to the medical issues, genetic testing also raises some social, ethical, and legal issues you should be aware of. Below is a list of some of the issues you should discuss with your physician or genetic counselor:

What treatments are available for this genetic disease? What impact would the genetic test results have on my family? What happens if the results are uncertain or inconclusive? What are the risks for future pregnancies? What is the cost of the test and will my insurance cover it? Who will have access to the test results? What emotional support services are available? Do other family members have a right to know the test results? What is the risk of discrimination by my employer or insurer?

Uses of Genetic Testing

2

Genetic tests can be used for many different purposes.

Newborn screening is the most widespread use of genetic testing [See Chapter 4 for more information about newborn screening]. Almost every newborn in the U.S. is screened for

several genetic diseases. Early detection of these diseases can lead to interventions to prevent the onset of symptoms or minimize disease severity.

Carrier testing can be used to help couples to learn if they carry—and thus risk passing to their children—an allele for a recessive condition such as cystic fibrosis, sickle cell anemia, and Tay-Sachs disease. This type of testing is typically offered to individuals who have a family history of a genetic disorder and to people in ethnic groups with an increased risk of specific genetic conditions. If both parents are tested, the test can provide information about a couple’s risk of having a child with a genetic condition.

Prenatal diagnostic testing is used to detect changes in a fetus’s genes or chromosomes. This type of testing is offered to couples with an increased risk of having a baby with a genetic or chromosomal disorder. A tissue sample for testing can be obtained through amniocentesis or chorionic villus sampling.

Genetic tests may be used to confirm a diagnosis in a symptomatic individual or used to monitor prognosis of a disease or response to treatment.

Predictive or predispositional genetic testing can identify individuals at risk of getting a disease prior to the onset of symptoms. These tests are particularly useful if an individual has a family history of a specific disease and an intervention is available to prevent the onset of disease or minimize disease severity. Predictive testing can identify mutations that increase a person’s risk of developing disorders with a genetic basis, such as certain types of cancer.

[edit] Types of Genetic Testing

3

Several different methods are currently used in genetic testing laboratories. The type of test will depend on the type of abnormality that is being measured. In general, three major types of genetic testing are available: cytogenetic, biochemical, and molecular testing.

[edit] Cytogenetic Testing

Cytogenetics involves the examination of whole chromosomes for abnormalities. Chromosomes of a dividing human cell can be clearly analyzed under a microscope. White blood cells, specifically T lymphocytes, are the most readily accessible cells for cytogenetic analysis since they are easily collected from blood and are capable of rapid division in cell culture. Cells from other tissues such as bone marrow (for leukemia), amniotic fluid (prenatal diagnosis), and other tissue biopsies can also be cultured for cytogenetic analysis.

Following several days of cell culture, chromosomes are fixed, spread on microscope slides, and then stained. The staining methods for routine analysis allow each of the chromosomes to be individually identified. The distinct bands of each chromosome revealed by staining allow for analysis of chromosome structure.

[edit] Biochemical Testing

The enormous numbers of biochemical reactions that routinely occur in cells require different types of proteins. Several classes of proteins exist to fulfill multiple functions, such as enzymes, transporters, structural proteins, regulatory proteins, receptors, and hormones. A mutation in any type of protein can result in disease if the mutation results in failure of the protein to correctly function.

Clinical testing for a biochemical disease utilizes techniques that examine the protein instead of the gene. Tests can be developed to directly measure protein activity (enzymes), level of metabolites (indirect measurement of protein activity), and the size or quantity of protein (structural proteins). These tests require a tissue sample in which the protein is present, typically blood, urine, amniotic fluid, or cerebrospinal fluid. Because proteins are more unstable than DNA and can degrade quickly, the sample must be collected, stored properly, and shipped promptly according to the laboratory’s specifications.

[edit] Molecular Testing

4

For small DNA mutations, direct DNA testing may be the most effective method, particularly if the function of the protein is not known and a biochemical test cannot be developed. A DNA test can be performed on any tissue sample and requires very small amounts of sample. Some genetic diseases can be caused by many different mutations, making molecular testing challenging. For example, more than 1,000 mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene can cause cystic fibrosis (CF). It would be impractical to sequence the entire CFTR gene to identify the causative mutation since the gene is quite large. However, since the majority of CF cases are caused by approximately 30 mutations, this smaller group of mutations is first tested before more comprehensive testing is performed.

Limitations to Genetic Testing

While the physical risks associated with most forms of genetic testing are small, since some tests only require a blood sample or buccal smear (retrieved from the inside of the cheek), there are many psychological, social, and financial effects on a person’s life that should be taken into consideration.

See Also

Ethical, Legal, and Social Issues Pregnancy Screening / Reproductive Screening Inheritance

5

Repair of DNA PhotoreactivationOrganisms have evolved at least four processes for repairing UV damage in DNA: photoreactivation, excision, error-prone, and recombination repair. Depending on the type of organism and the nature of the UV damage, these processes may successfully repair damage, partially repair the damage and create a mutation, or fail to work at all.The simplest process for repair of pyrimidine dimers is called photoreactivation which, as the name suggests, requires light. Photoreactivation is catalyzed by a single protein called photolyase, which uses the energy in a photon of light to chemically break apart a pyrimidine dimer in DNA. Photoreactivation probably represents the earliest type of UV repair system because many species, from bacteria through marsupials share the enzyme responsible. Humans and other placental mammals do not seem to have a photoreactivation process, but the gene which codes for photolyase has been conserved and may have evolved to play a role in the excision repair process. The PHR1 gene encoding photolyase is defective in the sensitive strain used in the experiments.

Excision repairIn excision repair, the region of DNA containing the dimer or other damage is physically cut out and then replaced by new DNA synthesis (Figure 1). Excision repair has more steps and requires more enzymes than photoreactivation, but it can work on damage created by agents other than UV and on lesions other than pyrimidine dimers. In Escherichia coli bacteria, excision repair requires six proteins: three are involved in finding the damaged region of the DNA and cutting the DNA strand around the lesion; one participates in removing the damaged bit; DNA polymerase replaces the portion which was removed; and a final enzyme called DNA ligase glues the new and old portions back together. Mutations in the genes coding for any of these proteins will interfere with the process and cause the mutant bacterium to be highly sensitive to killing and mutation by UV light. The excision repair system probably repairs a large amount of UV damage.In yeast and other eukaryotes, DNA is wrapped up in more complicated structures than in bacteria, which may explain why these organisms seem to need more proteins to carry out excision repair. In yeast, at least twelve proteins may participate in excision repair. Researchers originally identified many of these by finding mutants unable to repair UV damage. We don't yet know the functions of all of these proteins, but scientists very recently found that the RAD1 and RAD10 gene products may act together in cutting DNA near dimers and that the RAD3 gene product is needed to identify dimers to the other repair proteins. These genes have close counterparts in humans: for example, the protein made by the RAD3 gene has

6

the same sequence of amino acids in over 50% of the positions as the product of its human counterpart, ERCC2. People with mutations in ERCC2 are very sensitive to sunlight and suffer from the disease xeroderma pigmentosum. Yeast with mutations in RAD3 are very sensitive to UV and are killed or mutated by very low doses of UV. RAD1 is mutated in the sensitive strain G948-1C/U.

Error-prone repairThe excision process described in the previous section is mostly accurate, or error-free. Sometimes, however, mistakes are made when a cell tries to repair a lesion in its DNA. In the case of pyrimidine dimers, mistakes may happen when two dimers are near each other on opposite strands of the DNA (Figure 2). If the cell tries to do excision repair, it won't know how to copy the dimer when it tries to carry out the repair DNA synthesis because the dimer is not a normal part of DNA. It might make a mistake rather than not repair the gap in the DNA. Sometimes, unfortunately, an error-prone process is the only way to repair DNA damage. Most mutations arising after UV treatment of cells are the result of error-prone repair of the DNA lesions. In yeast, we know of several genes whose products are required for error-prone repair; one of them, RAD18, is mutated in the sensitive strain used in the experiments.

Recombinational repairWhen pyrimidine dimers block DNA replication in a eukaryotic chromosome, the polymerase can start replication at other places further downstream. The result of replicating a DNA molecule or chromosome containing a dimer is thus a gap in one strand of the DNA where the dimer blocked a portion from being copied (Figure 3). A gap in DNA means that one strand is missing information; the strand must be repaired before the cell divides. The most frequent way that cells fill such a gap is by genetic recombination with another DNA molecule or chromosome containing the same or similar information. The recombinational repair system is a fourth process involved in repair of UV damage to DNA. The genes which make the proteins functioning in this system have been identified because mutations in them block recombination. One important member of this group is the RAD51 gene, which makes a protein that can help DNA molecules find their similar partners and begin recombination.

Figure 1: Steps in Excision Repair

Figure 2: Steps in Error-prone Repair

Figure 3: Steps in Recombinational Repair

Step 1: DNA with dimer is replicated, leaving a gap in one daughter molecule.

Step 2: Recombination with other daughter molecule fills gap by transfer of good strand.

7

Step 3: DNA replication fills gap in donor daughter molecule.

 

Biochemistry 3107 - Fall 2001

8

DNA Repair

Direct Reversal

Direct repair systems reverse the mutagenic event. They are relatively rare. Examples are the photoreactivation repair system which can reverse the UV induced pyrimidine dimer formation and the removal of methyl groups by methyltransferases.

Pyrimidine dimers can be recognized by the enzyme photolyase which binds to the photodimer and, in the presence of visible light in the range 300-500 nm, will split the dimer.

[24-27]

 

Excision of the modified base

Bases which have been modified by alkylation or deamination may be removed from DNA by special DNA glycosylases.

[24-29] [S31-44]

Each type of modified base has a corresponding DNA glycosylases which removes the base leaving an apurinic or apyrimidinic site in the DNA. These sites are then recognized by AP endonucleases which remove the ribose-phosphate moiety from the backbone. The resulting gap can be reapired by DNA polymerase I and DNA ligase.

The following table lists a number of DNA glycosylases and their activities:

 Glycosylase  Base(s) recognized Ura-DNA glycosylase  Uracil Hmu-DNA glycosylase  Hydroxymethyl uracil 5-mC-DNA glycosylase  5-methylcytosine

 FaPy-DNA glycosylase  Formamidopyrimidines 8 hydroxyguanine

 5,6-HT--DNA glycosylase (endonuclease III)  5,6 hydrated thymines

 

9

Excision of modified nucleotides - Nucleotide Excision Repair

The Nucleotide Excision Repair pathway involves the removal of a short stretch of nucleotides containing a major distortion in the DNA double helix (including that caused by pyrimidine dimers). This pathway requires the uvrABC encoded excinuclease, a helicase encoded by uvrD, and DNA polymerase I.

[24-28] [S31-43]

 

UvrA is both an ATPase and a DNA-binding protein (it contains Zn-finger motifs). It functions as a dimer and it recognizes and binds to damaged DNA. The function of UvrA is to lead UvrB to the site of damage.

UvrB is an endonuclease and an ATPase, although the ATPase activity is cryptic and is only revealed when it is complexed with UvrA.

UvrC then binds to UvrB. This complex nicks the DNA on either side of the lesion or damage. UvrC nicks DNA about 7 nucleotides on the 5' side of the damage; UvrB nicks DNA about 4 nucleotides on the 3' side of the damage.

The UvrD helicase binds to this region and unwinds it. By so doing, it displaces the short single strand carrying the site of the damage. In total a region of 12-13 nucleotides is removed.

 

This region is then repaired by DNA polymerase I and DNA ligase.

 

Fidelity of DNA Replication

The process of DNA replication is remarkably accurate. Errors occur only once every 109 - 1010 nucleotides incorporated.

DNA polymerases, however, are not nearly so accurate. They make mistakes once every 104 - 105 nucleotides incorporated. The proofreading activity of a polymerase will improve the overall error rate by 102 - 103 but this still leaves a difference of 102 - 103 in the error rates between DNA synthesis and replication.

This difference is accomodated by mismatch repair systems which quickly fix any errors made during replication.

 

10

Excision of modified nucleotides - DNA Mismatch Repair

This classic repair system is required to repair errors that escape detection by the proof-reading systems during DNA replication. DNA Mismatch repair systems can distinguish newly-synthesized DNA from parental DNA by virtue of the fact that the newly-synthesized DNA strands are non-methylated while parental DNA strands are methylated.

DNA in which one strand is methylated and the other non-methylated is described as hemimethylated.

Methylation of DNA is due to the activity of the dam methylase which methylates adenine bases in the sequence GATC. The importance of this methylation for maintaining the integrity of bacterial DNA is confirmed by the observation that dam- strains of E. coli have increased rates of spontaneous mutation.

The mismatch repair system can act at a distance - in other words, a mismatch can be repaired even though the nearest hemimethylated site is 1000 bp away.

Repair requires the products of the mutS, mutL and mutH genes which are believed to function as a complex. These genes were originally identified as MUTATOR genes since mutations in these genes will result in defective repair systems with the consequence that the cells will have a higher rate of spontaneous mutation than usual.

MutS recognizes and binds at the site of a base pair mismatch.

MutH binds at a hemimethyalted GATC sequence and cleaves the nonmethylated strand.

MutL is thought to act as a linker protein which binds MutS and MutH in a complex.

The DNA between the nick caused by MutH and the site of the mismatch is removed by exonuclease I or by exonuclease VII. The UvrD helicase is also involved. The resulting gap is repaired by DNA polymerase III and DNA ligase.

[S31-45]

FROM: J. Jiricny (1998) Replication

11

errors: cha(lle)nging the genome. EMBO J. 7:6427-6436.NOTE: The above image may be restricted to users

from licensed or registered sites.

View the MutS Exhibit from the Online Macromolecular Museum.

View the MutH Exhibit from the Online Macromolecular Museum.

 

Repair and Cancer

In humans, at least one form of cancer is now known to be associated with a genetic defect in a gene whose product is likely to function in a mismatch repair system.

Human nonpolyposis colorectal cancer is associated with defects in a human counterpart to MutS (HNPCC Type 1) or MutL (HNPCC Type 2).

Genetic polymorphisms linked to HNPCC (type 1) were identified in a Newfoundland family and in a New Zealand family. Further isolation and sequencing of the locus identified it as coding for a homolog of MutS. Work to characterize the linkage in the Newfoundland family was carried out by Jane Green in the Faculty of Medicine at MUN. Subsequent work by Terry-Lynn Young identified a second family.

Online Mendelian Inheritance in Man entry on HNPCC (TYPE 1)

Genetic polymorphisms linked to HNPCC (type 2) have been identified in a locus identified coding for a homolog of MutL.

Online Mendelian Inheritance in Man entry on HNPCC (TYPE 2)

 

Recombination and Repair

The repair system known as postreplication repair permits the cell to tolerate damage without actually repairing it. It depends on the mechanisms of homologous genetic recombination to replace a damaged region of DNA that cannot be repaired with a good copy of the same region.

[24-30]

An example or model showing how this system might operate is as follows.

Let us suppose that a DNA molecule has acquired a thymine dimer:

 

12

 

Now also supose that this molecule is being replicated. A PolIII replisome will be unable to correctly copy the thymine dimer. Rather than stall at this point, it may simply skip over the problem:

 

 

It is now believed that DNA polymerase II (PolII) reinitiates DNA synthesis downstream of lesions such as thymine dimers.

Now, we are left with two daughter molecules, one of which is complete and one of which has an unpaired region containing a thymine dimer:

 

 

This cannot be repaired by the usual repair systems. However, the exposed ssDNA can be bound by the RecA protein which can then catalyse strand exchange with the correctly synthesised daugthter molecule:

 

13

 

This intermediate contains two Holliday junctions which can be cleaved (resolved) by the Ruv proteins to give:

 

 

One daughter molecule still contains the thymine dimer but the opposite strand has the correctgenetic sequence. The other daughter now conatins a gap but this gap can be repaired correctly by the usual repair systems.

Note, that under stress conditions, DNA polymerase V (see below) can copy thymine dimers. However, it often misincorporates a guanine nucleotide opposite the second thymine. This accounts for the observation that a thymine dimers (and, specifically, the second base of the dimer) is a hotspot for A -> G transitions.

 

SOS Repair

The SOS repair system is induced in response to major damage to the bacterial DNA or in response to agents which inhibit DNA replication. The system is a complex one with over 20 genes involved. Two of these are the important regulator genes: lexA and recA.

[Figure 10-17 from Snyder & Champness, Molecular Genetics of Bacteria]

LexA is a repressor that regulates the expression of all of the other SOS repair genes, including recA. It also regulates its own synthesis (i.e. it is autoregulatory). Normally, LexA blocks expression of the SOS repair genes.

The RecA protein is a multifunctional protein with ATPase and ssDNA binding activities. When bound by ssDNA, it is also a co-protease. Damage or severe stress to the cell generates ssDNA which activates this co-protease activity. The RecA co-protease

14

activity then stimulates the protease activity of the LexA protein. As a result, LexA is no longer able to block transcription and the SOS repair genes are thereby induced and expressed.

Among the genes that are induced are uvrABC and D and also umuC and umuD. UmuD is cleaved by the RecA coprotease activity and the truncated protein, UmuD', in association with UmuC forms DNA polymerase V. PolV requires the and subunit of PolIII for optimal activity. , which functions as the sliding clamp, is required for processivity and is the clamp loader. DNA synthesis by PolV is error-prone.

 

RESOURCE MATERIALVOET, VOET & PRATT

1. Chapter 24, DNA Replication, Repair and Recombination, pages 798 - 801

STRYER 1. Chapter 31, DNA Structure, Replication, and Repair, pages 811-813

LEHNINGER 1. Chapter 24, DNA Metabolism, pages 831 - 839

TAMARIN 1. Chapter 16, pages 472 - 480.

WEB SITES View the MutS Exhibit from the Online Macromolecular Museum.

View the MutH Exhibit from the Online Macromolecular Museum.

Format and Original Material © Martin E. Mulligan, 1996-2001

15

Marita Cohn

Molecular genetics of telomeres and telomerase

Project description

Telomeres are the terminal protein-DNA complexes of linear eukaryotic chromosomes, and are essential to ensure chromosome integrity and stability. Broken chromosome ends, lacking telomeres, show a propensity to fuse with each other and are also susceptible to degradation by exonucleases. Among a wide variety of eukaryotic species, the telomeric DNA consists of typically G-rich tandem

16

repeats, 5-8 bp in length. These repeats are synthesized by telomerase, a telomere-specific RNP polymerase, which uses an internal RNA moiety as a template sequence for this procedure. In a reverse-transcriptase like manner, telomerase copies part of this RNA sequence into DNA.

The mechanism of telomere elongation by telomerase. In this example the telomerase enzyme is synthesizing the repeated sequence TTGGGG, which is the telomeric sequence of Tetrahymena thermophila.

The first detection of telomerase activity, in the ciliate Tetrahymena thermophila, was followed by its detection in a variety of organisms including vertebrates, yeast, and plants. In the absence of telomerase activity, telomeres shorten with each cell division. Normal human somatic cells lack detectable telomerase activity, whereas telomerase is activated in germ cells, immortalized cells and the majority of primary tumors. The correlation between telomerase activity and tumor growth has spurred investigations of the possiblities to use telomerase activity as a target for anticancer drug treatments.

Our identification of much longer telomeric repeat units (16-26 bp) in several yeast species has expanded the previous

17

range of telomeric repeat sequences to include not only more complex sequences, but also ones that are not necessarily G-rich. Despite a marked telomeric sequence diversity, all the yeast species examined show a conserved core. This may be partly explained by the preservation of a binding site for the RAP1 protein.

The length of telomeres are regulated, so that each species has a defined average mean length. The RAP1 protein has been shown to play a key role in a negative-feedback mechanism that controls the length of telomeric repeat tracts in yeast. A model has been proposed where the number of bound RAP1 protein molecules is sensed by the cell, and is used to measure the length of the telomere tract.

The "protein counting" model for telomere length regulation. The RAP1 proteins bind to the telomeric DNA. When a threshold number is reached, further telomere elongation by telomerase is inhibited.

How the "protein counting" mechanism is mediated is still largely unknown, but it has been proposed that the binding of a critical number of RAP1 protein molecules alters the shape of telomeres so that the telomerase enzyme can no longer access the end. When the telomeres shorten and the number of protein molecules decrease, the enzyme would regain its ability to bind and elongate the telomere. Several other yeast telomere binding proteins are involved in the assembly of the functional telomere cap of the yeast chromosome, and are implicated in the regulation of telomere length. How the actions of these proteins are

18

coordinated to maintain telomeres within a defined range has yet to be determined.

The telomeric DNA sequences are bound by a number of different proteins which build up a protective cap on the chromosome. The RAP1 protein has been shown to regulate the length of the telomere, probably by controlling the access of telomerase to the end of the chromosome.

We have analyzed the Rap1p protein counting mechanism in two other yeast species; Saccharomyces castellii and Saccharomyces dairenensis, and have shown that they have RAP1 proteins with homologous functions. These species offer an advantage in the prediction of the number of bound Rap1p molecules, because they have homogeneously repeated telomeric DNA sequences, and thus constitute valuable new models for the analyses of the protein counting mechanism.

Fundamental knowledge of telomere maintenance will be of importance for the establishment of the role of telomerase in tumorigenesis. In our project we are characterizing the telomerase enzyme and the mechanisms of its DNA synthesizing activity, and we want to determine what factors that interact with telomerase to regulate its biochemical activity. We recently isolated the S. castellii CDC13 homolog (scasCDC13) and determined that the full-length protein specifically binds single-stranded telomeric DNA.

19

The minimal binding site is an octamer sequence which overlaps the Rap1 binding site. The four nucleotides of most importance for the sequence specific binding were found to be conserved among telomeric sequences of various different species, including those in human telomeres. Thus, further analysis of scasCdc13p function is promising interesting data on the details of the molecular mechanisms involved in telomere maintenance.

Telomerase is an enzyme that adds specific DNA sequence repeats ("TTAGGG" in all vertebrates) to the 3' ("three prime") end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. The telomeres contain condensed DNA material, giving stability to the chromosomes. The enzyme is a reverse transcriptase that carries its own RNA molecule, which is used as a template when it elongates telomeres, which are shortened after each replication cycle. Telomerase was discovered by Carol W. Greider and Elizabeth Blackburn in 1985 in the ciliate Tetrahymena.[1] There are some indicators that telomerase is of retroviral origin.[2]

Why do some cancer cells divide not into two, as cells are supposed to do in mitosis, but into three-four new cells that look thoroughly abnormal? This question was raised as early as the 1890s by the German tumor researcher David Hansemann, who could observe the strange mitosis even using the microscopes of his day. Now another David, Lund University researcher David Gisselsson, has found an answer.

Together with associates from the Section for Clinical Genetics, David Gisselsson has long been studying chromosome changes in various sorts of cancer cells. Contrary to the earlier belief that tumor cells are rather stable genetically, a few years ago he was able to show that genetic chaos prevails in certain severe cancer forms.

"The normal number of chromosomes in a human cell is 46. But in tumors from skeletal and pancreatic cancer, some cells can have far fewer than 46 chromosomes while others have several hundred. The structure of these chromosomes is also often abnormal-for example, they have lost some parts, traded segments with each other, and copied certain genes in mass production," says David Gisselsson.

The Lund scientists have scrutinized these phenomena in a series of studies. They have been able to demonstrate that certain tumor cells get stuck in mitosis, so that their chromosomes do not divide neatly in two directions,

20

but rather get pulled apart in a disorganized manner into the daughter cells. This is because the ends of the chromosomes, the so-called telomers, have lost their protective exteriors.

Cells with truncated, unprotected telomers from different chromosomes actually ought to simply die, but this does not happen in these tumor cells. Instead, the naked telomers cling to each other. This can be the explanation for the abnormal number of chromosomes in some tumor cells, where certain ones have incorporated a number of extra chromosomes while others wind up with too few.

Having the wrong number of chromosomes does not lead directly to death in these tumor cells. On the other hand, they have problems with mitosis.

"We have observed that these cells sometimes try to divide, but they fail and go into an idle state. If they then try again, they tend to divide in three or four directions. This explains Hansemann's discovery from the 1890s!" says David Gisselsson.

In its latest study the Lund team has also shown that the daughter cells of those cells which divide in more than two directions have a completely random distribution of chromosomes. This genetic chaos is so great that the cells usually die.

Research groups in several countries have been studying von Hansemann mitosis at the molecular level, that is, what happens inside the cell. But this work has proven to have little relevance to the struggle against cancer. These are not the cells that make a tumor grow, since they themselves typically die off.

On the other hand, the Lund team now wishes to study substances that might be able to counteract cancer by further damaging already truncated telomers. In that way it may be possible to increase the genetic chaos in tumor cells in order to get more of them to simply die.

Copyright 1998 by Beth A. Montelone, Ph. D., Division of Biology, Kansas State University; originally written as a supplement to BIOL400, Human Genetics.

21

Mutation, Mutagens, and DNA Repair

Outline

I. Introduction: Definitions and mutation rates

We have been using the term 'mutation' pretty loosely up to this point in the course...now we need to define it more precisely: mutation-- a change in the genetic material (ie. DNA). We are going to spend some time talking about how mutations can occur and what their consequences may be to cells; we will also be looking at the ways in which cells avoid mutations by repairing DNA damage.

Why this focus? Why are mutations important? There are several reasons: 1) they may have deleterious or (rarely) advantageous consequences to an organism (or its descendants); 2) they are important to geneticists: the most common way we study something is to break it--ie., we search for or make a variant (mutant) lacking the ability to perform a process which we want to study. These genetic variants possess mutant alleles of the genes we are interested in studying. 3) Mutations are important as the major source of genetic variation which fuels evolutionary change (as we will see later when we talk about population genetics and evolution).

Let's further define mutation as a heritable change in the genetic material. This point becomes important in multicellular organisms where we must distinguish between changes in gametes (germline mutations) and changes in body cells (somatic mutations). The former are passed on to one's offspring; the latter are not but we will see they can be very important in causing cancer.

In detection of germline mutations in humans and measurement of human mutation rates we have the problem of diploidy. Most forward mutations (normal gene to mutant form) are recessive and so won't be detected unless a zygote gets two copies of the mutant allele. [Reversion or reverse mutation (mutant back to normal) is generally much less frequent because there are a lot more ways to "break" a gene than there are to reverse an existing mutation.] So how can we detect and measure rates of new mutations? We

22

can look at dominant mutations on occuring on the autosomes and at both recessive and dominant mutations on the X chromosome, since males are hemizygous for X-linked genes. Example: achondroplasia occurs sporadically (in families with no previous history) as a result of new mutations in the gene for the fibroblast growth factor receptor. One study detected seven infants born with sporadic achondroplasia in one year among 242,257 total births recorded. So the rate (actually a frequency but we won't be concerned about the difference for the purposes of thinking about rates in this course) is 7/242,257 x 1/2 (2 alleles per zygote) = 1.4 x 10e-5.

This rate is roughly in the middle of the range reported for various human genes: those with high mutation rates like NF1 (neurofibromatosis type 1) and DMD (Duchenne muscular dystrophy) (ca. 1 x 10e-4) and those with low rates of new mutation like the Huntington's Disease gene (1 x 10e-6). This hundred-fold range shows that mutation rates per gene can be intrinsically different.

Why might this be? Two possible explanations are: 1) target size and 2) hot spots. Some genes are large, meaning that there are many bases at which mutations could alter or disrupt their function. The large target argument could well be responsible for the high rates of mutation of the NF and DMD genes, as these are known to have very large protein coding regions. Alternatively, some genes may be in regions of chromosomes which are more susceptible to genetic damage/change or may contain sequences which are more likely to be altered by spontaneous mutations; the achondroplasia gene is known to contain a hot spot of the latter type (a CpG sequence, discussed below).

From studies like these in vivo and others using human cells in vitro, the overall human mutation rate is estimated to be about 1 x 10e-6 per gene per generation. (Therefore the HD gene rate is probably more typical than the other genes mentioned above.) This rate is similar to those measured in various prokaryotic and eukaryotic microorganisms. We can use the estimated human mutation rate to determine its impact on the likelihood of changes occurring in each generation: a rate of 1 x 10e-6 mutations/gene x 5 x 10e4 genes/haploid genome = 5 x 10e-2 mutations per gamete (=5/100 or 1/20). 1/20 x 2 gametes per zygote = 1/10 chance that each zygote carries a new mutation somewhere in the genome. This seems like a very high number but we need to remember that most mutations are recessive and thus will not be expressed in the heterozygous condition.

23

II. Types of Mutations

Mutations, or heritable alterations in the genetic material, may be gross (at the level of the chromosome, which we have already discussed) or point alterations (this technically means mutations not visible as cytological abnormalities and/or those which map to a single "point" in experimental crosses). The latter can involve just a single nucleotide pair in DNA. In this section, we will be considering small changes in DNA, of the point mutation type.

A. Base pair (nucleotide pair) substitutions

These are of two types: transitions (purine to purine or pyrimidine to pyrimidine) and transversions (purine to pyrimidine or pyrimidine to purine). We break these down into the two categories because they can occur in different ways.

The consequences of base substitution mutations in protein coding regions of a gene depend on the substitution and its location. They may be silent, not resulting in a new amino acid in the protein sequence, eg. GCA or GCG codons in mRNA both mean arginine [this is often true in the third position of a codon, especially with transitions because of "wobble" base pairing]. A base substitution could also result in an amino acid substitution; this is referred to as a missense mutation. For example, CTC in the DNA sense strand [GAG in mRNA] will specify a glutamate residue in the protein; this is altered to CAC in the DNA or GUG in the mRNA, resulting in a valine residue in the beta-globin protein chain causing sickle-cell anemia. Missense mutations may have very serious consquences, as in the case of sickle-cell anemia, mild consequences as in the case of hemoglobin C (a different amino acid substitution in position 6 of beta-globin) or no phenotype as in the case of two known amino acid substitutions at position 7 of beta-globin. Finally, base substitutions in a protein coding region may mutate an amino acid codon to a termination codon or vice versa. The former type, which results in a prematurely shortened protein is referred to as a nonsense mutation. The effects of nonsense mutations are variable depending upon how much of the truncated protein is present and is required for its function.

Base substitution mutations may also occur in promoters or 5' regulatory regions of genes or in introns and may affect their transcription, translation, or splicing. Many of the beta-thalassemias are the result of these types of

24

non-structural mutations that affect the level of expression of the globin genes. All of the types of mutation described above have been observed in human globin genes. Their consequences depend on what they do to the level of expression of the gene product and/or on what amino acid substitution may have occurred and where it is in the protein.

B. Frameshift mutations

These result from the insertion or deletion of one or more (not in multiples of three) nucleotides in the coding region of a gene. This causes an alteration of the reading frame: since codons are groups of three nucleotides, there are three possible reading frames for each gene although only one is used.

eg. mRNA with sequence AUG CAG AUA AAC GCU GCA UAAamino acid sequence from the first reading frame: met gln ile asn ala ala stopthe second reading frame gives: cys arg stop

A mutation of this sort changes all the amino acids downstream and is very likely to create a nonfunctional product since it may differ greatly from the normal protein. Further, reading frames other than the correct one often contain stop codons which will truncate the mutant protein prematurely.

III. Origins of spontaneous mutation

A. Definition and sources

A spontaneous mutation is one that occurs as a result of natural processes in cells. We can distinguish these from induced mutations; those that occur as a result of interaction of DNA with an outside agent or mutagen. Since some of the same mechanisms are involved in producing spontaneous and induced mutations, we will consider them together. Some so-called "spontaneous mutations" probably are the result of naturally occurring mutagens in the environment; nevertheless there are others that definitely arise spontaneously, for example, DNA replication errors.

B. DNA replication errors and polymerase accuracy

Mistakes in DNA replication where an incorrect nucleotide is added will lead to a mutation in the next round of DNA replication of the strand with the incorrect nucleotide.The frequency at which a DNA polymerase makes mistakes (inserts an incorrect base) will influence the spontaneous mutation

25

frequency and it has been observed that different polymerases vary in their accuracy. One major factor affecting polymerase accuracy is the presence of a "proofreading" 3'-5' exonuclease which will remove incorrectly paired bases inserted by the polymerase. This was shown in vitro with purified DNA polymerases (those with 3'-5' exonucleases make fewer mistakes) and genetically by Drake with bacteriophage T4 mutants: T4 has its own polymerase with a 3'-5' exo. Drake isolated mutator mutants (which had a higher spontaneous mutation rate than normal) and antimutator mutants (lower mutation rate than normal) in the polymerase gene and showed that the mutators had a higher ratio of polymerizing to exonuclease activity than normal and that the antimutators had a lower ratio. These studies showed that the function of the 3'-5' exonuclease is to prevent misincorporation during DNA replication and to prevent mutations. Mutator mutants have since been isolated in other organisms and have been shown to affect various components of the DNA replication complex; alterations in a number of these proteins are likely to affect the accuracy of the system.

C. Base alterations and base damage

The bases of DNA are subject to spontaneous structural alterations called tautomerization: they are capable of existing in two forms between which they interconvert. For example, guanine can exist in keto or enol forms. The keto form is favored but the enol form can occur by shifting a proton and some electrons; these forms are called tautomers or structural isomers. The various tautomer forms of the bases have different pairing properties. Thymine can also have an enol form; adenine and cytosine exist in amino or imino forms. If during DNA replication, G is in the enol form, the polymerase will add a T across from it instead of the normal C because the base pairing rules are changed (not a polymerase error). The result is a G:C to A:T transition; tautomerization causes transition mutations only.

Another mutatgenic process occurring in cells is spontaneous base degradation. The deamination of cytosine to uracil happens at a significant rate in cells.

Deamination can be repaired by a specific repair process which detects uracil, not normally present in DNA; otherwise the U will cause A to be inserted opposite it and cause a C:G to T:A transition when the DNA is replicated.

26

Deamination of methylcytosine to thymine can also occur. Methylcytosine occurs in the human genome at the sequence 5'CpG3', which is normally avoided in the coding regions of genes. If the meC is deaminated to T, there is no repair system which can recognize and remove it (because T is a normal base in DNA). This means that wherever CpG occurs in genes it is a "hot spot" for mutation. Such a hot spot has recently been found in the achondroplasia gene.

A third type of spontaneous DNA damage that occurs frequently is damage to the bases by free radicals of oxygen. These arise in cells as a result of oxidative metabolism and also are formed by physical agents such as radiation. An important oxidation product is 8-hydroxyguanine, which mispairs with adenine, resulting in G:C to T:A transversions.

Still another type of spontaneous DNA damage is alkylation, the addition of alkyl (methyl, ethyl, occasionally propyl) groups to the bases or backbone of DNA. Alkylation can occur through reaction of compounds such as S-adenosyl methionine with DNA. Alkylated bases may be subject to spontaneous breakdown or mispairing.

D. Spontaneous frameshift mutations

Streisinger observed in the 1960's that frameshift mutations in bacteriophages tended to occur in areas with "runs" of repeats of one nucleotide.

Example:5' AGTCAATCCATGAAAAAATCAG 3'3' TCAGTTAGGTACTTTTTTAGTC 5'

He proposed that these frameshifts are the result of "slipped mispairing" between the template DNA strand and the newly synthesized strand during DNA replication. In the sequence above, a likely spot for frameshift mutations to occur would be in the stretch of 6 A:T base pairs. Subsequent studies with genes from other organisms, including humans, have shown that runs of repeated nucleotides are indeed hotspots for frameshift mutations.

27

IV. Mutagens

A mutagen is a natural or human-made agent (physical or chemical) which can alter the structure or sequence of DNA.

A. Chemical mutagens

28

The first report of mutagenic action of a chemical was in 1942 by Charlotte Auerbach, who showed that nitrogen mustard (component of poisonous mustard gas used in World Wars I and II) could cause mutations in cells. Since that time, many other mutagenic chemicals have been identified and there is a huge industry and government bureaucracy dedicated to finding them in food additives, industrial wastes, etc.

It is possible to distinguish chemical mutagens by their modes of action; some of these cause mutations by mechanisms similar to those which arise spontaneously while others are more like radiation (to be considered next) in their effects.

1. Base analogsThese chemicals structurally resemble purines and pyrimidines and may be incorporated into DNA in place of the normal bases during DNA replication:

bromouracil (BU)--artificially created compound extensively used in research. Resembles thymine (has Br atom instead of methyl group) and will be incorporated into DNA and pair with A like thymine. It has a higher likelihood for tautomerization to the enol form (BU*)

aminopurine --adenine analog which can pair with T or (less well) with C; causes A:T to G:C or G:C to A:T transitions. Base analogs cause transitions, as do spontaneous tautomerization events.

2. Chemicals which alter structure and pairing properties of basesThere are many such mutagens; some well-known examples are:

nitrous acid--formed by digestion of nitrites (preservatives) in foods. It causes C to U, meC to T, and A to hypoxanthine deaminations. [See above for the consequences of the first two events; hypoxanthine in DNA pairs with C and causes transitions. Deamination by nitrous acid, like spontaneous deamination, causes transitions.

nitrosoguanidine, methyl methanesulfonate, ethyl methanesulfonate--chemical mutagens that react with bases and add methyl or ethyl groups. Depending on the affected atom, the alkylated base may then degrade to yield a baseless site, which is mutagenic and recombinogenic, or mispair to result in mutations upon DNA replication.

3. Intercalating agentsacridine orange, proflavin, ethidium bromide (used in labs as dyes and mutagens)

29

All are flat, multiple ring molecules which interact with bases of DNA and insert between them. This insertion causes a "stretching" of the DNA duplex and the DNA polymerase is "fooled" into inserting an extra base opposite an intercalated molecule. The result is that intercalating agents cause frameshifts.

4. Agents altering DNA structureWe are using this as a "catch-all" category which includes a variety of different kinds of agents. These may be:

--large molecules which bind to bases in DNA and cause them to be noncoding--we refer to these as "bulky" lesions (eg. NAAAF)

--agents causing intra- and inter-strand crosslinks (eg. psoralens--found in some vegetables and used in treatments of some skin conditions)

--chemicals causing DNA strand breaks (eg. peroxides)

What these agents have in common is that they probably cause mutations not directly but by induction of mutagenic repair processes (to be described later).

B. Radiation

Radiation was the first mutagenic agent known; its effects on genes were first reported in the 1920's. Radiation itself was discovered in 1890's: Roentgen discovered X-rays in 1895, Becquerel discovered radioactivity in 1896, and Marie and Pierre Curie discovered radioactive elements in 1898. These three discoveries and others led to the birth of atomic physics and our understanding of electromagnetic radiation.

1. EM spectrumVisible light and other forms of radiation are all types of electromagnetic radiation (consists of electric and magnetic waves). The length of EM waves (wavelength) varies widely and is inversely proportional to the energy they contain: this is the basis of the so-called EM spectrum.

The longest waves (AM radio) have the least energy while successively shorter waves and increasing energy are seen with FM radio, TV, microwaves, infrared, visible, ultraviolet (UV), X and gamma radiation. The portion which is biologically significant is UV and higher energy radiation.

30

2. Ionizing radiationX- and gamma-rays are energetic enough that they produce reactive ions (charged atoms or molecules) when they react with biological molecules; thus they are referred to as ionizing radiation. This term also includes corpuscular radiation--streams of atomic and subatomic particles emitted by radioactive elements: these are of two types, alpha- and beta-particles [alpha are helium nuclei, 2 protons and 2 neutrons; beta are electrons].

UV radiation is not ionizing but can react with DNA and other biological molecules and is also important as a mutagen.

The units now used for ionizing radiation of all types are rems (roentgen equivalent man): 1 rem of any ionizing radiation produces similar biological effects. The unit used previously was the rad (radiation absorbed dose). However, the effects of different types of radiation differ for one rad unit: one rad of alpha particles has a much greater damaging effect than one rad of gamma rays; alpha particles have a greater RBE (relative biological effectiveness) than gamma rays. The relationship between these units is that:

# rads x RBE = # rems

In addition to the energy type and total dose of radiation the dose rate should be considered: the same number of rems given in a brief, intense exposure (high dose rate) causes burns and skin damage versus a long-term weak exposure (low dose rate) which would only increase risk of mutation and cancer.

3. Sources of radiationNatural sources of radiation produce so-called background radiation. These include cosmic rays from the sun and outer space, radioactive elements in soil and terrestrial products (wood, stone) and in the atmosphere (radon). One's exposure due to background radiation varies with geographic location.

In addition, humans have created artificial sources of radiation which contribute to our radiation exposure. Among these are medical testing (diagnostic X-rays and other procedures), nuclear testing and power plants, and various other products (TV's, smoke detectors, airport X-rays).

31

Taken together, our overall total average exposure from all sources is about 350 mrem/year; the major contributor of which is from radon exposure. See the graph on page 281 of your text for the breakdown.

4. Biological effects of radiationIonizing radiation produces a range of damage to cells and organisms primarily due to the production of free radicals of water (the hydroxyl or OH radical). Free radicals possess unpaired electrons and are chemically very reactive and will interact with DNA, proteins, lipids in cell membranes, etc. Thus X-rays can cause DNA and protein damage which may result in organelle failure, block cell division, or cause cell death. The rapidly dividing cell types (blood cell-forming areas of bone marrow, gastrointestinal tract lining) are the most affected by ionizing radiation and the severity of the effects depends upon the dose received. The information below is based upon accidental exposures of nuclear plant workers and victims of atomic bomb explosions such as those in Hiroshima and Nagasaki:

sublethal dose (100-250 rems): nausea and vomiting early; 1-2 wk. latent period followed by malaise, anorexia, diarrhea, hair loss, recovery (latency due to time it takes hematopoetic or other damage to show up)

lethal dose (350-450 rems): nausea and vomiting early; 1 wk. latent period followed by above with more severe symptoms including internal bleeding; a 50% chance of death [LD50 : dose at which half of exposed individuals will die; ca. 400 rems for humans]. Death is due to blood cell or gastrointestinal failure.

supralethal dose (>650 rems): nausea and vomiting early, followed by shock, abdominal pain, diarrhea, fever and death within hours or days. Death is due to heart or CNS damage.

For the affected tissues and organs, the number of destroyed cells and the likelihood of their replacement determines the survival chances. The long term effects include increased cancer risk and increased risk of mutations in one's offspring.

5. Genetic effects of radiationIonizing radiation produces a range of effects on DNA both through free radical effects and direct action:

32

-breaks in one or both strands (can lead to rearrangements, deletions, chromosome loss, death if unrepaired; this is from stimulation of recombination)

-damage to/loss of bases (mutations) -crosslinking of DNA to itself or proteins

The genetic effects of radiation were reported in 1927 in Drosophila by Muller and in 1928 in plants (barley) by Stadler; both showed that the frequency of induced mutations is a function of X-ray dose. Their experiments revealed that there was a linear relationship between X-ray dose and induced mutation level, that there was no threshold or "safe" dose of radiation and that all doses are significant, and finally, that "split dose" experiments showed that the genetic effects of radiation are cumulative.

6. UV (ultraviolet)UV radiation is less energetic, and therefore non-ionizing, but its wavelengths are preferentially absorbed by bases of DNA and by aromatic amino acids of proteins, so it, too, has important biological and genetic effects.

UV is normally classified in terms of its wavelength: UV-C (180-290 nm)--"germicidal"--most energetic and lethal, it is not found in sunlight because it is absorbed by the ozone layer; UV-B (290-320 nm)--major lethal/mutagenic fraction of sunlight; UV-A (320 nm--visible)--"near UV"--also has deleterious effects (primarily because it creates oxygen radicals) but it produces very few pyrimidine dimers. Tanning beds will have UV-A and UV-B. To see a graphic representation of the wavelengths of UV and ozone absorption, click here.

The major lethal lesions are pyrimidine dimers in DNA (produced by UV-B and UV-C)--these are the result of a covalent attachment between adjacent pyrimidines in one strand. This is shown here for a thymine-thymine dimer and here for a thymine-cytosine dimer. These dimers, like bulky lesions from chemicals, block transcription and DNA replication and are lethal if unrepaired. They can stimulate mutation and chromosome rearrangement as well.

V. DNA repair systems

33

Because DNA damage occurs spontaneously and as a result to ubiquitous environmental agents, most organisms possess some capacity to repair their DNA and DNA is the only macromolecule which IS repaired by cells. We can divide "repair" mechanisms into 3 categories:

damage reversal--simplest; enzymatic action restores normal structure without breaking backbone

damage removal--involves cutting out and replacing a damaged or inappropriate base or section of nucleotides

damage tolerance--not truly repair but a way of coping with damage so that life can go on

We will look at examples of each type of repair, the mechanisms, the consequences of mutations in each, in both model organisms and in humans.

A. Damage reversal

1. PhotoreactivationThis is one of the simplest and perhaps oldest repair systems: it consists of a single enzyme which can split pyrimidine dimers (break the covalent bond) in presence of light. Click here to see the photoreactivation reaction.

The photolyase enzyme catalyzes this reaction; it is found in many bacteria, lower eukaryotes, insects, and plants. It seems to be absent in mammals (including humans). The gene is present in mammals but may code for a protein with an accessory function in another type of repair.

2. Ligation of single strand breaksX-rays and some chemicals like peroxides can cause breaks in backbone of DNA. Simple breaks in one strand are rapidly repaired by DNA ligase. Microbial mutants lacking ligase tend to have high levels of recombination since DNA ends are recombinogenic (very reactive). A human known only by the code name of 46BR was found to have mutations in both of her DNA ligase I genes; she had poor growth, immunodeficiency, and sun sensitivity and died at a young age of lymphoma. Fibroblast cells from 46BR are sensitive to killing by DNA damaging agents including ionizing radiation. In addition, the rare hereditary disease Bloom syndrome also somehow is involved with DNA ligase deficiency (although the Bloom syndrome protein

34

is a DNA helicase); patients' cultured cells have high levels of chromosome aberrations and spontaneous mutation.

B. Damage removal

1. Base excision repairThe damaged or inappropriate base is removed from its sugar linkage and replaced. These are glycosylase enzymes which cut the base-sugar bond. example: uracil glycosylase--enzyme which removes uracil from DNA. Uracil is not supposed to be in DNA--can occur if RNA primers not removed in DNA replication or (more likely) if cytosine is deaminated (this is potentially mutagenic). The enzyme recognizes uracil and cuts the glyscosyl linkage to deoxyribose. The sugar is then cleaved and a new base put in by DNA polymerase using the other strand as a template. Mutants lacking uracil glycosylase have elevated spontaneous mutation levels (C to U is not fixed, which leads to transitions) and are hyper-sensitive to killing and mutation by nitrous acid (which causes C to U deamination).

There are other specific glycosylases for particular types of DNA damage caused by radiation and chemicals.

2. Mismatch repairThis process occurs after DNA replication as a last "spellcheck" on its accuracy. In E. coli, it adds another 100-1000-fold accuracy to replication. It is carried out by a group of proteins which can scan DNA and look for incorrectly paired bases (or unpaired bases) which will have aberrant dimensions in the double helix. The incorrect nucleotide is removed as part of a short stretch and then the DNA polymerase gets a second try to get the right sequence.

Human mismatch repair proteins have recently been identified and are very similar to those of the prokaryote E. coli and the simple eukaryote yeast (this is an old invention of cells); mutations are found to be passed in the germline of families with some types of inherited colon cancer (HPNCC).

3. Nucleotide excision repairThis system works on DNA damage which is "bulky" and creates a block to DNA replication and transcription (so--UV-induced dimers and some kinds of chemical adducts). It probably recognizes not a specific structure but a distortion in the double helix. The mechanism consists of cleavage of the

35

DNA strand containing the damage by endonucleases on either side of damage followed by exonuclease removal of a short segment containing the damaged region. DNA polymerase can fill in the gap that results. Excision repair is shown here .

Mutants that are defective in NER have been isolated in many organisms and are sensitive to killing and mutagenesis by UV and chemicals which act like UV. Humans with the hereditary disease xeroderma pigmentosum are sunlight-sensitive, they have very high risks of skin cancers on sun-exposed areas of the body and have defects in genes homologous to those required for NER in simple eukaryotes. NER mutants in lower organisms are UV-sensitive and have elevated levels of mutation and recombination induced by UV (because they are unable to use the accurate NER method to remove pyrimidine dimers and must use mutagenic or recombinogenic systems).

C. DNA damage tolerance

Not all DNA damage is or can be removed immediately; some of it may persist for a while. If a DNA replication fork encounters DNA damage such as a pyrimidine dimer it will normally act as a block to further replication.

However, in eukaryotes, DNA replication initiates at multiple sites and it may be able to resume downstream of a dimer, leaving a "gap" of single-stranded unreplicated DNA. The gap is potentially just as dangerous if not more so than the dimer if the cell divides. So there is a way to repair the gap by recombination with either the other homolog or the sister chromatid--this yields two intact daughter molecules, one of which still contains the dimer.

1. Recombinational (daughter-strand gap) repairThis is a repair mechanism which promotes recombination to fix the daughter-strand gap--not the dimer--and is a way to cope with the problems of a non-coding lesion persisting in DNA. The events of recombinational repair are shown here . This type of recombinational repair is generally accurate (although it can cause homozygosis of deleterious recessive alleles) and requires a homolog or sister chromatid. The products of the human breast cancer susceptibility genes BRCA1 and BRCA2 may be involved in recombinational repair together with homologs of the yeast RAD51 and RAD52 genes.

36

A second type of recombinational repair which is used primarily to repair broken DNA ends such as are caused by ionizing radiation and chemical mutagens with similar action is the non-homologous end-joining reaction. This repair system is also employed by B and T cells of the immune system for genetic rearrangements needed for their function. The Ku70, Ku80, and DNA-dependent protein kinase proteins are needed for non-homologous end-joining. Rodent cell lines with mutations in these genes are very sensitive to killing by ionizing radiation and defective in immune system rearrangement.

2. Mutagenic repair (trans-lesion synthesis)An alternative scenario for a DNA polymerase blocked at a dimer is to change its specificity so that it can insert any nucleotide opposite the dimer and continue replication ("mutate or die" scenario). See the figure . We know that this can happen in bacteria and think that it probably happens in eukaryotes, though the mechanism is not well understood. This is a reason why repair may sometimes cause mutations.

VI. Checkpoints

Ataxia telangiectasia is a human autosomal recessive hereditary disease which causes several defects including about a hundred-fold increase in cancer susceptibility. AT patients' cells in culture show abnormalities including spontaneous and radiation-induced chromosome breaks and sensitivity to killing by X-rays. (Ironically, the patients also show extreme sensitivity to killing by X-ray doses intended to be therapeutic for their cancers.) However, AT cultured cells do not show a defect in repair of X-ray damage to their DNA; instead, unlike normal cells, they continue to replicate their DNA even when it has been damaged by X-rays. It is the failure to recognize DNA damage and respond appropriately by halting the cell cycle until repair can occur that leads to chromosome aberrations and death after X-ray in the AT patients.

The defect in AT is one in a cell cycle checkpoint, a decision point that governs progression through the next phase of the cell cycle. There are genetically controlled checkpoints that decide entry into a new cell cycle (G0 to G1 point), the decision to replicate the DNA (G1 to S point), and the decision to divide (G2 to M point). Mutations in the checkpoint genes can lead to uncontrolled cell growth, ie. cancer.

37

Although AT itself is a rare condition, it has been estimated that the frequency of heterozygotes with one AT mutation is about 1% in the population. These individuals also have a higher cancer risk and intermediate radiation sensitivity. Thus, screening by X-ray methods (eg. mammography) may increase the chances of an AT heterozygote developing cancer.

Last updated June 14, 1999.

Replication of a circular bacterial chromosome

38

Bacterial chromosomes are circular, and replication proceeds with two replication forks proceeding from an origin of replication (ori) to the terminus in opposite directions. This process is termed bi-directional replication. It is useful to consider one-half of the replicating chromosome at a time. This half-chromosome replicating unit is called a replichore. The two replichores of a circular chromosome undergo very similar processes. (Graphic computer art by Daniel Yuen)

Introduction

A common bacteria that colonizes intestines serves as a excellent example of a bacterium with a circular chromosome. Replication of the Escherichia coli chromosome proceeds in stages, which can be divided into three major headings; initiation, elongation and termination. Bacteria initiate DNA replication at a specific site on the chromosome, the replication origin oriC, from which replication proceeds bidirectionally to the terminus.[1]

Initiation proceeds in a series of well defined biochemical steps, and is the only phase of DNA replication that is known to be regulated, but

39

is regulated such that replication occurs only once in each cell cycle.[2]

During the elongation phase of replication, two distinct but related events occurs; that is the simultaneous synthesis of the leading and lagging strands. Several enzymes at the replication fork are essential to the synthesis of both strands. Parental strands are first unwound by DNA helicases, and the resulting topological stress is relieved by topoisomerase. Each separated strand is then stabilized by single stranded binding proteins [SSB]. From this point synthesis of leading and lagging strands is very different.

Eventually, the two replication forks of the circular chromosome meet at a terminus region containing multiple copies of a 23 base pair sequence called Ter for terminus.[3] The Ter sequences function as a binding site for a protein called Tus (for Terminus Utilization Substance), whereby replication halts when either replication fork encounters a functional Tus-Ter complex.

Initiation

The E.coli bacterial replication origin, called oriC consists of 245 base pairs bearing DNA sequences that are highly conserved among bacterial replication origins. The chromosomal origin, functions as a site where enzymes assemble to form the machinery that will generate the replication fork.[4]

Image:Tobeuploaded

DNA sequence elements within oriC that are important for its function include DnaA boxes, a 9-mer repeat with a highly conserved consensus sequence 5' - TTATCCACA - 3' [5] , that are recognized by the DnaA protein. DnaA protein plays a crucial role in the initiation of chromosomal DNA replication. [6] Bound to ATP, and with the assistance of bacterial histone-like proteins [HU] DnaA then unwinds an AT-rich region near the left boundary of oriC, which carries three 13-mer motifs [7], and opens up the double-stranded DNA for entrance of other replication proteins.[8]

This region also contains four “GATC” sequences that are recognized by DNA adenine methylase (Dam), an enzyme that modifies the

40

adenine base when this sequence is unmethylated or hemimethylated. The methylation of adenines is important as it alters the conformation of DNA to promote strand separation[9] , and it appears that this region of oriC has a natural tendency to unwind.[10]

DNA sequence motifs in oriC of the E. coli. The gray bars represent GATC sequences recognized by DNA adenine methyltransferase. Small blue arrows are 13-mer sequences near the left border of oriC that become single-stranded when oriC is bound by DnaA in association with ATP. The red boxes are DnaA box sequences recognized by DnaA protein. Smaller green boxes represent I sites bound by DnaA-ATP. The site within oriC to which integration host factor (IHF) binds is shown between DnaA boxes R1 and R5 (M). Dashed lines represent two regions bound by SeqA protein. (after Jon M. Kaguni 2006).[11]

DnaA then recruits the replicative helicase, DnaB, from the DnaB-DnaC complex to the unwound region to form the pre-priming complex.[12] After DnaB translocates to the apex of each replication fork, the helicase both unwinds the parental DNA and interacts momentarily with primase .[13]

In order for DNA replication to continue, single stranded binding proteins are needed to prevent the single strands of DNA from forming secondary structures and to prevent them from re-annealing. In addition, DNA gyrase is needed to relieve the topological stress created by the action of DnaB helicase.

41

Processivity of the DNA pol III replication complex is assured by a clamp. The DNA polymerase beta clamp in more detail (image).

Elongation

DNA-replication illustrated by the bacterial replication fork. The helix unwinds and both strands replicate simultaneously, during the unwinding process. The leading strand replicates continuously from 3' end of existing strand, with newest end of forming strand facing into replication fork. The lagging strand replicates by a series of fragments (Okazaki-fragments placed end-to-end, with newest ends of fragments facing away from fork; the Okazaki-fragments later ligated together. During replication, DNA polymerase III proof-reads for mismatched bases

Bacterial chromosomal replication occurs in a bidirectional manner, and has been investigated both genetically and autoradiographically, whereby results provide clear evidence for bidirectional replication in E. coli. In specific experiments, E. coli cells initiating chromosome replication after release from amino-acid starvation were incubated in [3H]thymine of moderate specific activity, followed by incubation in [3H] thymine plus [3H]thymidine of very high specific activity. The grain tracks produced in autoradiographs of chromosomes were denser on both ends than in the middle. The autoradiographic

42

patterns are, therefore, evidence that replication of the chromosome in E. coli is bidirectional.[1]

See Figure 4 of D. M. Prescott, and P. L. Kuempel (1972): A grain track produced by an E. coli chromosome from cells labeled for 19 min with [3H] thymine, followed by labelingfor 2.5 min with [3H]thymine and ['H]thymidine. [1].[1]

The E. coli replicase DNA polymerase III is a 900 kD complex, possessing a dimeric structure.Each monomeric unit has a catalytic core, a dimerization subunit, and a processivity component .[14] DNA Pol III uses one set of its core subunits to synthesize the leading strand continuously, while the other set of core subunits cycles from one Okazaki fragment to the next on the looped lagging strand. Leading strand synthesis begins with the synthesis of a short RNA primer at the replication origin by the enzyme Primase (DnaG protein).

Deoxynucleotides are then added to this primer by a single DNA polymerase III dimer, in an integrated complex with DnaB helicase. Leading strand synthesis then proceeds continuously, while the DNA is concurrently unwound at the replication fork. In contrast, lagging strand synthesis is accomplished in short Okazaki fragments. First, an RNA primer is synthesized by primase, and, like that in leading strand synthesis, DNA Pol III binds to the RNA primer and adds deoxyribonucleotides.

When the synthesis of an Okazaki fragment has been completed, replication halts and the core subunits of DNA Pol III dissociates from the β sliding clamp [B sliding clap is the processivity subunit of DNA Pol III]. [15]The RNA primer is remove and replaced with DNA by DNA polymerase I [which also possesses proofreading exonuclease activity] and the remaining nick is sealed by DNA Ligase, which then ligates these fragments to form the lagging strand.

Since replication of a circular chromosome occurs bidirectionally, when the replication fork moves around the circle, a structure shaped like the Greek letter theta Ө is formed. John Cairns provided a well-designed demonstration of E. coli chromosomal replication in 1963. In his experiment, he radioactively labeled the chromosome by growing

43

his cultures in a medium containing 3H-thymidine. The nucleoside base was incorporated uniformly into the bacterial chromosome. He then isolated the chromosomes by lysing the cells gently and placed them on an electron micrograph (EM) grid which he exposed to X-ray film for two months. This Experiment clearly demonstrates the theta replication model of circular bacterial chromosomes.[16]

See Autoradiograph of intact replicating chromosome of E.coli [2][17]

Termination

Replication termination of prokaryotic occurs at specific sequences called replication termini.[18] In E.coli, there are 10 replication termini (Ter) located in a region opposite to the replication origin (Fig 5).The Ter sites have polarity, that is, they arrest replication forks, when they are present in one orientation with respect to ori, but allow forks to pass through unrestricted in the opposite orientation. The arrangement of the Ter sites forms a replication trap that forces the two forks, initiated at oriC, to meet each other within a well-defined region of the chromosome.[19]

See locations and sequences of the replication termini of E. coli.(A) Map showing the ori and the 10 Ter sites. (B) The consensus sequence of Ter. [3][20]

The Ter sites specifically interact with the replication terminator protein called Tus, which is a polar contra-helicase, that is, it impedes the DNA unwinding activity of DnaB in an orientation-dependent manner.[21] The crystal structure of the Tus-Ter complex has been solved, and it reveals a protein that has structural asymmetry and has a DNA-binding domain, consisting of a series of β-strands, that invade the major groove of Ter DNA. The crystal structure was originally interpreted to account for replication fork arrest, solely on the basis of Tus-Ter, protein-DNA interaction, that allegedly was strong enough to form a nonspecific barrier, not only to DnaB helicase-catalyzed DNA unwinding, but in principle, to any protein that would unwind DNA .[22] When either replication fork encounters a functional Tus-Ter complex, it halts replication.

44

The crystal structure of the Ter DNA-Tus protein complex (A) showing the nonblocking and the fork-blocking faces of Tus. (B) A cross-sectional view of the helicase-arresting surface.[4][23]

Topoisomerase activities illustrated with on covalently closed circular DNA. Topisomerase enzymes are able to form supercoils in DNA, and interconvert covalentely closed circular DNA and their catenated forms.Replication of the DNA separating the opposing replication forks, leaves the completed chromosomes joined as ‘catenanes’ or topologically interlinked circles. The circles are not covalently linked, but cannot be separated because they are interwound and each is

45

covalently closed. The catenated circles require the action of topoisomerases to separate the circles [decatanation]. In E.coli, DNA topoisomerase IV plays the major role in the separation of the catenated chromosomes, transiently breaking both DNA strands of one chromosome and allowing the other chromosome to pass through the break.[24]

There has been some confusion about the role DNA gyrase plays in decatenation. To define the nomenclature, there are two types of topoisomerases: type I produces transient single-strand breaks in DNA and types II produces transient double-strand breaks. As a result, the type I enzyme removes supercoils from DNA one at a time, whereas the type II enzyme removes supercoils two at a time. The topo I of both prokaryotes and eukaryotes are the type I topoisomerase. The eukaryotic topo II, bacterial gyrase, and bacterial topo IV belong to the type II.

We often forget that DNA gyrase does in fact have topoisomerase type II activity; thus, with it being a homologue of topoisomerase IV (also having topoisomerase II activity) we expect similarity in the two proteins' functions. DNA gyrase preliminary role is to introduce negative super coils into DNA, thereby relaxing positive supercoils that come into play during DNA replication. Topoisomerase IV also relaxes positive supercoils, therefore, DNA Gyrase and topoisomerase IV play an almost identical role in removing the positive supercoils ahead of a translocating DNA polymerase, allowing DNA replication to continue unhindered by topological strain. [25]

Confusion arises when some scientific literature state that DNA gyrase is the sole enzyme responsible for decatanation. In an experiment conducted by Zechiedrich,Khodursky and Cozzarelli in 1997, it was found that topoisomerase IV is the only important decatenase of DNA replication intermediates in bacteria.[26] In this particular experiment, when DNA gyrase alone were inhibited, most of the catenanes were unlinked. However, when Topoisomerase IV alone was inhibited, decatenation was almost completely blocked. The results obtained suggest that Topoisomerase IV is the primary decatenase in vivo, and although DNA gyrase does play a role in

46

decatenation, its function is not as essential as topoisomerase IV in the decatentation of interlinked chromosomes.

Conclusion

Replication of circular chromosomal DNA. Partially replicated DNA forms a theta structure due to bidirectional replication.It is now known that not all bacteria have a single circular chromosome; in fact, some bacteria have multiple circular chromosomes, and many bacteria have linear chromosomes and linear plasmids. However, in bacterial cells which contain a single circular chromosome, such as E.coli, studies have shown DNA replication to occur at specific sequences called the Origin, and proceed bidirectionally in which the partially replicated chromosome forms a theta like structure. Replication continues until the replication fork encounters a functional Tus-Ter complex, which functions as a molecular trap to halt further replication of the molecule. With the assistance of topoisomerase IV in E.coli, the two catenanted circles are then separated forming two double stranded, circular chromosomes.

Summary

Although it is now well established that not all prokaryotic chromosomes exist as a single circular molecule of DNA as previously thought, it still holds true that in most bacterial cells, the chromosome replicates as a circular structure. The synthesis of a DNA molecule can be divided into three stages: initiation, elongation and termination, distinguished by the reactions taking place, and the enzymes involved. In bacterial cells with circular chromosomes, synthesis occurs at the replication fork, the place at which the DNA helix is unwound from the origin until they have copied the

47

whole replicon. When the replication fork moves around the circle, it occurs bidirectionally, and as a result, a structure shaped like the Greek letter theta Ө is formed. Finally since the bacterial chromosome is a single replicon, the fork meets on the other side and two complete double-stranded circular DNA molecules are formed. In this review, we will be focusing on the replication of circular bacterial chromosomes, and we will use a model prokaryote, namely the common gut bacterium Escherichia coli, to demonstrate how circular DNA molecules in prokaryotic organisms are replicated.

Acknowledgments

This is based on an article by Imalda Devaparanam and David Tribe made available under CC by SA licensing conditions from a University course activity at the Department of Microbiology and Immunology, University of Melbourne, 2007.

48

Mechanisms of Telomere Replication

PI: PRICE, CAROLYN M.

Abstract: Telomeric DNA is packed into a protective complex that acts as a cap over the chromosome end. This cap is essential for preventing chromosome fusions and hence the chromosomal rearrangements that result in cancer. The telomeric cap is a dynamic structure that balances the need to protect the DNA terminus from the DNA repair machinery with the need to allow access to telomerase and other replication enzymes. The architecture of the cap is still unclear, but it seems to be composed of a number of molecular interactions that include DNA-protein or protein-protein interactions with the single-strand overhang on the DNA terminus, the telomeric tract, and subtelomeric sequences. This proposal focuses on the single-strand overhang and its associated proteins because it is a particularly critical component of the cap. The proposal has two main goals: to define the architecture of the telomeric cap by ascertaining how factors that associate with or modulate overhang structure promote cap formation, and to determine how the DNA terminus is processed to generate the precise overhang structure that is required to form a functional cap. The specific aims are as follows: 1. To characterize the telomeric DNA structure generated by leading-strand synthesis in Tetrahymena. This aim tests current models for telomere replication and will establish the structures from which G-overhangs are generated. 2. To investigate the role of telomerase and repair proteins in telomere capping and G-overhang generation and maintenance. This will be achieved by deleting or mutating TERT, Ku70 or Rad51 and determining the effect on overhang structure and cap architecture. 3. To

49

delineate the role of the Tetrahymena G-overhang binding protein in telomere capping and determine whether this protein specifies the boundaries for overhang processing. The Tetrahymena Pot1 homolog (tPot1) will be identified and the effect of tPot1 deletion or mutagenesis on capping and overhang processing will be determined. 4. To characterize the nucleases responsible for G- and C-strand cleavage. In vivo and in vitro processing assays will be developed with artificial telomere substrates. The proposed studies will give a much deeper understanding of the DNA processing reactions that lead to assembly of the terminal DNA-protein complex, the architecture of this telomeric cap, and its role in chromosome protection and stabilization.

Termination of replication

Because bacteria have circular chromosomes, termination of replication occurs when the two replication forks meet each other on the opposite end of the parental chromosome. E coli regulate this process through the use of termination sequences which, when bound by the Tus protein, enable only one direction of replication fork to pass through. As a result, the replication forks are constrained to always meet within the termination region of the chromosome.[15]

Eukaryotes initiate DNA replication at multiple points in the chromosome, so replication forks meet and terminate at many points in the chromosome; these are not known to be regulated in any particular manner. Because eukaryotes have linear chromosomes, DNA replication often fails to synthesize to the very end of the chromosomes (telomeres), resulting in telomere shortening. This is a normal process in somatic cells — cells are only able to divide a certain number of times before the DNA loss prevents further division. (This is known as the Hayflick limit.) Within the germ cell line, which passes DNA to the next generation, the enzyme telomerase extends the repetitive sequences of the telomere region to prevent degradation. Telomerase can become mistakenly active in somatic cells, sometimes leading to cancer formation

50

Telomere shortening

Lagging strand during DNA replication

"Telomeres" shorten partly (see below) because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerases that have been discovered move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.

On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a little way ahead of where the initiation site was. The DNA polymerase can start

51

replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

Eventually, the last RNA primer attaches, and DNA polymerase, RNA nuclease and DNA ligase come along to convert the RNA (of the primers) to DNA, and seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it doesn't happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade RNA left on the DNA. Thus, a section of telomeres is lost during each cycle of replication at the 5' end of lagging strand.

However, in vitro studies (von Zglinicki et al. 1995, 2000) have shown that telomeres are highly susceptible to oxidative stress. Telomere shortening due to free radicals explains the difference between the estimated loss per division because of the end-replication problem (ca. 20 bp) and actual telomere shortening rates (50-100 bp), and has a greater absolute impact on telomere length than shortening caused by the end-replication problem

52

Origins of Replication Although the semiconservative nature of DNA replication had been confirmed, many questions about replication remained. One of these questions was: is replication initiated at a specific site on the chromosome, or is it initiated at random sites, or even multiple sites?

The answer to this question depends somewhat on the organism being considered. Bacteria, for example, have a single specific origin of replication; in other words, bacterial replication begins at the same spot on the chromosome every time. In E. coli, this site is called OriC. OriC is a 9 base-pair (bp) sequence that is repeated four times within the region.

Eukaryotes also have specific sites at which replication is originated. However, because eukaryotic cells contain much more DNA than bacteria (humans have approximately 1500 times as much DNA as E.coli), there must be multiple origins of replication on each chromosome in order to replicate all of the DNA in a timely fashion. The amount of DNA replicated from a single origin is called a replicon.

Other research has revealed that DNA replication proceeds bidirectionally from an origin of replication. This means that replication proceeds in opposite directions away from the origin:

53

Note in the diagram how each original DNA molecule branches, or forks, at the point where replication is occurring. These branch points are called replication forks. Because replication is bi-directional, two replication forks form at each origin of replication. (Some rare examples have been seen where replication is unidirectional from the origin.) The open area of the chromosome between the replication forks is called a replication bubble.

DNA Polymerase I

DNA replication is catalyzed by a family of enzymes called DNA polymerases. The first of these enzymes to be discovered, DNA polymerase I, was isolated from bacteria (specifically, E. coli). Characterization of the activity of this enzyme in vitro revealed that it had certain requirements for activity. It needed 5'-triphosphate forms of the four nucleotides, and it required the presence of preexisting DNA. The DNA serves two purposes: 1) it serves as a template for the synthesis of the new DNA (the template determines the sequence of the new DNA strand, through the specificity of base pairing), and 2) it serves as a primer for DNA synthesis. It turns out that DNA polymerase I cannot initiate DNA synthesis without having a free 3'-OH to add a new nucleotide to. DNA synthesis therefore needs a primer, a preexisting piece of nucleic acid to serve as an initiator of DNA synthesis.

DNA polymerase I synthesizes DNA by forming a bond between the 5' phosphate of the incoming nucleotide (the other two phosphate groups from the nucleotide triphosphate are lost) and the 3' OH group of the nucleotide at the end of the growing DNA chain. If you draw this out for yourselves, you'll realize that this means the DNA chain being synthesized grows in a 5' to 3' direction. This is an important rule to remember: DNA polymerase synthesizes DNA only in a 5' to 3' direction.

In addition to its polymerase activity, DNA polymerase I has two other enzymatic activities, both of which are exonuclease activities. Exonucleases are enzymes that digest DNA (cleave phosphodiester bonds), chewing away at nucleotides from the end of the DNA chain. DNA polymerase I has 3' to 5' exonuclease activity, which degrades DNA in a direction opposite to that

54

of synthesis. This provides the enzyme with a proofreading function: if a wrong nucleotide gets inserted into a growing chain, the enzyme can digest it out with the 3' to 5' exonuclease activity (almost like using the delete key while word processing), and insert the correct nucleotide.

DNA polymerase I also has a 5' to 3' exonuclease activity, which degrades nucleic acids in the same direction as synthesis. As we'll see, this activity is used to remove primers during DNA replication.

Multiple Polymerases

DNA polymerase I, it turns out, is not the main enzyme involved in replicating the bacterial chromosome. When the gene encoding the enzyme was mutated in E. coli, the bacteria were still able to replicate their chromosomes. They were, however, deficient in DNA repair. This suggested that DNA polymerase I is primarily involved in DNA repair (although it does play a role in replication, as we will see), and that another yet-to-be-discovered enzyme would be responsible for replication.

Eventually, two other DNA polymerases were identified, and named DNA polymerases II and III. These both had 5' to 3' polymerase activity like DNA polymerase I, and 3' to 5' exonuclease activity. Neither of these enzymes had the 5' to 3' exonuclease activity found

in DNA polymerase I. The various enzyme activities of the different polymerases are summarized in the table below.

Enzyme Activity

DNA Polymerase

I

DNA Polymerase

II

DNA Polymerase III

5' to 3' polymerase Yes Yes Yes

3' to 5'exonuclease Yes Yes Yes

5' to 3'exonuclease Yes No No

DNA polymerase III turns out to be the main enzyme involved in DNA replication. DNA polymerase II is a minor enzyme involved in DNA repair. DNA polymerase I is the main polymerase involved in DNA repair, and plays a specialized role in DNA replication, using its 5' to 3' exonuclease activity.

55

The Mechanism of Prokaryotic DNA Replication

As mentioned above, DNA replication in E. coli begins at OriC. It starts when the polypeptide products of the dnaA gene bind to the origin. These polypeptides cause localized strand separation. This allows a complex of the protein products of the dnaB and dnaC genes to bind. This complex acts as a helicase, which functions to unwind the DNA further. This unwinding produces the two replication forks. The unwound single-stranded region is kept single stranded through the action of single-strand binding proteins. There are other proteins that are found at the replication forks at this time, but their function is not well understood, so they will not be addressed.

At this point, a primer is needed so that DNA polymerase III can begin to act. As mentioned earlier, DNA synthesis needs a primer, so how is a primer produced? An enzyme called primase serves this purpose, by synthesizing a short stretch of RNA (generally from 5 to 15 nucleotides in length). RNA synthesis does not require a primer, so primase (which is a type of enzyme called an RNA polymerase) is able to synthesize a short primer where needed. Once this primer is made, DNA synthesis can begin, extending the polynucleotide chain originating with the RNA primer. Priming and synthesis occurs on both strands in the helicase complex moves along the parental DNA, shifting the replication fork, and allowing synthesis to continue.

This leads to another problem that has to be solved. As more DNA unwinds, and the replication fork moves along, synthesis of one strand (the lower strand in the diagram) can just continue, following the movement of the replication fork. The other strand being synthesized, however, cannot do this. As the replication fork moves along, it leaves a gap behind, as shown in panel B of the figure. To compensate for this, a second RNA primer must be synthesized a bit behind the first one, and DNA synthesized until it reaches the first primer (this is shown in panel C). You can easily imagine that as the replication fork progresses a bit further, this process will have to be repeated. Therefore, at each replication fork, the synthesis

56

of one new DNA strand (the lower one in the figure) is continuous, while synthesis of the other strand must be accomplished in small increments, short stretch after short stretch; this type of synthesis is termed discontinuous. The strand of DNA that is synthesized continuously is called the leading strand, and the strand that is synthesized discontinuously is called the lagging strand. The small fragments of DNA making up the lagging strand are named Okazaki fragments, after the researcher who discovered them. Okazaki fragments are typically about 1000 to 2000 nucleotides each.

Discontinuous replication solves one problem but still leaves one matter unsettled: the lagging strand will be composed of individual, unjoined fragments of DNA and RNA. This is where DNA polymerase I comes into play. DNA polymerase I uses its 5' to 3' exonuclease activity to digest away the primer RNA, and replaces the primer with DNA by extending

the strand from the adjacent Okazaki fragment. At this point all that is left to be done is to physically join the Okazaki fragments. This is accomplished by an enzyme known as DNA ligase. DNA ligase is able to join the 5' end of one DNA strand to the 3' end of another DNA strand. 

Eukaryotic DNA Replication

Synthesis of DNA in eukaryotes is less well understood, but the process appears to be basically the same as in prokaryotes, with a few notable exceptions. For one thing, eukaryotic DNA is complexed with histones to form chromatin. Every round of replication, therefore, requires that the histones be removed, then replaced after replication is complete. This requirement understandably slows the whole replication process down.

Eukaryotic cells are also much more complex than prokaryotes, because they contain organelles such as mitochondria and chloroplasts (in plants) that contain their own DNA, which must also be replicated. Eukaryotic cells therefore have more than three DNA polymerases; there have been five DNA polymerases identified so far.

Eukaryotes have another difference: eukaryotic chromosomes are linear, rather than circular as in prokaryotes.

57

DNA Replication: Summary of Key Points

DNA replication is semiconservative, with each existing strand serving as a template for the synthesis of a new strand.

Replication begins at specific locations called origins of replication. Replication requires a primer , and proceeds bidirectionally from the point of origin, creating an expanding replication bubble.

On one strand (the leading strand), synthesis is continuous; on the other strand (the lagging strand) synthesis is discontinuous, producing a series of Okazaki fragments that must be ligated together.

Replication fork

From Wikipedia, the free encyclopedia

Jump to: navigation, search

Scheme of the replication fork.a: template, b: leading strand, c: lagging strand, d: replication fork, e: primer, f: Okazaki fragments

The replication fork is a structure that forms within the nucleus during DNA replication. It is created by helicases, which break the hydrogen bonds holding the two DNA strands together. The resulting structure has two branching "prongs", each one made up of a single strand of DNA, that are called the leading and lagging strands. DNA polymerase creates new partners for the two strands by adding nucleotides.

Leading strand

58

DNA replication

The leading strand is the DNA strand at the opposite side of the replication fork from the lagging strand. It goes from a 5' to 3' direction, because DNA Polymerase can only synthesize a new DNA strand in a 5' to 3' manner. On the leading strand, DNA polymerase III (DNA Pol III) "reads" the DNA and adds nucleotides to it continuously.

Lagging strand

The lagging strand is the DNA strand opposite the replication fork from the leading strand. It goes from a 3' to 5'.

When replicating, the original DNA splits in two, forming two "prongs" which resemble a fork (i.e. the "replication fork"). DNA has a ladder-like structure; imagine a ladder broken in half vertically, along the steps. Each half of the ladder now requires a new half to match it.

Pol III, the main DNA replication enzyme, cannot work in the 3' to 5' direction of the template strand, and so replication of the lagging strand is more complicated than of the leading strand.

On the lagging strand, primase "reads" the DNA and adds RNA to it in short, separated segments. DNA polymerase III lengthens the primed segments, forming Okazaki fragments. DNA polymerase I then "reads" the fragments, removes the RNA using its flap endonuclease domain, and replaces the RNA nucleotides with DNA nucleotides (this is necessary because RNA and DNA use slightly different kinds of nucleotides). DNA ligase joins thLog in / create account

59

How to Extract DNA From FruitsCONTENTS

INTRODUCTION PROCEDURE

Summary of the procedure Preliminary operations Preparation of the extracting solution Preparation of the mush Extracting the DNA Filtration Removing the proteins Precipitating the DNA Observation through the microscope

CONCLUSION

REFERENCES

60

Figure 1: Test tube with DNA extract

INTRODUCTION

In recent years, it is not uncommon to read articles on DNA in both scientific and popular magazines. DNA is regularly mentioned in the news and is often featured in TV detective or crime-scene investigation dramas. DNA, also known as DeoxyriboNucleic Acid, is a long molecule that holds the genetic information for all living beings, be it vegetable, animal or a simple microorganisms. It is capable of copying itself and can synthesize RNA (RiboNucleic Acid). In more evolved or complex forms of life, DNA is contained in the nucleus of the cells. Except for the red blood cells of mammalians, which are devoid of a nuclei, all cells of a living being have their own DNA. The cells of an organism use certain parts of the DNA molecule, or genes, to produce the proteins they need to function. For a more detailed description of DNA including its structure, its functions and the mechanism by which proteins are produced, the reader should consult the texts listed [1] the Reference section of this paper, which are well written and contain excellent illustrations. In this article, I describe a simple experiment that will allow you to

61

extract a bit of DNA from a banana, however, you can also try it using other fruits and even vegetables. It is an experiment that can be performed both at home and in a school laboratory.

PROCEDURE

SUMMARY OF THE PROCEDURE The procedure described below exploits the fact that the external membrane of cells and that of their nuclei are composed of fatty substances that can be broken down using a simple detergent. The first operation in this procedure is to break-up the fruit into a pulp or mush so that the cells are separated each from other as much as possible thereby exposing them to the action of the detergent. Secondly, the detergent is added to the pulp of the fruit so as to release the DNA from the cell membranes, which encapsulate it. Thirdly, it is necessary to filter the mixture to separate the nucleic acid from the remains of the cellular membranes. Finally, the DNA is precipitated in alcohol where it becomes visible. The DNA you obtain using this procedure can be observed with a microscope and can be used for other experiments like electrophoresis or other experiments.

PRELIMINARY OPERATIONS

MATERIALS- pot;- thermometer; - plastic salad bowl;- ice cubes;- 50 cc of 70 - 95 % 70-95% isopropyl or denatured alcohol (ethanol) in a closed bottle;- rags and absorbent paper tissues.

METHOD- The day before the experiment, prepare some ice cubes;- at least 2 hours before, place in a freezer a sealed vapor-tight plastic bottle with 50 cc of 70-95% isopropyl or ethyl denatured alcohol. This container must to be closed tightly to prevent alcohol vapors from being released since they are flammable;- 15 minutes before starting the procedure, warm a pot of tap water to 60°C;

62

Figure 2 - Before starting the experiment, it is important to perform the preliminary operations described here .

PREPARATION OF THE EXTRACTION SOLUTION

As mentioned previously, the DNA is held inside the nucleus of the cells of the fruit we are using. To free the DNA, it will be necessary to breakdown the membranes of the cells as well as those of the nuclei. As these membranes are made up of phospholipids, which are molecules rich in fats, we will dissolve them by using a simple household detergent. We will also use a little table salt, which helps to eliminate the proteins, called histones, on which the DNA is wrapped.

MATERIALS- 100 cc of distilled water but tap water can also be used ;- a scale to weigh few grams (if possible);- 3 g of table salt (a half teaspoon);- 10 cc of liquid detergent;- a 10 cc syringe without needle;- a 100 cc beaker;- a glass rod.

METHOD- Pour 3 g of salt and 80 cc of distilled water in a 100 cc beaker;- mix until the salt is completely dissolved;- with the syringe, take 10 cc of liquid detergent and add it to the solution;- add distilled water until you obtain a total volume of 100 cc;- while avoiding to produce bubbles, mix to homogenize the solution;- the extracting solution is ready.

63

Figure 3 - Preparation of the extracting solution (Distilled water, table salt, detergent, syringe, 100 cc beaker and spoon).

PREPARATION OF THE PULP

This operation serves to separate the cells from each other and to better expose them to the action of the extraction solution.

MATERIALS- 100 g of banana (or: kiwi, apple, pear, kaki, peas, onion, etc.);- balance;- knife;- chopping board and fork;- 250 cc beaker;- a teaspoon.

METHOD- Place 100 g of banana (without peel) on a chopping board and crush it with a fork until you obtain a pulp. If you use an onion, with a knife obtain cubes of about 5 mm of side or less. You can also use a mortar or a blender. If so, do not shred the pulp too much;- pour the mush in a 250 cc beaker.

64

Figure 4 - Preparation of the fruit pulp

EXTRACTING THE DNA

The aim of this operation is to breakdown the membranes of the cells and their nuclei to free the DNA. The pulp will heated to 60°C to speed up and help the process of breaking down the membrane walls. Heating the pulp also helps to deactivate certain enzymes like DNase that can degrade the DNA. However, if the pulp is held at an elevated temperatures for too long a time the DNA may begin to fragment du to the heat exposure. For this reason it is advised to cool the pulp after approximately 15 minutes in a bath of chilled water.

Figure 5 - Pour the extraction solution in the pulp and mix.

65

Figure 6 - The pulp should be kept at 60°C for no more than 15 minutes and then chilled to about 0°C for 5 minutes

MATERIALS- thermometer;- pot with water at 60°C;- salad bowl with tap water and ice cubes.

METHOD- Pour the extracting solution on the mush;- place the beaker in a bain-marie in the pot with water at 60°C;- mix the mush so to distribute the extracting solution and to make the temperature uniform;- after 15 minutes, place the beaker in a bain-marie in the water with ice cubes;

- mix the mush to make the temperature uniform;- after 5 minutes, remove the beaker from the cold water and prepare yourself for the filtration

How to Extract DNA From FruitsG. Carboni, January 2007

Text editing by Donald Desaulniers, Ph.D.

66

 

 

 

 

.

67

   

 

 

.

.

 

FILTRATION

The filtration process is used to collect the liquid rich in DNA and to separate it from the cellular remnants and the other tissues of the fruit, which will be discarded.

MATERIALS- sieve with a diameter of about 12 cm;- coffee filter paper (laboratory filter is too much thick). Kitchen absorbent tissue paper can also be used, provided that it does not have any visible holes;- bowl.

METHOD- place the sieve on the bowl;- take a filter paper, soak it and place it in the sieve;- pour a little pulp on the filter, taking care that is goes through the filter paper ;- mix with care to help the filtration and avoid ripping the filter paper;- the filtered liquid you will obtain is rich in DNA.

Figure 7 - Filtering the pulp using a sieve, filter paper and a bowl.

 

REMOVING THE PROTEINS (optional)

With this additional operation it is possible to obtain a purer DNA extract, but it it is not essential if you want to observe the DNA. Because DNA is wrapped on proteins called histones is will be necessary to remove these proteins to obtain a DNA extract of higher purity. To remove these histones, you can use proteolytic enzymes like Protease. While you can purchase protease in a shop that sells chemical products, you can also substitute it with a substance that is much easier to find; it is found in the juice of the pineapple which that contains Bromelain, a

68

substance able to breakdown proteins into the amino acids of which they are composed.

 

Figure 8 - Obtaining the pineapple juice. Figure 9 - In a tube, pour 5 cc of filtrate and 1 cc of pineapple juice.

MATERIALS- Proteolytic enzyme (ex: Protease or pineapple juice); - a 5 cc syringe without needle.

METHOD- In a tube, pour 5 cc of the filtered solution;- add 1 cc of pineapple juice and mix;- wait 2 - 3 minutes to let to the bromelain react.

PRECIPITATING THE DNA

DNA is quite soluble in water and invisible, while it is insoluble in alcohol wherein it precipitates and becomes visible. By adding alcohol to the DNA filtrate solution in the tube, the DNA is rendered visible.

 

69

Figure 10 - Very slowly, pour some ice cold alcohol intothe tube and avoid mixing the alcohol with the filtrate.

Figure 11 - Tube with DNA of the banana mixed with a numerous tiny air

bubbles freed from the alcohol which is warming up. In Figure 1, there

are less bubbles and the DNA is observed as a milky substance.

MATERIALS- Some tubes for the possible repetition of the operation;- tubes holder;- icy alcohol (kept in a freezer).

METHOD- Slowly, pour in the tube of the previous step some icy alcohol by avoiding it mix with the filtrate;- the volume of the alcohol has to be about the same of that of the solution;- let the tube rest for 5 minutes to allow to the DNA to precipitate and accumulate in the tube.

Now, at the interface between alcohol and the filtrate you should be able to see a milky substance, which tends to increase in volume as time progresses. This milky substance is the DNA of the banana. Unfortunately, inside this milky little mass, you may observe numerous tiny bubbles. The presence of these bubbles is due to the property that the solubility of gases in a cold liquid is higher than in a warm one. While alcohol was in the freezer it likely absorbed some gases that are expelled as the liquid is warmed up.

 

70

OBSERVATION THROUGH THE MICROSCOPE (optional)

MATERIALS- some clean microscope slides;- hook made with a long metal wire;- dye to stain the nucleus (ex: Toluidine, Methylene Blue, Aceto-Orcein);- dropper;- microscope.

METHOD- with a long metal wire ending with a hook, extract a sample of DNA from the tube and place it on a clean  microscope slide;- level the mass on the slide and stain it with a nuclear dye;- if necessary, add a little water and mount the coverslip.

By observing this preparation under the microscope, do not expect to see the well-known double helix ladder structure of the DNA. You cannot see it even with an electronic microscope. What you will see are clumps or flocks of DNA material which look like a tangled mass of protein strands as illustrated Figure 12.

Figure 12 - Sample of banana DNA at about 100 X

(stained with a 1% solution of Toluidine).

CONCLUSION

This experiment was not so difficult to carry out after all, was it not?. The aim of this simple experiment was to provide you with an introduction to the procedures that are used in molecular biology. Often, the techniques used in modern microbiology laboratories are based on simple operations like this one. In other cases the procedures can be quite complex and may involve more sophisticated manipulations and equipment. In all cases a sound knowledge of biology and chemistry is essential to understanding how DNA is used in the fields of life sciences and health sciences. If this experiment has sparked an interest in pursuing future explorations, remember that resources available through the Internet you can lead you to new areas of discovery. If you would like to learn more, look at the document [2] in the References section of this paper. The extraction of the DNA is the first step of many other fascinating experiments.

BIBLIOGRAPHY

1 - Helena Curtis, N. Sue Barnes; "Biology"; Worth Publishers, Inc., New York; A biology text for high schools.

2 - http://www.funsci.com/texts/wsites_en.htm  Look for the term: "SAPS". You will find the directions to made other interesting and fun experiments in biology.

Internet keywords: dna extraction, dna proteins amino acids ribosome. 

71

(1+1)2     نبت: مبادئ الوراثة الجزيئية357 ؟ الشفرة الوراثية، نسخDNA التكاثر الذاتي للـــ RNAو الــ    DANالتركيب البنائي للــ

والوحدات الوراثية، توازن تركيب الجينات والسالسلDNAوترجمة المادة الوراثية ؟ إعادة تنظيم المادة الوراثيةDNAالببتيدية، وظائف البناء المتشابه والبناء المختلف للــ

؟ تعديل التعبير عن الجينات.   DNAفي البكتيريا، البالزميدات واألبيسومات والـ تبرع اآلن «

الجزيئ األحياء علمالجزيئي يقوم األحياء الجزيئية أو علم :باإلنجليزية (البيولوجيا

Molecular biology (فهو لذلك ، الجزيئي المستوى على األحياء بدراسةمن كال مع األحياء يتداخل مع الكيمياءو علم يتقاطع و فروع عدة الكيمياءفي

الوراثة و الحيوية الجزيئية . علم البيولوجيا تهتم تخصصات و مناطق عدة فيبخاصة و الخلوية األنظمة كافة بين المتبادلة العالقات مختلف بدراسة

بين البروتيني و الرناو الدناالعالقات االصطناع تنظيم عملية آليات إلى إضافةالحيوية . العمليات كافة و العملية هذه

أستبوري يصف في وليم له مقالة في الجزيئي االحياء نيتشر علم : مجلة

يدعى" ... ما نظر وجهة من مقاربة مقاربة، هو بل تقنية ليس بأنهالخطوط و الحقائق ضمن للبحث موجهة فكرة مع األساسية بالعلوم

أساسا . يهتم علم إنه موافقة جزيئية خطة عن األحياء لعلم العريضةالثالثية ... البنى على تحديدا أكثر بشكل و الحيوية الجزيئات بأشكال

الشكلية الدراسة على فقط تقتصر ال بحيث البنيوية التشكيالت و األبعادmorphology التشكل لتدرس تتعداها الوظيفة . "genesisبل و

الجزيئي [عدل] المستوى على األخرى األحياء بعلوم العالقة

72

وعلم الوراثة، وعلم الحيوية، الكيمياء لبن للعالقة توضيحي رسم. الجزيئي األحياء

األحياء علم منشؤها محددة تقنيات استخدموا الجزيئية األحياء في الباحثونوعلم, الوراثه علم و تقنيات من األفكار هذه بين الجمع تزايد مع ولكن الجزيئي

المجاالت هذه بين ترابط هناك ليس انه مع الحيويه الفيزياء و الحيويه الكيمياء . المجاالت تلك بعض بين عالقه مخطط يمثل التالي الشكل قبل من كان كما

: اللذان الحيوية والعمليات الكيميائية المواد دراسة هي الحيوية الكيمياء . ة الحي الكائنات في يحدثان

. : الحية الكائنات على الوراثية اإلختالفات تأثير دراسة هو الوراثة علم

- : ذلك ( على ومثال طبيعي مكون غياب علي االستدالل من هذا يمكننا ما كثيرا.( واحد جين

" الفنية " العناصر من أكثر او واحد الي تفتقر التي الكائنات المسوخ دراسه . التفاعالت " " طبيعي ظاهري نمط ¬و أ البري بالنوع يسمي بما يتعلق فيما

مثل مثل epistasisالوراثية األحيان أغلب في بسيطة تفسيرات تفند ¬ن أ يمكن." القاضية " الدراسات هذه

الجزيئي األحياء النسخ:  علم عمليه من الجزيئيه االسس دراسه . الجزيئي األحياء لعلم المركزية العقيدة الجينيه والترجمه واالستنساخإلى ترجمت ذلك وبعد أي إن آر إلى نسخت وراثية مادة أن حيث

األحياء علم تبسيط في ¬غة ¬ال مب صورة¬ هناك¬ أن من الرغم على البروتين، . هذه ان بيد الميدان لفهم جيده انطالق نقطه يوفر يزال وال ، الجزيئي

للرنا . الناشئه الجديده االدوار ضوء في تنقيحها يجري الصوره

العمل من الكثير انجاز تم ، كمي الجزيئي األحياء علم في العمل معظم

73

الحاسوب وعلوم الجزيئيه البيولوجيا في الحيوية المشترك وعلم والمعلوماتيةالحسابي وعلم . األحياء الجينات بنية ودراسه ، العشرين مطلع من اعتبارا

. الجزيئي األحياء لعلم األبرز الثانوي الحقل كان الجزيئية الوراثه

، الجزيئات على األحياء لعلم األخرى الحقل من العديد متزايد نحو على تركزفي مثل تواجدهم أماكن في لتفاعالتهم مباشرة دراسة الخلوي إما األحياء علم

التطوري األحياء األحياء وعلم علم تقنيات حيث ، مباشر غير بشكل ¬و أ ، السكان من التأريخية الخواص إلستنتاج تستعمل في الجزيئي كما النوع، أnو

و السكان وراثة علم مثل المتطورة األحياء علم علممجاالتالعرقي دراسه . phylogenetics الوراثة عريقه تقاليد ايضا وهناك

البيولوجية " الجزيئات في " الصفر الحيوية من .الفيزياء

الجزئية [عدل] األحياء تقنيات

كيفية الجزيئي االحياء علماء تعلم ، الستينات وأوائل خمسينات أواخر منذ . هذه تتضمن الحية والكائنات للخاليا الجزيئية المكونات ومعالجة وعزل تمييز

؛) DNA (الدناالمكونات الوراثية المعلومات الشبيه) RNA (الرنامستودعأي ( إن العاملة) . DNAبالدي كالنسخة الع¬م¬ل من وظائف¬ها ¬تراوح ت الذي

ل ( الوظيفيه دنا) DNAالمؤقتة كذلك انزيمية ومهام فعلية هيكلية إلى . االنزيمي والنوع الرئيسي الهيكل هو والبروتين النقل أجهزة من والهيكليه

. الخليه في للجزيئات

74

لبعض اإلنزيمات القاطعةRecognition Sites تسلسل مواقع القطع المقطع الذي تميزةالمصدراإلنزيم القاطعBamHIBacillus

amyloliquefaciens HGGATCC

EcoRIEscherichia coli RY13GAATTCHaeIIIHaemophilus aegyptiusGGCCHindIIIHaemophilus influenzae

RdAAGCTT

HpaIHaemophilus parainfluenzae

GTTAAC

HpaIIHaemophilus parainfluenzae

CCGG

MboIMoraxella bovisGATCNotINocardia otitidis-

caviarumGCGGCCGC

SfiIStreptomyces fimbriatusGGCCNNNNNGGCCTaqIThermus aquaticusTCGA

RFLP's  Map خريطة القطع المحددة

لقد أنشاء العلماء خريطة تسمى خريطة القطع المحددة لكثير من الكائنات الحية.و هذه الخريطة  تبين مكان القطع و محلها مقارنة بالقطع األخرى .و عملت هذه الخريطة عن طريق تقطيع جميع

الكروموسومات بإضافة أنواع مختلفة من اإلنزيمات القاطعة ثم رتبت هذه القطع بشكل منتظم.و كان الهدف من هذه الخريطة هو لتحديد نقاط و عالمات على طول الشريط الطويل من الدي إن

أي التي تتركب منه الكروموسومات و لكي يستطيعوا أن يقارنوا بين هذه القطع في الكائناتالمختلفة.

و فيروس خريطة للقطع المحدودة لـليمبدا فيج االدينوفيرس.توضح مواقع القص لثالث أنواع من

BamHI, EcoRI, and اإلنزيمات القاطعة HindIII( (

 

75

بالكهرباء الجل من لوح على أي إن الدي قطع )Gel Electrophoresis(فصل

بطريق   البعض بعضها عن البروتينات فصل تقنية العلماء استعمل ( ذلك( و البعض، بعضها عن انفصالها و رحالن إلى  انتقالها تعريضها طريق عن

. استعمل ولقد بالجل المعروفة الهالمية المادة من لوح على هي و كهربائي تيارالفكرة نفس قطع  العلماء فصل في

. ومن البعض بعضها عن أي إن الديعن عبارة النووي الحمض أن المعروف

بعض ضع و فعند لذلك و سالبة شحنةأطراف من طرف في أي إن الدي من

كهربائي لتيار وتعريضها ثم الجيل لوحالطرف عند السالب القطب يكون بحيث

القطب و أي إن الدي فيه وضعنا الذيألواح من األخير الطرف عن الموجب

بتجاه تلقائيا ينتقل إي إن الدي فانفيه الذي الطرف

قطع حركة تتوقف و الموجب القطبعلى إحجامها حسب على أي إن الدي

. تتحرك الصغيرة فالقطع اللوح طول . بذلك و الكبيرة القطع من اكبر بشكل

بعضها عن القطع هذه فصل يمكنالفعلي. لحجم ا تحديد يمكن و البعضقطع إضافة طريق عن قطعة لكل

التي و أي إن الدي من الحجم معروفةأحجام الستنتاج إليه يرجع مقياس تكون

القطع.

ألواح   من أساسيان نوعان وهناكاالقروز. ( بجيل يسمى األول الجيل

Agarose gel ( البولي بجيل الثاني و و ). Polyacrylamide gelاكريليميد(

البولي بين التي الفراغات لصغر نظراالقطع لفص يستخدم فانه اكريليميد

من اصغر تكون التي العادة في و أي ان الدي من الحجم الصغيرةأو 500 بجزيء البعض بعضها بين تتفاوت التي و النووي الحمض من جزيء

الرسم ( انظر إن).. Aجزيئين الدي من األكبر لألحجام االقروز يستخدم بينمابين. حجمها يتراوح التي و انظر (10000إلى 300أي أي إن الدي من جزيء

76

عند).. Bالرسم و الطحالب من مستخرجة سكرية مادة هي االقروز ومادةقوامها في أقوى لكنها و نأكله الذي الجيالتين قوامها في تشبه فإنها تحضيرها

. حرص بغير نقلها عند االنقطاع أو للتهتك قابلة لكنها و الشيء واجهه بعض لقد و

في صعوبات و العلماء القطع هذه الن ذلك و أي إن الدي من الكبيرة القطع فصلوضعها ألنها  عند تتوقف عليها الكهربائي التيار تسليط بعد و االقروز جيل على

و السالب القطب باتجاه طرف ملتوي ثعبان شكل على متعرج بشكل تتمدد . جل تعريض طريق عن المشكلة هذه حلت لقد و الموجب القطب بتجاه األخر

بذلك و اللوح طول على الكهربائية القوة من متفاوتة مستويات إلى االقروزيجعلها مختلف كهربائي تيار إلى تتعرض عندما الطويلة أي إن الدي قطعة فان

المتعرج تمددها من يستمر  تعدل و الجديد الكهربائي التيار في تدخل أن قبلالذي المكان إلى تصل حتى القطعة قوام في التعديل و التيار في التفاوت هذا . عن بالفصل الفصل من النوع هذا يسمى و حجمها حسب فيه تقف أن يجب

المتردد ( الكهربائي المجال و. )Pulsed-field gel electrophoresisطريققطع فصل حتى و أي إن الدي من كبيرة قطع فصل من التقنية هذه أمكنت

تتراوح و الجل على الكروموسومات منالطريقة بهذه فصلها يمكن التي القطع

من 2.5إلى 220000بين جزيء مليونالرسم ( انظر أي إن ).Cالدي

بالبولي   المفصولة القطع تكون اللذلك و للعيان واضحة االقروز و اكريليميد

لصباغة مادة إلى يعرض الجيل لوح فانمادة هو المواد هذه اشهر و أي ان الدي

االثيديوم ( Ethidium  برميداتBromide ( تعريضها عند تلمع التي و

. لوح على القطع لمشاهدة دقه أكثر طريقه هناك و البنفسجية فوق لألشعةأي إن الدي إلى نووية مشعة مادة إضافة على تعتمد الطريقة هذه و الجيل

معينه احتياطيات إلى تحتاج الطريقة هذه لكن و الجيل لوح على يوضع أن قبليستخدمها بمن تضر ال .لكي

77

) النووي التسلسل DNAمعرفةsequencing(

معرفة   إلى يحتاجون العلماء أن شك الهذا و جين لكل التسلسلية التركيبةالبروتين عن المزيد معرفة من يمكنهمالتركيبة وعن الجين ذلك يصنعه الذي

على يصلون قد و الجين لعمل التنظيميةفي تتحكم التي األمور معرفة إلى ضوءه

النووي. التسلسل بمعرفة انه كما عملهسبق التي بالجينات مقارنته يمكن للجين

معلومات يعطي قد هذا و اكتشافهااالبحاث من الكثير يختصر و الجين هذا وضيفة عن غزيرة

. النووي التسلسل لمعرفة أساسيتان طريقتان وهناك اجرائها اعادة يتجنب و) . اإلنزيمية بالطريقة تسمى األولى أي إن الدي من قطعة Enzymaticألي

method) الكيميائية ) بالطريقة األخرى الطريقة ). Chemicalو طغت لقد و. استعماال األكثر الطريقة هي أصبحت حتى األولى

اإلنزيمية ( Enzymatic methodالطريقة:(

طريقة   أيضا الطريقة هذه على يطلقإلى ) Sanger procedureسنجر ( نسبة

هذه. أسس الذي و سنجر فريدريك دالتسلسل. تعرف أيضا أنها كما الطريقة

ديوكسي ( دي طريق dideoxyعنsequencing .(على الطريقة هذه تترتكز و

في أي إن الدي شريط أن مفهومالديوكس من جزيئات من مبنى األساس

عن نيوكلويتيد الديوكسي دي  يختلفجود و بعدم بيوكلوتيد ديوكسي

( النقطة ( في هيدروكسي مجموعةالخماسية السكر حلقة من الثالثة

الشكل.

حلقة deoxynucleotides (dNTPs )نيوكلويتيد ( من الثالثة النقطة على يوجد و ) هيدروكسيه مجموعة أي مؤكسدة مجموعة الريبوزي هذه) OHالسكر ويليها الذي الجزيء من الخامسة النقطة في ترتبط التي هي هكذا  النقطة و

. . ستنجر د قام لقد و أي إن الدي من طويل شريط لتكون الترابط يتم) من الجزيء فبدل الخاصية هذه من (OHباالستفادة ) Hإلى) طريق عن

ديوكسي إضافة (ودي من )ddNTPsبيوكلوتيد (بدل نيوكلوتيد )dNTPsديوكسيترابط توقف الى يؤدي هذا و أخرى مرة الشريط نسخ طريق عن ذلك و

. النووية األحماض من واحد نوع جزيء كل طرف في يكون و الجزيئات

78

: بالترتيب االختبار بهذا للقيام األساسية الخطوات إليك و

1: التالي- الشكل على ذلك و أي ان الدي بنسخ القيام

) البريمر- من قطع أي إن الدي عينة إلى أضف انه) specific primerأ يعرف ( ) بعنصر بطرفة ملتصق معرف و نسخة المراد أي إن بالدي يلتصق سوف

مشع.

التالية- السماء عليها اكتب أنبوبة كل و اختبار أنابيب أربع إلى العينة قسم (بdGTP, dATP, dCTP, and dTTP.(.

البولمريز- ( إنزيم أضف )DNA polymerase ج

اسم- حسب نيوكليتيد ديوكسي الدي من واحد نوع أنبوبة كل إلى أضف د . و. التفاعل يحدث سوف نيولكليتيد ديوكسي من كمية معه أضيف و األنبوب

. لدي إضافته وعند النووية األحماض هذه رص و تركيب و ببنان البريمر يبداء . أخر تفاعل يحدث ثم النقطة هذه على يتوقف الشريط فان نيوكليتيد ديوكسي

هكذا و التفاعل يتوقف نيوكليتيد ديوكسي دي إضافة عند و أخر شريط لنسخفي الطول متفاوتة و منسوخة قطع النهاية في عندي ينتج و العملية تستمر

. اختبار أنبوب كل

ثم- 2  االقروز لوح على خاص حقل في أنابيب األربعة كل من كمية أضيفو المنسوخة القطع اللوح طول على تظهر ثم من و كهربائي تيار امرر

. القطع ترتيب يعطيني حقل كل األطوال المتفاوتة

3) لألشعة- الذي) Autoradiographyتعريضها و أي إن الدي رؤية يتسنى لكي. مشعة مادة عليه

4 . من- نسخة على مر ما وكل أعلى إلى أسفل من االقروز لوح بقراءة ابدأو طرفة في الذي نيوكليتيد الديديوكسي نوع و ترتيب اعرف أي إن الدي

لوح ينتهي أن إلى القراءة في استمراالقروز.

استخدم القراءة عملية لتسهيل وذلك و إلي بشكل يقرأها لكي الكمبيوتر

عن و ليزر أشعة إلى االقروز لوح بتعريضللنبضات مضخم و استشعار وحدة طريق

)photomultiplier ( أن الكمبيوتر يستطيعثم و نيوكليتيد ديوكسي الدي نوع يحدد

بيانيا رسما يعطيك و يطبعها و يرتبها . ال و باأللوان و نووي حمض كل الماكن

79

بمادة عنها يستعاض بل بالكمبيوتر اآللية القراءة في المشعة المواد تستخدمديوكسي   ) fluorescentمضيئة( دي لكل يكون أن على البريمر على توضع

( ) بذلك و المضيئة المادة من ألوان أربعة أي اآلخر عن مختلف لون نيوكليتيد . و الجانبي الرسم في واضح هو كما واحد ممر في القطع جميع تمر أن يمكن

المراجعة و التدقيق يلزم فانه للخطاء قابل الكمبيوتر جهاز أن إلى نظرا . مدار على تعمل عمالقة كمبيوتر أجهزة قامة لقد و األخطاء حدوث لتفادي

) الكامل بالكشف البشري الجينوم مشروع مظلة تحت و %99الساعةقد) و اإلنسان في الموجود أي إن الدي لجميع النووي التسلسل من تقريبا

العمل و الحية الكائنات من لكثير النووي التسلسل عن الكشف ذلك سبق. المزيد لمعرفة جاري

 

)Vectors  الناقالت (

  " قطع " أو فيروسات الغالب في هي فيكتور اإلنجليزية باللغة تسمى التي و الناقل . في صنعها تم صناعية أنواع هناك أن كما البكتيريا في موجودة النووي الحمض منمن مصنعة األصل في ألنها صناعية شبه مواد العادة في هي و الطبية المختبرات . مع التعامل الطرق و بالبروتكوالت اهتمام لديهم من و الطبيعة في موجودة مواد

من العديد على تحتوي والتي الصفحة هذه مراجعة عليك اقترح الناقالت هذهبالناقالت ( بالعناية المتعلقة هنا الروابط )اضغط

) Plasmid البالزميد (

قابلة   النووي الحمض من صغيرة قطعة عن عبارة هو ،و الناقالت اشهر من هي وشبيهة . هي و الكروموسومات في الموجود النووي الحمض بقية عن بمعزل للتكاثر

. البروتين من خارجية طبقة على تحتوي ال لكنها و الصغير بالفيروس

في. خاصة البكتيريا في موجود النووي الحمض من قطعة عن عبارة البالزميد  و) كولي الخميرة) ( E.Coliاالي أنوع بعض الذاتي) . Yeastو التكاثر على القدرة لدية و

الكروموسومات بقية من بمعزل و

. و البكتيريا داخل التكاثر تستطيع بالزميدات هناك أن كما الخلية في الموجودة . النووي الحمض نوع حسب على البالزميد من نوعان يوجد و واحد آن في الخميرة

80

فهناك فيها المصنوع البالزميد

الدي أي ( من إنDNA ( أخر و نوع

األر مصنوع منأي ( و ). RNAإن

أنواع هناك من عديدة

فمنها البالزميدو منها الصغير

كما منها الكبير أنال يحتوي ما

أي بينما على جين أنواع هناك تحتوي كبيرةعدة و. على جينات

وحدة باإلضافة إلىعلى تكون قد التي الجينات من الكثير هناك البالزميد على الموجد الذاتي التكاثر

فد فمثال النووية القطع و الجينات نسخ عملية في للعلماء مفيدة هي و البالزميدالتترسيكلين و كالمبيسيلين الحيوية المضادات يكافح خاص جين البالزميد على يوجد

البكتيريا. عزل و التعرف في تساعد الحيوية المضادات من الحامية الجينات هذه وراجع ( للمزيد استنساخه ننوي كنا الذي الجين عليه الذي البالزميد على تحتوي التي ( في المنتشرة الفيروسات أن نظريا يعتقد و النووية القطع و الجينات نسخ عملية

. فيروسا أصبحت و خارجي بروتيني غالف اكتسبت أنها حيث بالزميدات كانت  األصل

الفيروسية (   ) :Viral Vectorsالناقالت

بالفيج (   المعروفة البكتيرية الفيروسات هي األنواع هذه اشهر هي). Phage إن و . ما الفيج أنواع اشهر ومن بروتيني بغالف مغطاة أي ان الدي من قطعة عن عبارة

لمدا ( بفيج كولي) lambda phageيسمى االي في موجود فيروس هو وهذا. E. coliوغاية حتى أي إن الدي من قطعة تحمل أن تستطيع الناقالت من .   النوع لقد و كيلوبيز

. سبيل فعال أي إن الدي من اكبر كمية حمل تستطيع لكي الفيروسات هذه حورتالكوزميد ( ( Cosmidsالمثال تسمى ) ان الدي من قطعة جزء تهجين عن عبارة

بالكوز cohesive sequenceالالصقة مختصرة تعرف (Cos sequenceو ليمبدا) فيج منPhage) ( بالزميد حتى ) Plasmidمع نقل يستطيع الذي الباك ) 40kbكيلوبيز (40و و

بي بكروموسوم المسمى PAC P1-derived Artificialالصناعي (1الفيروسيChromosomes ( / بي للفيج تحوير عن إلى ) P1 Bacteriophage (1عبارة إضافته و

 البالزميد..

81

الخبز خميرة في تنمو التي البالزميد أنواع

 

YIP, yeast integrating plasmid = selectable marker +cloning sites

YRP, yeast replicating plasmid = YIP + ARS origin of replication

YEP, yeast expression plasmid = YIP + 2 micron origin of replication

YCP, yeast centromere plasmid = YRP + centromere sequence

 

Cos sequence from Lambda phage + PlasmidCosmid

P1 Phage + PlasmidPACModified E.coli fertility plasmid-factorBAC

الصناعية ( الكروموسومية ArtificialالناقالتChromosomes:(

بتحوير   العلماء بعض قام فقد أي إن الدي من كبيرة إحجام نقل إلى للحاجة نظراالطبيعية الناقالت .  بعض شكل على ناقالت حاليا يوجد و المهمة بهذه تقوم لكي

. هذه من و كروموسوم شكل على تعمل لكي األساسية القطع فيها و كروموسوم) الصناعي الخميرة كروموسوم او الياك بــ يعرف ما Yeast Artificialاألنواع

Chromosomes / YAC   (من أكثر نقل يستطيع الذي و ).kb 500كيلوبيز (500وطرفين على تحتوي و مترابطة أي ان الدي من قطعة عن عبارة الياك

(Telomeres 2للكروموسوم( للكروموسوم) مركز (Centromereو للتكاثر) مركز وAutonomous replicating sequence ARS) البكتيري). الباك Bacterial Artificialبينما

Chromosomes / BAC   (حتى حمل يستطيع الذي تحوير ) kb 150كيلوبيز (150و هو) االيكولي بكتيريا تناسل ببالزميد المعروف -E.coli fertility plasmidللبالزميد

factor.(( 

الناقل Vectorنوع

الدي حجمأي ان

الذي يستطيعحملة

       Standard plasmid0 -10البالزميدKB

بكتيريوفيج لمبدا        Lambda Bacteriophage0-23 Kbمحور

Cosmid30-44كوزميدKb

بي     1Bacteriophage P170-100بكتريوفيجKb

بي 1كروموسومP1الصناعي

P1Artificial chromosome      PAC

130 -Kb 150

البكتيريا كروموسومالصناعي

Bacterial Artificial Chromosome BAC

أقصى بحد300 Kb

الخميرة       Yeast Artificial Chromosome 0.2-2 كروموسوم

82

YACMbالصناعي 1996Human Molecular Genetics by T.Strachan andالمرجع:

A.Read

 

) واالستنساخ ):Cloningالنسخ

أو   الكائنات بخلق الرتباطها نظرا االستنساخ كلمة الناس بين يشتهر . استنساخ أو نسخ كلمة فان الطبي بالمصطلح لكن و منها نسخ إنشاء

. قد و نسخها يراد التي المادة من األصل طبقا صورة إنشاء عملية تعنى . شك ال و متكامل حي كائن نسخ أو أي إن الدي من لقطعة النسخ يكون

نستخدم سوف لكننا و استنساخ و نسخ كلمة بين تفرق العربية لغتنا أن . كلمة في و الشيء نفس لنعني حديثنا في استنساخ أو نسخ كلمة

تعني ( العربية باللغة مستنسخ) (Cloningاستنساخ أو نسخة عنه وينتجClone.(

 ) ... بنشر العلمي فريقه و الدكتور قام Nature 385, 810-13, 1997عندما ) " مختبر) " اسكتلندا مختبرات احد في دولي النعجة استنساخ خبر

عام ) زاد 1997روزيلين و االستنساخ بموضوع العالم اهتمام زادالخبر ذلك فجر و اإلنسان استنساخ عن الحديث في العلمي الفضول

العلمية و الدينية المراكز من كثير من الدولية التحفظات من الكثير. اإلنسان استنساخ عملية من األخالقي الجانب على

في   العامة بين تستخدم استنساخ كلمة أصبحت اخبر ذلك بعد وبذلك و اإلنسان أو الحيوان من أخرى نسخة خلق عملية عن الحديث

. كانوا العلماء فان شك ال و الكلمة هذه معنى في الكثيرين بين البس بدأمن نسخة صنع عملية إلى اإلشارة في الكلمة هذه يستعملون مازالوا و

. و بالكامل حي كائن نسخ أو خلق بالضرورة ليس و وراثية مادة أيإلى النسخ أو االستنساخ يقسمون فالعلماء أنواع :3لذلك

الهندسة      -1  طريق عن أي إن الدي من القطع استنساخ أو نسخأي ( إن الدي بتهجين يعرف بما و Recombinant DNA الوراثية

83

technology. (

الجنسي        -2  أو التكاثري   Reproductive cloning    االستنساخ

العالجي        -3  Therapeutic cloningاالستنساخ 

. الوراثية الهندسة طريق عن أي إن الدي من القطع استنساخ أو نسخ

هذه   كانت أي إن الدي من قطع نسخ هو االستنساخ باب في العلماء به يهتم ما إن ) ( ) في الموجود أي إن الدي كل أي الجينوم جميع أو مورث جين عن عبارة القطع

. .( يحتاج و أي إن الدي من قطعة نسخ هي تجرى التي العمليات اشهر و الحي الكائنذلك و النسخ هذه من كبيرة كمية إلى يحتاجون ألنهم القطع بنسخ للقيام العلماء

اإلنشائية التعقيدات لوجود ذلك و الخلية داخل من مرة كل في استخالصها لندرةفي . بيتا لسلسة المنتج الجين فان المثال سبيل على و للكروموسومات

بمورث المعروف و (  الهيموجلوبين جلوبين فقط) Beta-Globin Geneببيتا يمثل0.00005 ) ب% يتراوح الذي و الخلية في الكلي أي إن الدي حجم قاعدة 3من باليين

) الدستروفين). بجين المعروف و العمالق الجين أن كما و ) Dystrophin Geneنوويةبال حجمه يتراوح من ) 2.5Megabasesميقابيز (2.5الذي أكثر يمثل من% 0.08ال

. نسخ إجراء إلى يحتاجون العلماء فان لذلك و الخلية في أي إن للدي الكلي الحجمإجراء و بها التعامل لهم يتسنى لكي أي إن الدي من القطعة أو الجينات لهذه

: . للنسخ رئيسيتان طريقتان هناك و عليها التجارب

 1-     ) الحية الخاليا استخدام طريق عن )Cell-Based DNA cloningالنسخ

 2-     ) الحية الخاليا غير طريق عن باستخدام) Cell-Free DNA cloningالنسخ ذلك و ) أر سي صفحة). Polymerase chain reaction PCRالبي الطريقة لهذه نورد سوف

. الله إنشاء مستقلة

الخاليا (  استخدام طريق عن )Cell-Based DNA cloningالنسخ

 : خطوات ثالث على الحية الخاليا باستخدام النسخ  يرتكز

  

84

أي- 1 إن الدي من مهجنة قطعة تصميمناقل ( من أي إن دي و نسخها ) Vectorالمراد

. طريق عن ذلك و التكاثر على القدرة لدية و) القاطعة اإلنزيمات Restrictionاستخدام

enzymes.(

 

1- Construction of recombinant DNA molecules by in Vitro attachment to Replicon(Vector).

 

بداخل- 2 هي التي و المهجنة القطعة نقلتستخدم العادة في و حية خلية إلى الناقل

المعروف ) Bacteriaالبكتيريا( النوع خاصة( E,coliبااليكولي ( الخميرة ).Yeastاو

 

 2-Transformation using bacteria or yeast

 

تحتوي- 3 التي البكتيرية المستعمرات اختيارلها السماح و المهجنة القطعة و الناقل على

) الزراعة. أطباق طريق عن CultureبالتكاثرPlates. سائلة) محاليل في أو

 

 3- Selective propagation of cell clones.

 

الدي- 4 استخراج و المهجنة القطع استخالص. كبيرة بكميات منها أي ان

 

 3- Isolation of recombinant DNA clones

إن- 1  الدي من مهجنة القطع  تصميم

على   الحية الخاليا باستخدام النسخ يعتمدأو االنقسام على نسخها المراد القطعة قدرة

الخلية داخل توضع عندما الذاتي التكاثرالعادية. أي إن الدي قطع أن شك ال و الحية

لذلك و الذاتي التكاثر على القدرة لديها ليسادخلوا بان األمر هذا بتجاوز قاموا العلماء فانمن ناقل في نسخها يريدون التي القطعة

على) Vectors النواقل( بقدرتها المعروفة

85

.( ) نوع عن النظر بغض و النواقل موضوع راجع الذاتي طريقة  التكاثر فان الناقل . الخطوات هذه و واحدة تقريبا الناقل إلى نسخها المراد أي ان الدي قطعة إدخال

: يلي كما ببساطة

و      -1 محدد قاطع إنزيم إليها يضاف نسخها المراد القطعة تحديد يتم أن بعدمحدد ( ) مكان في أي إن الدي بقطع اإلنزيم هذا فيقوم أ إنزيم مثال ليكن

. النووي التسلسل حسب

التسلسل      -2 نفس في أيضا بقطعة يقوم الذي و للناقل اإلنزيم نفس يضافالنووي.

الناقل        -3 إلى القاطع باإلنزيم قطعها بعد نسخها المراد القطع تضافأي. إن الدي قطع بين و الناقل بين النووية التسلسالت فتتداخل المقطع

. القطعة بداخله و الناقل من مهجنة قطعة ذلك من فنشاء نسخها المراد . برابطة أطرافها من البالزميد أي إن الدي قطعة ترتبط و نسخها المراد

) الالصق أو ليقيز يسمى إنزيم يضاف لذلك ضعيفة رابطة هي و هيدروجينيةLigase ) قوية) رابطة إلى التناقل و أي إن الدي قطعة بين الترابط يحول لكي

Covalent Bond(

أي   أو الياك أو الفيج استخدام يمكن لكن و البالزميد هي استخداما لناقالت أكثر إن . المراد القطعة كبر العادة في هو استخدامه المراد الناقل نوع يحدد الذي و أخر ناقل

يستخدم. بينما الفيج أو البالزميد يستخدم الصغيرة القطع حالة ففي استنساخها. الكبيرة القطع حالة في الباك أو الياك

حية      -2  خلية إلى الناقل بداخل هي التي و المهجنة القطعة نقل

 ) االيكولي المعروف النوع خاصة البكتيريا تستعمل الغالب عملية) E.Coliفي فيالبكتريا ( تنقسم انقسامها سرعة إلى و إليها، الناقل إدخال لسهولة ذلك و الزراعة

كل ) 20تقريبا خاصة على تعتمد التي خاصة االختيار طرق توفر إلى إضافة ، دقيقة . البكتيريا داخل إلى تلقائيا الفيج أو البالزميد يدخل و الحيوية المضادات من الحماية

المحيطة األمالح تركيز بتغيير العادة في ،و مساعدة إلى تحتاج األخرى الناقالت بينمابدخول بالبكتيريا المحيط الجدار يسمح لكي كهربائية نبضة إلى تعرض أو بالبكتيريا

. البالزميدات. كذلك و سريع بشكل و تلقائيا تنقسم إنها البكتريا طبيعة من و الناقالت

86

تحتوي- 3  التي البكتيرية المستعمرات اختيارالمهجنة القطعة و الناقل على

البالزميد   تكاثر و البكتيرية الخاليا تكاثر معمن كثيرة أعداد لدينا ينتج بداخلها التي

البالزميد بها و البكتيرية المستعمراتالطبق. داخل في يكون قد لكن و المهجن

ال التي البكتريا بعض البكتريا فيه زرع الذييمكن لكي و المهجن البالزميد على تحتوي

على تحتوي التي البكتيريا على التعرفيقام العادة في فنه المهجن البالزميد

من واقية جينات عليها ناقالت باستعمالمن الواقي كالجين الحيوية، المضادات

و التترسيلين أو امبيسيلين الحيوي المضاديمنع. سوف الحيوي فالمضاد بذلك و غيرها

البالزميد على تحتوي ال بكتيرية خلية أي تكاثرمن الواقي الجين علي الذي و المهجن

. الحيوي المضاد

استخراج- 4  و المهجنة القطع استخالص. كبيرة بكميات منها أي ان الدي

يمكن   فانه المهجن البالزميد على تحتوي التي المستعمرات على يتعرف أن بعد . البكتيريا هذه و بالتكاثر تستمر لكي تغذى و عليها يحافظ و جديد طبق إلى نقلها

. هذه من يستفاد و النسخ عملية تنتهي بذلك و البالزميد من كثيرة أعداد فيها يكونمثال يقام كان عليها التجارب أو البحوث من بالمزيد القيام في المنسوخة القطع

. يمكن كما للقطعة النووي التسلسل استنتاج محاولة أو أي إن الدي من مكتبة إنتاج) أي إن دي سي من قطعة على البالزميد يحتوي بحيث العملية هذه )cDNAتحوير

. أي إن الدي من بدال بروتين إلنتاج الزراعة من األخيرة المراحل تحوير ثم من و بدلالنمو . كهرمون الهرمونات بعض إنتاج في تستعمل التي هي الطريقة هذه و

 

 

PCRتقنية Polymerase Chain Reaction

87

تفاعل البليمريز التتابعي 

.  ) DNAالحمض النووي ( تحفظ المعلومات الوراثية و انتاج المواد لصنع الخاليا و الحفاظ عليها في داخل بشكل تلقائي و بشكل سريع مع وجود  بمضاعفة كمية الحمض النووي وقت انقسام الخلية  و تقوم الخلية

قاعدة نيتروجينية بالثانية1000 سرعة النسخ والمضاعفة إلى  نظام تصحيح لألخطاء خالل النسخ. . و تبلغتحدث في الخلية في وقت التكاثر واالنقسام فقط .  ( داخل النظام الحيوي ) و هي كما ذكرنا

ومع التطور في مجال التكنولوجيا الحيوية والذي يقوم على ، بشكل أساسي  ) DNAالتعامل مع الحمض النووي (

العلماء على أن يبحثوا عن طريقة أو تقنية تقوم استدعى ذلك بشكل كبير ،  ) DNAعلى مضاعفة كمية الحمض النووي (

فكان هناك عدة محاوالت لتنشيط الخلية على االنقسام ، ولكن هذهgrowth factorsالمستمر بإضافة عوامل النمو

الطريقة لم تكن ذات جده لدى العلماء ألسباب كثيرة. إلى أن في عام  Dr. Kerry Mullis توصل العالم د. كري مولس

( و قد حصل على جائزة نوبل في الكيمياء عام1985 فكانت هذهPCRالبي سي ار  )بنشر اختراعه لتقنية 1993

التقنية بوابة لكثير من التطورات المتسارعة في مجال التكنولوجيا الحيوية ، من أهم األسباب التي ساعدت هذه

DNA و التحكم بكمية الحمض النووي ( التقنية على االنتشار عدم اعتمادها على النظام الحيوي(أي الخلية) و وسرعة في اإلنتاج ولكن كان من عيوب هذه التقنية عدم وجود نظام إصالح أخطاء االرتباط الخاطئ )

miss match      .

:   PCRما هو    خارج    ) DNAتقريبا تقوم على إكثار نسخ الحمض النووي ( م 1983هو تقنية مخبريه تم اكتشافها عام

الستنساخ النظام الحيوي . أي أنها طريقة لنسخ الحمض النووي في المختبر. و لذلك فهي تقنية حيوية لكي يتسنى إجرى عليه اختبارات و فحوصات  مضاعفة إنتاجها  قطعة من محددة من الحمض النووي و

إضافية.

:   PCRما هي متطلبات   بواسطة  ) DNAلتقوم بإنتاج الحمض النووي (

PCR : يتتطلب عليك توفير

للتحكم بدرجات حرارة التفاعل بشمل   . جهاز1 Thermocycle( الدورة الحرارية  دقيق و متتالي

) : ويقوم هذا الجهاز بتغير درجة الحرارة بشكل سريع ، آلن تغير درجة الحرارة هو األساس الذي

تقوم عليه فكرة هذه التقنية .

. البليمريز : وهو اإلنزيم الذي يقوم ببناء وترتيب2 ( حدات الحمض النووي ( القواعد النيتروجينية

DNA (  ويجب أن يكون هذا اإلنزيم مقاوم للحرارة العالية ليتمكن من العمل . و قد اكتشف انزيم ، ( Tagمقاوم للحرارة و اسم تاج

) ليتمكن اإلنزيم من ترتيبها في مواقعها أثناءA T C G. مجموعة متفرقة من القواعد النيتروجينية: ( 3

88

.   ) DNAعملية نسخ الحمض النووي (

و بداء البناء  ليتمكن اإلنزيم من   ) DNA: وهو قطعة صغيرة من الحمض النووي (  Primer بريمر      .4 عليها .  النسخ

المراد نسخه .   ) DNAوالشيء األهم هو وجود نسخة من الحمض النووي (       .5

باإلضافة إلى محلول أو وسط ليتم به التفاعل : وهذا المحلول يختلف بين تفاعل و أخر .      .6

عملي  ة

النسخ : مجموعة مع األحماض النووية البوليمريز و  و إنزيم   مع البريمر و بعد وضع الحمض النووي المراد نسخة

تمر بها عملية النسخ:  مراحل منفصلة3 التحكم الحراري فان هناك  في أنبوب داخل جهاز

األصل .   ) DNA م وذلك لفك الحمض النووي (94 : رفع الحرارة إلى   Denature. مرحلة التفكيك 1

60-55إنزال الحرارة إلى ما بين   :  anneal   . مرحلة االلتصاق2 م ليقوم البريمر باأللتزاق فيزيائيا

89

األصل .   ) DNAبواسطة الروابط الهيدروجينية مع الحمض النووي (

م ليقوم البلمريز بعمله في بناء75 : ثم يقوم برفع درجة الحرارة إلى   extend   مرحلة االمتداد     .3الجديد .   ) DNAالحمض النووي (

) األصل قد تضاعف ، وتعتمدDNAوهذه المراحل الثالث تعتبر دورة كاملة وفيها يصبح الحمض النووي ( توضح العملية ) .  على عدد الدورات ( والصورة التالية  ) DNAكمية ناتج الحمض النووي (

.هنالمشاهدة هذه العملية اضغط على

: PCRتطبيقات و الوراثة ومنها :   ) DNA تطبيقات كثيرة في مجال أبحاث الحمض النووي (PCRلتقنية

. الكشف عن الطفرات الوراثية : وذلك عن طريق وضع بريمر خاص للطفرة لتكثير الجين الخاص بها .1 ) . alleleومنه نقوم بمعرفة المرض إذا كان على زوجين الكروموسومات أو على احدهما (

تعين البصمة الوراثية .      .2

الكشف عن الفيروسات : وهذه الطريق هي األدق في تحديد نوع وجنس الفيروس وكميته.      .3

) : حيث نقوم   ) DNA الحمض النووي (Recombinant هو العنصر األهم في عملية التجميع الجيني ( .4المضيف .    ) DNAبتكثير الجين المراد إدخاله على البالزمد أو الحمض النووي (

) . Restriction enzyme استخدامه في تغير نهايات الجين لتصبح متوافقة مع إنزيمات القطع (      .5

( الحمض النووي  ) DNA الحمض النووي ( . هو العملية األساس في تحديد تتابع القواعد النيتروجينية في6)DNA (  Sequencer   . (

.   ) DNA معرفة طول الحمض النووي (     .7

) .   ) DNAالحمض النووي (cالمكمل (    ) DNA تقنية الحمض النووي (     .8

تحديد الجين المطلوب من خليط من الجينات .      .9

).  microarraysيستخدم في تقنية (   .10

) .   human genome project في مشروع الخارطة الجينية البشرية ( .11

) .   southern plot الساوثرين بلوت ( .12

DNA- ( Protein– بروتين ( الحمض النووي (  ) DNA تقنية ارتباط الحمض النووي ( .13Interaction. (

في مجال الطب الشرعي ( اختبار األمومة ، حاالت االغتصاب ، تحديد الهوية ... الخ ) .  .14

المخبرية والبحثية .  وغيرها من التطبيقات

90

: PCR هناك نوعان من :PCRأنواع  

1.  PCR . العادي : وهو ما تم شرحه والتطرق اليه في الخطوات السابقة

2.  rtPCR ) وهو اختصار لـ : Real Time PCRوهذا النوع يقوم على نفس المبدأ ولكن الخالف : ( الوحيد يكون مربتط الجهاز بكمبيوتر لتحديد الوقت الحقيقي لبدا التفاعل ومن ثم الكمية الحقيقية لعدد

ويعتمد ذلك على وجود قواعد نيتروجينية حرة مشعة لتحديد ذلك . مما  ) DNAنسخ الحمض النووي ( يسهل على الباحثين الوقت لتحدد وجود الجين المطلوب أو ال ، وكمية الجين بدون الوصول إلى نهاية

الدورات الحرارية المحددة .

اضغط هنا لسماع تسجيل فديو لتسمية البي سي ار بهذا االسم.

 

.االردن من  قام بإعداد هذه الصفحة مشكورا: األستاذ معاذ محمود17-6-2007

 

 

 

 

 صفحة الهندسة الوراثية الرئيسية

) استنساخ الكائنات الحية بالكاملReproductive cloningاالستنساخ التكاثري ( 

) Nuclear DNA يعرف االستنساخ التكاثري أو الجنسي بأنه إنتاج لكائن حي له نفس المادة الوراثية(  لكائن حي أخر المنسوخ منه. لقد قام الفريق العلمي بمختبر روزلين بعملية استنساخ جنسي في عملية

somatic cell nuclear ( استنساخ للنعجة دولي.و تعرف هذه العملية أيضا بنقل نواة الخلية الجسميةtransfer" (SCNT )و بشكل مبسط نقل نواة من خلية من خاليا الجسم غير الجنسية أي غير التي .

توجد في المبيض (في األنثى )و من خاليا الخصية(في الذكر).و الخلية التي استعملت الستنساخ دولي كان من خاليا الثدي لنعجة أخرى.و من ثم أخذت أيضا بويضة من المبيض و قام العلماء من التخلص من النواة

التي بداخل تلك البويضة ثم قاموا بزرع النواة التي أخذوها من ثدي في داخل البويضة. ثم قاموا بصعق تلك البويضة بالكهرباء لكي ينشطوا عملية االنقسام. و بعد أن بدأت هذه البويضة في االنقسام قاموا

بغرزها داخل رحم نعجة و بعدها نما الجنين في الرحم فأصبح"بإذن الله" نعجة كاملة.

علميا فان دولي (أو أي حيوان أو إنسان )يستنسخ بهذه الطريقة ليس في الحقيقة نسخة مطابقة لالم أو  األب الذي اخذ منه النواة. فهناك بعض من المادة الوراثية موجود خارج النواة و هو بالتحديد موجود في

داخل البويضة التي أزيل منها النواة.و هذه المادة الوراثية موجودة على جسيمات صغيرة تسمى

91

). و مع أن الميتوكوندريا مصنع هام للطاقة إال انه يكثر فيها الطفرات مع Mitochondriaبالميتوكوندريا (تقدم العمر وقد يكون لها عالقة بالهرم.

 

 

   

الوراثية الرئيسية صفحة الهندسة

Therapeutic cloningاالستنساخ العالجي

) و ال يسمح لها للوصول إلى تخليقStem Cellsو يقصد بذلك استنساخ كائنات حية ألخذ خاليا جذعية(  كائن حي كامل. و أهمية هذه الخاليا تنبع في قدرة هذه الخاليا في إنتاج أي خاليا أو أعضاء كالكلية و الكبد

و الخاليا الدموية و التي يرجى في استخدامها عالج الكثير من األمراض التي ال يوجد لها عالج شافي. و Advanced Cellلقد قامة إحدى الشركات العلمية في والية ماسيشيوستز بالواليات المتحدة األمريكية (

Technologies باإلعالن عن محاولة ناجحة الستخالص خاليا جذعية2001عام   ) في شهر نوفمبر من بويضات بشرية تم تفريغها من نواها ثم زرع بداخلها8 من أجنة مستنسخة و ذلك بعد أن قامة باستخدام

نوى خاليا من الجلد.و لقد نجحوا في إنتاج خاليا جذعية من بويضة واحدة بينما فشلة البويضات السبع.و.صفحة الخاليا الجذعية للمزيد من المعلوماتيمكنك الرجوع إلى

 

الشرعية |  المتالزمات| األم و الطفل | الطبية الوراثة   نحن من|

وسرطان الوراثة  الثدي

 

يعتبر سرطان الثدي عند النساء ثاني السرطانات شيوعا عند النساء،.بينما هو من السرطانات النادرة لدى % من مجموع المصابين بسرطان الثدي.وفي األسطر القادمة سوف نناقش1الرجال فهو يمثل فقط

سرطان الثدي من الناحية الوراثية و دور الجينات(المورثات)في اإلصابة بالمرض ولن نتطرق إلى األساليبالعالجية.

92

الوراثة و سرطان الثدي

المتعددة   بالوراثة تنتقل التي األمراض من الثدي سرطان أن العلماء لدى شك الثم. لإلصابة قابله يجعلها وراثي استعداد لديها كان إذا الثدي بسرطان تصاب فالمرأة األسباب

. التي الجينات عن البحث يحاولون الوراثة وعلماء بها المحيطة البيئة في ما شيء إلى تعرضهعن البحث عام بشكل بسرطان المهتمون يقوم أنهم كما لإلصابة قابليه لديها المرأة تجعل

. البيئية المسبباتالعائالت بعض هناك أن إال األسباب المتعددة بالوراثة ينتقل الثدي سرطان أن قلنا أننا مع

) . على المرض ينتقل قد بذلك و قوي وراثي عامل لوجود نتيجة لإلصابة عالية قابلية لديها . ( العائالت هذه على الوراثية األبحاث بإجراء الوراثة علماء يقوم و أخر إال جيل من جين شكل

. جين اكتشاف عن أخر و حين بين الصحف في تقراء قد و الجينات من جديدة أنواع الكتشافللسرطان الحقيقية األسباب اكتشاف لمحاولة الجهود فتتضافر الثدي سرطان يسبب جديد

لهذا وفعال جديد عالج إنتاج أو سرطان من للوقاية حديثة طرق اكتشاف في تفيد قد والتي. الخبيث المرض

عن نتيجة اإلصابة هذه تكون أن بالضرورة فليس ما عائلة في الثدي سرطان تكرر عند و . بعضها مع أسباب عدة تضافر عن ناتجة تكون فقط األسرة تلك في قوية وراثية عوامل وجود

( مسرطنة( مواد إلى المصابين كل تعرض عن ناتجة أو األسباب المتعددة الوراثة أي البعض . السرطان لهم حدث الثدي بسرطان المصابين معظم أن نقول أن نستطيع فلذلك البيئة في

. وراثية عوامل لديهم المصابين من القليل بينما البعض بعضها مع وبيئية وراثية لعوامل نتيجة . أن هو ذلك في السبب و أسباب نقل ولم عوامل كلمة استعملنا أننا الحظ فقط بيئية أو فقط

نتيجة بسرطان لإلصابة الوالدة منذ االستعداد لديه عنده كان بسرطان أصيب الذي الشخص ( ) لوحده التغيير هذا ولكن بالطفرة التغير هذا ويسمى الجينات احد في تغير أو خلل أو لعطب

في ما شيء إلى التعرض بعد أو العمر مرور مع ولكن مرض بأي العادة في يسبب ال ( الثانية( النسخة إصابة إال أدى النووية األشعات او الكيميائية المواد او الفيروسات بعض البيئة

. الثدي سرطان و السرطانات تعتبر ولذلك بالسرطان اإلصابة له فسبب بالعطب الجين من

..الفحص قبل الزواجد : * رهبيني . بقلم عبدالله (*) زهير

أعد قد الشورى مجلس عضو الفالح زيد بن فالح الدكتور لتطوير كان دراسةالذي المستقبلية الرؤية مؤتمر إلى قدمها المملكة، في الصحي نظمته النظام

التخطيط . وزارةفي الصحي النظام تطور دراسته في الفالح الدكتور ذكر والذي وقد المملكة

« : ... وبالرغم التالي النص األخرى الخدمات بقية مثل متنام بشكل هذا ينمو منإال السعودية العربية المملكة في الصحية الخدمات في والواضح الجيد التطور

في أن الصحي النظام قصور على تدل التي المؤشرات من مجموعة هناك...«. المملكة

الرضع » ( وفيات معدل يزال ال أنه وهو األول المؤشر بذكر في 21واكتفىالتطور ) األلف درجة في المملكة تماثل أخرى دول إلى قياسا «. مرتفعا

الوفيات عدد ) (إن عام حتى الرضع حي، 52هـ 1405وفيات مولود ألف لكلعام في إلى 1420وانخفضت . 21هـ إنجاز هذا أن شك وال حي مولود ألف لكل

وضع إلى يرجع وذلك السعودي الصحي من للنظام للحد االستراتيجيات

93

التطعيم برامج استكمال مثل المعدية األمراض بسبب ضد الوفيات والتحصينبالحوامل األفضل العناية بسبب وأيضا المعروفة المعدية في األمراض والوالدة

مهيأة صحية . مراكزمن هي المتدرجة االستراتيجية الصحية البرامج التقليل إن في العوامل أهم

والعالج التشخيص في وكذلك باألمراض اإلصابة من . المبكر والحدواالقتصادية والتوعوية واإلعالمية الصحية العملية بالبرامج وغيرها وأقصد

برنامج بها اإلشادة من بد ال التي البرامج هذه ومن األمراض من والحد للتقليلاألمراض من للحد استراتيجية خططا البرنامج شمل حيث لألطفال التطعيم

تتضمن بين المعدية القائم والترتيب واإلرشادية والتوعوية الصحية النواحيووزارة الصحة من وزارة االنتهاء بعد والده بطاقة إلى المولود بإضافة الداخلية

األساسي . التطعيماإلصابة كل كانت حيث ناجحا برنامجا يعتبر التطعيم برنامج جعلت األمور هذه

عام بشلل في هي 1405األطفال إصابة 29، 0هـ توجد ال واآلن ألف مائة لكلالحمد ولله . والمنة تذكر

( سن ( حتى ب الوبائي الكبد التهاب من 12ونقص إلى 7، 6سنة ألف مائة لكلالسكان 3، 0 من ألف مائة . لكل

أنه للتطعيم الصحي النظام نجاح في السبب كان إذا متكامال برنامجا كانوعونه الله توفيق بعد فقط للتطعيم مواعيد . وليست

عام أعود في الوفيات عدد الرضع 1420/1419إلى وفيات معدل وأقصد هـ مرتفعا اليزال أنه ) 21 (حيث تماثل أخرى دول إلى قياسا حي مولود ألف لكل

الصحي التطور درجة في . المملكةفي المسؤولة الطبية المصادر من واضحا ليس العدد لهذا الحقيقي السبب إن

لبعض المملكة إال للمعلومات دقيق نظام وجود عدم إلى يرجع هذا ولعللها وضع التي والسرطان األمراض األورام أمراض مثل وطني . سجل

خاصة دقيقة غير عادة الوفاة تقارير السبب إن حسب أحيانا تمأل ألنها للرضعالتنفسي الجهاز توقف مثل للوفاة عن األخير معلومات تعطي وال والدوري

: بسبب يكون قد الوفاة سبب أن مثل للوفاة المباشر المعدية السبب األمراضمن الوفاة تقارير تمأل كثيرة أحيان وفي لغيرها، أو الوراثية الطبيب أو ¬ل قب

السابقة المريض حالة عن كافية دراية لديه يكون ال قد الذي . المناوبب للرضع الوفيات معدل انخفاض عام% 60إن إلى 1405من يعود 1420ه ه

ذكرت المعدية، كما األمراض من للحد البرامج ووضع الصحي التطور إلىنسبته ما تبقى عائدة لم% 40ولكن نظري في وهي مباشرا سببا لها نعرف

الوراثية األمراض إلى األولى الوراثية بالدرجة التمثيل أمراض منها وأخصاأليض( أمراض أو االستقالب ). أمراض

قام بدراسة لقد بالرياض األبحاث ومركز التخصصي فيصل الملك مستشفىمن سنوات ثالث لمدة في 1417هـ 1414 استمرت دم عينات بأخذ وذلك هـ

في يولد مولود لكل الثالث أو الثاني الرياض ( اليوم في أثنين مراكز ثالثة ( من مرضا ثالثين يشمل الفحص وكان ، جدة في التمثيل وواحد أمراض

المذكورة سنوات الثالث خالل مولود ألف ثالثين مسح تم وقد وكانت الغذائي، ( لكل ( واحد مولود إصابة هي مولود ( 1400النتيجة وأربعمائة ألف حي مولود

94

). حييكون طفل وأربعمائة ألف من واحدا طفال ان وهي بسيطة معادلة ولوضع

بأحد عدد مصابا يكون فكم الدراسة، عليها جرت التي الثالثين األمراضأن عرفنا إذا خمسمائة المصابين تتجاوز المعروفة الغذائي التمثيل أمراض

بأحد! اإلصابة تكون وكم اآلن مرض؟ تتجاوز أنها عرفنا إذا الوراثية األمراضمرض؟ آالف عشرة من أكثر

أمراض الوراثية إن األمراض من جدا بسيطا جزءا تعتبر الوراثية الدمالمملكة، في هي الموجودة األخرى الكثيرة الوراثية األمراض من كثيرا إن بل

مناطق في وموجودة منها كثرة أخطر بسبب االختصاص لذوي معروفة معينةمعينة مناطق من األمراض لهذه . الحاالت

المدينة إن وحول وجيزان الشرقية المنطقة في موجودة الوراثية الدم أمراضولكن مناطق المنورة في الوقت نفس في وخطيرة أخرى وراثية أمراضا هناك

العربية المملكة من . السعودية أخرىالدم في الحموضة فأمراض الحصر وليس المثال سبيل Organic (وعلى

Acidemia ( ،الجنوبية والمنطقة القويعية منطقة في كبيرة بنسبة موجودةأمراض الدواسر وبعض وادي منطقة في شيوعا أكثر الوراثي األمونيا ارتفاع

أمراض وبعض الخرمة، الباحة، وفي منطقة في معروفة األمينية األحماضالدهنية للمواد الغذائي التمثيل الشمالية، وأمراض المنطقة في موجودة

المدينة منطقة في موجودة الجاليكوجين تخزين وأمراض وأمراض المنورة، ( القصيم ( منطقة في أكثر الميتوكندريا أمراض الالكتيك حمض . ارتفاع

الوراثة، طب مجال في قرب عن يعمل من لكل معروفة السابقة األمثلة كلأن نمط كما لها أصبح الوراثية الطفرات عن الناتجة المتالزمات من كثيرا

في معروف . المملكة جغرافي حاليا تضم والتي التخصصي فيصل الملك مستشفى في الوراثة عيادات إن

تستقبل عشر أسبوعيا مريض مائة من أكثر ومتابعة لرؤية األسبوع في عياداتعن يقل ال ) (ما الطبية الوراثة أمراض من أسبوعيا جديدة حالة عشرين

الوالدة عند لما والتشوهات بسيطا جزءا يعتبر وهذا المختلفة، والمتالزماتالمستشفى إلى الحاالت من للمرضى يحول الفعلي العدد هو فكم المذكور

الذين المرضى أو الصحة وزارة في المحولين المستشفيات غير في يتابعونالدفاع ووزارة الوطني الحرس من كل في األخرى الصحية ووزارة والخدمات

الخاص والقطاع الجامعية والمستشفيات . الداخليةوزارة على أن أرى تحتوي إنني المدى طويلة استراتيجيات تضع أن الصحة

الزواج قبل لما المبكر الفحص برامج وذلك على الوالدة وبعد الحمل وأثناءاألطفال على الباهظة العالجية النفقات من انخفضت للحد وقت في المعوقين

الزيادة بسبب وذلك األفراد على الصحي الصرف ميزانية عدد فيه في السنويةإلى تصل التي الفرد% 7، 3السكان على الصحي الصرف معدل كان فقد ،

إلى 1404 عام يصل عام 1085هـ في وانخفض إلى 1419رياال رياالت 610هـأن شك وال العام سعودية، اإلنفاق من سيقلل الوقائية الصحية البرامج وضع

البعيد المدى على الصحة . علىاألخرى الوقائية البرامج أو الزواج قبل الفحص برنامج أن سبق مما يتضح إذا

95

واضحة مهمة ليست أهميتها أن أظن وال اثنان، عليها يختلف أنه أظن والوزارة في هذه للمسؤولين مثل تطبيق مسؤولية عليها تقع التي الصحةاألولى بالدرجة . البرامج

قامت الوبائية لقد األمراض لبعض الزواج قبل الفحص ببرنامج بالبدء الوزارةالدم محرم / وأمراض في الصادر الوزراء مجلس قرار على استنادا الوراثية

. هـ1423أن هذه وقبل على القائمين شكر من البد المذكور البرنامج في رأيي أعطي

بدأت ألنها قبل البرامج الفحص أن كما السعودي، الصحي النظام ضمن تضعهاكبرنامج حقيقة يبدأ لم مع الزواج التطعيم لبرنامج الحال هو كما متكامل

البرنامجين آلية . اختالفليس الزواج وله إن واجتماعي شرعي ارتباط هو بل فقط طبيا فحصا

معها التعامل يجب كثيرة على مداخالت متحفظ مجتمع في وطني كبرنامجاألمور هذه . مثل

أمراض على مقتصر أوال في فهو معينة مناطق في تنتشر التي الوراثية الدمعلى تعمم أن األولوية من فليس يوجد المملكة ال المملكة في أخرى مناطق

من ليست القصيم منطقة فمثال األمراض، تلك مثل بها بها يوجد التي المناطقتلك على الفحص هذا مثل يعمم فلماذا الوراثية الدم !! المنطقة أمراض

وأن التكاليف معقولية على أهدافه تقوم أن صحي نظام أي أهداف من إنصحيحة علمية أسس على . تقوم

التي المناطق على البرنامج هذا مثل تطبيق يمكن األمراض نعم هذه بها تنتشرالشرعية الجوانب يراعي ومتوازن متكامل بشكل تكون واألسرية وأن

وغيرها واالقتصادية والطبية . واالجتماعيةالبرنامج هذا تطبيق أردنا وحول لو جيزان ومنطقة الشرقية المنطقة على

أمراض بها تكثر حيث المنورة المدينة وضعنا منطقة فهل الوراثية الدماآلتية : االعتبارات

في 1 الزواج قبل للفحص برنامج استشارية كل عيادات يضم أن يجب العالمفليس إيجابية عينة أي ظهور عند الوراثية يكون للمشورة أن العدل من

التي العيادات هذه مثل توجد ال وكما إجباري شبه أو اجباريا أن الفحص يجبالمجال هذا في متدربة بأيد . تدار

علما أصبح الوراثي الطب علم منها إن كثيرة تخصصات تحته يضم مستقالالتمثيل أمراض وتخصص األكلينيكي الوراثي الوراثة الطب وتخصص الغذائي

الوراثية... الطبية المشورة في معروف تخصص ومنها Genetic (الجزيئيةCounselling .( عدد لمثل وموازية موجودة استشارية عيادة كم فالسؤال

السعودية الحاالت الكوادر لتدريب برنامج هناك هل إيجابية، ستظهر التيهذا مثل لتغطية الحقا . البرنامج

تؤخذ دم عينة ليست الزواج قبل الفحص أن أؤكد أن أريد برنامج وهنا ولكنهمتكامل . صحي

قبل من إداريا يرتب الزواج قبل الفحص برنامج لألمراض إن الوطنية اللجنةشهادة يحملون منهم اثنان أعضاء تسعة تضم التي في الوراثية التخصص

أكثر األقل على أو اللجنة أعضاء معظم يكون أن أتمنى وكنت الوراثي الطب

96

الفحص % 50 من برنامج وضع ألن وذلك المذكور بالتخصص عالقة لهم منهميحتاج الزواج الوراثية قبل لألمراض الشمولية للنظرة التخصص أصحاب إلى

. بالمملكةقبل 2 الفحص لتفادي إن كاملة بسرية يتم أن يجب الالحقة وتبعاته الزواج

أخذ فهل االجتماعية، البرنامج الوصمة ضمن ذلك يتم كيف االعتبار فياالعتبارات حيث مجتمعنا في خصوصا تخفى المذكور ال واألسرية االجتماعية

أحد . على ( على ( أقبل س أن لو أكثر أوضح ) ولعلي الزواج ( قبل وبالفحص ص من الزواج

( فكيف ( المنجلية، الدم موروثات يحمل س أن الفحص تبين هذا سرية تحفظاجتماعية تبعات الزواج هذا فصل لمثل يكون قد الذي مجتمعنا نأخذ في لم

البرنامج ضمن . حسابهافإنه الموجودة المختلفة الفحوصات لفكرة أن وكمقدمة معروف هو كما

. والخلية الخاليا ماليين من تتركب وأعضاء أجهزة من يتكون هي اإلنسانتحمل والتي النواة على بداخلها تحتوي حيث الحي للمخلوق األساسية الوحدة

. الوراثية الحقيبةالخاليا في وراثية صبغة وأربعين ست من تتكون الوراثية الجسدية والحقيبةالحيوانات ( الجنسية الخاليا أما وغيرها والشعر الجلد و الدم خاليا المنوية مثل

كروموسومات) ( وراثية صبغة وعشرين ثالث على فتحتوي ). والبويضات) تحتوي التي ( الوراثية الشيفرة وهي الجينات المورثات على الكروموسوماتالبروتينات أو تكون الهرمونات أو األنزيمات مثل الجسم في المختلفة

مئات من وغيرها الدم الجسم هيموجلوبين بوظائف تقوم التي البروتينات. المختلفة

را تغي يعني الوراثي المرض بالطفرة إن يعرف ما وهو الوراثية الشيفرة فيغير أو ناقص بروتين إنتاج في تتسبب . طبيعي التي

إلى يؤدي قد الهيموجلوبين مورثة في طفرة حدوث أن ذلك ومثالأنيميا هيموجلوبين أو المنجلي الدم مرض بشكل عمليا يظهر طبيعي غيرالمتوسط البحر الوراثية) (حوض الدم أمراض من غيرها أو . التالسيميا

بالمعادلة السابق فهم ) ويمكن الجين: ( المورثة في طفرة غير 3اآلتية بروتينمرض (3طبيعي طبيعية غير ). وظيفة

يلي فيما المرض حاملي فحوصات تلخيص : ويمكن1 : يمكن السريرية بعض العالمات معرفة الوراثي الطب في للمتخصص

األمراض بعض حاملي على تظهر التي األمراض األعراض خصوصا الوراثيةإلى ( المرض لنقل كافية واحدة مورثة أن أي السائدة من% 50 الوراثية

السينية) بالصبغة المرتبطة الوراثية األمراض أو )Chromosome X (األطفالالكهربائي كالتخطيط المختبرية بالدراسات السريري الفحص مساندة ويمكن

أو من للعضالت وغيرها األشعات عمل أو للعين الكهربائي التخطيط. الفحوصات

لناتج 2 قياس: تحليل باإلمكان حيث الوراثية الدم أمراض ذلك ومثال المورثةفي الهيموجلوبين وبالتالي نوع الطبيعية وغير الطبيعية نسبه ومعرفة الدم

ولكن للمرض، الحامل معرفة ألمراض يمكن محدودة الطريقة هذه تبقى

97

يعرف ال الوراثية األمراض من كثيرا إن حيث البروتين معينة نوع طبيعة فيهافقط وتؤدى مكلفة الطريقة تبقى ولكن يعرف أنه أو مختبرات المصاب، في

. األبحاث3 : بعض الدم في الكيميائية المواد لبعض الثانوية الوراثية التغيرات األمراض

أو المريض على معرفتها يمكن ثانوية كيميائية تغيرات إلى تؤدي حامل قدالعضالت حثل أمراض بعض في الكرياتين مادة ازدياد مثل . المرض

هذه تبقى دقيقة ولكن ليست االختبار حساسية أن كما محدودة أيضا الطريقة . أيضا

) : المورثات 4 أصبح ( المجين البشري الجينوم أو الوراثية الخارطة اكتشاف بعدأماكن معرفة الطفرات باإلمكان أن كما الوراثية األمراض من لكثير المورثات

على دراستها تمت قد . الجينية تحليل إجراء ويمكن األمراض من كثيراألمراض من كثير على مباشرة الوراثية أن . الطفرات على التنبيه يجب ولكن

مجتمع من تختلف المورثات في التغيرات أو الوراثية وعلى الطفرات آخر، إلىأنها وجد الرئوي الكيسي التليف مورثة في الطفرات فإن المثال تختلف سبيلونشرت تمت التي الدراسات حسب الغرب في عنها السعودي المجتمع . في

نظري طريقة وفي أفضل وأنها المرض حامل لفحص طريقة أهم هذه إنقبل الفحص على تطبيقها المنتشرة يمكن الوراثية األمراض من لكثير الزواج

الوراثية ( الدم أمراض غير المملكة الهيموجلوبين في إلى النظر يمكن التيمباشرة الطبيعي ). غير

هذه تطبيق قبل من ولكن لكثير الوراثية الطفرات دراسة من البد الفحوصاتالجهد وهذا المملكة في األبحاث األمراض ومراكز الصحة وزارة على يقع

المملكة في . والجامعاتأؤكد أن أريد بل وهنا الوراثية الدم أمراض فقط ليست الوراثية األمراض أن

التي األمراض من عشرات في هي والقبائل العوائل حسب المملكة في تنتشرالمختلفة . المناطق

في المتخصص الوراثية إن األمراض هي ما يعرف أصبح الوراثي الطبقبيلة كل وفي منطقة كل في إلى المنتشرة اليومية اإلحاالت واقع من

التخصصية . المستشفياتالفحوصات تطبيق ألمراض ويمكن الزواج قبل ما فحص يحدد بأن السابقة

ومنطقة الشرقية للمنطقة الوراثية المنورة، الدم المدينة منطقة وحول جيزانالمورثات فحص طريقة في فينظر األخرى المناطق ألمراض أما مباشرة

منطقة كل في انتشارها حسب محددة . وراثيةفي الصحية األنظمة النظام إن أن إال مثالي نظام يوجد وال متعددة العالم

يعكس أن البد بلد ألي للمؤسسة الصحي المتكاملة االستراتيجية الرؤيةلألنظمة المشترك القاسم ولكن تحقيقها التنفيذية طبيعة هو الجيدة الصحية

منها معينة : ألهدافوالعادلة 1 الشاملة المواطنين التغطية . لكلمعقولة 2 تكلفة ذات تكون . أنصحية 3 علمية أسس على تتم . أن

برامج من كبرنامج الزواج قبل الفحص على األهداف هذه إنزال حاولنا ولو

98

مناطق النظام لكل شامال الزواج قبل الفحص برنامج يكون أن فالبد الصحيمدنها . وقراها المملكة

منطقة كل في الشائعة لألمراض ينظر بحيث عادال الفحص يكون أن البد ولكنأنها حين في موجودة غير أمراض إلى ينظر أن العدل من فليس قبيلة، أو

الفحص إلى لهم أحوج بالنسبة أهمية أكثر أخرى ألمراض . المبكرموجودة الزواج قبل الفحص برامج والواليات إن أوروبا دول في ومطبقة

هذه يصنفون ولكنهم وغيرها وكندا األمريكية العرق المتحدة حسب الفحوصاتلهم السوداء البشرة ذوو فاألمريكان المثال سبيل وعلى فحوصات الموجود

يهود أن كما بهم خاصة فحوصات لهم أوروبية أصول من واألمريكان معينةبأمراضهم أمريكا متعلقة فحوصات . لهم

وهنا معقولة، تكلفة ذا البرنامج يكون أن على والبد الفحص تعميم أن أؤكدغير في األموال يضع المملكة مناطق لكل الوراثية الدم مكانها أمراض

باهظة تكون قد بتكاليف الفحص فرض يمكن كيف إذ للجهد، وإهدار الصحيح. على أو األمراض اختيار أن كما األمراض هذه مثل بها يوجد ال منطقة

يجب للفحص صحية المورثات علمية ودراسات وأسس ضوابط على يقوم أنمثل في الخبرة أهل مشاركة من البد العلماء لذلك منهم وأخص البرامج هذه

واألخصائيين الوراثيين والمرشدين الوراثة حيث وأطباء وغيرهم االجتماعيينمن الجميع لمشاركة يحتاج وطني برنامج هو البرنامج هذا االختصاص إن . ذوي

: الزواج قبل الفحص برنامج هل التالي السؤال الذهن إلى يتبادر يكون هناما ألخص ولكن آخر مقال إلى يحتاج الحقيقة في والجواب إجباريا؟ أم اختياريا

التالية النقاط في : أراهقبل 1 الفحص برامج وضع إلى سبقتنا التي الدول أكثر جعلته إن الزواج

على الفحص نتيجة يربط لم إجباريا جعله ومن إجباريا، وليس العالقة اختياريابغض اختياريا الزواج على واإلقدام إجباريا الفحص جعلوا بل مباشرة الزوجية

الفحص نتيجة عن . النظراختيارية أنها من الرغم على البرامج تلك نجاح في تبنوها والسبب أنهم

األولى المراحل منذ والتوعوية التعليمية القضايا يشمل متكامل من كبرنامجمن وجزء اإلعالمية التوعوية البرامج من وجزء التعليم من جزء فهو الحياة

. الرعاية في ووطنية جماهيرية قناعة هناك أصبح لذلك وغيرها األولية الصحيةبأهمية الدول الحياة تلك في وتطبيقاتها الفحوص . هذه

كان 2 لذلك وقانونية شرعية قضية هو الزواج واالجتماع إن الدين لعلماءالدول تلك في الفحوصات هذه مثل في القوية . آراؤهم

الزواج إن على المقدمين والمرأة الرجل بين القلبي واالرتباط الزوجية العالقةيمكن نفسية ال قناعة هناك يكن لم إذا اختياريا أو إجباريا الفحص بجعل منعها

هذه . اإلجراءات لمثلعلمائنا رأي أسمع لم فإني المملكة في البرنامج هذا لمثل الحماس ومع

إجباريا جعله في اإلسالم ورأي الزواج قبل الفحص إجبارية بإقرار األفاضلفي وليس الشرعية الهيئات من غيرها أو العلماء كبار هيئة هنا وأقصد اختياريا،

السعودية المملكة . العربيةالعيادات 3 الزواج قبل الفحص برامج تطبق التي الدول في االستشارية يوجد

99

ما فكثيرا الزواج قبل لما االستشارية العيادات وخاصة الوراثة يأخذ ألمراضباألمراض عالقة لها التي األمور كل لمناقشة موعدا الزواج على المقدمون

الشرعية النظرة بدون العيادات هذه مثل عندنا نؤسس أن أقصد وال الوراثية،عاداتنا لمجتمعنا مع لتتماشى وتكييفها الفكرة من االستفادة باإلمكان ولكن. وتقاليدنا

: بعد يكون هل الفحوصات، هذه لعمل وقت أفضل هو ما آخر سؤال وهنافي أم مباشرة؟ الوالدة الزواج قبل أم الدراسة سني

أجل من الجدد المواليد من العينات أخذ مورثات إن يحملون هم هل المعرفةفي قانونيا شائكة مسألة تعتبر ال أم معينة اإلسالمية مرضية غير المجتمعات

نفسه اإلنسان من الحق أخذ بدون المورثات هذه إلى ينظر هذه حيث في وهوسرية حفظ إلى باإلضافة قانونية، قضايا أثار مما الجديد المولود الحالة

التأمين بشركات وعالقته اإلنسان تخص قضايا من ذلك يتبع وما . المعلوماتأن مناسب كما غير المملكة في عندنا مقرر هو كما للفحص العينة أخذ

العالقة أن أحيان والسبب في ومخطوبته الخاطب بين واالجتماعية النفسيةالفحص قبل بدأت قد تكون إذا كثيرة كبيرا إحراجا يسبب قد هذا أن رأيي وفي

الدم، فحص بسبب العالقة هذه سبب انقطعت يعرفون ال واألقارب فالمجتمعالسبب عرف فإذا كثيرة تساؤالت يثير مما الفصل لم هذا وإذا مصيبة كانت

أكبر المصيبة كانت . يعرفزالوا ال الناس أن هنا أؤكد المرض وأنا ومعنى الوراثية األمراض طبيعة يجهلون

يوصم أن يمكن بساطة فبكل المرض وتبقى وحامل وراثيا مريض بأنه اإلنسانللمرض مورثات يحمل ربما أنه حين في اجتماعية شيء وصمة وهذا فقط

أن يمكن التي المرضية المورثات هذه من عددا يحمل إنسان فكل طبيعيالوراثية الطفرات نفس تحمل زوجته كانت إذا أبنائه إلى كمرض . ينقلها

هنا الرجال ومن على الفحوصات هذه لعمل وقت أنسب يكون أن أرى فإننييكون عندما هو أن والنساء وقبل العامة الثانوية في طالبة أو طالبا المواطن

بالزواج . يرتبطاعندما وهذه نجاحها أثبتت والية التجربة في االشكنازي اليهود على طبقت

بالواليات أمراض نيويورك العرق هذا بين انتشرت فقد األمريكية المتحدةإشكاالت هناك وكانت خطيرة ثم وراثية ومن الحمل أثناء التشخيص في

هذه بأحد الجنين إصابة ثبت إذا العالجي فوضع اإلسقاط األمراضلما المورثات لفحص الدم عينات أخذ وهو متكامال برنامجا يقارب المتخصصون

إلى العينات هذه وترسل الثانوية وطالبات طلبة من وراثية أمراض عشرة مركز مطلقا الشخص اسم خاللها يذكر وال معين برقم . للتحاليل

االسم ذكر عدم في رقم والسبب يعرف وال تماما السرية على للحفاظ هوتحفظ ذلك وبعد ، صاحبها إال وقبل العينة الخطوبة موعد يأتي حتى المعلومات

مركز في الرقمين من التأكد يتم ذلك غير كل أم متوافقة هي هل التحاليلالوراثية المشورة بإعطاء أيضا يشرع وعندها مباشر متوافقة غير بشكل

والمرأة للرجل أخيرا الخيار . ويتركالسابقة التجربة أثبتت هذه لقد وبعد شائعة األمراض هذه كانت حيث نجاحها

قلت الماضية سنة العشرين خالل تحت التجربة أصبحت أنها حتى كبير بشكل

100

األمريكية المتحدة الواليات في العام انتشارها . مستوىأسبوعين أو بأسبوع يرتبط لم أنه البرنامج هذا نجاح في المباشر السبب إن

يحفظ قبل البرنامج أن كما المدى بعيدة استراتيجية هناك كانت بل الزواجالكاملة واالجتماعية السرية الدينية القضايا ويتضمن الفحص يريد لمن

برنامج أنه أي . والتعليمية إن الزواج قبل تؤخذ دم عينة مجرد وليس متكاملوترتيبها تطويرها يمكن التجربة الديني هذه لوضعنا مالءمة أكثر تصبح بحيث

عند األنسب الموعد اختيار وربما مناطق واالجتماعي مختلف على تعميمهاقبيلة أو منطقة كل في الشائعة األمراض بحسب . المملكة

اآلتية النقاط إلى أخلص لعلي النهاية : وفيالزواج: قبل الفحص تبني متكامل أوال . كبرنامج

: إجباريا وجعله للمواليد المبكر الفحص ببرنامج البدء في ثانيا التوسع قبلالزواج قبل الفحص . برنامج

استشاريي: من أكبر عدد إشراك الوطنية ثالثا اللجنة في الوراثي الطبيمثلون بحيث الوراثية من% 50لألمراض األقل اللجنة على . أعضاء

في: الشروع قبل مبكرة مرحلة في وجعله الفحص وقت في النظر رابعاوتفادي المعلومات سرية على والحفاظ لمخطوبته الخاطب وتحديد الزواج

. االجتماعية الوصمةتضم: الزواج قبل للفحص استشارية عيادات إنشاء في الشروع خامسا طبيبا

األقل على وراثيا ومرشدا . متخصصامع: األخرى الوزارات مشاركة البرنامج سادسا هذا دعم في الصحة وزارة

ووزارة والتعليم التربية وزارة بالذات لوضع وأخص واإلعالم الثقافةوالفحص الوراثية األمراض عن وتوعوية تعليمية لألمراض استراتيجيات المبكر

المبكر والفحص الحمل وأثناء الزواج قبل ما فحص تشمل التي الوراثيةالجدد . للمواليد

والطبية: الصحية الكليات خالل من أكاديمية برامج وضع في سابعا للتخصصالطبية المشورات أو العالج أو التشخيص مجال في سواء المجال . هذا

كان هذه فما الزواج قبل الفحص لبرنامج المستقبلية والرؤية االقتراحات بعضفمن الشيطان صوابا ومن فمني خطأ كان وما . الله

أن دعوانا وآخر محمد نبينا على الله العالمين وصلى رب لله . الحمد

الملك(*) بمستشفى الوراثي والطب األطفال طب استشاري . بالرياض األبحاث ومركز التخصصي فيصل

مستقبلية رؤية..... الرجوع ..... .. صحيا برنامجا يصبح أن البد الزواج قبل االعتبار الفحص في يأخذ وطنيا

الزواج قبل الفحص مجتمعنا ..خصوصيةمستقبلية رؤية

.. صحيا برنامجا يصبح أن البد الزواج قبل االعتبار الفحص في يأخذ وطنيامجتمعنا خصوصية

101

102