SUPPLEMENTAL METERIALS AND METHODS

Isolation of the Target Metabolite

Fresh leaves (37 kg, uncut) of the bitter cultivar 9930 were extracted thrice with 95%

ethanol (300 L for the first extraction and 220 L for following two times) at 80°C.

After filtration, the extracts were combined and evaporated under vacuum to remove

the ethanol. This extract (6 L) was defatted and decolorized using petroleum ether

(PE, 60-90°C; 8×5 L) and the final residue was subjected to column chromatograph

(CC) on macroporous resin (D101, 1 kg, 30×14 cm) with an EtOH-H2O gradient

(20:80, 80:20, 95:5) to yield three fractions (Fr.1–Fr.3). About half amount of Fr.2 (59

g) was then chromatographed on silica gel (1 kg, 25×8 cm) with a CH2Cl2-MeOH

gradient (20:1, 10:1, 5:1, 1:1) to yield seven fractions (Fr.A–Fr.G). Fr. D (2.2 g) was

subjected to chromatography on silica gel (110 g, 20×4 cm) with a gradient solvent of

CH2Cl2-MeOH (10:1, 5:1, 2:1) to yield three fractions (Fr.D-1–Fr.D-3). Fr.D-2 was

then chromatographed on RP-18 silica gel (30×2 cm) with a gradient solvent of

MeOH-H2O (50:50, 70:30, 100:0) to afford four fractions (Fr.D-2-1–Fr.D-2-4). Fr.D-

2-2 was finally purified by semi-preparative HPLC (MeOH/H2O, 38:62, 2.0 mL/min)

to yield compounds 1 (21 mg).

Structure Elucidation of the Target Metabolite

NMR analyses of compound 1 were performed on a Bruker Avance III 500 with

Pyridine-d5.

Compound 1 white, amorphous powder; [α] +35.8 (c 0.12, MeOH). The molecular

formula was determined to be C38H58O13 on the basis of the HRESIMS at m/z

740.4220 [M+NH4]+ (calcd for 740.4216) (Supplemental Figure 1). A Molish test

showed that the compound was a glycoside. The NMR data (Supplemental Figure 2

and Supplemental Table 1) of 1 assigned by HSQC and HMBC experiments

(Supplemental Figure 3) exhibited obviously aglycon and sugar components, of which

aglycon part displayed quite similar patterns with those of cucurbitacin C (CuC). Acid

hydrolysis of compound 1 gave D-glucose identified by GC-MS analysis

(Supplemental Figure 4). Compared to CuC, a significant downfield shift of C-3 from

δC 76.3 to δC 83.5 in 13C NMR spectrum suggested that the glucosyl was attached to

C-3 position, which was further confirmed by the 1H-13C long-range correlation from

20D

the anomeric proton (δH 4.90) to C-3 of the aglycon in the HMBC experiment

(Supplemental Figure 3B). The sugar unit was deduced to be β-glycosides from the

coupling constant of the anomeric protons (J = 8.0 Hz).

Identification of the Sugar Component of the Target Metabolite

CuC 3-O-β-glucopyranoside (2 mg) was heated in 3 mL of 10% HCl-dioxane (1:1) at

90°C for 4 h in a sealed amp. After the dioxane was removed, the solution was

extracted with EtOAc (2 mL×3) to yield the aglycon and the sugar, respectively. The

sugar components in the aqueous layer was evaporated and dissolved in anhydrous

pyridine (100 μL), and then derivatized using an N,O-bis (trimethylsilyl)

trifluoroacetamide and trimethylchlorosilane mixture (99:1) at 70°C for 30 min and

analyzed on a GC-MS system (Agilent 7000B) equipped with an Agilent HP-5MS

column (5% phenyl methyl silox, 30 m×250 μm internal diameter, 0.25 μm film). The

front inlet, transfer line, and ion source temperatures were set at 280°C, 250°C and

230°C, respectively. The oven temperature program used was as follows: 70°C for 2

min, then 20°C/min to 260°C, final 10°C/min to 300°C for 10 min. The flow rate of

the carriage gas (He) was 1 mL/min. Split injection (split ratio 5:1). The mass spectral

data between m/z 50-800 were recorded. D-glucose was confirmed by comparing the

retention time and MS/MS fragmental characteristics with those of D-glucose

standard (Supplemental Figure 4).

Cytotoxicity Assay

Two cell lines (HepG2 and A549) were purchased from Peking Union Medical

College, Cell Bank (Beijing, China). These cells were maintained in DMEM medium

(Hyclone, Waltham, MA, USA) supplemented with 10% fetal bovine serum

(Hyclone), penicillin (100 U/mL) and streptomycin (100 μg/mL) at 37°C. The cells

were treated with indicated drug or conditioned medium for 24 h. The culture

supernatants were exchanged with medium containing 0.5 mg/mL 3-(4, 5-

dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide (MTT), and the cells were

incubated for 4 h at 37°C. Subsequently, the medium was removed, and 100 μL

DMSO was added. The absorbance at 550 nm was detected using a microplate reader.

Cell viability was expressed as the mean percentage of absorbance in treated vs.

control cells.

HPLC-QQQ-MS Analysis of the Leaves Metabolites of 9930

Samples were frozen in liquid N2 and ground in a mortar and pestle. The resultant

powder (0.2 g) was added to methanol (2 mL) and homogenized for 15 min, followed

by centrifugation at 10,000 g at 4°C for 3 min. The solution was filtered through a

0.22 μm membrane prior to injection on an Agilent 1260 HPLC system coupled with

electrospray ionization, a triple quadrupole (QQQ) mass spectrometry, and using a

ZORBAX Eclipse Plus C18 column (3.5 μm, 2.1×100 mm, Agilent). The mobile phase

consisted of 0.1% formic acid aqueous solution (v/v, solvent A) and acetonitrile/0.1%

formic acid (v/v, solvent B). The flow was 0.5 mL/min, and the injection volume was

1 μL. A linear gradient with the following proportion of phase B (tmin, B%) was used:

(0, 20), (8, 75), (8.5, 100). The mass acquisition was performed in positive ionization

and full scan (50-1,000 Da) modes. Spray parameters were as follows: gas temp.

300°C, gas flow 10 L/min, nebulizer 30 psi, capillary 4,000 V. Fragment voltage 135

V, collision energy 10 V, cell accelerator voltage 7 V. The precursor ion of CuC and

CuC glycoside were 578 Da and 740 Da, respectively. The production ion of CuC and

CuC glycoside were both 501 Da.

UPLC-qTOF-MS Analysis of the Enzyme Reaction Product

Chromatography was performed on an Agilent 1290 UPLC system using a ZORBAX

rapid resolution RP-C18 column (1.8 μm, 2.1×150 mm, Agilent). The mobile phase

consisted of 0.1% formic acid aqueous solution (v/v, solvent A) and acetonitrile (v/v,

solvent B). The flow was 0.3 mL/min, and the injection volume was 1 μL. A linear

gradient with the following proportion of phase B (tmin, B%) was used: (0, 10), (9, 70),

(9.5, 100). The UPLC was coupled with a electrospray ionization, a hybrid

quadrupole time-of-flight (q-TOF) mass spectrometer (model 6540, Agilent). The

mass acquisition was performed in positive ionization and full scan (50-1000 Da)

modes. Spray parameters were as follows: gas temp. 320°C, gas flow 10 L/min,

nebulizer 35 psi, Vcap 3,500, fragment voltage 135 V, skimmer voltage 65 V.

Plant Materials

Seeds of cultivated cucumber seedling 9930 (‘Chinese long’ inbred line 9930, which

is commonly used in modern cucumber breeding) were seeded in pots with a

photoperiod of 16/8 h (light/dark) at 25 ± 1°C in a growth chamber. The seedling at

the two-leaf stage was transplanted and grown in the ground in a greenhouse for 60

days. Leaves grown at specific nodes (node 5, 7, 10, 14, 19, and 25, from bottom to

top of the plant) were collected for both RNA-Seq and metabolic analysis. The

developmental statuses of the leaves used in the assays are shown in Supplemental

Figure 6A.

Phylogenetic Tree Analysis

The alignment of 33 UGTs were carried out by MUSCLE and used to construct a non-

rooted phylogenetic tree using MEGA6 software (Tamura et al., 2013). The

evolutionary history was inferred by using the Maximum Likelihood method based on

the Le_Gascuel_2008 model. The ML tree was subjected to a bootstrap test (100

replicates), only value over 70 are shown. The tree was drawn to scale, with branch

lengths measured in the number of substitutions per site. All positions with less than

95% site coverage were eliminated.

qRT-PCR and UGT Candidates Cloning

Total RNA was extracted from the leaves of different developmental stages using the

RNA prep pure Plant Kit (TIANGEN, Beijing, China). First-strand cDNA was

synthesized from 1.5 µg total RNA isolated using FastQuant RT Super Mix

(TIANGEN). Primer specificity (listed in Supplemental Table 6) was checked by

sequencing and blast analysis. PCRs were performed on an ABI 7900 using SYBR

Premix (Roche) according to the manufacturer’s instruction. Three technical

replicates and three independent biological experiments were performed in all cases.

Relative gene expression was performed using the comparative 2-∆Ct [(-∆Ct=Ct (target

gene)-Ct (reference gene)] method (Thomas, D. et al, 2008). The coding region of

each UGT candidate was PCR amplified using KOD FX (TOYOBO, Japan) and

cloned into the BamHI and SacI restriction sites of the pET32a (N-terminal His-tag)

expression vector using the primer listed in Supplemental Table 5.

Protein Purification and in vitro Enzyme Assay

Escherichia coli BL21 (DE3) was used as a host for the pET32a vector harboring the

putative UGT gene. The strain was grown overnight at 37°C in 2 mL of LB medium

supplemented with 50 μg/mL ampicillin. 200 μL of the preculture was then inoculated

into 200 mL LB medium. When cells reached an OD600 of 0.4-0.6, IPTG was added to

a final concentration of 0.1 mM. The cells were incubated for 16 h-20 h at 16°C and

harvested by centrifugation at 5,000 g for 6 min at 4°C. The pellet was suspended in

the lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 10 mM imidazole, pH 7.2). After

sonication process, the homogenate was centrifuged at 10,000 g for 30 min at 4°C.

Recombinant His-tagged UGT was purified by Ni-affinity chromatography. Fractions

containing UGT protein were eluted from the Ni-resin by Imidazole. Protein

measurements were performed by SDS/PAGE with BSA as quantification standard.

Enzyme activity assay was performed by incubating 50 μg of the purified

recombinant protein in 200 μL of 50 mM sodium phosphate (pH 7.2) buffer

containing 5 mM MgCl2, 1 mM UDP-glucose and 200 μM CuC. After incubating for

1h at 25°C, reactions were stopped by addition of 600 μL methanol and 0.1% formic

acid, and followed by brief vortexing and sonication for 5min. Subsequently, the

extracts were centrifuged at 10,000 g for 5 min, and filtered with a 0.22 μm filter prior

to analysis by LC-qTOF-MS.

Cotyledon Transient Gene Expression Assay

The coding region of Csa3G744990 or Csa7G051410 was fused to the binary vector

(pCAMBIA1300) downstream of the 35S promoter. The construct was transformed

into Agrobacterium tumefaciens strain EHA105. After cultivation, cells were

harvested by centrifugation at 3,000g for 10 min and suspended in 10 mM MES

buffer containing 10 mM MgCl2 and 200 μM acetosyringone (Sigma) to a final OD600

of 0.5. After incubation at room temperature for 2-4 hours, the Agrobacterium

suspension was infiltrated into cotyledons of ten-day-old 9930 seedling using a

needleless syringe. 3-5 days was optimal for the target gene expression after the

infiltration. These experiments were repeated, independently, at least six times with

the similar results.

Supplemental Figure 1. HRESIMS result of CuC 3-O-β-D-glucopyranoside. (A)

Total ion chromatography (TIC) of CuC 3-O-β-D-glucopyranoside. ESI+, electrospray

ion mass spectrum in positive ion mode. (B) MS/MS spectrum of CuC 3-O-β-D-

glucopyranoside.

Supplemental Figure 2. 1H NMR (A) and 13C NMR (B) spectrums of CuC 3-O-β-D-

glucopyranoside.

Supplemental Figure 3. HSQC (A) and HMBC (B) spectrums of CuC 3-O-β-D-

glucopyranoside.

Supplemental Figure 4. GC-MS analysis of the sugar unit hydrolyzed from CuC

glycoside. (A) TIC of the glucose standard derived by tetramethyl silane (TMS). (B)

TIC of the sugar unit hydrolyzed from CuC glycoside and then derived by TMS.

Supplemental Figure 5. UGT candidates share similar expression profiles with the

CuC biosynthetic gene Bi. The FPKM values were presented in the form of log 2. The

numeric FPKM values are shown in Supplemental Table 2.

Supplemental Figure 6. Gene expression of UGT candidates in the leaves sampled at

different developmental stages. (A) The developmental status of the leaves sampled at

different nodes of the plant. N, node; N-5 to N-25, the node number counts from

bottom to top of the plant. (B) The relative gene expressions of the UGT candidates in

the bitter leaves sampled at different growth stages. N, node. Data were average

values ± SD (n=3 biological replicates).

Supplemental Figure 7. Non-rooted phylogenetic tree analysis of UGT candidates

from cucumber and previously characterized UGTs from other plants. The tree was

constructed using maximum likelihood method as described in the Methods. Only

bootstrap values above 70 were shown. The accession numbers of the sequences used

for this analysis were listed in Supplemental Table 4.

Supplemental Figure 8. MS/MS spectrums of the specific product catalyzed by

Csa3G744990 and the CuC 3-O-β-D-glucopyranoside standard.

Supplemental Figure 9. UPLC-qTOF-MS analyses of the enzymatic preference of

UGT73AM3. (A) The structures of ursolic acid, oleanolic acid, CuB, CuE and CuC.

(B) UPLC-qTOF-MS analysis of the product catalyzed by UGT73AM3. UDP-glucose

was used as donor-substrate; ursolic acid, oleanolic acid, CuB, CuE or CuC as an

acceptor-substrate, respectively. ESI+, electrospray ionization in positive mode. EIC,

extracted ion chromatogram.

Supplemental Figure 10. UPLC-qTOF-MS analyses of the enzymatic preference of

UGT73AM3. (A) The structures of caffeic acid, p-coumaric acid, quercetion and

naringenin. (B) UPLC-qTOF-MS analysis of the product catalyzed by UGT73AM3.

UDP-glucose was used as donor-substrate; caffeic acid, p-coumaric acid, quercetion,

naringenin or CuC as an acceptor-substrate, respectively. The product of naringenin-7-

O-β-glucoside and CuC 3-O-β-glucoside were indicated by black arrow, respectively.

ESI+, electrospray ionization in positive mode. EIC, extracted ion chromatogram.

Supplemental Table 1 1H NMR (500 MHz) and 13C NMR (125 MHz) data of CuC 3-

O-β-D-glucopyranoside (in Pyridine-d5). J in Hz and δ in ppm.

No. δH δC No. δH δC

1 2.04, m; 0.98, m 24.8 21 1.71, s 25.7

2 2.22, m; 1.70, m 28.1 22 204.8

3 3.60, m 83.4 23 7.36, d (15.6) 122.9

4 42.4 24 7.40, d (15.5) 150.6

5 142.9 25 80.3

6 5.75, d (5.5) 120.1 26 1.53, s 26.6

7 2.59, m; 2.08, m 24.4 27 1.56, s 26.8

8 3.26, m 34.1 28 1.21, s 25.8

9 54.5 29 1.46, s 22.2

10 2.59, m 36.1 30 1.63, s 19.9

11212.6 C

H3CO1.90, s

22.1

12 2.11, m; 1.80, m 47.1 RCO 170.2

13 48.7 Glu

14 51.4 1′ 4.90, d (8.0) 103.0

15 3.24, d (14.5); 2.89, d (14.5) 49.6 2′ 4.03, m 75.6

16 5.11, m 71.3 3′ 4.00, m 78.7

17 3.04, d (7.0) 60.4 4′ 4.27, m 72.4

18 1.56, s 20.1 5′ 4.28, m 79.0

19 4.81, dd (9.0, 2.5)

3.50, dd (9.0, 2.5)

60.8 6′ 4.58, m

4.42, m

63.5

20 80.2

Supplemental Table 2. FPKM values of the UGT candidates co-expressed the CuC

biosynthetic gene Bi in different cucumber tissues.

Gene ID Root Stem LeafMale

flower

Female

flowerFruit Tendril

Bi 0 39.229 91.812 0 0.169 0 0

Csa4G279820 0.173 40.752 69.085 0.861 0.744 1.885 1.741

Csa6G366250 1.809 49.593 38.789 0.144 1.127 0.757 0.102

Csa6G366270 0.059 14.512 23.397 0.657 0.735 0.113 0

Supplemental Table 3. FPKM values of UGT candidates in the bitter leaves of 9930

sampled at different growth stages.

Gene ID Node-25 Node-19 Node-15 Node-10 Node-7 Node-5

Csa3G744990 5.425 11.618 26.640 43.978 89.937 45.156

Csa4G618520 1.678 23.521 73.648 177.730 262.973 237.481

Csa3G745010 16.908 24.379 19.386 29.918 34.682 43.514

Csa7G051410 1.968 8.699 10.018 20.693 15.244 36.621

Csa6G109750 17.238 23.662 24.518 34.312 37.687 75.410

Supplemental Table 4. Accession numbers, substrate acceptors and references of the

UGTs used for phylogenetic analysis.

Gene name Species GenBank No. Sugar acceptor References

UGT73C3 Arabidopsis

thaliana

KJ138867 Flavonoids, sesquiterpene

(Vomitoxin)

(Lim et al.,

2004; Schweiger

et al., 2013)

UGT73C1 Arabidopsis

thaliana

AAD20151 Zeatin (Hou et al.,

2004)

UGT73C10 Barbarea vulgaris JQ291613 Flavonoids,

Triterpenes: (Oleanolic

acid, hederagenin)

(Augustin et al.,

2012)

UGT73C11 Barbarea vulgaris AFN26667 β-Amyrin, hederagenin (Augustin et al.,

2012)

UGT73C12 Barbarea vulgaris AFN26668 β-Amyrin, hederagenin (Augustin et al.,

2012)

UGT73C13 Barbarea vulgaris AFN26669 β-Amyrin, hederagenin (Augustin et al.,

2012)

UGT72E3 Arabidopsis

thaliana

AAC26233 monolignol (Lanot et al.,

2006)

UGT74F1 Arabidopsis

thaliana

AAB64022 Benzoate: (Salicylic acid),

Flavonoids

(Nagashima et

al., 2004)

UGT73F2 Glycine max BAM29362 Saponin A0-αg (Sayama et al.,

2012)

UGT73F3 Medicago

truncatula

FJ477891 Flavonoids,

Triterpenes: (Hederagenin)

(Naoumkina et

al., 2010)

UGT73F4 Glycine max BAM29363 Saponin A0-αg (Sayama et al.,

2012)

UGT73G1 Allium cepa AAP88406 (Iso)Flavonoids (Kramer et al.,

2003)

UGT73K1 Medicago

truncatula

AY747626 (Iso) Flavonoids,

Triterpenes: (Hederagenin)

(Achnine et al.,

2005)

UGT73P2 Glycine max BAI99584 Soyasapogenol B

3-O-glucuronide

(Shibuya et al.,

2010)

UGT72B1 Arabidopsis

thaliana

CAB80916 3,4-dichloroaniline

2, 4,5-trichlorophenol

(Brazier‐Hicks

and Edwards,

2005)

UGT71G1 Medicago

truncatula

AY747627 (Iso) Flavonoids,

Triterpenes: (Medicagenic

(Achnine et al.,

2005)

acid)

UGT71A27 Panax ginseng KF377585 Triterpenes:

(Protopanaxadiol)

(Jung et al.,

2014)

UGT91H4 Glycine max BAI99585 Soyasaponin III (Shibuya et al.,

2010)

UGT74M1 Saponaria

vaccaria

DQ915168 Triterpenes:

(16α-hydroxygypsogenic

acid, Gypsogenic acid,

Gypsogenin)

(Meesapyodsuk

et al., 2007)

UGT74AE2 Panax ginseng JX898529 Triterpenes:

(Protopanaxadiol,

Compound K)

(Jung et al.,

2014)

UGT74R1 Rhodiola

sachalinensis

ABP49574 Tyrosol (Yu et al., 2011)

UGT74B1 Arabidopsis

thaliana

NP_173820 Glucosinolate (Douglas Grubb

et al., 2004)

UGT74G1 Stevia rebaudiana AAR06920 Diterpene (Steviol,

Steviolmonoside,

Steviolbioside)

(Richman et al.,

2005)

UGT74AC1 Siraitia

grosvenorii

HQ259620 Flavonoids,

Triterpenes: (Mogrol)

(Dai et al., 2015)

UGT74F1 Arabidopsis

thaliana

AAB64022 Benzoate: (Salicylic acid),

Flavonoids

(Cartwright et

al., 2008; Lim et

al., 2002)

Supplemental Table 5. Primers used for the in vitro enzyme assays.

Name Sequence

pET32a-Csa3G744990-F GGCTGATATCGGATCCATGGATTCTCACACCCATG

pET32a-Csa3G744990-R CAAGCTTGTCGACGGAGCTCTCAGCAGCTTCCATTTCCA

pET32a-Csa4G279820-F GGCTGATATCGGATCCATGGCCATGGATACCCACCAAG

pET32a-Csa4G279820-R CAAGCTTGTCGACGGAGCTCTTATGAAATGTTAAAGAAGCGA

G

pET32a-Csa4G618520-F GGCTGATATCGGATCCATGAACAAGTTTGAGTTAGTTTTCATAC

C

pET32a-Csa4G618520-R CAAGCTTGTCGACGGAGCTCTTAGTAGTTGCCCTCTTGTAAGT

TAGTCA

pET32a-Csa6G366250-F GGCTGATATCGGATCCATGGAAGAAGAAGAAATAATGGAGATA

G

pET32a-Csa6G366250-R CAAGCTTGTCGACGGAGCTCTCAAGATTGTTTAATCATAGACA

CAAACTC

pET32a-Csa6G366270-F GGCTGATATCGGATCCATGCAACTCCACCGCAAGACA

pET32a-Csa6G366270-R CAAGCTTGTCGACGGAGCTCTTAAATAATTGAGTCAACAAATT

G

pET32a-Csa7G051410-F GGCTGATATCGGATCCATGGAGAGAGGAAAGAAACC

pET32a-Csa7G051410-R CAAGCTTGTCGACGGAGCTCTTAATCAACTAAAATTTTCTCCC

pET32a-Csa6G109750-F GGCTGATATCGGATCCATGAATAACACAACACCCAATCC

pET32a-Csa6G109750-R CAAGCTTGTCGACGGAGCTCCTAAGAACATACGTGATCCACA

AAA

pET32a-Csa3G745010-F GGCTGATATCGGATCCATGGCGTCTTCCAAATCCAA

pET32a-Csa3G745010-R CAAGCTTGTCGACGGAGCTCTTAATTTTGAGACTGCTGAGAAT

CTG

Supplemental Table 6. Primers used for qRT-PCR.

Name Sequence

CsActin2-qPCR-F ATTCTTGCATCTCTAAGTACCTTCC

CsActin2-qPCR-R CCAACTAAAGGGAAATAACTCACC

Csa4G618520-qPCR-F GCTCGAGCACTGGAGCGAAGT

Csa4G618520-qPCR-R GTGGTGCCCACCCGATGACC

Csa6G109750-qPCR-F CCAACTCGCCAAGCGCCTCA

Csa6G109750-qPCR-R CCACGACGCTCAAGCTCGGA

Csa3G744990-qPCR-F GCTCGCCGTGGAGCCATTGT

Csa3G744990-qPCR-R AGCCTTCTGGGAGGCCGGTT

Csa3G745010-qPCR-F TGGCCACTTTGCGAGCTACCG

Csa3G745010-qPCR-R AGCGCGGTCAGCTTTAGCCA

Csa7G051410-qPCR-F CACGCAGCCTTGCTCGGTCA

Csa7G051410-qPCR-R ACGGCATCTCCTCCACCCGA

Supplemental Table 7. Primers used for cotyledon infiltration assays.

Name Sequence

Csa7G051410-1300-F CACGGGGGACTCTAGAATGGAGAGAGGAAAGAAACC

Csa7G051410-1300-R GATCGGGGAAATTCGAGCTCTTAATCAACTAAAATTTTCTCCC

Csa3G744990-1300-F CACGGGGGACTCTAGAATGGATTCTCACACCCATGG

Csa3G744990-1300-R GATCGGGGAAATTCGAGCTCTCAGCAGCTTCCATTTCCATT

REFERENCESAchnine, L., Huhman, D.V., Farag, M.A., Sumner, L.W., Blount, J.W., and Dixon, R.A. (2005).

Genomics‐based selection and functional characterization of triterpene glycosyltransferases

from the model legume Medicago truncatula. Plant Journal 41:875-887.

Augustin, J.M., Drok, S., Shinoda, T., Sanmiya, K., Nielsen, J.K., Khakimov, B., Olsen, C.E.,

Hansen, E.H., Kuzina, V., and Ekstrøm, C.T. (2012). UDP-glycosyltransferases from the

UGT73C subfamily in Barbarea vulgaris catalyze sapogenin 3-O-glucosylation in saponin-

mediated insect resistance. Plant physiology 160:1881-1895.

Brazier‐Hicks, M., and Edwards, R. (2005). Functional importance of the family 1

glucosyltransferase UGT72B1 in the metabolism of xenobiotics in Arabidopsis thaliana. Plant

Journal 42:556-566.

Cartwright, A.M., Lim, E.-K., Kleanthous, C., and Bowles, D.J. (2008). A kinetic analysis of

regiospecific glucosylation by two glycosyltransferases of Arabidopsis thaliana: domain

swapping to introduce new activities. Journal of Biological Chemistry 283:15724-15731.

Dai, L., Liu, C., Zhu, Y., Zhang, J., Men, Y., and Sun, Y. (2015). Functional characterization of

cucurbitadienol synthase and triterpene glycosyltransferase involved in biosynthesis of

mogrosides from Siraitia grosvenorii. Plant and Cell Physiology:pcv043.

Douglas Grubb, C., Zipp, B.J., Ludwig‐Müller, J., Masuno, M.N., Molinski, T.F., and Abel, S.

(2004). Arabidopsis glucosyltransferase UGT74B1 functions in glucosinolate biosynthesis and

auxin homeostasis. Plant Journal 40:893-908.

Hou, B., Lim, E.-K., Higgins, G.S., and Bowles, D.J. (2004). N-glucosylation of cytokinins by

glycosyltransferases of Arabidopsis thaliana. Journal of Biological Chemistry 279:47822-

47832.

Jung, S.-C., Kim, W., Park, S.C., Jeong, J., Park, M.K., Lim, S., Lee, Y., Im, W.-T., Lee, J.H., and

Choi, G. (2014). Two ginseng UDP-glycosyltransferases synthesize ginsenoside Rg3 and Rd.

Plant and Cell Physiology:pcu147.

Kramer, C.M., Prata, R.T.N., Willits, M.G., De Luca, V., Steffens, J.C., and Graser, G. (2003).

Cloning and regiospecificity studies of two flavonoid glucosyltransferases from Allium cepa.

Phytochemistry 64:1069-1076.

Lanot, A., Hodge, D., Jackson, R.G., George, G.L., Elias, L., Lim, E.K., Vaistij, F.E., and Bowles,

D.J. (2006). The glucosyltransferase UGT72E2 is responsible for monolignol 4‐O‐glucoside

production in Arabidopsis thaliana. Plant Journal 48:286-295.

Lim, E.-K., Doucet, C.J., Li, Y., Elias, L., Worrall, D., Spencer, S.P., Ross, J., and Bowles, D.J.

(2002). The activity of Arabidopsis glycosyltransferases toward salicylic acid, 4-

hydroxybenzoic acid, and other benzoates. Journal of Biological Chemistry 277:586-592.

Lim, E.K., Ashford, D.A., Hou, B., Jackson, R.G., and Bowles, D.J. (2004). Arabidopsis

glycosyltransferases as biocatalysts in fermentation for regioselective synthesis of diverse

quercetin glucosides. Biotechnology and bioengineering 87:623-631.

Meesapyodsuk, D., Balsevich, J., Reed, D.W., and Covello, P.S. (2007). Saponin biosynthesis in

Saponaria vaccaria. cDNAs encoding β-amyrin synthase and a triterpene carboxylic acid

glucosyltransferase. Plant physiology 143:959-969.

Nagashima, S., Inagaki, R., Kubo, A., Hirotani, M., and Yoshikawa, T. (2004). cDNA cloning and

expression of isoflavonoid-specific glucosyltransferase from Glycyrrhiza echinata cell-

suspension cultures. Planta 218:456-459.

Naoumkina, M.A., Modolo, L.V., Huhman, D.V., Urbanczyk-Wochniak, E., Tang, Y., Sumner,

L.W., and Dixon, R.A. (2010). Genomic and coexpression analyses predict multiple genes

involved in triterpene saponin biosynthesis in Medicago truncatula. Plant Cell 22:850-866.

Richman, A., Swanson, A., Humphrey, T., Chapman, R., McGarvey, B., Pocs, R., and Brandle, J.

(2005). Functional genomics uncovers three glucosyltransferases involved in the synthesis of

the major sweet glucosides of Stevia rebaudiana. Plant Journal 41:56-67.

Sayama, T., Ono, E., Takagi, K., Takada, Y., Horikawa, M., Nakamoto, Y., Hirose, A., Sasama, H.,

Ohashi, M., and Hasegawa, H. (2012). The Sg-1 glycosyltransferase locus regulates

structural diversity of triterpenoid saponins of soybean. Plant Cell 24:2123-2138.

Schweiger, W., Pasquet, J.-C., Nussbaumer, T., Paris, M.P.K., Wiesenberger, G., Macadré, C.,

Ametz, C., Berthiller, F., Lemmens, M., and Saindrenan, P. (2013). Functional

characterization of two clusters of Brachypodium distachyon UDP-glycosyltransferases

encoding putative deoxynivalenol detoxification genes. Molecular Plant-Microbe Interactions

26:781-792.

Shibuya, M., Nishimura, K., Yasuyama, N., and Ebizuka, Y. (2010). Identification and

characterization of glycosyltransferases involved in the biosynthesis of soyasaponin I in

Glycine max. FEBS letters 584:2258-2264.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013). MEGA6: molecular

evolutionary genetics analysis version 6.0. Molecular biology and evolution:mst197.

Thomas, D., Kenneth J. (2008). Analyzing real-time PCR data by the comparative CT method. Nature

Protocols 3:1001-1008

Yu, H.-S., Ma, L.-Q., Zhang, J.-X., Shi, G.-L., Hu, Y.-H., and Wang, Y.-N. (2011). Characterization

of glycosyltransferases responsible for salidroside biosynthesis in Rhodiola sachalinensis.

Phytochemistry 72:862-870.