wave2 regulates high-affinity integrin-binding by recruiting
TRANSCRIPT
WAVE2 Regulates High-Affinity Integrin-Binding by Recruiting Vinculin and Talin
to the Immunological Synapse
Jeffrey C. Nolz1, Ricardo B. Medeiros3, Jason S. Mitchell3, Peimin Zhu4, Bruce D.
Freedman4, Yoji Shimizu3 and Daniel D. Billadeau1,2,5
From the Department of Immunology1 and the Division of Oncology Research2, Mayo
Clinic College of Medicine, Rochester, MN 55905,
the Department of Laboratory Medicine and Pathology3, Center for Immunology, Cancer
Center, University of Minnesota Medical School, Minneapolis, MN 55455 and
the Department of Pathobiology4, School of Veterinary Medicine, University of
Pennsylvania, Philadelphia, PA 19104,
Corresponding author5: Daniel D. Billadeau Department of Immunology and
Division of Oncology Research 200 First Street SW Rochester, MN 55905 Tel: (507)-266-4334 Fax: (507)-266-5146
Email:[email protected]
Running Head: WAVE2 Regulates TCR-Mediated Integrin Activation
ACCEPTED
Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Mol. Cell. Biol. doi:10.1128/MCB.00136-07 MCB Accepts, published online ahead of print on 25 June 2007
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
2
ABSTRACT
T cell receptor (TCR)-mediated integrin activation is required for T cell – antigen
presenting cell (APC) conjugation and adhesion to extracellular matrix components.
While it has been demonstrated that the actin cytoskeleton and its regulators play an
essential role in this process, no mechanism has been established which directly links
TCR-induced actin polymerization to the activation of integrins. Here, we demonstrate
that TCR-stimulation results in WAVE2-ARP2/3-dependent F-actin nucleation and the
formation of a complex containing WAVE2, ARP2/3, vinculin and talin. The verprolin-
connecting-acidic (VCA) domain of WAVE2 mediates the formation of the ARP2/3-
vinculin-talin signaling complex and talin recruitment to the immunological synapse (IS).
Interestingly, although vinculin is not required for F-actin or integrin accumulation at the
IS, it is required for the recruitment of talin. In addition, suppression of either WAVE2 or
vinculin inhibits activation-dependent induction of high-affinity integrin binding to VCAM-
1. Overall, these findings demonstrate a mechanism in which signals from the TCR
produce WAVE2-ARP2/3-mediated de novo actin polymerization, leading to integrin
clustering and high-affinity binding through the recruitment of vinculin and talin.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
3
INTRODUCTION
Reorganization of the actin cytoskeleton is an essential process required for
many aspects of T cell biology (45). Besides providing the mechanical force for various
basic biological functions including cell migration and polarization, the actin cytoskeleton
serves a specialized role in T cells during the formation of the Immunological Synapse
(IS) between the T cell and an antigen-presenting cell (APC) decorated with appropriate
peptide-MHC complexes. Signaling cascades originating from the engaged T cell
receptor (TCR) initiate IS formation causing dynamic cytoskeletal reorganization,
changes in gene transcription, and activation of cell surface integrins (25).
Integrins are heterodimeric cell surface receptors that are responsible for cell
adhesion, including T cell – APC conjugation and attachment to extracellular matrix
components such as fibronectin. TCR-mediated activation of integrins occurs as a
result of physical conformational changes within the receptor (affinity) as well as
clustering of individual subunits on the cell surface (avidity) in response to signals
generated from TCR ligation, a process known as “inside-out” signaling (25). Among
the various integrin heterodimers expressed by T cells, LFA-1 (αLβ2) plays a critical role
during T cell – APC conjugation and eventually localizes to the pSMAC of the IS where
it binds to its ligand ICAM found on the surface of the APC (9). The α4β1 integrin (VLA-
4) also localizes to the pSMAC (33). In addition, VLA-4 binds to extracellular matrix
proteins, such as fibronectin, and cell surface ligands, such as VCAM-1, in response to
TCR stimulation (34). An array of signaling proteins are required for TCR-mediated
integrin activation, including the Guanine Nucleotide Exchange Factor (GEF) VAV1
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
4
(26), the small GTPase RAP1 (8, 40), adhesion and degranulation-promoting adaptor
protein (ADAP, a.k.a. SLAP-130/Fyb) (18, 38), and the non-conventional PKC isoform,
PKD (a.k.a. PKCµ) (30). However, the exact molecular mechanism by which these
proteins regulate TCR-mediated integrin activation remains largely unknown.
Actin cytoskeletal reorganization is also required for TCR-mediated integrin
activation (39). Interestingly, T cells from WASP-/- mice are unimpaired in their ability to
form T cell – APC conjugates, adhere to fibronectin, or cluster integrins in response to
TCR stimulation, whereas T cells lacking VAV1 are defective in all three processes (26).
Recently, we have demonstrated that the actin regulatory protein WAVE2 is an
essential component of “inside-out” signaling required for TCR-mediated integrin
activation (36). Additionally, WAVE2 participates in TCR-stimulated actin cytoskeletal
dynamics needed for lamellipodial formation and accumulation of F-actin at the IS.
Structurally, WAVE2 contains an N-terminal WAVE-homology domain (WHD), which
links WAVE2 to a complex of associated protein components that includes ABI-1/2,
NAP/HEM-1, and SRA-1/PIR121 (13). A basic region (BR) and a proline-rich region
(PR) in WAVE2 play roles in both the localization as well as the activation of WAVE2
(32, 37). Finally, similar to WASP, WAVE2 has a C-terminal verprolin (also known as
WH2)-connecting-acidic (VCA) domain, which binds the ARP2/3 complex and G-actin
and promotes de novo actin polymerization. However, the exact mechanism or
structural feature of WAVE2 that is required to link TCR-initiated signaling to integrin
activation is not known.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
5
In this report, we use biochemical, cellular and genetic approaches to define the
molecular mechanism by which WAVE2 regulates integrin activation downstream of the
TCR. We show that the interaction of the WAVE2 VCA domain with the ARP2/3
complex links WAVE2 to the integrin scaffolding proteins vinculin and talin. The
formation of a WAVE2-ARP2/3-vinculin complex leads to talin recruitment to the IS and
high-affinity integrin binding. Overall, these findings establish a molecular mechanism
by which WAVE2 and de novo actin polymerization control integrin activation in
response to TCR stimulation.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
6
MATERIALS AND METHODS
Reagents and antibodies. Unless otherwise stated, all chemicals were obtained from
Sigma-Aldrich. The antisera against WAVE2 (36) and VAV1 (15) have been previously
described. Antibodies for RAC1 (clone 23A8), p34-Arc/ARPC2, vinculin (clone V284)
and phosphotyrosine (clone 4G10) were purchased from Upstate Biotechnology. The
antibody against β1 integrin (clone P5D2) was purchased from Chemicon, the antibody
for talin (clone 8d4) and FLAG epitope were purchased from Sigma, the antibody for
CDC42 was purchased from BD Biosciences, and the antibody for ARP2 was
purchased from Santa Cruz Biotechnology. The antibody against β2 integrin is clone
MHM23. The OKT3 mAb antibody was obtained from the Mayo Pharmacy and the anti-
CD28 mAb was purchased from BD Biosciences.
Plasmids and cloning. The pCMS4 “suppression/re-expression” vectors used for
shRNA silencing and re-expression of resistant cDNAs has been described previously
(15). The following 19-nucleotide sequence was generated to target human WAVE2
(GAGAAGAGAAAGCACAGGAA). The DNA sequence encoding full length WAVE2
was amplified from Jurkat cDNA using the following set of oligonucleotides: (5’-
GCACACGCCGACGCGTATGCCGTTAGTAACGAGGAACATCGAGCCA-3’ and 5’-
GACGATGCGAGCGGCCGCTTAATCGGACCAGTCGTCCTCATCAAATTC-3”).
Underlined sequence indicates unique restriction sites used for subcloning. An shRNA
resistant form of WAVE2 was created using the Quick Change Site-Directed
Mutagenesis kit from Strategene, where the targeting sequence within the DNA was
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
7
changed to GAaAAaAGgAAaCACAGGAA (lowercase letters indicates a changed
nucleotide that does not affect amino acid sequence). The ∆BR mutant of WAVE2 was
created by deleting amino acids 172-209 (37) and the ∆PR mutant by deleting amino
acids 247-419 using Site-Directed Mutagenesis. The ∆VCA version of WAVE2 was
created by deleting the C-terminal end of the protein beginning with amino acid 436.
The following 19- and 21-nucleotide sequences were generated to target human
vinculin (A: GGTAGCCATCCCATGAACA, B: GCCTTCCTCCACATCCTTTCT).
Human vinculin cDNA was a gift from Dr. Tina Izard (St. Jude’s Children's Hospital,
Memphis, TN) and was subcloned into the pCMS4 vector. Since the both of the
shRNA’s used to target human vinculin lied in the 3’ UTR of the primary transcript,
generation of resistant cDNA for vinculin was not necessary. The P878A mutant of
human vinculin was generated using site-specific mutagenesis. The following sequence
was generated to target human ARP2 (GTGGGTAAATCTGAGTTTA).
Cell culture and transfection. Jurkat T cells, NALM6 B cells and Raji B cells were
grown in RPMI-1640 supplemented with 5% fetal bovine serum, 5% fetal calf serum,
and 4mM L-glutamine. Human CD4+ T cells were purified from buffy coats obtained
from the Mayo Clinic Blood Bank using RosetteSep purification (StemCell
Technologies). Following purification, human CD4+ cells were cultured in serum
containing media along with 5 µg/ml PHA and IL-2 for 24 hours. Cell were then washed
and cultured in serum containing media with IL-2 for 72 hours. Transient transfections
in Jurkat were performed using 1 x 107 cells per sample along with 30-40 µg of plasmid
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
8
DNA as previously described (5). Transfected Jurkat cells were used 48-72 hours
following transient transfection.
Cell stimulation and immunoblot analysis. For the stimulation timecourse studies,
10 x 106 Jurkat T cells or 25 x 106 human CD4+ T cells were stained on ice with 5 µg/ml
anti-CD3 (OKT3, mAb) and 5 µg/ml anti-CD28 and then crosslinked using goat anti-
mouse over the indicated time course at 37°C. After each time point the cells were
immediately washed in ice cold PBS and lysed in NP-40 lysis buffer (20 mM HEPES,
pH 7.9, 100 mM NaCl, 5 mM EDTA, 0.5 mM CaCl, 1% NP-40, 1 mM PMSF, 10 µg/ml
leupeptin, 5 µg/ml aprotinin, 1 mM Na3VO4, and 5 µM MG-132) for 10 min on ice.
Lysates were clarified by centrifugation at 18k x g for 5 min at 40C and then transferred
to antibody-coated beads. The protein complexes were then washed twice with NP-40
lysis buffer, eluted in 60 µl of SDS-sample buffer, resolved by SDS-PAGE, and
transferred to Immobilon-P membranes (Millipore). For activation of GTPases, cells
were lysed in GTPase activation buffer (50 mM TRIS, pH 7.5, 500 mM NaCl, 5 mM
MgCl2, 0.5% NP-40, 10% glycerol, 1 mM PMSF, 10 µg/ml leupeptin, 5 µg/ml aprotinin, 1
mM Na3VO4), vortexed, and immediately clarified and transferred to glutathione agarose
previously bound to GST-Pak CRIB. Lysates were allowed to rotate for 10 minutes and
washed once before elution and analysis as described above. In cases where whole
cell lysates were prepared, 50-100 µg of protein was resolved by SDS-PAGE. For
immunoblots, mAbs were detected using goat anti-mouse IgG coupled to horseradish
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
9
peroxidase (Santa Cruz), and polyclonal rabbit antisera were detected using goat anti-
rabbit coupled to horseradish peroxidase (Santa Cruz) and SuperSignal Enhanced
Chemiluminescence (Pierce, Rockford, IL).
Immunofluorescence microscopy. B cell/T cell conjugates were formed essentially as
described previously (4). Briefly, NALM6 or Raji cells were stained with CellTracker
Blue CMAC (7-amino-4-chloromethylcoumarin, Molecular Probes) and pulsed with or
without 2 µg/ml SEE or 2 µg/ml of a cocktail of Staphylococal superantigens (SEA, SEB,
SEC3, SEE; Toxin Technologies). B cells were centrifuged together with the same
number of T cells, incubated at 37°C for 15 min, plated onto poly-L-lysine-coated
coverslips, and fixed with 4% paraformaldehyde/PBS for 10 minutes at room
temperature. Fixed cells were quenched with 50 mM NH4Cl and permeabilized in 0.3%
Triton X-100. Blocking and antibody incubations were performed in PBS/0.05%
saponin/0.25% fish skin gelatin. Slides were labeled with primary antibodies followed
by goat anti-rabbit FITC or goat anti-mouse TRITC (Molecular Probes). F-actin was
visualized with fluorescein or rhodamine phalloidin (Molecular Probes). Coverslips were
mounted in Mowiol 4-88 (Hoeschst Celanese) containing 10% 1,4-diazobicyclo [2.2.2]
octane. Quantification of F-actin polarization and protein localization was performed by
an individual blinded to the experimental conditions. To minimize bias, 50 conjugates
were chosen at random, based upon DIC and CMAC images, disregarding cell
morphology or protein distribution, and only conjugates consisting of 1 green (GFP-
transfected) T cell and 1 blue (CMAC stained) B cell were scored. Those conjugates
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
10
showing a distinct, bright band of labeling at the cell-cell contact site were scored as
positive. Typically, this band was much brighter than any other portions of either cell,
however, where necessary, the pixel intensity was determined, and only those
interfaces with pixel intensity greater than the sum of the two cell surfaces away from
the interface were scored as polarized.
Conjugate analysis. Conjugate assays were performed essentially as described
previously (35). Briefly, Raji B cells were stained with PKH26 according to
manufacturers directions. After quenching with media containing serum, cells were
incubated in the presence or absence of 2 µg/ml SEE for 1 hour, washed and
resuspended at 0.5 x 106 cells/ml in RPMI. Jurkat T cells transfected with GFP-
expressing plasmids were also resuspended at 0.5 x 106 cells/ml in RPMI. For
conjugation, equal volumes of B and T cells were pelleted together at a speed of 500
RPM for 5 minutes, then incubated at 37°C for 10 – 15 min. Cells were vortexed for 5 –
10 seconds and then fixed by adding an equal volume of 4% paraformaldehyde. The
relative proportion of red, green, and red/green events in each tube was determined by
two-color flow cytometric analysis using a FACScalibur flow cytometer (BD
Biosciences). The number of gated events counted per sample was at least 15,000.
Adhesion assays. Adhesion assays were performed as previously described (10, 46).
Briefly, Jurkat T cells were transfected with the indicated GFP-suppression vector and
adhesion analysis was performed 48-72 hours later using a 96-well plate pre-coated
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
11
with 0.3 µg/well fibronectin. For TCR stimulation, the cells were pre-incubated with
OKT3 and then added to wells containing secondary anti-IgG as a crosslinker. PMA
stimulation was used at a concentration of 10 ng/ml. Adhesion was quantified by flow
cytometry as previously described (10, 46).
Single cell calcium analysis. Jurkat T cells were loaded with the cell permeant
calcium indicator fura-2 AM (3.0 �M, Molecular Probes, USA) in RPMI medium for 15
minutes at room temperature (25oC). For the final 10 minutes of Fura-2 loading, OKT3
(5 �g/ml) was added to the incubation mixture. Cell suspensions containing Fura-2 and
OKT3 were placed into the recording chamber on an inverted fluorescence microscope
(Nikon, USA) and allowed to adhere to Poly-L-lysine treated coverslips for 5 minutes in
a solution which contained 155 mM NaCl, 4.5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10
mM glucose, and 10 mM Hepes (pH 7.4). Excess fura-2 AM (Molecular Probes) and
OKT3 were removed by perfusing the chamber with additional extracellular solution.
Before stimulation, the chamber was perfused with Ca2+ free bath solution containing
155 mM NaCl, 4.5 mM KCl, 1 mM MgCl2 and 0.5 mM EGTA, 10 mM glucose and 10
mM Hepes (pH = 7.4). Intracellular Ca2+ mobilization was initiated by addition of goat
anti-mouse IgG in Ca2+-free bath solution. Fura-2 fluorescence of individual cells was
measured by digital imaging microscopy as previously described (28) and plotted as the
ratio of fluoresence emission at 510nm following sequential fura-2 excitation at 340 nM
and 380 nM.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
12
Soluble VCAM-1 binding. Procedure is modified as previously described (6, 47).
Briefly, 1x106 Jurkat T cells were washed with modified Tyrode’s buffer (12mM
NaHCO3, 20mM Hepes (pH 7.4), 1mg/ml glucose, 150mM NaCl, 2.5mM KCl, 1mg/ml
BSA, 1mM Ca2+, 1mM Mg2+) and incubated in 50 µl of Tyrode’s with 1.0 µg of
recombinant chimeric human 7-domain VCAM-1 Fc (R&D Systems, Minneapolis, MN).
The cells were either left untreated or stimulated with PMA (50ng/ml) or Mn2+ (1mM) for
10 min at 37oC and then diluted in 3ml of Tyrode’s buffer and immediately fixed with 0.5
ml of 4% paraformaldehyde for 20 min. The cells were then washed with Tyrode’s
buffer and stained with biotinylated goat anti-human Fc and streptavidin-
allophycocyanin (eBioscience, San Diego, CA). Flow cytometry with a FACSCaliber
system (BD Biosciences, San Jose, CA) was used to determine the degree of VCAM-1
binding.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
13
RESULTS
WAVE2 regulates integrin activation downstream of Vav1, Rac1 and Cdc42
We have previously demonstrated that WAVE2 regulates TCR-mediated integrin
activation required for both T cell – APC conjugation (primarily β2 integrin-mediated) and
adhesion to fibronectin (primarily β1 integrin-mediated) (36). Even though WAVE2 and
de novo actin polymerization are required for TCR-induced integrin activation, the exact
mechanism by which WAVE2 controls this process is unknown. We have previously
demonstrated that suppression of WAVE2 does not alter the activation of the TCR-
stimulated proximal tyrosine kinases LCK or ZAP-70, formation of the LAT signalosome,
or the activation of PLCγ1 (36), which are all essential components of signaling
pathways leading to TCR-mediated integrin activation (see Fig 1). VAV1, which is a
GEF for the Rho GTPases RAC1 and CDC42, is heavily tyrosine phosphorylated in
response to TCR stimulation (44). In addition, T cells from VAV1-/- mice are unable to
form conjugates, adhere to fibronectin, or cluster integrins in response to TCR
stimulation (26). Thus, we determined if loss of WAVE2 affects the activation of TCR-
stimulated molecular pathways leading to the activation of VAV1, RAC1, and CDC42.
In order to determine if WAVE2 controlled VAV1 and RHO GTPase activation, gross
tyrosine phosphorylation of VAV1 was analyzed in WAVE2 suppressed T cells. TCR
stimulation of both control and WAVE2-suppressed T cells induced tyrosine
phosphorylation of VAV1 that peaked at 1 minute and was reduced to background
levels by 15 minutes (Fig. 2A). In addition, the activation of the cytoskeletal regulators
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
14
RAC1 and CDC42, two RHO GTPases activated by VAV1, in the absence of WAVE2
was not impaired when compared to control cells (Fig. 2B,C). In fact, it appeared that
the activation of both RHO GTPases in the absence of WAVE2 was augmented.
Together, these data indicate that WAVE2 affects TCR-stimulated integrin activation at
a point distal to the regulation of signaling cascades that regulate the activity of these
small GTP-binding proteins.
The VCA domain of WAVE2 regulates integrin activation
WAVE2 is a multidomain protein that interacts with several other proteins and
can directly modulate actin dynamics through an association of its VCA domain with
ARP2/3. Since depletion of WAVE2 did not seem to impact known TCR-stimulated
signaling pathways leading to integrin activation, we decided to directly examine the role
of WAVE2 in this actin-regulated process. In order to determine which domain(s) of
WAVE2 regulated integrin activation, “suppression/re-expression” plasmids were
generated that would suppress endogenous levels of WAVE2 by driving shRNA behind
the H1 RNA polymerase III-dependent promoter and re-express resistant forms of
FLAG-tagged WAVE2 cDNA from a separate CMV promoter. Transfection of these
plasmids into Jurkat T cells consistently yielded a GFP+ population >80%. As shown in
Figure 3A, endogenous WAVE2 protein levels were suppressed 72 hours following
transient transfection when compared to vector control. In addition, re-expression of
wildtype (WT) WAVE2, along with deletion mutants lacking the basic region (∆BR),
proline-rich region (∆PR), or the verprolin-connecting-acidic region (∆VCA) was
comparable to endogenous levels of WAVE2 in the control transfection (Fig 3A).
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
15
Using the “suppression/re-expression” system, we next determined which
domains of WAVE2 were required for TCR-induced adhesion to fibronectin. As
previously demonstrated, Jurkat T cells lacking WAVE2 are inhibited in their ability to
adhere to fibronectin in response to TCR stimulation (Fig 3B). However, re-expression
of the WT resistant form of WAVE2 in shWAVE2 transfected cells rescued the ability of
the cells to adhere to fibronectin, demonstrating that the shRNA against WAVE2 is
specific and that this result is not an artifact or an off-target effect. Two mutants of
WAVE2 (∆BR and ∆PR) partially rescued the adhesion phenotype. However, re-
expression of the ∆VCA version of WAVE2 did not restore integrin activation, and in
fact, was found to be similar to that seen in cells lacking WAVE2 altogether (Fig 3B). In
addition, re-expression of the ∆VCA version of WAVE2 was not able to rescue the
ability of WAVE2-suppressed T cells to form LFA-1 integrin-dependent conjugates with
superantigen pulsed B cells (Fig 3C). The defect in integrin activation was not a result
of altered β1 or β2 integrin expression, as levels of these integrin subunits were
comparable between control and WAVE2-suppressed T cells (Fig 3D).
The above results suggest that WAVE2 may be the critical mediator linking the
TCR to actin polymerization and integrin activation. Indeed, cells suppressed for
WAVE2 demonstrate defective actin accumulation at the IS, which is rescued by
expression of WT WAVE2, but not the VCA domain deletion mutant (Figure 4A). We
have previously demonstrated that WAVE2 is required for calcium mobilization at a
point distal to IP3-mediated store release (36). Since calcium is an important regulator
of intracellular pathways required for many biological functions (12), including actin
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
16
dynamics and integrin activation, we obtained single-cell calcium measurements to
determine whether the VCA domain of WAVE2 is also required for TCR-mediated
calcium mobilization. As shown in Figure 4B, shWAVE2 transfected cells exhibit a
defect in extracellular calcium entry following TCR engagement when compared to
control vector transfected cells. However, single cell calcium imaging revealed that both
the WT and ∆VCA versions of WAVE2 rescued the deficiency in TCR-mediated calcium
entry seen with cells lacking WAVE2 (Fig 4B). Thus, WAVE2 regulates TCR-mediated
integrin activation independently of its role in regulating calcium entry.
Stimulation with the phorbol ester PMA also induces integrin clustering and
activation in T cells and bypasses the requirement for intact TCR proximal signals (9,
41). In fact, cells that lack ZAP-70 (10), LAT (14), VAV1 (26), ITK (11), PLCγ1 (24), or
ADAP (18, 38) show no impairment of integrin activation in response to PMA stimulation
(see Fig 1). Since WAVE2 does not appear to regulate any of these upstream signaling
pathways required for integrin activation, we hypothesized that WAVE2 regulates
adhesion at a point downstream to these processes. In agreement with this, PMA
stimulation was unable to rescue the ability of WAVE2 suppressed cells or cells re-
expressing a ∆VCA version of WAVE2 to adhere to fibronectin (Fig 4B). Overall, these
data suggest that the VCA domain of WAVE2 is required for F-actin accumulation at the
IS, and although not required for calcium mobilization, does regulate integrins at a point
distal to the TCR signaling pathways outlined in Figure 1.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
17
WAVE2 and ARP2/3 are required for localization of integrins to the IS
LFA-1 (αLβ2 integrin) is required for conjugation between a T cell and an APC
and localizes to the pSMAC area of the IS, where it associates with its ligand ICAM-1
found on the surface of the APC. Since the VCA domain of WAVE2 was required for F-
actin accumulation at the IS, we next determined whether WAVE2 and the ARP2/3
complex were required for localization of LFA-1 to the IS. As shown in Figure 5A,
localization of CD18 (β2 chain of LFA-1) to the IS occurred readily in control transfected
cells interacting with SEE pulsed Raji B cells. However, localization of LFA-1 to the IS
in both WAVE2- and ARP2-suppressed T cells was severely impaired (Fig 5A). In fact,
the number of WAVE2- and ARP2-suppressed T cells that localized LFA-1 to the IS was
similar to control cell conjugates formed in the absence of SEE.
VLA-4 (α4β1 integrin) also plays a critical role in T cell biology and can bind to
both VCAM-1 and the extracellular matrix component fibronectin. In addition, VLA-4
can serve as a co-stimulatory molecule and also localizes to the IS of a T cell – APC
conjugate (33), where it may interact with CD14 on the APC (20). Since LFA-1
localization and adhesion to fibronectin requires both WAVE2 and the ARP2/3 complex,
we next determined whether the localization of this integrin also required these proteins.
Similar to the result obtained for LFA-1, localization of β1 integrins was impaired in both
WAVE2- and ARP2/3-suppressed T cells in response to TCR stimulation (Fig 5B).
Overall, these data indicate that both WAVE2 and the ARP2/3 complex are required for
localization of integrins to the IS during T cell – APC conjugation.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
18
WAVE2 forms a complex with ARP2/3 and vinculin in response to TCR
stimulation
Vinculin is an integrin scaffolding protein known to regulate integrin activation in
other cell types. Vinculin becomes activated downstream of cell surface receptors and
binds both talin and F-actin, providing a physical link between the actin cytoskeleton
and integrins (48). Since the biological function of vinculin has not been extensively
studied in T cells, we examined the localization of this scaffolding protein in T cell - APC
conjugates. Vinculin localizes to the IS in human CD4+ T cells conjugated to
superantigen pulsed NALM6 B cells, where it colocalized with both F-actin (Fig 6A) and
WAVE2 (Fig 6B). Localization to the IS was dependent upon TCR stimulation, since
conjugates formed in the absence of superantigen did not localize vinculin or WAVE2,
nor did they polymerize actin at the T cell – APC interface (Fig 6A,B; -SAg).
In addition to binding F-actin and talin, activated vinculin has recently been
shown to bind the ARP2/3 complex, and this association is enhanced in the presence of
a VCA domain (7). We therefore investigated whether a complex might form between
WAVE2, ARP2/3 and vinculin in response to TCR/CD28 ligation. Indeed, following
receptor engagement, an increased association of vinculin, ARP2/3 and WAVE2 is
observed (Fig 6C). Since vinculin is known to interact with ARP2/3, we next utilized
shRNA against ARP2 to test whether WAVE2 requires ARP2/3 in order to form a
complex with vinculin. Indeed, when compared to control cells, T cells suppressed for
ARP2 were unable to form the WAVE2-vinculin complex (Fig. 6C), indicating that the
ARP2/3 complex is a necessary component linking WAVE2 to vinculin. In addition,
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
19
WAVE2 is required for vinculin to associate with the ARP2/3 complex in response to
TCR stimulation (Fig 6D). Re-expression of the WT form of WAVE2, but not the ∆VCA
mutant, reconstituted the association of ARP2/3 and WAVE2 with vinculin (Fig 6D).
Overall, these data demonstrate that the VCA domain of WAVE2, through its
association with ARP2/3, is necessary to link WAVE2 to vinculin and that vinculin is
unable to bind the ARP2/3 complex without the VCA domain of WAVE2.
Vinculin regulates TCR-stimulated integrin activation, but not F-actin
accumulation or integrin localization to the IS.
The above data suggest that vinculin might be recruited to areas of de novo actin
polymerization through an association with WAVE2 and ARP2/3. Since vinculin is
known to be involved in integrin activation in other cell types, we next investigated
whether vinculin was involved in integrin activation in T cells. In order to functionally
characterize the possible role for vinculin in regulating TCR-mediated integrin adhesion,
two shRNAs against vinculin were generated that suppress vinculin protein levels in
Jurkat T cells (Fig 7A). Depletion of vinculin in T cells resulted in a reduction in the
formation of stable T cell – APC conjugates as determined by flow cytometry (Fig 7B).
Since vinculin is required for TCR-mediated conjugation to occur, we next analyzed
vinculin-suppressed T cells for F-actin accumulation and integrin localization to the IS.
In contrast to WAVE2- and ARP2/3-suppressed T cells (16, 36), which show dramatic
defects in both F-actin polymerization at the IS and localization of integrins to the T cell -
APC contact site, vinculin-suppressed Jurkat T cells conjugated to SEE pulsed Raji B
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
20
cells efficiently polymerized actin at the IS similarly to what is seen with control cells (Fig
7C). The localization of LFA-1 to the IS also occurs in the absence of vinculin (Fig 7D),
suggesting that vinculin affects TCR-stimulated integrin activation independently of de
novo actin polymerization and does not control integrin localization to the IS.
The ARP2/3 binding region of vinculin regulates integrin activation
Since WAVE2 and ARP2/3 both associate with vinculin in response to TCR
stimulation, we next sought to determine whether vinculin binding to ARP2/3 is required
for TCR-mediated integrin activation. To test this, “suppression/re-expression”
constructs were generated for vinculin, which re-expressed a resistant form of WT
vinculin or a previously defined mutant of vinculin that does not bind the ARP2/3
complex (7). Importantly, transfection of these plasmids into Jurkat T cells results in the
suppression of endogenous vinculin and re-expression of either the wild type or
ARP2/3-binding mutant protein (Fig 8A).
To determine whether vinculin binding to ARP2/3 was required for TCR-mediated
integrin activation, Jurkat T cells expressing the different “suppression/re-expression”
vinculin plasmids were analyzed for their ability to adhere to fibronectin in response to
TCR stimulation. As previously shown, Jurkat T cells transfected with control vector
adhered readily to fibronectin in response to TCR stimulation. In contrast, cells that
were transfected with the vinculin suppression vector were impaired in their ability to
adhere to fibronectin when compared to the control cells (Fig 8B). In addition, the ability
of vinculin to bind the ARP2/3 complex is required for TCR-mediated integrin activation,
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
21
because re-expression of the P878A mutant of vinculin failed to rescue the adhesion
defect, whereas re-expression of WT protein resulted in adhesion similar to that of
control transfected cells (Fig 8B). Similar to the phenotype seen in WAVE2-suppressed
cells, PMA did not rescue the ability of vinculin-suppressed cells, or cells expressing the
P878A mutant of vinculin, to adhere to fibronectin (Fig 8C). Overall, these data
demonstrate that the TCR-mediated association of WAVE2, ARP2/3, and vinculin
controls integrin activation required for T cell adhesion.
Talin is part of the TCR-stimulated WAVE2-ARP2/3-vinculin ternary complex.
Many scaffolding proteins that link to integrins also bind to the actin cytoskeleton, such
as α-actinin, filamin and talin. Talin, a large 250 kDa protein that binds directly to the β
chain of the integrin heterodimer and F-actin branches (2), localizes to the interface of
the T cell – APC conjugate in response to TCR stimulation (27) and binds directly to
vinculin. These qualities of talin prompted us to investigate whether WAVE2 and
vinculin played a role in the regulation of this important integrin activator. Importantly,
when Jurkat T cells were stimulated with anti-CD3/CD28, a complex consisting of
WAVE2, ARP2/3, vinculin, and talin could be detected in cell lysates (Fig 9A). This
complex was mostly undetectable in unstimulated cells, but the association continued to
form with increasing time of stimulation and still persisted after 30 minutes of TCR/CD28
stimulation. Formation of this complex could also be induced in primary CD4+ human T
cells (Fig 9B). We next investigated whether talin and vinculin binding to the β1 integrin
tail following TCR ligation would be affected by the loss of WAVE2. Indeed, both talin
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
22
and vinculin could be detected associated with β1 integrin following receptor ligation,
which was abrogated in WAVE2-suppressed cells (Fig 9C). These observations
suggest that in T cells, WAVE2 might regulate TCR-mediated integrin activation through
the formation of an ARP2/3-vinculin-talin signaling complex.
WAVE2 and vinculin are required for talin localization to the IS.
Our finding that WAVE2 is required for both integrin localization to the IS, as well
as the interaction of talin with the β1 integrin, prompted us to investigate the requirement
of WAVE2 in the localization of talin to the IS. Since the VCA domain of WAVE2
controlled actin accumulation at the IS, it seemed plausible that these mechanisms
could be linked and that talin localization may be dependent on WAVE2-mediated actin
polymerization. To test this hypothesis, both control cells and WAVE2-suppressed T
cells were allowed to form conjugates with SEE-pulsed Raji B cells and scored for their
ability to localize talin to the IS. In control cells, talin localization was apparent, with
nearly all of the protein localizing to the synapse in response to TCR stimulation (Fig
10A). In contrast, in T cells lacking WAVE2, talin remained in both the cytoplasm and
around the entire periphery of the cell. In addition, the VCA domain of WAVE2
regulated this process, since a WT version of WAVE2 rescued the ability to localize talin
to the IS, whereas the ∆VCA version did not (Fig 10A). Overall, these data suggest that
the VCA domain of WAVE2, which regulates F-actin polymerization and integrin
activation, is also required for talin localization to the IS.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
23
It is of interest that vinculin suppression did not affect the accumulation of F-actin
or integrins at the IS, but did affect TCR-stimulated integrin-mediated adhesion. Since
vinculin forms a complex with both WAVE2-ARP2/3 and talin, we reasoned that vinculin
might affect integrin activation in T cells by localizing talin to the IS. Indeed, in contrast
to vector-transfected cells, localization of talin to the contact site between T cells and
APCs is significantly diminished in vinculin-suppressed T cells (Fig 10B). These data
suggest that vinculin regulates integrin-dependent adhesion in T cells in part through its
ability to stably recruit talin to the IS.
WAVE2 and vinculin are required for integrin affinity modulation
Integrin activation is regulated by both the clustering of individual subunits on the
cell surface (avidity), as well as conformational changes within the integrin heterodimer
itself (affinity) (25). To test whether WAVE2 and vinculin regulated changes in integrin
affinity, we analyzed these cells for their ability to bind soluble VCAM-1 in response to
PMA stimulation. As shown in Figure 10C, stimulation with PMA results in increased
binding of VCAM-1 to vector control cells over unstimulated cells in all populations
analyzed (GFP-High, GFP-Low and GFP-Negative). However, both WAVE2- and
vinculin-suppressed GFP-high expressing T cells are less efficient at binding soluble
VCAM-1 in response to PMA stimulation than control cells (Fig 10C). In contrast, all
three transfected cell populations were able to bind soluble VCAM-1 at similar levels
when treated with Mn2+ (regardless of GFP expression), which directly induces the high
affinity conformation of β1 integrins. These data suggest that in T cells, both WAVE2
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
24
and vinculin are required to regulate intracellular signaling pathways leading to changes
in integrin affinity
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
25
DISCUSSION
T cell activation is dependent upon stable conjugation with an APC that may
persist for several hours (21). During this time, TCR engagement with peptide-MHC
complexes found on the APC initiates signaling cascades that lead to the transcription
of various target genes required for activation of the responding T cell. Besides the
effects on gene transcription, TCR stimulation also initiates the activation of cell surface
integrins, which in turn mediate tight conjugation between the T cell and APC required
for sustained signaling. The data presented here indicates that the adaptor protein
WAVE2 is a critical regulator of integrin function in T cells by directly linking ARP2/3-
mediated de novo actin polymerization initiated by the TCR to the integrin scaffold
proteins vinculin and talin (Fig 11).
Our data demonstrate that several key signaling pathways required for T cell
activation of integrins remain intact in WAVE2 suppressed cells, and thus suggest that
WAVE2 controls integrin activation downstream of these TCR signals. This finding is
supported by the fact that PMA stimulation is unable to induce adhesion in T cells
lacking WAVE2 or expressing WAVE2 that lacks the VCA domain. In fact, PMA
induces adhesion in cells missing TCR signaling components including ZAP-70 (10),
LAT (14), VAV1 (26), ITK (11), PLCγ1 (24), and ADAP (18, 38), and is thought to initiate
adhesion through the direct activation of PKC’s (9, 41) and possibly other signaling
molecules. Our results further suggest that WAVE2 may be one of the target molecules
stimulated by PMA leading to integrin activation. Interestingly, WAVE2 phosphorylation
can directly result from PMA stimulation, independently of TCR ligation, through a
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
26
mechanism downstream of ERK and PKC activation (31, 36). Although it remains to be
formally demonstrated that phosphorylation of WAVE2 by PMA leads to its activation,
TCR-stimulated phosphorylation kinetics of WAVE2 mirror that of its association with
vinculin and talin.
Our data demonstrates that the ability of vinculin to associate with WAVE2 and
ARP2/3 is essential for TCR-mediated integrin activation. This is in contrast to a
previous report in fibroblasts suggesting that vinculin’s association with ARP2/3 was
important for lamellipodial formation and not adhesion (7). However, that study
examined cell adhesion in the absence of any receptor stimulation, whereas TCR
stimulation results in a substantial increase in adhesion to integrin ligands. Clearly,
vinculin is providing a link between the actin cytoskeleton and components of integrin
activation such as talin. Both vinculin and talin bind F-actin filaments, but the origin of
these filaments has not been established. The data presented herein suggest that
WAVE2-mediated F-actin nucleation through ARP2/3 is required for integrin clustering
and the recruitment of vinculin and talin. Although it is clear that the actin cytoskeleton
is necessary for integrin function, it is also apparent that simply an absence of gross F-
actin at the IS does not necessarily result in decreased adhesion. For example, T cells
in which the actin regulators dynamin2 (15) or HS1 (17) have been suppressed display
decreased F-actin accumulation at the IS, while having no effect on conjugation.
Therefore, WAVE2, through its association with vinculin, may be providing the specific
de novo F-actin polymerization required for stabilization of talin and the integrin in the
cell membrane.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
27
The interaction between WAVE2, ARP2/3, vinculin, and talin provides a physical
link between the actin cytoskeleton and the integrin scaffold network downstream of
TCR engagement. Moreover, our data suggest that WAVE2-mediated ARP2/3 F-actin
nucleation is critical for integrin clustering at the IS, as well as providing the interaction
with both vinculin and talin. Moreover, vinculin, although not required for F-actin and
integrin accumulation at the IS, is required for the recruitment of talin to the IS. This
most likely causes the defect in integrin-mediated adhesion, as talin is a critical
regulator of integrin-mediated adhesion in both T cells and other cell types, and is
believed to induce the active conformation of the integrin through direct binding to
integrin β subunit cytoplasmic tails (1, 42, 43). In contrast to our results, RNAi-mediated
suppression of talin has recently been shown to be critical for integrin localization at the
IS. (42). This suggests additional complexity in the functions of vinculin and talin in
integrin activation. However, talin, like vinculin, is not required for F-actin accumulation
at the IS. This is consistent with our model that vinculin is functioning to regulate TCR-
stimulated integrin activation by recruiting talin to areas of de novo F-actin
polymerization, which are being generated by newly formed WAVE2-ARP2/3
complexes.
The present study also provides additional evidence for different biological
functions between WAVE2 and another VCA domain containing protein, WASP.
Previously it has been demonstrated that WASP-/- mouse T cells display no defects in
cell adhesion, including the formation of T – APC conjugates, TCR-mediated adhesion
to fibronectin, polymerization of F-actin at the IS, or the ability to cluster integrins in
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
28
response to TCR stimulation (3, 26). However, these cells are still impaired in certain
aspects of T cell activation and cannot efficiently internalize TCRs after stimulation (29),
another F-actin dependent process. Interestingly, our data also suggests that the VCA
domain of WAVE2 is specifically required to link the Arp2/3 complex to vinculin and
does not occur in the absence of WAVE2, even though the VCA domain of WASp is still
present. Therefore, WAVE2 and WASP appear to control distinct actin-dependent
cellular functions that are required for T cell activation. Our data further suggest that
integrin avidity is a WAVE2-ARP2/3-dependent process. It is of interest that integrin
avidity relies heavily on the activation of the Ras Family GTPase, RAP1, which induces
integrin clustering through the activation of recently characterized downstream effectors
(22, 23). It will be of interest to determine whether the activation of RAP1 occurs
mutually exclusive to WAVE2-mediated de novo actin polymerization or if the two
processes are linked in order to induce integrin clustering.
Surprisingly, it is now apparent that the ability of WAVE2 to control CRAC-
mediated calcium entry appears to be VCA domain independent. This is consistent with
our recent observation that suppression of ARP2/3 in T cells does not affect TCR-
stimulated calcium mobilization (16). While this finding clearly establishes the
importance of the VCA domain in controlling integrin activation, it now raises questions
as to how WAVE2 regulates calcium flux independent of its established effector
functions. It has previously been demonstrated that treatment of T cells with the actin
destabilizing agent cytochalasin D impairs NFAT-mediated gene transcription (19), but
augments calcium signaling and nuclear localization of NFAT in other studies (39).
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
29
Although these studies demonstrate opposing roles for the actin cytoskeleton in
regulating TCR-mediated calcium flux, they still suggest that the actin cytoskeleton
plays a role. It will be of interest to uncover the VCA-independent mechanism by which
WAVE2 or its associated complex members regulates calcium signaling, and also to
identify other actin nucleators that may play a role in this process.
In summary, this study establishes a molecular mechanism by which WAVE2
regulates integrin activation in response to TCR stimulation. We propose that T cells
spatially and temporally regulate integrin avidity and affinity by linking WAVE2-
mediated, ARP2/3-dependent de novo actin polymerization to the recruitment of vinculin
and talin. This permits both integrin recruitment to the IS, and affinity modulation of
integrins at the IS. Continued research examining the spatial and temporal regulation of
actin regulatory proteins involved in inside-out signaling to integrin activation, as well as
the identification of new binding partners, will no doubt continue to enhance our
understanding of the contribution of the actin cytoskeleton to this important cellular
process. ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
30
Acknowledgements
We would like to thank Dr. Tina Izard for the vinculin cDNA. This work was supported by
the Mayo Foundation and NIH grants R01-AI065474 to D.D.B., R01-AI038474 and R01-
AI031126 to Y.S., R01-AI060921 to B.D.F., NIH-T32-CA009138 Cancer Biology Training
Grant to J.S.M., and NIH-T32-AI07425 pre-doctoral Immunology Training Grant to J.C.N.
D.D.B. is a Leukemia and Lymphoma Society Scholar.
Competing Interest Statement
The authors declare that they have no competing financial interests.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
31
References
1. Calderwood, D. A., R. Zent, R. Grant, D. J. Rees, R. O. Hynes, and M. H. Ginsberg. 1999. The Talin head domain binds to integrin beta subunit cytoplasmic tails and regulates integrin activation. J Biol Chem 274:28071-4.
2. Campbell, I. D., and M. H. Ginsberg. 2004. The talin-tail interaction places integrin activation on FERM ground. Trends Biochem Sci 29:429-35.
3. Cannon, J. L., and J. K. Burkhardt. 2004. Differential roles for Wiskott-Aldrich syndrome protein in immune synapse formation and IL-2 production. J Immunol 173:1658-62.
4. Cannon, J. L., C. M. Labno, G. Bosco, A. Seth, M. H. McGavin, K. A. Siminovitch, M. K. Rosen, and J. K. Burkhardt. 2001. Wasp recruitment to the T cell:APC contact site occurs independently of Cdc42 activation. Immunity 15:249-59.
5. Cao, Y., E. M. Janssen, A. W. Duncan, A. Altman, D. D. Billadeau, and R. T. Abraham. 2002. Pleiotropic defects in TCR signaling in a Vav-1-null Jurkat T-cell line. Embo J 21:4809-19.
6. Chan, J. R., S. J. Hyduk, and M. I. Cybulsky. 2001. Chemoattractants induce a rapid and transient upregulation of monocyte alpha4 integrin affinity for vascular cell adhesion molecule 1 which mediates arrest: an early step in the process of emigration. J Exp Med 193:1149-58.
7. DeMali, K. A., C. A. Barlow, and K. Burridge. 2002. Recruitment of the Arp2/3 complex to vinculin: coupling membrane protrusion to matrix adhesion. J Cell Biol 159:881-91.
8. Duchniewicz, M., T. Zemojtel, M. Kolanczyk, S. Grossmann, J. S. Scheele, and F. J. Zwartkruis. 2006. Rap1A-deficient T and B cells show impaired integrin-mediated cell adhesion. Mol Cell Biol 26:643-53.
9. Dustin, M. L., and T. A. Springer. 1989. T-cell receptor cross-linking transiently stimulates adhesiveness through LFA-1. Nature 341:619-24.
10. Epler, J. A., R. Liu, H. Chung, N. C. Ottoson, and Y. Shimizu. 2000. Regulation of beta 1 integrin-mediated adhesion by T cell receptor signaling involves ZAP-70 but differs from signaling events that regulate transcriptional activity. J Immunol 165:4941-9.
11. Finkelstein, L. D., Y. Shimizu, and P. L. Schwartzberg. 2005. Tec kinases regulate TCR-mediated recruitment of signaling molecules and integrin-dependent cell adhesion. J Immunol 175:5923-30.
12. Gallo, E. M., K. Cante-Barrett, and G. R. Crabtree. 2006. Lymphocyte calcium signaling from membrane to nucleus. Nat Immunol 7:25-32.
13. Gautreau, A., H. Y. Ho, J. Li, H. Steen, S. P. Gygi, and M. W. Kirschner. 2004. Purification and architecture of the ubiquitous Wave complex. Proc Natl Acad Sci U S A 101:4379-83.
14. Goda, S., A. C. Quale, M. L. Woods, A. Felthauser, and Y. Shimizu. 2004. Control of TCR-mediated activation of beta 1 integrins by the ZAP-70 tyrosine
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
32
kinase interdomain B region and the linker for activation of T cells adapter protein. J Immunol 172:5379-87.
15. Gomez, T. S., M. J. Hamann, S. McCarney, D. N. Savoy, C. M. Lubking, M. P. Heldebrant, C. M. Labno, D. J. McKean, M. A. McNiven, J. K. Burkhardt, and D. D. Billadeau. 2005. Dynamin 2 regulates T cell activation by controlling actin polymerization at the immunological synapse. Nat Immunol 6:261-70.
16. Gomez, T. S., K. Kumar, R. B. Medeiros, Y. Shimizu, P. J. Leibson, and D. D. Billadeau. 2007. Formins regulate the actin-related protein 2/3 complex-independent polarization of the centrosome to the immunological synapse. Immunity 26:177-90.
17. Gomez, T. S., S. D. McCarney, E. Carrizosa, C. M. Labno, E. O. Comiskey, J. C. Nolz, P. Zhu, B. D. Freedman, M. R. Clark, D. J. Rawlings, D. D. Billadeau, and J. K. Burkhardt. 2006. HS1 functions as an essential actin-regulatory adaptor protein at the immune synapse. Immunity 24:741-52.
18. Griffiths, E. K., C. Krawczyk, Y. Y. Kong, M. Raab, S. J. Hyduk, D. Bouchard, V. S. Chan, I. Kozieradzki, A. J. Oliveira-Dos-Santos, A. Wakeham, P. S. Ohashi, M. I. Cybulsky, C. E. Rudd, and J. M. Penninger. 2001. Positive regulation of T cell activation and integrin adhesion by the adapter Fyb/Slap. Science 293:2260-3.
19. Holsinger, L. J., I. A. Graef, W. Swat, T. Chi, D. M. Bautista, L. Davidson, R. S. Lewis, F. W. Alt, and G. R. Crabtree. 1998. Defects in actin-cap formation in Vav-deficient mice implicate an actin requirement for lymphocyte signal transduction. Curr Biol 8:563-72.
20. Humphries, J. D., and M. J. Humphries. 2007. CD14 is a ligand for the integrin alpha4beta1. FEBS Lett 581:757-63.
21. Iezzi, G., K. Karjalainen, and A. Lanzavecchia. 1998. The duration of antigenic stimulation determines the fate of naive and effector T cells. Immunity 8:89-95.
22. Katagiri, K., M. Imamura, and T. Kinashi. 2006. Spatiotemporal regulation of the kinase Mst1 by binding protein RAPL is critical for lymphocyte polarity and adhesion. Nat Immunol 7:919-28.
23. Katagiri, K., A. Maeda, M. Shimonaka, and T. Kinashi. 2003. RAPL, a Rap1-binding molecule that mediates Rap1-induced adhesion through spatial regulation of LFA-1. Nat Immunol 4:741-8.
24. Katagiri, K., M. Shimonaka, and T. Kinashi. 2004. Rap1-mediated lymphocyte function-associated antigen-1 activation by the T cell antigen receptor is dependent on phospholipase C-gamma1. J Biol Chem 279:11875-81.
25. Kinashi, T. 2005. Intracellular signalling controlling integrin activation in lymphocytes. Nat Rev Immunol 5:546-59.
26. Krawczyk, C., A. Oliveira-dos-Santos, T. Sasaki, E. Griffiths, P. S. Ohashi, S. Snapper, F. Alt, and J. M. Penninger. 2002. Vav1 controls integrin clustering and MHC/peptide-specific cell adhesion to antigen-presenting cells. Immunity 16:331-43.
27. Lin, J., M. J. Miller, and A. S. Shaw. 2005. The c-SMAC: sorting it all out (or in). J Cell Biol 170:177-82.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
33
28. Liu, Q. H., B. K. Fleischmann, B. Hondowicz, C. C. Maier, L. A. Turka, K. Yui, M. I. Kotlikoff, A. D. Wells, and B. D. Freedman. 2002. Modulation of Kv channel expression and function by TCR and costimulatory signals during peripheral CD4(+) lymphocyte differentiation. J Exp Med 196:897-909.
29. McGavin, M. K., K. Badour, L. A. Hardy, T. J. Kubiseski, J. Zhang, and K. A. Siminovitch. 2001. The intersectin 2 adaptor links Wiskott Aldrich Syndrome protein (WASp)-mediated actin polymerization to T cell antigen receptor endocytosis. J Exp Med 194:1777-87.
30. Medeiros, R. B., D. M. Dickey, H. Chung, A. C. Quale, L. R. Nagarajan, D. D. Billadeau, and Y. Shimizu. 2005. Protein kinase D1 and the beta 1 integrin cytoplasmic domain control beta 1 integrin function via regulation of Rap1 activation. Immunity 23:213-26.
31. Miki, H., M. Fukuda, E. Nishida, and T. Takenawa. 1999. Phosphorylation of WAVE downstream of mitogen-activated protein kinase signaling. J Biol Chem 274:27605-9.
32. Miki, H., H. Yamaguchi, S. Suetsugu, and T. Takenawa. 2000. IRSp53 is an essential intermediate between Rac and WAVE in the regulation of membrane ruffling. Nature 408:732-5.
33. Mittelbrunn, M., A. Molina, M. M. Escribese, M. Yanez-Mo, E. Escudero, A. Ursa, R. Tejedor, F. Mampaso, and F. Sanchez-Madrid. 2004. VLA-4 integrin concentrates at the peripheral supramolecular activation complex of the immune synapse and drives T helper 1 responses. Proc Natl Acad Sci U S A 101:11058-63.
34. Mobley, J. L., E. Ennis, and Y. Shimizu. 1994. Differential activation-dependent regulation of integrin function in cultured human T-leukemic cell lines. Blood 83:1039-50.
35. Morgan, M. M., C. M. Labno, G. A. Van Seventer, M. F. Denny, D. B. Straus, and J. K. Burkhardt. 2001. Superantigen-induced T cell:B cell conjugation is mediated by LFA-1 and requires signaling through Lck, but not ZAP-70. J Immunol 167:5708-18.
36. Nolz, J. C., T. S. Gomez, P. Zhu, S. Li, R. B. Medeiros, Y. Shimizu, J. K. Burkhardt, B. D. Freedman, and D. D. Billadeau. 2006. The WAVE2 complex regulates actin cytoskeletal reorganization and CRAC-mediated calcium entry during T cell activation. Curr Biol 16:24-34.
37. Oikawa, T., H. Yamaguchi, T. Itoh, M. Kato, T. Ijuin, D. Yamazaki, S. Suetsugu, and T. Takenawa. 2004. PtdIns(3,4,5)P3 binding is necessary for WAVE2-induced formation of lamellipodia. Nat Cell Biol 6:420-6.
38. Peterson, E. J., M. L. Woods, S. A. Dmowski, G. Derimanov, M. S. Jordan, J. N. Wu, P. S. Myung, Q. H. Liu, J. T. Pribila, B. D. Freedman, Y. Shimizu, and G. A. Koretzky. 2001. Coupling of the TCR to integrin activation by Slap-130/Fyb. Science 293:2263-5.
39. Rivas, F. V., J. P. O'Keefe, M. L. Alegre, and T. F. Gajewski. 2004. Actin cytoskeleton regulates calcium dynamics and NFAT nuclear duration. Mol Cell Biol 24:1628-39.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
34
40. Sebzda, E., M. Bracke, T. Tugal, N. Hogg, and D. A. Cantrell. 2002. Rap1A positively regulates T cells via integrin activation rather than inhibiting lymphocyte signaling. Nat Immunol 3:251-8.
41. Shimizu, Y., G. A. Van Seventer, K. J. Horgan, and S. Shaw. 1990. Regulated expression and binding of three VLA (beta 1) integrin receptors on T cells. Nature 345:250-3.
42. Simonson, W. T., S. J. Franco, and A. Huttenlocher. 2006. Talin1 Regulates TCR-Mediated LFA-1 Function. J Immunol 177:7707-14.
43. Tadokoro, S., S. J. Shattil, K. Eto, V. Tai, R. C. Liddington, J. M. de Pereda, M. H. Ginsberg, and D. A. Calderwood. 2003. Talin binding to integrin beta tails: a final common step in integrin activation. Science 302:103-6.
44. Tybulewicz, V. L. 2005. Vav-family proteins in T-cell signalling. Curr Opin Immunol 17:267-74.
45. Vicente-Manzanares, M., and F. Sanchez-Madrid. 2004. Role of the cytoskeleton during leukocyte responses. Nat Rev Immunol 4:110-22.
46. Woods, M. L., W. J. Kivens, M. A. Adelsman, Y. Qiu, A. August, and Y. Shimizu. 2001. A novel function for the Tec family tyrosine kinase Itk in activation of beta 1 integrins by the T-cell receptor. Embo J 20:1232-44.
47. Woodside, D. G., R. M. Kram, J. S. Mitchell, T. Belsom, M. J. Billard, B. W. McIntyre, and P. Vanderslice. 2006. Contrasting roles for domain 4 of VCAM-1 in the regulation of cell adhesion and soluble VCAM-1 binding to integrin alpha4beta1. J Immunol 176:5041-9.
48. Ziegler, W. H., R. C. Liddington, and D. R. Critchley. 2006. The structure and regulation of vinculin. Trends Cell Biol 16:453-60.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
35
FIGURE LEGENDS
Figure 1. Signaling cascades required for TCR-mediated integrin activation. Ligation
of the T cell receptor (TCR) activates the proximal tyrosine kinases Lck (not shown) and
ZAP-70. These kinases can then activate several pathways known to regulate integrin
activation including the LAT-ITK-PLCγ1 pathway, required for both TCR-mediated
calcium flux, as well as activation of the small GTPase of the Ras Family, RAP1.
Targets of Rap1 (PKD, RAPL, MST1) regulate integrin activation primarily through the
appropriate clustering of integrins on the cell surface. ADAP and SKAP55 are both
required for TCR-mediated integrin activation and have been shown to affect both
cytoskeletal dynamics as well as the localization of RAP1. ADAP/SKAP55 have also
been shown to be indirectly linked to active RAP1 through another RAP1 effector,
RIAM, which constitutively interacts with SKAP55. Finally, the RHO GTPases RAC1
and CDC42 (while never formally shown to be required for TCR-mediated integrin
activation) can be activated by VAV1 leading to cytoskeletal reorganization, possibly
through the activation of WAVE2. The integrin scaffolding protein Talin1 binds to F-
actin filaments and also directly to the tail of the integrin β chain and has been shown to
control both integrin affinity and clustering. Importantly, several of these proteins (*) are
not required for PMA stimulated integrin activation, suggesting that integrins can be
activated independently of proximal TCR-stimulated signaling pathways when
stimulated with PMA.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
36
Figure 2. WAVE2 is Not Required for TCR-Mediated Activation of VAV1, RAC1, or
CDC42. (A) Jurkat T cells were transfected with either control or WAVE2-suppression
vector. Seventy-two hours post-transfection, cells were stimulated with anti-CD3/goat
anti-mouse for 0, 1, 2, 5, or 15 minutes. Cells were immediately lysed and after
clarification, VAV1 was immunoprecipitated. Bound proteins were eluted, separated by
SDS-PAGE, transferred, and blotted with 4G10 mAb (pTyr) and VAV1. Whole cell
extracts were also analyzed for expression of WAVE2 and VAV1. (B,C) Cells were
transfected as in (A). Cells were stimulated for 0, 1, or 5 minutes and immediately
lysed. Following clarification, GTP-bound RAC1 (B) or GTP-bound CDC42 (C) was
detected using GST-PAK GBD and immunoblot.
Figure 3. The VCA Domain of WAVE2 Regulates TCR-mediated Integrin Activation.
(A) WAVE2 contains an N-terminal WAVE-Homology Domain (WHD), followed by a
small Basic Region (BR), a large Proline-Rich Domain (PR) and a C-terminal verprolin-
connecting-acidic (VCA) Domain. Jurkat T cells were transfected with “suppression/re-
expression” constructs which suppress endogenous levels of WAVE2 and re-express
FLAG-tagged shRNA resistant form of WAVE2 and various deletion mutants. Seventy-
two hours post-transfection, whole cell extracts were harvested, separated by SDS-
PAGE, transferred, and blotted for WAVE2, FLAG, and ARPC2 as a loading control.
The immunoreactive portion of WAVE2 is not present in the ∆PR mutant and can only
be detected with a FLAG immunoblot. Multiple bands in the ∆VCA and ∆BR versions of
WAVE2 are most likely due to different phosphorylation states of the proteins (36). (B)
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
37
Cells were transfected as in (A) and analyzed for their ability to adhere to fibronectin in
response to either no stimulation (-) or stimulation of the TCR (+). Adherent cells (GFP
negative, GFP low, and GFP high) were detected using flow cytometry. GFP negative
cells (untransfected) serves as an internal control to demonstrate adequate stimulation
required for adhesion. (C) Cells were transfected as in (A) and analyzed for their ability
to form conjugates with PKH26 stained Raji B cells that were either pulsed with SEE or
left unpulsed. Conjugate formation was determined using two-color flow cytometry as
described in Materials and Methods. (D) Cells were transfected as in (A) with either
control or WAVE2-suppression vector and analyzed for surface expression of both β1
and β2 integrins. Cells were gated as GFP+ or GFP- and stained with either control IgG
(white histogram), β1 (black histogram) or β2 (gray histogram) integrin in the different cell
populations.
Figure 4. The VCA Domain of WAVE2 Regulates Actin Polymerization and Integrin
Activation Downstream of Proximal Signals, but Independently of Calcium Mobilization.
(A) Jurkat T cells were transfected with either control, WAVE2-suppression, WT WAVE2
re-expression, or ∆VCA WAVE2 re-expression vectors and allowed to recover for 72
hours. T cells (green) were then allowed to form conjugates with CMAC stained Raji B
cells (blue) that were pulsed with SEE, allowed to adhere to poly-L-lysine coated
coverslips, fixed, and stained with rhodamine phalloidin (red) to visualize the
accumulation of F-actin at the IS. Accumulation of F-actin was quantified in 50 random
conjugates as described in Materials and Methods and shown are the averages of three
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
38
independent experiments. (B) Jurkat T cells were transfected as in (A). After 72 h,
calcium measurements were performed using single cell fluorescence ratio (Fura-2
imaging) of GFP positive control and WAVE2 suppressed Jurkat cells. In calcium-free
bath solution, increases in Fura-2 ratio reflect Ca2+ release from intracellular stores.
Extracellular Ca2+ entry via activated CRAC channels was subsequently assessed by
reintroduction of extracellular calcium (2 mM Ca2+). Shown are representative
examples of three independent experiments for each condition and each trace
represents the average response of at least 100 cells in the recording chamber. (C)
Cells were transfected as in (A) and analyzed for their ability to adhere to fibronectin in
response 10 ng/ml PMA stimulation. Adhesion was determined as described in Fig. 2B.
Figure 5. Localization of both LFA-1 and β1 integrins to the IS requires WAVE2 and
ARP2/3. (A) Jurkat T cells were transfected with either control, WAVE2-suppression, or
ARP2 suppression vectors and allowed to recover for 72 hours. T cells (green) were
then allowed to form conjugates with CMAC stained Raji B cells (blue) that were pulsed
with SEE, allowed to adhere to poly-L-lysine coated coverslips, fixed, and stained with
antibody against the β2 chain of LFA-1. Localization of LFA-1 to the synapse was
quantified in 50 random conjugates as described in Materials and Methods and shown
are the averages of three independent experiments. (B) Cells were transfected and
conjugates were formed as in (A). Conjugates were then analyzed for their ability to
localize β1 integrins to the IS and quantification was determined as in (A).
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
39
Figure 6. The ARP2/3 complex is required to link WAVE2 to vinculin. (A) Human
CD4+ T cells were allowed to form conjugates with CMAC labeled NALM6 B cells (blue)
that were pulsed with a superantigen cocktail containing SEE, SEA, SEB, and SEC (+
SAg) or left unpulsed (- SAg). Conjugates were then allowed to adhere to poly-L-lysine
coated coverslips, fixed, and subsequently stained for vinculin (red) and F-actin (green)
or (B) vinculin (red) and WAVE2 (green). (C) Jurkat T cells were transfected with either
control vector or ARP2-suppression vector and allowed to recover for 72 hours. Cells
were then left unstimulated or stimulated with anti-CD3/CD28 for 30 minutes and
immediately lysed. Lysated were clarified and vinculin was immunoprecipitated. Bound
proteins were eluted, separated by SDS-PAGE, transferred, and subsequently blotted
for WAVE2, ARP2, and vinculin. Whole cell extracts were also analyzed for protein
levels of WAVE2, ARP2, and vinculin. (D) Cells were transfected with control, WAVE2-
suppression, WT WAVE2 re-expression, or ∆VCA WAVE2 re-expression vector. Cells
were stimulated and lysates were immunoprecipitated as in (C) and subsequently
blotted for WAVE2, ARPC2, and vinculin.
Figure 7. Vinculin is required for TCR-mediated integrin activation independently of
actin and integrin accumulation at the IS. (A) Jurkat T cells were transfected with either
vector control or with suppression vectors against vinculin. Seventy-two hours post-
transfection, cells were analyzed by immunoblot for expression of vinculin and WAVE2.
(B) Cells were transfected as in (A) and analyzed for their ability to form conjugates with
PKH26 stained Raji B cells that were either pulsed with SEE or left unpulsed.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
40
Conjugate formation was determined using two-color flow cytometry as described in
Materials and Methods. (C) Jurkat T cells were transfected as in (A). T cells (green)
were then allowed to form conjugates with SEE pulsed Raji B cells (blue), allowed to
adhere to poly-L-lysine coated coverslips, fixed, and stained with rhodamine phalloidin
to visualize accumulation of F-actin at the IS. Actin polymerization was quantified in 50
random conjugates as described in Materials and Methods and shown are the averages
of two independent experiments. (D) Same as (C) except stained for β2 integrin.
Figure 8. The Association between ARP2/3 and vinculin is required for TCR-mediated
integrin activation. (A) Jurkat T cells were transfected with control, vinculin-suppression,
WT vinculin re-expression, or P878A vinculin re-expression vectors. Seventy-two hours
post transfection, whole cell extracts were harvested, separated by SDS-PAGE,
transferred, and membranes were subsequently blotted for vinculin, FLAG, and ARPC2
as a loading control. (B) Cells were transfected as in (A) and analyzed for their ability to
adhere to fibronectin in response to TCR stimulation (+) or no stimulation (-). (C) Cells
were transfected as in (A) and analyzed for their ability to adhere to fibronectin in
response to simulation with 10 ng/ml PMA or no stimulation. Adherent cells were
detected using flow cytometry as described in Figure 3B.
Figure 9. Vinculin associates with WAVE2, ARP2/3, and talin in response to TCR
stimulation. (A) Jurkat T cells were stimulated with anti-CD3/CD28 antibody for 0, 5, 15,
or 30 minutes, lysed, and immunoprecipitations were performed using either an isotype
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
41
control IgG antibody or anti-vinculin antibody. Bound proteins were eluted, separated
by SDS-PAGE, transferred, and membranes were subsequently blotted for talin,
WAVE2, ARPC2, and vinculin. (B) Same as (A) except human CD4+ T cells were used.
(C) Jurkat T cells were transfected with either control or WAVE2-suppression vectors
and allowed to recover for 72 hours. Cells were then stimulated with anti-CD3/CD28 for
0, 15, or 30 minutes, lysed, and β1 integrin was immunoprecipitated. Bound proteins
were eluted, separated by SDS-PAGE, transferred, and membranes were subsequently
blotted for talin, vinculin, and β1 integrin. Whole cell extracts were also analyzed for
expression of talin, vinculin, β1 integrin, and WAVE2.
Figure 10. The VCA domain of WAVE2 and vinculin are required for talin localization
and activation-dependent high-affinity integrin-binding. (A) Jurkat T cells were
transfected with either control, WAVE2-suppression, WT WAVE2 re-expression, or
∆VCA WAVE2 re-expression vectors and allowed to recover for 72 hours. T cells
(green) were then allowed to form conjugates with CMAC stained Raji B cells (blue) that
were pulsed with SEE, allowed to adhere to poly-L-lysine coated coverslips, fixed, and
stained with antibody against talin (red) to visualize accumulation at the IS. Localization
of talin was quantified in 50 random conjugates as described in Materials and Methods
and shown are the averages of three independent experiments. (B) Same as (A)
except cells were trasfected with control or vinculin-suppression vectors. Localization
was quantified as in (A). (C) Jurkat T cells were transfected with control, WAVE2-
suppression, or vinculin-suppression vectors and allowed to recover for 72 hours. Cells
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
42
were then either left unstimulated or stimulated with 50 ng/ml PMA or 1 mM Mn2+ for 10
min in the presence of soluble VCAM-1-Fc. Cells were then diluted and immediately
fixed with paraformaldehyde and subsequently stained to detect binding of soluble
VCAM-1 as described in Materials and Methods. Cells were analyzed by flow cytometry
to detect binding of VCAM-1 and separated based on GFP expression. Gated
populations indicate cells that bind with either high (right) or low (left) affinity to VCAM-1.
High, Low, Neg listed to the left of each stimulation condition refer to the GFP-
expressing population being analyzed in the experiment.
Figure 11. Proposed model for the role of WAVE2, ARP2/3, vinculin, talin and actin
polymerization in TCR-mediated integrin activation. (A) In resting cells, WAVE2,
ARP2/3, vinculin, and talin are free of association and cell surface integrins are
distributed evenly on the cell surface. (B) Stimulation of the TCR causes the activation
of several signaling cascades leading to the activation of WAVE2, which then binds
ARP2/3 and promotes de novo actin polymerization toward the forming IS. Vinculin
localizes to the IS through a direct interaction with WAVE2 and the ARP2/3 complex
and integrins begin to localize to the pSMAC. (C) Finally, talin (probably through its
association with vinculin and F-actin) localizes and binds both β1 and β2 integrins,
resulting in the high affinity conformation at the IS. The newly formed F-actin generated
by WAVE2 probably also serves as a binding partner for both vinculin and talin,
providing the structural integrity required for stabilizing the integrin at the pSMAC.
ACCEPTED
on April 13, 2019 by guest
http://mcb.asm
.org/D
ownloaded from
ααααββββ
WAVE2 VCA
ARP2/3
IntegrinTCR
Talin
Vin
cu
lin
F-Actin
WAVE2 VCA
ARP2/3
TCR
F-Actin
WAVE2 VCA
ARP2/3
ααααββββ
Integrin
TCR
Talin
Vinculin
Talin
A B C
Nolz et al Figure 11
Vin
cu
lin
ααααββββ
Integrin
Low
AffinityHigh
Affinity
ACCEPTED on A
pril 13, 2019 by guesthttp://m
cb.asm.org/
Dow
nloaded from