vttra and vttrb encode toxr family proteins that mediate ... · which is necessary for both the...

INFECTION AND IMMUNITY, June 2010, p. 2554–2570 Vol. 78, No. 60019-9567/10/$12.00 doi:10.1128/IAI.01073-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

vttRA and vttRB Encode ToxR Family Proteins That MediateBile-Induced Expression of Type Three Secretion System

Genes in a Non-O1/Non-O139 Vibrio cholerae Strain�

Ashfaqul Alam,1 Vincent Tam,2† Elaine Hamilton,1 and Michelle Dziejman1*Department of Microbiology and Immunology, University of Rochester School of Medicine and Dentistry, Rochester, New York1 and

Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, Massachusetts2

Received 21 September 2009/Returned for modification 15 November 2009/Accepted 31 March 2010

Strain AM-19226 is a pathogenic non-O1/non-O139 serogroup Vibrio cholerae strain that does notencode the toxin-coregulated pilus or cholera toxin but instead causes disease using a type three secretionsystem (T3SS). Two genes within the T3SS pathogenicity island, herein named vttRA (locus tag A33_1664)and vttRB (locus tag A33_1675), are predicted to encode proteins that show similarity to the transcrip-tional regulator ToxR, which is found in all strains of V. cholerae. Strains with a deletion of vttRA or vttRBshowed attenuated colonization in vivo, indicating that the T3SS-encoded regulatory proteins play a rolein virulence. lacZ transcriptional reporter fusions to intergenic regions upstream of genes encoding theT3SS structural components identified growth in the presence of bile as a condition that modulates geneexpression. Under this condition, VttRA and VttRB were necessary for maximal gene expression. Incontrast, growth in bile did not substantially alter the expression of a reporter fusion to the vopF gene,which encodes an effector protein. Increased vttRB reporter fusion activity was observed in a �vttRB strainbackground, suggesting that VttRB may regulate its own expression. The collective results are consistentwith the hypothesis that T3SS-encoded regulatory proteins are essential for pathogenesis and control theexpression of selected T3SS genes.

Vibrio cholerae is a gram-negative, motile bacterium that isfound globally as a common inhabitant of brackish and estua-rine waters. Strains exhibit extensive phenotypic and geneticheterogeneity and can be classified according to several differ-ent criteria. For example, serogroup designation is based onthe structure of the somatic O antigen, whereas the pathoge-nicity of a strain is determined by its ability to colonize ahuman host and cause the severe and potentially lethal diar-rheal disease known as cholera (15, 26, 68). Importantly, morethan 200 different serogroups have been identified, and bothpathogenic and nonpathogenic strains of different serogroupshave been found to coexist in environmental reservoirs world-wide (27, 77).

Only O1 and O139 serogroup strains are associated withepidemic disease, and strains belonging to other serogroupsare collectively referred to as non-O1/non-O139 strains (14,26). Pathogenicity is not serogroup specific, however, and iso-lates of many different non-O1/non-O139 serogroups havebeen associated with sporadic diarrheal disease, extraintestinalinfections, sepsis, and wound infections worldwide (3, 6, 7, 20,39, 53, 54). Although unable to cause epidemic disease, non-O1/non-O139 serogroup strains are viewed as an emergingthreat due to recent reports of limited outbreaks in indepen-dent geographic locations and epidemiological data suggesting

an increased incidence of non-O1/non-O139 strain-associateddiarrheal disease in areas of endemicity such as India andSoutheast Asia (5, 19–21, 27, 66, 67).

Conventionally, pathogenic strains are identified by thepresence of horizontally acquired genes encoding the toxin-coregulated pilus (TCP; essential for colonization) and chol-era toxin (CT) (28, 65). In contrast to epidemic O1 andO139 serogroup strains, which strictly employ TCP- andCT-mediated mechanisms of pathogenesis, most non-O1/non-O139 clinical isolates do not carry the genes encodingTCP and CT (4, 27, 64). It is not well understood how strainscolonize the host in a TCP-independent manner, and al-though other virulence factors have been identified (e.g., ElTor hemolysins, a thermostable direct hemolysin), it is un-clear whether such factors alone can recapitulate the clinicalsimilarity and severity of disease associated with CT-ex-pressing strains (4, 34, 38, 53, 64, 66, 69).

Genomic sequence analysis of AM-19226 (an O39 sero-group, TCP/CT-negative, clinically isolated strain) identi-fied genes predicted to encode the structural components ofa type three secretion system (T3SS) (25). The genes liewithin an �55-kb region that displays characteristics of hor-izontal transmission, and similar sequences have been iden-tified in other non-O1/non-O139 serogroup strains (16, 25,64). In other bacteria, the T3SS island typically encodesthree classes of proteins in addition to the structural com-ponents of the translocation apparatus: effector proteins(which mediate disease), their chaperones, and transcrip-tional regulators dedicated to controlling T3SS gene expres-sion. The V. cholerae T3SS most closely resembles T3SS2 ofV. parahaemolyticus in linear organization and sequencesimilarity but appears unique in comparison to the systems

* Corresponding author. Mailing address: Box 672, University ofRochester, School of Medicine and Dentistry, 601 Elmwood Avenue,Rochester, NY 14642. Phone: (585) 273-4459. Fax: (585) 473-9573.E-mail: [email protected].

† Present address: Institute for Systems Biology, 1441 N. 34th Street,Seattle, WA 98103.

� Published ahead of print on 12 April 2010.

2554

on February 20, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/IAI.01073-09&domain=pdf&date_stamp=2010-06-01

http://iai.asm.org/

encoded by Yersinia, Salmonella, and Shigella species (16,17, 25). Nearly half of the genes within the V. cholerae T3SSisland are predicted to encode hypothetical proteins withlittle or no homology to proteins in current databases. None-theless, experiments using strain AM-19226 demonstratedthat the V. cholerae T3SS is essential for colonization in theinfant mouse model, and one effector protein, VopF, wasshown to function in the reorganization of host cell actin(75). Although additional effector proteins have not yetbeen identified, it is hypothesized that for T3SS-positive V.cholerae strains, the coordinated functions of multiple ef-fector proteins promote unique mechanisms of host coloni-zation and disease manifestation that result in TCP/CT-independent cholera.

Strain AM-19226 encodes two putative transcriptional reg-ulatory proteins within the T3SS island (25; unpublished ob-servations). Both proteins show significant sequence similarityto the ToxR protein, a transmembrane DNA binding proteinencoded by nearly all strains of V. cholerae, including AM-19226. In epidemic O1 and O139 serogroup strains, the ToxRprotein and the ToxR regulatory network have been studied indetail and serve as a paradigm for understanding coordinatedvirulence gene expression and transcriptional regulation by atransmembrane protein. Briefly, maximal activation of viru-lence genes requires that ToxR interact with other proteins,including ToxS, TcpP, and TcpH, to activate the expression ofthe toxT gene. toxT is found within the TCP island and encodesan AraC-related transcriptional regulator that directly bindsand activates the transcription of the genes encoding TCP andCT (48). ToxR directly binds DNA through amino acids foundin the amino-terminal winged helix-turn-helix (HTH) domain,which is necessary for both the positive and negative transcrip-tional regulation of genes (45, 50, 52, 57, 62). In addition to itsrole as a transcriptional activator of virulence genes, ToxR alsofunctions to regulate the expression of the outer membraneporins OmpU and OmpT and the expression of metabolicpathway components (8, 52).

Numerous studies have contributed to our understanding ofhow epidemic V. cholerae strains direct the transcription ofvirulence factors in response to specific stimuli that the bacte-ria might encounter during infection (41, 48). pH, mucus, bile,temperature, anaerobiosis, and osmolarity have been identifiedas potentially important signals in the human intestine thatmodulate the expression of genes belonging to the ToxR regu-lon, and several of these signals can be reproduced in vitro topromote virulence gene expression (22, 44, 49, 58). For exam-ple, bile and bile salt components have been used to mimicphysiologically relevant in vivo conditions during in vitro stud-ies aimed at probing the regulatory mechanisms controllingTCP and CT expression (32, 37, 71). Although the interpreta-tion of data has been complex, such studies have significantlycontributed to our ability to dissect and understand the regu-latory networks governing V. cholerae virulence gene expres-sion. Similarly, the role of bile and bile salts in promoting theexpression of T3SS genes in other enteric pathogens has alsobeen explored (31).

In many T3SSs, regulation occurs at multiple levels and iscoordinated by several regulatory systems (29, 76). It is notknown how strain AM-19226 regulates T3SS-mediated patho-genesis, nor do we currently understand if ToxR is involved in

controlling virulence gene expression in TCP/CT-negative,pathogenic non-O1/non-O139 strains. Since ToxR is a proteinknown to regulate the expression of horizontally acquired vir-ulence genes (e.g., tcp and ctx), its role in effecting T3SS geneexpression clearly warrants investigation. The presence of twoputative transcriptional regulators within the T3SS pathoge-nicity island, each with amino acid similarity to ToxR, suggeststhat T3SS gene expression may instead (or also) be controlledby the activity of ToxR homologues. Regulation of T3SS geneexpression might therefore be achieved by ToxR-directedmechanisms (similar to the regulation of TCP/CT gene expres-sion), by the proteins encoded within the T3SS pathogenicityisland, or by a combination of factors. We therefore sought todetermine the roles of the AM-19226 ToxR protein and thetwo T3SS-encoded putative regulatory proteins in the viru-lence of strain AM-19226. We evaluated the in vitro effect ofcrude bile and deoxycholate, a bile acid, on the expression ofthe structural genes encoding the T3SS apparatus and deter-mined whether ToxR and the ToxR-like proteins modulate theexpression of T3SS genes under these conditions. We presentresults indicating that two novel proteins related to ToxR haveimportant roles in directing T3SS-mediated pathogenesis instrain AM-19226, thus allowing us to begin to develop modelsof how virulence is regulated in TCP/CT negative, T3SS-pos-itive, non-O1/nonO139 V. cholerae strains.

MATERIALS AND METHODS

Strains and growth conditions. The bacterial strains and plasmids used in thisstudy are shown in Table 1. Escherichia coli and V. cholerae strains were main-tained at �80°C in Luria-Bertani (LB) broth containing 25% glycerol. For E. coliand V. cholerae, ampicillin and streptomycin were each used at 100 �g/ml.5-Bromo-4-chloro-3-indolyl-�-D-galactopyranoside (X-Gal) and 5-bromo-4-chloro-3-indolyl-phosphate p-toluidine salt (X-Phos) were added to LB agar at20 �g/ml. Sodium deoxycholate (D-6750) and bovine bile (B-3883) were pur-chased from Sigma. Stock solutions of 10% crude bile and 4% deoxycholate wereprepared in deionized water and centrifuged for 10 min at 16,000 � g, and thesupernatant was filtered through a 0.45 �m filter.

Strain and plasmid constructions. Nucleic acid manipulations were performedusing standard molecular biological techniques (70). The primers used are shownin Table 2. Nonpolar in-frame deletions of toxR, A33_1664 (vttRA), andA33_1675 (vttRB) were constructed using overlapping PCR (splicing by overlap-ping extension) and standard allelic-exchange methods (23, 35), leaving se-quences coding for 7, 13, and 20 amino acids (aa). The number of amino acidresidues in the N-terminal and C-terminal ends of the proteins left after thein-frame deletions are as follows: 2 and 5 aa for �toxR, 3 and 10 aa for �vttRA,and 3 and 17 aa for �vttRB. Deletions were confirmed by sequencing, PCR, andSouthern analysis (70).

Alkaline phosphatase analysis. For PhoA fusion analysis, plasmid pKB1 wasconstructed by cloning the signal sequenceless phoA gene into the PstI site ofpBSSK� (Invitrogen). The coding regions for AM-19226 ToxR (aa 1 to 293),A33_1664 (aa 1 to 247), and A33_1675 (aa 1 to 182) were cloned upstream of thephoA gene to generate C-terminal translational fusions, resulting in plasmidspKN1, pKN2, and pKN3, respectively. All three fusions code for a glycine-cysteine-arginine triplet between the C-terminal coding amino acid and PhoA.Liquid alkaline phosphatase assays were performed as previously described (11).

lacZY transcriptional reporter studies. pAAC3 is a multicopy transcriptionalfusion vector constructed for T3SS gene expression analysis. The promoterless E.coli lacZY genes (including the native Shine-Dalgarno sequence) and the tran-scriptional terminator sequence rrnT1T2 were cloned into pBSSK�. Putativepromoter sequences upstream of V. cholerae strain AM-19226 T3SS genes wereamplified by PCR using iProof High-Fidelity DNA polymerase (Bio-Rad) andcloned into the multiple cloning site of pAAC3. The resulting transcriptionalfusion plasmids were introduced into a genetically responsive lacZ mutant de-rivative of strain AM-19226, MD996, by electroporation (unpublished data; 75).

pEH3 was constructed as a suicide vector based on pCVD442 to facilitate theintegration of single-copy transcriptional reporter fusions at the lacZ locus of V.

VOL. 78, 2010 VttRA AND VttRB REGULATE V. CHOLERAE T3SS GENES 2555


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

TABLE 1. Bacterial strains and plasmids used in this study

Strain Genotype/descriptiona Reference

V. choleraeMD 992 AM19226 R� M� Strr Laboratory stockMD 996 AM19226 R� M� �lacZ Strr Laboratory stockAAC40 MD992 �vttRB (A33_1675) This studyAAC228 MD992 �vttRA (A33_1664) This studyMD1069 MD992 �vttRA (A33_1664) �vttRB (A33_1675) This studyAD10 MD992 �toxR This studyAAC66 MD 996(pAAC3-A33_1675-lacZY) This studyAAC67 MD 996(pAAC3-lacZY) This studyAAC76 MD 996(pAAC3-vcsJ2-lacZY) This studyAAC78 MD 996(pAAC3-vspD-lacZY) This studyAAC87 MD 996(pAAC3-vcsRTCNS2-lacZY) This studyAAC89 MD 996(pAAC3-vcsVU2-lacZY) This studyAAC125 MD 996(pAAC3-vopF-lacZY) This studyAAC243 MD992 integrated vcsRTCNS2-lacZY fusion This studyAAC201 MD992 integrated vspD-lacZY fusion This studyAAC350 MD992 integrated vcsVUQ2-lacZY fusion This studyAAC355 MD992 integrated vcsJ2-lacZY fusion This studyAAC204 MD992 integrated vopF-lacZY fusion This studyAAC198 MD992 integrated vttRB (A33_1675)-lacZY fusion This studyAAC318 MD992 integrated vttRA (A33_1664)-lacZY fusion This studyAAC244 MD992 integrated promoterless lacZY fusion This studyAAC245 AAC40 integrated vcsRTCNS2-lacZY fusion This studyAAC259 AAC40 integrated vspD-lacZY fusion This studyAAC365 AAC40 integrated vcsVUQ2-lacZY fusion This studyAAC357 AAC40 integrated vcsJ2-lacZY fusion This studyAAC255 AAC40 integrated vttRB (A33_1675)-lacZY fusion This studyAAC321 AAC40 integrated vttRA (A33_1664)-lacZY fusion This studyAAC264 AAC40 integrated promoterless lacZY This studyAAC267 AAC228 integrated vcsRTCNS2-lacZY fusion This studyAAC282 AAC228 integrated vspD-lacZY fusion This studyAAC352 AAC228 integrated vcsVUQ2-lacZY fusion This studyAAC368 AAC228 integrated vcsJ2-lacZY fusion This studyAAC276 AAC228 integrated vttRB (A33_1675)-lacZY fusion This studyAAC324 AAC228 integrated vttRA (A33_1664)-lacZY fusion This studyAAC279 AAC228 integrated promoterless lacZY This studyAAC299 AD10 integrated vcsRTCNS2-lacZY fusion This studyAAC302 AD10 integrated vspD-lacZY fusion This studyAAC354 AD10 integrated vcsVUQ2-lacZY fusion This studyAAC358 AD10 integrated vcsJ2-lacZY fusion This studyAAC308 AD10 integrated vttRB (A33_1675)-lacZY fusion This studyAAC327 AD10 integrated vttRA (A33_1664)-lacZY fusion This studyAAC311 AD10 integrated promoterless lacZY This studyEK3 MD1069 integrated vcsRTCNS2-lacZY fusion This studyEK15 MD1069 integrated vspD-lacZY fusion This studyAAC486 MD1069 integrated vcsVUQ2-lacZY fusion This studyAAC490 MD1069 integrated vcsJ2-lacZY fusion This studyEK9 MD1069 integrated vttRB (A33_1675)-lacZY fusion This studyEK11 MD1069 integrated vttRA (A33_1664)-lacZY fusion This studyEK19 MD1069 integrated promoterless lacZY This study

E. coliDH5�F F endA1 hsdR17 supE44 thi-1 recA1 gyrA relA1 �U169(lacZYA-argF) (80 dlac�M15) Laboratory stockSM10�pir thi thr leu tonA lacY supE recA RP4-2–Tc::(�pir) Kanr Laboratory stock

PlasmidspAAC3 Expression vector; Ampr This studypCVD442UMCS Suicide vector with unique multiple cloning site, Ampr Laboratory stockpEH3 (EH077) Allelic exchange suicide vector based on pCVD442; facilitates chromosomal

integration of lacZY transcriptional fusions into V. cholerae lacZ; AmprThis study

pCVD442UMCS-� vttRB vttRB (A33_1675) deletion plasmid; Ampr This studypCVD442UMCS-� vttRA vttRA (A33_1664) deletion plasmid; Ampr This studypCVD442UMCS-�toxR toxR deletion plasmid; Ampr This studypKB1 phoA fusion vector based on pBSSK�; Ampr This studypKN1 toxR-phoA fusion; Ampr This studypKN2 vttRA-phoA fusion; Ampr This studypKN3 vttRB-phoA fusion; Ampr This study

a Ampr, ampicillin resistant; Strr, streptomycin resistant; Kanr, kanamycin resistant; R�, type II restriction endonuclease deletion; M�, methyltransferase positive;UMCS, unique multiple cloning site introduced into pCVD442 (MD1003).

2556 ALAM ET AL. INFECT. IMMUN.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

TABLE 2. Primers used in this study

Primer used and gene/ORF amplified Ampliconsize (bp) Primer name Sequence

RT-PCRA33_1675-A33_1674 936 RT toxR 2332 F CTTGTGCTGCAGTTTGTG

RT 2332 toxR R GGCATGGTGTTATTACTCAAG

A33_1674-vcsR2 253 3VcsR2 XbaI R TGAGTCTAGACAACTGCAACGCTTAATGGRT 2332 vcsR2 NR AGAAAGCAGCACCAACAC

vcsR2-vcsT2 764 RT vcsR vcsT2 F TACTAGAGCATGCCAAACAGRT vcsT vcsR R CCACCACGGTTTGATATAACG

vcsT2-A33_1671 516 RT vcsT 2329 F CGGTATTTAAACCGCTACTGGRT 2329 vcsT R ACGCATTTGACGAATAGACTC

A33_1671-vcsC2 1,061 RT 2329 vcsC F TGCTTCTCAAGAGGGAGATGRT 2329 vcsC R GTAAATTCCTCGGCTACCATTTAAC

vcsC2-vcsN2 1,002 RT vcsC vcsN F GATAGCGGCTGGTTAAATGGRT vcsN vcsC R GCCCTTCTCCGATAGTAAAC

vcsN2-A33_1668 1,012 RT vcsN 2326 TGCGAGCTCCAATTGAAACRT 2326 vcsN R GCAGCCACTCAATATGATCC

A33_1668-A33_1667 676 RT 2326 ORF32 F TGAGCATGATAGCCTTAAACGRT 2326 ORF32 R AGTCTGCCGGCTAAATTG

A33_1667-vcsS2 458 RT ORF32 vcsS F CCAATTTAGCCGGCAGACRT ORF32 vcsS R CCACCAAACTGGGTTAGTAG

vcsS2-ORF69 295 5 ToxR2.A Del SalI ACTAAGTCGACTTGGTGGCAGTATTTATGAGRT ORF69 vcsS R CCATAATCTTAGGTGCTTTGTAACG

ORF69-ORF65 317 RT ORF69 ORF65 F CGTTACAAAGCACCTAAGATTATGGRT ORF69 ORF65 R CATATACCAAGCCAAACTCTACC

A33_1684-A33_1683 1,014 RT fw 2342 2341 AGTTCGCAGTTTGAAGTTGGRT NRv 2341 2342 ACTTTGGGAATCGCTTTATGC

A33_1683-vcsV2 961 RT Fd 2341 vcsV GCGTCACGTTGAGTATTGAGRT Rv vcsV 2341 GATAATACCGCCAATCACTAGC

vcsV2-vcsU2 1,128 RT Fd vcsV vcsU GGCGGTATTATCATTATCTTGGGRT Rv vcsV vcsU TTGGAAATTGGCCTTTCTG

vcsU2-A33_1680 1,114 RT vcsU2 Fd AACCGAACCCAAGAAATATCCRT Rv vcsU 2338 TCTTGATCGAGCACTATGTTG

A33_1680-A33_1679 994 RT 2338 2337 F CAACATAGTGCTCGATCAAGACRT 2338 2337 R CAACAACCTAGCAATTTCATCTC

A33_1679-A33_1678 1,096 RT 2337 2336 F GGGCATTAAAGTGACCAGTAAGRT 2337 2336 R CAGTATCGACCCAGTTCATC

A33_1678-A33_1677-vcsQ2 990 RT 2336 vcsQ2 F GATGAACTGGGTCGATACTGRT vcQ 2335 R GTCACTGCGTATTGGTCATC

vcsQ2-A33_1675 280 3 ToxR2PRMkd R XbaI GATTTCTAGAGATGACCAATACGCAGTGACToxR2B R SB CTTAACATCGTTGAACCCTTTCAC

Transcriptional reporter fusions (plasmid andsingle copy)

Upstream region of A33_1674 (vcsRTCNS2) 969 3 PM 2332 XbaI TTTTTCTAGATGCGCTGATTTCTTCATTTGC5 PM 2332 PstI GCTGCTGCAGGTGCGCCAGCAATATCACG

Upstream region of A33_1683 (vcsVUQ2) 390 3 PM 2341 XbaI CAACTCTAGATTTAACAACTCAGGGAATGG5 PM 2341 PstI AATCCTGCAGTGCGACGCATCTAATTCG

Continued on following page



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

cholerae (23). The E. coli lacZY genes and the transcriptional terminator se-quence rrnT1T2 were cloned into a derivative of pCVD442 that contains uniquemultiple cloning sites, including XbaI, SacI, FseI, PmeI, RsrII, PmeI, SphI, andSacI (M. Dziejman, unpublished construct). Approximately 775-bp DNA frag-ments representing the 5 and 3 flanking regions of V. cholerae lacZ sequenceswere amplified from AM-19226 and cloned into the SalI site immediately up-stream of the rrnBT1T2 sequence and the SphI and SmaI sites downstream of theE. coli lacZY genes. The resulting plasmid is pEH3, which has the followingrelevant features: a � protein-dependent origin of replication (oriR6K), a mul-tiple cloning site between the transcriptional terminator sequences and the E.coli lacZY reporter fusion to facilitate the cloning of putative promoter regions,5 and 3 regions of homology to the V. cholerae lacZ locus to facilitate allelicreplacement at the AM-19226 lacZ locus, and the bla and sacB genes for theselection of primary integrants and recombinants, respectively.

Single-copy lacZ transcriptional fusions to T3SS genes were then constructedby PCR amplification using the primers specified in Table 2, followed by ligationof the product into pEH3. The lacZY reporter constructs were integrated into thechromosome of AM-19226 strains MD992, AAC40 (�A33_1675), AAC228(�A33_1664), MD1069 (�A33_1675 �A33_1664), and AD10 (�toxR). Integra-tion of the promoterless E. coli lacZY reporter (pEH3) into the same strainbackgrounds served as the control in each case. Integration of the reporter

constructs at the V. cholerae lacZ locus was confirmed by PCR and Southern blotanalysis.

�-Galactosidase assay. Single colonies were inoculated into 5 ml of LB brothwith or without deoxycholate or bile and grown with aeration at 37°C for 16 to18 h to stationary phase. Logarithmic-phase cultures were grown in LB broth at37°C until an optical density at 600 nm (OD600) of 0.3 to 0.6 was reached aftera 1:500 dilution of an overnight culture. �-Galactosidase assays were performedfollowing the protocol described by Slauch and Silhavy (73). Briefly, bacterialcultures were centrifuged and pellets were resuspended in Z buffer at pH 7.0(with �-mercaptoethanol) and the OD600 was determined. One percent sodiumdodecyl sulfate and chloroform were added to the cell suspensions and mixedwell. The reaction was initiated by adding 10 �g/ml ONPG (o-nitrophenyl-�-D-galactopyranoside; Sigma), and the OD420 was read every 5 min for 60 min atroom temperature using a PowerWave XS spectrophotometer (Bio-Tek). Theresults are shown as �-galactosidase activity, calculated as (units per A600 unit �milliliters of cell suspension) � 103, where the units are micromoles ofo-nitrophenol formed per minute.

RNA isolation and reverse transcriptase PCR (RT-PCR). Strain AM-19226was grown overnight in LB broth with 0.04% deoxycholate. RNA was extractedusing Trizol (Invitrogen) following previously described methods (8, 43). TotalRNA was further purified using the RNeasy Mini kit (Qiagen). Contaminating

TABLE 2—Continued

Primer used and gene/ORF amplified Ampliconsize (bp) Primer name Sequence

Upstream region of A33_1689 (vspD) 460 3 VspD R XbaI AAATTCTAGATTCAAATTATGCGTGACGAACG5 VspD F PstI CACACTGCAGCTTGGTTCTCTGCGATATTCAC

Upstream region of A33_1693(vcsJ2) 527 3 VcsJ2 R XbaI CAATTCTAGAGGAGCATAAGGAGAGTAAGC5 VcsJ2 F PstIN CCGGCTGCAGAACCCGAGACAATCAGAGC

Upstream region of A33_1696 (vopF) 421 5 WH2 PM F XbaI TTGTTCTAGACAGCCCGACATTACTATGC3 WH2 PM R PstI AGAGCTGCAGGTTGTGCCGTGTCACTGG

Upstream region of A33_1675 (vttRB) 310 3 ToxR2PRMkd R XbaI GATTTCTAGAGATGACCAATACGCAGTGAC5 ToxR2PMRkd F PstI AAAACTGCAGGGTTGCCTAGTAAGTAGTTTC

Upstream region of A33_1664 (vttRA) 412 ToxR2A F XbaI GGGATCTAGACTGCTCCTTGCTTAACACTCToxR2A R PstI AATCCTGCAGAAAGGGTGAGTCAGATGAGAG

Deletion constructionsDeletion of toxR (VC0984 and A33_0921)

3 toxRdel TTAGCGGTCCGGATGTTTTGGTGCATGG5 toxRdel OL CTGGGACATTAGATGTTCATCAAAGTGTGTGA

GTAGG5 toxRdel TATATTAATTAACCATGCTTATGTTCACG

ATTG3 toxR OL CCTACTCACACACTTTGATGAACATCTAATGT

CCCAG

Deletion of vttRB (A33_1675)3 ToxR2Rkd SacI GACGGAGCTCTTACGATGAACTGGGTCGAT

ACTG5 ToxR2Fkd SalI AACCCGTCGACAGGCATTGGCAGGACTTAAT

AATTC3 SOEa toxR2del GTGAAAGGGTTCAACGATGTTAAGATCTGCG

CTGATTTCTTCATTTGC5 SOEToxR2Del GCAAATGAAGAAATCAGCGCAGATCTTAACA

TCGTTGAACCCTTTCAC

Deletion of vttRA (A33_1664)3 SOE N ToxR2A GAATTGATCTCAAAAATGTATAAACGTGAGC

ATATAATAAATGAAATC5 ToxR2.A SOE F GATTTCATTTATTATATGCTCACGTTTATACAT

TTTTGAGATCAATTC3 ToxR2.A del SacI TATACGAGCTCCTTTCTACAGAACGACTTGAG5 ToxR2.A Del SalI ACTAAGTCGACTTGGTGGCAGTATTTATGAG

a SOE, splicing by overlapping extension.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

DNA was eliminated by DNase I treatment according to the manufacturer’sspecifications (amplification grade; Invitrogen). The RT-PCR used 1 �g of RNAas the template and each primer (listed in Table 2) at 0.20 �M. Forty cycles wereperformed using SuperScript One-Step RT-PCR with Platinum Taq (Invitrogen)according to the manufacturer’s protocols.

Infant mouse competition assay. Competition assays using 4- to 5-day-oldCD-1 mice were performed as previously described (2, 30). Strains carryingin-frame deletions in the toxR (AD10), A33_1664/vttRA (AAC228), andA33_1675/vttRB (AAC40) genes were lacZ� and were competed against theisogenic parent strain that was �lacZ. The competitive index (CI) was calculatedbased on the input and output ratios of bacteria for each strain, where CI (mutant output/wild-type output)/(mutant input/wild-type input).

In silico analyses. Clone Manager Professional Suite v9 was used for basicsequence analyses and manipulations. Kyte-Doolittle plots (42) were generatedby Clone Manager. Transmembrane helix predictions were performed using theTMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/). Transcrip-tion terminator sequences were predicted by the RibEx online program (http://132.248.32.45:8080/cgi-bin/ribex.cgi). The Basic protein BLAST (NCBI) wasused to find protein similarities, and the ClustalW2 program (http://www.ebi.ac.uk/Tools/clustalw2/index.html) was used to perform multiple-sequence align-ments. The SCRATCH Protein Predictor (http://www.ics.uci.edu/�baldig/scratch/index.html) was used for secondary-structure predictions.

RESULTS

The AM-19226 T3SS island encodes two predicted tran-scriptional regulators with homology to ToxR. Partial genomicsequencing of strain AM-19226 originally identified geneswithin an �30-kb contig (contig 247) that were predicted toencode proteins comprising the structural apparatus of a T3SS(25). Annotation at that time also identified NTO1VC2333, anopen reading frame (ORF) within contig 247 that was pre-dicted to encode a protein, initially named ToxR2, with 55%sequence similarity to the transcriptional regulator ToxR (25).Subsequent sequencing efforts by the National Institute ofAllergy and Infectious Diseases (NIAID)-sponsored J. CraigVenter Institute Microbial Sequence Center expanded the sizeof the T3SS island to �55 kb and resulted in the identificationof a second ToxR homolog encoded within the T3SS island,locus tag A33_1664 (gene ID 6826006). In the NIAID anno-tation, ToxR2 was assigned locus tag A33_1675 (gene ID6825995). For consistency, the two ToxR-related, T3SS-en-coded ORFs will be referred to by the A33 locus tags asannotated in the NCBI database and shown in Fig. 1A. Likeother strains of V. cholerae, strain AM-19226 also encodes aToxR protein, locus tag A33_0921, that is 99% identical to thatencoded by the O1 El Tor N16961 strain (gene designationVC0984) and found in a similar chromosomal context (Fig.1A). This protein will be referred to as strain AM-19226 ToxR.

A33_1664 is predicted to encode a 249-aa product, whileA33_1675 is predicted to encode a protein of 183 residues. Fig-ure 1B shows the amino acid sequence alignment of the full-length AM-19226 and N16961 ToxR proteins with the AM-19226T3SS-encoded homologues. A33_1664 and A33_1675 show com-parable levels of amino acid sequence similarity to ToxR (59 and55%, respectively). Although sequence similarity is foundthroughout the length of the proteins, significant amino acididentity aligns mainly with the amino-terminal DNA bindingdomain of ToxR. Consistent with this finding, BLAST analysisof the A33_1664- and A33_1675-encoded proteins revealedputative conserved DNA binding domains (trans_reg_C) in theN-terminal regions of both proteins, indicating that the T3SS-encoded proteins share the conserved winged HTH DNAbinding motif present in ToxR (Fig. 1B). Secondary-structure

prediction analysis supports the conclusion that A33_1664 andA33_1675 encode HTH-containing transcriptional regulatoryproteins (data not shown). Interestingly, a BLAST search anal-ysis performed using the full-length A33_1664-encoded pro-tein as the query sequence also revealed considerable aminoacid similarity to the TcpP protein of V. cholerae O1 El Torstrain N16961 (54% similarity with E 2e�5), whereasA33_1675 did not. Both A33_1664- and A33_1675-encodedproteins have homologues in T3SS-positive V. parahaemolyti-cus strain RIMD2210633; the A33_1664-encoded protein is61% identical in amino acid content to VPA1332, and theA33_1675 gene product is 83% identical to VPA1348.

Kyte-Doolittle and TMHMM analyses predicted that, likeToxR, each AM-19226 T3SS-encoded ToxR-like protein has asingle transmembrane domain (Fig. 1C). Hydrophobicity plotsfor the ToxR proteins of strains N16961 and AM-19226 ToxR(52) are shown for reference. The topology of the A33_1664gene product is predicted to be similar to that of ToxR, con-sisting of an amino-terminal cytoplasmic domain of 129 resi-dues, a stretch of �23 hydrophobic residues that are predictedto span the inner membrane (aa 130 to 152), and a periplasmicdomain of �97 aa (aa 153 to 249, Fig. 1C and D). Similarly,A33_1675 is predicted to encode a protein with an �159-aacytoplasmic domain, followed by a 22-aa membrane-spanningsegment (aa 159 to 181). However, the hydrophobic residues ofA33_1675 lie at the C terminus of the protein and are pre-dicted to represent a membrane-spanning alpha helix (second-ary-structure prediction, data not shown) that anchors thecytoplasmic domain. Thus, only 2 aa of A33_1675 are pre-dicted to be localized in the periplasm. The alignment pre-sented in Fig. 1B indicates amino acid similarity in the C-terminal periplasmic region of ToxR to the region of theA33_1675-encoded protein that is predicted to reside in thecytoplasm. It is therefore also possible that the true transmem-brane domain of A33_1675 lies closer to the N terminus thanshown here.

To confirm the predicted topology of the ToxR homologs,we constructed alkaline phosphatase translational fusions tothe C-terminal final coding amino acid of the AM-19226 ToxR,A33_1664, and A33_1675 proteins, resulting in plasmidspKN1, pKN2, and pKN3 (47, 52). The parental plasmid, pKB1,which expresses the signal sequenceless phoA gene, was usedas a negative control. pKB1, pKN1, pKN2, and pKN3 wereeach singly introduced into V. cholerae strain AM-19226 byelectroporation, and the resulting strains were grown on LBagar plates containing the chromogenic substrate X-Phos.Strain AM-19226 carrying the parent plasmid pKB1 producedwhite colonies, whereas strains expressing the ToxR and ToxR-related fusion proteins produced dark blue colonies (data notshown). The results were confirmed by measuring the alkalinephosphatase activity in liquid cultures (data not shown; 11).Figure 1D therefore represents the results of PhoA fusionexperiments that confirm the predicted topology of the AM-19226 ToxR-like proteins.

The T3SS-encoded ToxR-like proteins and ToxR are re-quired for full colonization in the infant mouse model. Weused the suckling mouse model to determine whether theT3SS-associated putative transcriptional regulatory proteinsencoded by A33_1664 and A33_1675 are each required forAM-19226 to colonize the infant mouse intestine (30). Un-



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

FIG. 1. (A) The flanking genes for the ancestral toxR gene (hatched arrow) and the region of the T3SS pathogenicity island encoding thestructural components (dark-gray arrows) and the two putative transcriptional regulators (black and checkered arrows) are shown. White arrowsrepresent genes encoding hypothetical or conserved hypothetical proteins. The dotted arrow represents a gene present in our annotation but notannotated by the J. Craig Venter Institute. Genes encoding known proteins are shown in light gray. The seven small arrows above the genesindicate the locations of predicted promoter sequences. (B) Multiple-sequence alignment (ClustalW2 with default settings) of the ToxRN16961,ToxRAM-19226, A33_1664, and A33_1675 protein sequences. Amino acid residues that constitute the predicted transmembrane domains are in boldand underlined. The predicted secondary structures of the ToxR domains comprising the winged HTH motif are indicated above the N16961 ToxRsequence. Residues forming beta sheets are indicated by thin lines, those forming alpha helices are indicated by thick lines, and wing residues areindicated by the letter W. (C) Hydrophilicity plots of ToxR and the ToxR-related proteins using Kyte-Doolittle analysis. Hydrophilic residues havea negative score and hydrophobic residues have a positive score on the plot. The numbers at the bottom of each panel refer to amino acid positionswithin the four proteins. (D) Domain structure and membrane localization of ToxR paralogs based on TMHMM analysis, hydrophilicity plots, andphoA fusion analysis. OM, outer membrane; IM, inner membrane.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

marked in-frame deletions in A33_1664, A33_1675, and toxRthat retained 7, 13, and 20 aa, respectively, were constructedusing standard allelic-exchange methods, resulting in strainsAD10, AAC228, and AAC40. Each deletion strain was coin-oculated along with the isogenic parent strain, and organismswere recovered from the small intestine after 18 h of infection.The results were calculated as CIs and are shown in Fig. 2.Deletion of A33_1664 significantly reduced colonization by�100-fold, suggesting that its gene product is required for fullcolonization. Deletion of A33_1675 reduces colonization�1,000-fold compared to the wild-type strain, suggesting that itis essential for AM-19226 colonization. We therefore con-cluded that both proteins are required for the full virulence ofstrain AM-19226.

In strains that possess TCP and CT, deletion of ToxR resultsin a dramatic colonization defect (51). While strain AM-19226does not encode TCP or CT, an analogous situation exists inthat the pathogenicity of AM-19226 is due to functions asso-ciated with the laterally acquired T3SS pathogenicity island(75). Thus, it is conceivable that the AM-19226 ToxR proteinmight play a role in regulating the expression of the T3SSvirulence genes. We therefore tested whether a deletion in theAM-19226 toxR gene had an effect on the ability of the strainto colonize in the infant mouse model. The results indicate thatthe toxR deletion strain displayed a 10-fold colonization defectcompared to the isogenic parent, suggesting that even in theabsence of known downstream virulence factors such as TCP,CT, and the toxT gene, ToxR may still contribute to the fullvirulence of strain AM-19226 (Fig. 2).

Identification of T3SS gene regulatory sequences using mul-ticopy lacZ reporter fusions. We wanted to evaluate the ex-pression of genes encoding three different classes of T3SS

proteins: those that comprise the structural apparatus, putativeregulators of the T3SS, and effector proteins. We constructedpAAC3, which facilitates the insertion of putative promotersequences downstream of a transcriptional terminator and up-stream of the promoterless E. coli lacZY genes. pAAC3 wasused as the basis for all initial reporter fusion constructs. An-notation and sequence analysis of the T3SS island sequencesuggested that the 10 genes encoding the structural compo-nents of the apparatus are organized within four operons,based on the presence of intergenic regions indicated by thesmall arrows above genes in Fig. 1A. We postulated that theintergenic regions contained promoter sequences that con-trolled the expression of the structural genes. The VcsJ2 cod-ing sequence lies downstream from and overlaps the predictedhypothetical protein encoded by A33_1694; the two genes arelikely cotranscribed, and the proteins are likely to be transla-tionally coupled (Fig. 1A). vspD is predicted to be the first genein an operon. vcsVUQ2 lie downstream of ORF A33_1683,which is predicted to encode a hypothetical protein, with fourORFs interspersed between vcsU2 and vcsQ2 (Fig. 1A and D).vcsRTCNS2 are predicted to be cotranscribed downstream ofthe hypothetical protein encoded by A33_1674 (Fig. 1A andD). We therefore predicted that the expression of structuralgenes vcsRTCNS2, vcsVUQ2, and vcsJ2 is controlled by regu-latory sequences found in the intergenic regions upstream ofA33_1674, A33_1683, and A33_1694, respectively. Since vspDis the first gene of its predicted operon, sequences includingthe region immediately upstream of the coding region werechosen to construct a vspD-lacZ transcriptional reporter fu-sion. Sequences directly upstream of the putative ToxR-liketranscriptional regulators encoded by A33_1664 and A33_1675and upstream of the known effector protein VopF coding re-gion were also chosen for transcriptional reporter analysis.

Each plasmid expressing a lacZ transcriptional fusion wasintroduced into strain MD996 (AM-19226 R� M� �lacZ), andthe resulting reporter strains were evaluated for �-galactosi-dase activity after overnight growth in LB medium at 37°C(data not shown). We observed detectable levels of expressionfor most reporter fusions, suggesting that we had correctlytargeted putative regulatory sequences for the reporter con-structs. To determine whether the regulatory sequences couldmodulate reporter fusion expression in response to differentgrowth parameters, we grew the strains under several differentin vitro conditions, including temperature, minimal mediumwith different carbon sources, and LB broth supplemented with0.04% deoxycholate. Growth of strains in the presence of0.04% deoxycholate resulted in maximal reporter fusion ex-pression under the initial conditions tested (data not shown).The results suggested that the intergenic sequences included inthe constructs contained transcriptional regulatory regions thatwere active and responsive to environmental modulation.

Operon organization of T3SS structural genes. As statedearlier, sequence data suggested that the expression of thevcsVUQ2 and vcsRTCNS2 structural genes was likely con-trolled by sequences upstream of ORFs A33_1683 andA33_1674 (arrows above genes in Fig. 1A), resulting in poly-cistronic messages. To confirm that the putative regulatoryregions chosen for lacZ transcriptional reporter fusions wereresponsible for controlling the expression of all of the struc-tural genes within the predicted operons, we performed RT-

FIG. 2. ToxR homologs are essential for full colonization in theinfant mouse model. Competition assays with CD-1 infant mice wereperformed using a lacZ mutant derivative of strain AM19226 (MD996)and a strain with the following gene deleted: �A33_1664 (strainAAC228, diamonds), �A33_1675 (strain AAC40, triangles), or �toxR(strain AD10, circles). The results of a single experiment are shown,where each symbol represents the CI from a single animal (n 9, n 8, and n 8, respectively). The bars indicate the mean CI for eachexperiment. Experiments were repeated with similar results.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

PCR analysis using RNA isolated from cultures grown in thepresence of 0.04% deoxycholate as a template. Figures 3A andD show the predicted organization of the transcriptional unitswithin each operon.

An overlapping-amplicon strategy was employed to deter-mine whether the vcsVUQ2 genes are cotranscribed in a singleoperon. Primer pairs were designed to produce products (am-plicons) that overlapped the coding sequences of adjacentgenes; bars above the gene designations denote the regionsexpected to be amplified (primer sequences are listed in Table2). Lanes labeled “No RT” in Fig. 3B and E show a represen-

tative reaction using only Platinum Taq polymerase and RNAas the template to test for genomic DNA (gDNA) contamina-tion. Similar negative results were obtained for each primerpair (data not shown). We did not observe a product in theRT-PCR using primers designed to amplify sequences over-lapping the A33_1684 and A33_1683 coding regions, suggest-ing that the intergenic region may contain promoter sequencesthat control the expression of downstream genes (Fig. 3B, lane1). Products were generated using primers designed to produceproducts that overlap subsequent pairs of genes beginning withA33_1683 and vcsV2, continuing with vcsV2 and vcsU2, and

FIG. 3. The transcriptional organization of the two main operons encoding the VcsVUQ2 and VcsRTCNS2 structural components are depictedin panels A and D. Primer pairs were designed to amplify the regions shown by the bars above the genes. The open bars above the genes in panelsA and D indicate that RT-PCR did not produce an amplicon, whereas the solid bars indicate that an amplicon was obtained using RT-PCR. Thenumbers above the bars correspond to the gel lanes in panels B, C, E, and F, showing the results of RT-PCR analyses using RNA extracted fromcells grown in LB broth with 0.04% deoxycholate as the template (B and E) and PCR using the same primer pairs with gDNA as the template(C and F). Lanes marked “No RT” in panels B and E show representative PCRs conducted using RNA as the template, indicating that no productwas observed, consistent with a lack of gDNA contamination.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

then gene pairs downstream through vcsQ2. No RT-PCR prod-uct was found using the primer pair designed to amplify vcsQ2and A33_1675, suggesting that the vcsQ2 gene lies at the 3 endof the transcript (Fig. 3B, lane 8). In addition, in silico analysis(RibEx; http://132.248.32.45:8080/cgi-bin/ribex.cgi) of the in-tergenic region of the vcsQ2 and A33_1675 genes reveals apotential factor-independent transcriptional terminator (datanot shown; 1). Figure 3C lanes 1 to 8 show the results of areaction using the same primer pairs, Taq polymerase, andgDNA as a template. The results indicate that each primer paircan successfully bind a template to produce an amplicon of theexpected size. Together, these data suggest that vcsVUQ2 areindeed cotranscribed as part of a larger operon of eight genesfrom a promoter upstream of A33_1683.

We used a similar strategy to confirm that the expression ofthe vcsRTCNS2 genes is controlled by sequences upstream ofA33_1674, resulting in a polycistronic message that included atleast 10 genes. Primers that bind to sequences within A33_1675and A33_1674 did not produce an amplicon in the RT-PCR(Fig. 3E, lane 1), whereas those designed to bind withinA33_1674 and vcsR2 did (Fig. 3E, lane2). Primers designed toproduce overlapping products for each successive pair ofgenes, including vcsS2 as the most distal gene encoding astructural subunit, also resulted in detectable amplicons of theexpected sizes (lanes 3 to 9). Figure 3F shows the results ofreactions that used gDNA as a template and Taq polymeraseto produce amplicons of the expected size using the primerpairs described in Table 2 (as shown in Fig. 3C for vcsVUQ2).The combined results suggest that sequences upstream ofA33_1674 likely encode the promoter for the operon encodingthe VcsRTCNS2 structural proteins for the type three secre-tion apparatus.

Although previous AM-19226 annotation identified A33_1665 as an ORF beginning �250 bp downstream of vcsS2 andencoding a hypothetical protein, we suggest, based on subse-quent annotation and BLAST analysis, that the ORF begins�20 bp downstream of vcsS2 and encodes a 124-aa protein thathas �94% similarity to VPA1334, a T3SS2-encoded hypothet-ical protein of V. parahaemolyticus. An additional putativeORF on the complementary strand, which was not originallyidentified in the annotation of AM-19226, is shown as a whitearrow with a dotted outline in Fig. 3D. The predicted proteinproduct has �79% amino acid similarity to VPA1333, a pre-dicted protein encoded by V. parahaemolyticus T3SS2. Notably,RT-PCR results suggest that gene A33_1665 is cotranscribedwith the vcsRTCNS2 genes (Fig. 3E, lane 10) and that tran-scription extends at least �140 downstream of the 3 end ofA33_1665 (Fig. 3E, lane 11).

Chromosomal integration of lacZ reporter fusions. The re-sults of RT-PCR analysis further suggested that the intergenicsequences chosen for multicopy lacZ reporter fusion studieswere sufficient to promote the expression of all of the genesencoding the structural apparatus. To more accurately assessthe effect of in vitro growth conditions in modulating T3SSgene expression and to determine the role of ToxR and theputative regulatory proteins encoded by A33_1675 andA33_1664, seven lacZ transcriptional reporter fusions wereeach integrated in single copy into the lacZ locus in strainMD992. The reporter fusions included (i) genes encoding thestructural components, as described for the multicopy vectors

(vcsRTCNS2-lacZ, vcsVUQ2-lacZ, vspD-lacZ, and vcsJ2-lacZ),(ii) genes encoding the toxR-like putative transcriptional reg-ulators A33_1675 and A33_1664, and (iii) the gene encodingVopF, a known effector protein. The small arrows above genesin Fig. 1A denote putative promoter locations, and the size ofeach region chosen for analysis is indicated in Table 2. Theseven strains carrying the reporter fusions and the isogenicparent strain carrying a promoterless reporter fusion weregrown in LB medium to logarithmic and stationary phases andthen assayed for �-galactosidase expression. The results areshown in Fig. 4. In exponentially growing cells (dark gray bars),detectable levels of expression over background (3- to 4-foldover promoterless lacZ) were observed for strains carrying allreporter fusions except vcsRTCNS2-lacZ and vopF-lacZ. Ex-pression from the vcsRTCNS2-lacZ fusion was approximatelyequal to that observed from the promoterless construct,whereas vopF-lacZ expression was undetectable. Both thevspD-lacZ and A33_1664-lacZ fusions showed dramaticallyhigher levels of activity compared to the other reporter fusions(Fig. 4, note that the two graphs have different y axis scales).When cells were grown to stationary phase (Fig. 4, white bars),moderate increases in expression levels compared to thatachieved during exponential growth (generally, 2- to 3-fold)

FIG. 4. The growth phase influences the expression of lacZ tran-scriptional fusions to T3SS genes. �-Galactosidase activity levels weremeasured in strains containing single-copy transcriptional lacZ fusionsto the structural genes vcsRTCNS2, vspD, vcsJ2, and vcsVUQ2, thevopF gene (encoding an effector protein), and the putative transcrip-tional regulators A33_1675 and A33_1664. The promoterless lacZfusion was integrated as a control for the basal level of reporter geneexpression. Strains were grown in LB medium at 37°C to exponentialphase (dark gray bars) or to stationary phase (white bars). The datashown represent the results of one experiment. Experiments wereperformed twice using three individual colonies each time and pro-duced similar results. Note that the two graphs have different y-axisscales.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

were observed for all reporter fusions except vopF-lacZ. Theseresults supported the conclusion that active promoter regionsfor the structural and putative regulatory genes were targetedfor analysis and suggested that growth phase might influenceT3SS gene expression.

Bile and deoxycholate promote the expression of T3SSstructural genes. Crude bile and purified bile acids (Na-deoxy-cholate and cholate) represent relevant in vivo signals that V.cholerae encounters during infection of the small intestine.Interestingly, bile and deoxycholate have been shown to elicitopposing effects on the expression of TCP and CT in epidemic-causing V. cholerae strains (32, 37). Because strains expressingmulticopy reporter fusions to the T3SS structural gene vectorsdisplayed increased levels of activity when grown in the pres-ence of deoxycholate (data not shown), we proceeded to de-termine the effects of both bile and deoxycholate on T3SS geneexpression when the reporter fusions were integrated in singlecopy into the chromosome.

Since bile acids have an antibacterial effect, we first exam-ined the effect of deoxycholate and bile on the growth ofparent strain AM-19226 and isogenic strains with toxR,A33_1675, and A33_1664 deleted. Strains were grown over-night in LB medium or LB medium supplemented with 0.04%Na-deoxycholate or 0.4% bile. After 16 to 18 h of growth in LBmedium in the presence of bile or deoxycholate, the final ODof cells was typically within a 2- to 3-fold range when theA33_1675 and A33_1664 deletion strains were compared tothe wild-type strain, and all of the strains appeared to reach astationary phase of growth with similar growth kinetics (datanot shown). The concentrations of bile and deoxycholate usedand the data obtained were consistent with those reported byother investigators (37, 63).

When strains carrying the vcsRTCN2-lacZ, vspD-lacZ, vcsJ2-lacZ, vcsVUQ2-lacZ, and A33_1675-lacZ reporter fusions weregrown in the presence of deoxycholate, expression increased�12- to 45-fold over background levels compared to the ex-pression levels obtained during growth in LB medium alone(Fig. 5, compare medium gray bars to white bars). TheA33_1664-lacZ reporter fusion showed a more moderate in-crease (�4-fold), and the expression of vopF-lacZ was unde-tectable over background levels in deoxycholate. Growth in thepresence of 0.4% bile resulted in an additional 2- to 3-foldincrease in the expression of the structural gene reporters(�25- to 115-fold higher compared with expression in LB me-dium). Similarly, A33_1675-lacZ expression was increased ap-proximately 3.5-fold over levels achieved during growth in de-oxycholate, whereas the A33_1664-lacZ reporter fusionshowed similar levels of expression in deoxycholate and bile.Although the vopF-lacZ reporter fusion did not show any ac-tivity in the presence of deoxycholate, it did exhibit a very lowlevel of activity when the strain was grown in the presence ofbile (16.6 � 7.5 U versus 0 U for the promoterless negativecontrol). Similar trends were observed in multiple experi-ments. However, it is not clear at this time whether such lowlevels of vopF expression accurately represent bile inducedexpression above background levels. In general, we found thatincreased expression of the T3SS-lacZ transcriptional fusionscorrelated with growth in LB broth containing increasing con-centrations of Na-deoxycholate (0.01 to 0.04%) and bile (0.1 to0.4%) (data not shown). The data therefore suggest that, com-

pared to growth in LB broth alone, growth in the presence ofeither deoxycholate or bile enhanced the expression of T3SSgenes encoding the structural apparatus and the genes encod-ing the putative ToxR-like transcriptional regulators.

A33_1664 (vttRA) and A33_1675 (vttRB) gene products reg-ulate T3SS gene expression in the presence of bile. Havingdetermined in vitro conditions that increased expression of theT3SS structural and putative regulatory genes, we next deter-mined the role of ToxR and the T3SS-encoded ToxR-likeproteins in regulating T3SS island gene expression. The lacZtranscriptional fusions were integrated into the lacZ locus offour AM-19226-derived strains containing in-frame deletionsof A33_1675 alone, A33_1664 alone, A33_1675 and A33_1664,and toxR. Figure 6A shows the results of �-galactosidase assaysconducted with strains grown in LB broth alone. Reporterfusion activity was measured, and background levels (promot-erless constructs) were subtracted. Results were comparedamong strains with a deletion of ToxR and the ToxR-likeproteins by calculating the percent activity relative to thatachieved in the isogenic parent strain (carrying the wild-typeallele). For each fusion, the activity in the isogenic strain car-rying wild-type alleles of A33_1664, A33_1675, and toxR wasassigned a value of 100%. We did not observe any difference inreporter fusion expression levels when fusions were expressedin the different deletion backgrounds (Fig. 6A).

FIG. 5. Deoxycholate and bile increase the expression of T3SSpromoter-lacZ transcriptional fusions. �-Galactosidase activity levelswere measured in strains containing single-copy chromosomal tran-scriptional lacZ fusions to the indicated promoter regions. Strains weregrown at 37°C overnight in LB medium alone (white bars), LB brothcontaining 0.04% Na-deoxycholate (dark gray bars), or LB broth con-taining 0.4% bile (light gray bars). The data shown represent theresults of a single experiment using three individual colonies of eachstrain. The experiment was repeated twice with similar results. Notethat the two graphs have different y-axis scales.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

We then proceeded to assay the reporter fusions in differentstrain backgrounds with growth in the presence of 0.4% bile.Figure 6B shows the results of �-galactosidase assays calcu-lated as described for Fig. 6A. Again, for all of the strains, thelevel of background activity from the promoterless reporterconstruct was subtracted and the level of expression from thewild-type allele strain was assigned a value of 100%. In the�A33_1664 strain background, vcsRTCNS2-lacZ, vspD-lacZ,vcsJ2-lacZ, and vcsVUQ2-lacZ expression levels decreased toless than 20% of that seen in the isogenic parent strain (Fig. 6,checkered bars). A similar decrease in activity for structuralgene fusions was observed in the �A33-1675 strain background(Fig. 6, black bars). Although expression levels of the vspD2reporter fusion in bile were typically very high (Fig. 4), levelswere dramatically reduced in the �A33_1664 and �A33_1675deletion strains. Expression of the structural gene reporterfusions was not further decreased when expression was assayedin the double-deletion background (Fig. 6, vertical lined bars).The results suggest that both T3SS-encoded transcriptionalregulatory proteins contribute to T3SS structural gene expres-sion in the presence of 0.4% bile.

Individual deletions of A33_1664 and A33_1675 also af-

fected the level of expression of reporter fusions to their ownputative promoter regions. Deletion of A33_1675 resulted inan �2-fold increase in A33_1675-lacZ reporter fusion activitycompared to the level observed in the wild-type strain (whencells were grown in the presence of bile). The increase inexpression was reproducible over the course of several exper-iments and appeared statistically significant (P 0.0004, Stu-dent’s paired t test with a two-tailed distribution), suggestingthat the A33_1675-encoded protein might negatively regulateits own expression under these conditions. Deletion ofA33_1664 resulted in an �2-fold increase in its own reporterfusion expression and an �2-fold decrease in the expression ofthe A33_1675 reporter fusion over the course of multiple ex-periments. Expression levels were also consistently lower forthe A33_1675 reporter fusion when assayed in the �A33_1675�A33_1664 double-deletion background (Fig. 6B, verticallystriped bars), suggesting that A33_1664 may positively contrib-ute to A33_1675 expression levels.

Collectively, the data presented in Fig. 5 and 6 indicatethat bile and deoxycholate promote the expression of thestructural components of the T3SS apparatus. The expres-sion of additional genes contained within the T3SS island,

FIG. 6. T3SS pathogenicity island-encoded transcriptional regulators VttRA (encoded by A33_1664) and VttRB (encoded by A33_1675)regulate T3SS structural gene expression when strains are grown in LB broth containing 0.4% bile but not when they are grown in LB broth alone.Single-copy transcriptional lacZ fusions in five different genetic backgrounds were assayed after overnight growth at 37°C in LB medium alone(A) or containing 0.4% bile (B). The �-galactosidase activity for each fusion was measured in each of the following five backgrounds: wild type(light gray bars), �A33_1664 (checkered bars), �A33_1675 (black bars), �A33_1664 �A33_1675 (striped bars), and �toxR (hatched bars). The datapresented represent the results of three experiments using at least three individual colonies of each strain. All values are background subtracted(using strains expressing the promoterless construct), and the activity for each fusion in the isogenic parent strain was assigned a value of 100%.The percent activity for each reporter fusion in each deletion strain was calculated relative to the expression obtained with the isogenic parentstrain, and the standard deviation was calculated based on at least three experiments.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

such as A33_1664 and A33_1675, are also positively regu-lated by growth in deoxycholate and bile. Because A33_1664and A33_1675 (previously annotated as toxR2-B) are eachrequired for colonization in the infant mouse model (Fig. 2)and for maximal expression of the structural genes duringgrowth in bile (Fig. 6B), we propose to rename A33_1664 asVibrio type three regulator A (vttRA) and A33_1675 asVibrio type three regulator B (vttRB).

Effect of ToxR on T3SS structural gene expression. Since thestrain with a deletion of the toxR gene showed a 10-fold defectin colonization (Fig. 2), we assayed the reporter fusions in the�toxR background to determine if the colonization defectmight be mediated by T3SS gene expression (Fig. 6B, hatchedbars). Compared to other detection backgrounds, deletion oftoxR did not dramatically alter the expression level of anyof the reporter fusions to structural genes, although a trend of2-fold decreased expression (�50% of wild-type expression)was observed. In the �toxR strain background, we observed an�2-fold increase in the expression of the reporter fusion toA33_1664 (vttRA) compared to the expression level observedin the wild-type background and a �2-fold decrease for thevttRB-lacZ deletion (60% of the activity observed in the iso-genic parent strain, Fig. 6B). In both cases, the standard devi-ation from multiple experiments suggests that this trend mustbe further evaluated before arriving at any conclusion as to therole of ToxR in vttRA and vttRB expression.

DISCUSSION

In many organisms, the T3SS genes are typically found clus-tered within a large pathogenicity island. The linear organiza-tion and operon structures differ among bacteria, but certainsimilarities, as well as phylogenetic analysis based on proteinhomologies and gene positions, suggest that the systems can begrouped into clades (17). Although the V. cholerae T3SS re-sides on an �55-kb pathogenicity island, the gene organizationdoes not resemble that found in any of the established clades.Instead, the V. cholerae T3SS appears mosaic in nature andmost closely resembles T3SS2 of V. parahaemolyticus isolates(16, 25, 46). In V. cholerae strain AM-19226, the highly con-served protein structural subunits are encoded within fouroperons, with the structural genes interspersed with ORFs thatare predicted to encode hypothetical proteins and, based onour analysis, are likely coexpressed along with the structuralgenes. The mosaic nature of the Vibrio T3SS suggests that thissystem may have been derived from multiple T3SS systems,resulting in a unique island whose function likely provides anadvantage specific to Vibrio spp. for host infection, survival inthe environmental reservoir, or perhaps both. AdditionalT3SS-containing Vibrio genomes have been sequenced, and itis becoming clear that diversity exists among the differentgenes carried by the T3SSs, even within strains of the samespecies (16, 55). Nonetheless, the operon organization of thestructural genes appears to be conserved among differentVibrio strains and is consistent with our data demonstrating thecoordinated regulation of the structural genes by VttRA andVttRB in response to growth in medium containing bile anddeoxycholate (discussed below).

The ToxR protein has long served as the foundation forunderstanding V. cholerae virulence gene regulation. Data

from numerous laboratories have shown that the expression ofthe horizontally acquired virulence factors for colonization(TCP) and toxin production (CT) is mediated by a complexcircuitry involving not only the transmembrane ToxR proteinbut multiple membrane-associated and cytoplasmic transcrip-tional regulators. Some genes encoding products that are partof the ToxR regulon are horizontally acquired along with thevirulence factors (e.g., toxT), whereas others, such as toxR, areconsidered “ancestral” or core genes that are found in allstrains. The V. cholerae non-O1/non-O139 T3SS is encoded ona horizontally acquired pathogenicity island that carries twogenes encoding proteins with significant amino acid similarityto the ToxR protein. These observations prompted our inves-tigation of whether T3SS gene expression might be regulatedby the ancestral ToxR and/or the T3SS-encoded ToxR-relatedproteins.

The results of colonization studies using the infant mousemodel demonstrated that the T3SS-encoded VttRA andVttRB transcriptional regulators are essential for full viru-lence. This is consistent with the finding that T3SS islandsequences encode dedicated transcriptional regulators inother bacteria (36). For example, the Y. enterocolitica T3SSgene cluster encodes VirF, which belongs to the AraC familyof transcriptional regulators and controls yop expression(17). Similarly, ExsA, an AraC-like transcriptional activator,is located in the Pseudomonas aeruginosa T3SS gene cluster.ExsA activates the transcription of genes encoding the se-creted effector proteins and the T3SS structural apparatus(79). Both AraC-like transcriptional regulators and two-component regulatory systems are commonly responsiblefor regulating the expression of T3SS genes (29). In thatregard, it is important to note that the V. cholerae T3SSencodes regulatory proteins most similar to the ToxR familyof transmembrane transcriptional regulators. Since relatedproteins are encoded by V. parahaemolyticus T3SS2, wespeculate that the activity of ToxR-related proteins influ-ences T3SS gene expression in this bacterium as well.

In other organisms, global regulatory proteins (e.g., HIS, Fis,and quorum-sensing components) also contribute to T3SSgene regulation. The increase in reporter fusion expressionobserved for strains grown to stationary phase in LB brothcompared to logarithmic phase was not due to ToxR, VttRA,or VttRB, suggesting that growth phase-dependent regulationmay function in controlling T3SS expression in V. cholerae(data not shown). The effect could be mediated either throughthe requirement for alternative sigma factors such as RpoS/�S

(40) or for density-dependent signals such as the LuxO-HapR/LuxR quorum-sensing system, as seen in V. harveyi (33) and P.aeruginosa. Alternatively, other factors might be necessary toensure a basal level of expression or to relieve the repression ofT3SS gene expression in the absence of inducing conditions.For example, H-NS is involved in the repression of T3SS genesin Yersinia, Shigella, enterpathogenic E. coli and enterohemor-rhagic E. coli (29). It is therefore reasonable to speculate thatadditional contributors to V. cholerae T3SS regulation mayhave characteristics similar to those of factors found in otherorganisms. We favor this hypothesis in light of the recentreport by Shakhnovich et al. that identified Hfq as an impor-tant factor regulating T3SS virulence gene expression in patho-genic E. coli and demonstrated that V. cholerae AM-19226



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

vopF transcription was detected in a �Hfq background but notin the wild-type strain (72). Further studies are needed toidentify additional regulatory candidates that control VibrioT3SS expression, either in concert with or independently ofVttRA and VttRB.

Deletion of the AM-19226 ancestral toxR gene produceda colonization defect in the infant mouse model, although itwas not as severe as that resulting from the deletion ofVttRA or VttRB (10-fold versus 100- to 1,000-fold). Theresults of transcriptional fusion studies suggest that ToxR isrequired for the maximal expression of structural genes un-der that condition, although it does not affect gene expres-sion to the same extent as VttRA and VttRB (discussedbelow). It is well established that ToxR regulates the ex-pression of porin genes and components of metabolic path-ways, and it is therefore plausible that the regulation ofnon-T3SS genes by ToxR is important for AM-19226 fitnessin the mouse intestine (8, 18, 45, 62). Alternatively, ToxRmay regulate T3SS-related genes that are important for fullvirulence but are as yet unidentified (e.g., effector proteins,chaperones, or additional regulatory factors).

We used lacZ transcriptional fusion analyses to identify an invitro condition that stimulated T3SS gene expression so that wecould then assess whether the ToxR, VttRA, and VttRB pro-teins contributed to virulence by modulating the expression ofT3SS genes. Although host cell contact typically serves as an invivo signal to induce T3SS gene expression, it is presumed thatother in vivo signals (e.g., temperature, divalent cation concen-tration, pH) can modulate T3SS gene expression (29). Formany enteric pathogens, bile and deoxycholate are importanthost intraintestinal signaling molecules that serve to regulatethe expression of virulence factors during infection. For exam-ple, bile can repress SPI1 T3SS-mediated invasion of Salmo-nella spp., and in V. parahaemolyticus, bile acids enhance theproduction of the thermostable direct hemolysin, which is anessential virulence factor (56, 59–61). Regulation can also oc-cur at the protein level, and bile salts have been shown to actas environmental signals for the stable recruitment of IpaBonto the Shigella needle tip complex (74). Because previousstudies reported that bile and the bile acid deoxycholate reg-ulate virulence gene expression in epidemic V. cholerae strains(32, 37, 62, 63, 71), we chose similar growth conditions to testthe induction and regulation of T3SS genes. We found thatdeoxycholate stimulated the expression of T3SS structural andregulatory genes, consistent with the reports of deoxycholatestimulating virulence gene expression in epidemic O1 andO139 strains. In V. cholerae O1 serogroup classical-biotypestrains O395 and 569B, bile has been shown to dramaticallyreduce the expression of the ctxAB and tcpA genes (32). Therepression by crude bile was shown to be mediated by H-NSand is independent of the ToxR regulon (13). However, Hunget al. showed that the purified bile acid deoxycholate or cholateinduced CT and TCP expression through ToxR (37). In con-trast, our studies show that, like deoxycholate, bile promotesthe expression of T3SS structural genes and the genes encod-ing the VttRA and VttRB regulatory proteins. As shown in Fig.6B, maximal bile-dependent expression of the structural genesrequired VttRA, VttRB, and ToxR. Preliminary studies sug-gested that deoxycholate-induced expression was dependent onVttRA and VttRB as well (data not shown). It is not clear why, in

contrast to regulation in epidemic strains, both crude bile andpurified bile acids can act as stimulatory signals for virulence geneexpression in AM-19226. Perhaps it is not surprising given thatthe T3SS encodes an inherently different mechanism of patho-genesis compared to TCP/CT-mediated colonization and disease.The in vivo signals perceived temporally during infection and atspecific locations within the intestine may also play a role (71).Clearly, the roles of VttRA and VttRB in coordinating gene ex-pression in response to environmental stimuli and the identifica-tion of additional proteins that have a role in the T3SS regulatorynetwork require additional investigation; it seems likely that fur-ther studies will identify both conserved features and mechanisticdifferences used by diverse V. cholerae strains to control virulencegene expression.

We were surprised to find comparatively high levels of ex-pression of the vspD-lacZ and vttRA-lacZ (A33_1664) reporterfusions. High levels of vspD expression might be related to therole of VspD as the protein that comprises the multisubunittranslocator component of the T3SS. The elevated level ofexpression of the vttRA-lacZ fusion is more difficult to explain,since transcriptional regulators are typically expressed at rela-tively low levels and the vttRA deletion strain was less impairedfor colonization than the vttRB deletion strain. Since multiplesignals are typically sensed by bacteria in the host, it is possiblethat a combination of stimuli result in a more moderate levelof expression in vivo. For both the vspD-lacZ and vttRA-lacZconstructs, it is formally possible that the intergenic regionschosen for transcriptional fusion analysis lack sequences thatbind repressor proteins when in the native chromosomal con-text. It is interesting to speculate that increased vttRA expres-sion in the ToxR deletion strain is consistent with a role forToxR as a repressor of T3SS gene expression in specific cases,but any firm conclusions necessitate further investigation. Fu-ture studies that more precisely define the promoter regionsand identify additional regulators should help to clarify thispoint.

Our studies did not identify conditions that promoted vopFexpression to levels comparable to those observed for otherreporter fusions, although VopF is clearly expressed and trans-located in vitro when AM-19226 is cocultured with HEp-2 cells(75). vopF expression might respond to in vitro signals thatdiffer from those to which the structural or regulatory proteingenes respond, or perhaps vopF expression and translocationare tightly linked with host cell contact. Alternatively, lowlevels of vopF expression might be sufficient to produce thelevels of protein necessary for pathogenesis. The results ofShakhnovich et al. (mentioned above) suggest that vopF ex-pression is, at least in part, negatively regulated by Hfq (72).The identification of additional effector proteins, the analysisof their expression patterns, and studies conducted with strainshaving deletions of multiple regulators are expected to provideinsights into the mechanisms contributing to effector proteinexpression.

Our data indicate that VttRA and VttRB are both necessaryfor maximal structural gene expression in the presence of bile.One possible explanation is that VttRA and VttRB must inter-act with each other to bind target sequences and promotetranscription. Interaction could occur either as heterodimersor as homodimeric complexes that function cooperatively toregulate T3SS gene expression. Alternatively, the two proteins



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

may not interact with each other and might instead bind dif-ferent regions of promoter sequences. Another possibility in-volves a transcriptional regulatory hierarchy whereby VttRA

and VttRB exhibit an epistatic interaction with each other orwith another transcriptional regulator that might affect T3SSgene expression. For example, a situation analogous to theinteraction of ToxR and TcpP may exist, where the resultingprotein interactions result in the activation of toxT expressionin TCP/CT-positive strains. The C-terminal periplasmic do-mains of VttRA and ToxR share less sequence similarity thanthe N-terminal regions that contain the HTH DNA bindingdomains, perhaps indicating that the VttRA periplasmic do-main differs functionally or structurally from its ToxR coun-terpart. In this context, it is interesting to again note thatVttRB has no or a very small periplasmic domain and appearsunusual in that respect among ToxR-like proteins.

That bile is perceived as a signaling molecule for the expres-sion of virulence factors is complicated in light of its antimi-crobial nature. Bile has been shown to modulate the expressionof the V. cholerae outer membrane porins OmpU and OmpT ina ToxR-dependent manner (9, 62). Recent microarray analysisindicates that bile regulates the expression of more than 100genes, and three RND efflux systems are reported to contrib-ute to bile resistance in V. cholerae (9, 10, 12). Cerda-Maira etal. have reported that the BreAB (VexCD) RND efflux pumpis upregulated specifically by bile and its expression is regu-lated by the BreR protein, a bile-responsive autoregulatorytranscriptional repressor (12). The authors also proposed thatBreR requires bile acids as inducer molecules to dissociatefrom the breAB or breR promoter under conditions of “highbile” similar to the 0.4% bile concentration used in our andothers’ experiments. BreR represses its own transcription inthe presence of “low bile,” and deoxycholate alone was re-ported to provide the most robust induction of a bre-lacZreporter fusion. Strain AM-19226 does contain a gene pre-dicted to encode BreR, although we do not know its effect onvirulence gene expression. The AM-19226 protein responsiblefor bile sensing is unknown, and although it is tempting tospeculate that the periplasmic domain of VttRA may have arole in this function, it is prudent to note that previous studiesof ToxR suggest that the ToxR periplasmic domain functionsin protein-protein interactions rather than environmental sens-ing and signaling (24, 41, 48).

We do not know whether the T3SS has a role in the aquaticexistence of V. cholerae or whether its role is restricted tovirulence in the human host. It is formally possible that T3SSactivity could influence the relationship of V. cholerae withchitinaceous organisms in the marine environment. In thisregard, determining whether the VttRA and VttRB proteinsregulate the transcription of genes that lie outside the T3SSisland will expand our understanding of whether T3SS-en-coded regulator activity is restricted to the T3SS pathogenicityisland or whether they can impact global gene expression toaffect other parameters of the V. cholerae lifestyle.

ACKNOWLEDGMENTS

We thank Scott Butler and Marty Pavelka for critically reading themanuscript, the members of the Dziejman lab for helpful discussions,and Adam Derr, Peter Hong, Edward Katich, and Katelin Noble forgeneration of preliminary data and assistance with plasmid and strain

constructions. We are especially grateful to John Mekalanos for shar-ing resources and for supportive discussions.

This work was supported by grant AI073785 from NIH/NIAIDto M.D.

ADDENDUM IN PROOF

Kodama et al. (T. Kodama, K. Gotoh, H. Hiyoshi, M.Morita, K. Izutsu, Y. Akeda, K. S. Park, V. V. Cantarelli, R.Dryselius, T. Iida, and T. Honda, PLoS One 5:e8678, 2010)have recently demonstrated that the Vibrio parahaemolyticushomologues of VttRA and VttRB regulate genes within thetype III secretion system (T3SS2) (the V. parahaemolyticuspathogenicity island region) and are essential for T3SS2-me-diated cytotoxicity in vitro and enterotoxicity in vivo.

REFERENCES

1. Abreu-Goodger, C., and E. Merino. 2005. RibEx: a web server for locatingriboswitches and other conserved bacterial regulatory elements. NucleicAcids Res. 33:W690–W692.

2. Alam, A., R. C. Larocque, J. B. Harris, C. Vanderspurt, E. T. Ryan, F. Qadri,and S. B. Calderwood. 2005. Hyperinfectivity of human-passaged Vibriocholerae can be modeled by growth in the infant mouse. Infect. Immun.73:6674–6679.

3. Anderson, A. M., J. B. Varkey, C. A. Petti, R. A. Liddle, R. Frothingham, andC. W. Woods. 2004. Non-O1 Vibrio cholerae septicemia: case report, discus-sion of literature, and relevance to bioterrorism. Diagn. Microbiol. Infect.Dis. 49:295–297.

4. Bag, P. K., P. Bhowmik, T. K. Hajra, T. Ramamurthy, P. Sarkar, M. Ma-jumder, G. Chowdhury, and S. C. Das. 2008. Putative virulence traits andpathogenicity of Vibrio cholerae non-O1, non-O139 isolates from surfacewaters in Kolkata, India. Appl. Environ. Microbiol. 74:5635–5644.

5. Bagchi, K., P. Echeverria, J. D. Arthur, O. Sethabutr, O. Serichantalergs,and C. W. Hoge. 1993. Epidemic of diarrhea caused by Vibrio choleraenon-O1 that produced heat-stable toxin among Khmers in a camp in Thai-land. J. Clin. Microbiol. 31:1315–1317.

6. Begum, K., C. R. Ahsan, M. Ansaruzzaman, D. K. Dutta, Q. S. Ahmad, andK. A. Talukder. 2006. Toxin(s), other than cholera toxin, produced by envi-ronmental non O1 non O139 Vibrio cholerae. Cell. Mol. Immunol. 3:115–121.

7. Bhattacharya, M. K., D. Dutta, S. K. Bhattacharya, A. Deb, A. K. Mukho-padhyay, G. B. Nair, T. Shimada, Y. Takeda, A. Chowdhury, and D. Ma-halanabis. 1998. Association of a disease approximating cholera caused byVibrio cholerae of serogroups other than O1 and O139. Epidemiol. Infect.120:1–5.

8. Bina, J., J. Zhu, M. Dziejman, S. Faruque, S. Calderwood, and J. Mekala-nos. 2003. ToxR regulon of Vibrio cholerae and its expression in vibrios shedby cholera patients. Proc. Natl. Acad. Sci. U. S. A. 100:2801–2806.

9. Bina, J. E., D. Provenzano, C. Wang, X. R. Bina, and J. J. Mekalanos. 2006.Characterization of the Vibrio cholerae vexAB and vexCD efflux systems.Arch. Microbiol. 186:171–181.

10. Bina, X. R., D. Provenzano, N. Nguyen, and J. E. Bina. 2008. Vibrio choleraeRND family efflux systems are required for antimicrobial resistance, optimalvirulence factor production, and colonization of the infant mouse smallintestine. Infect. Immun. 76:3595–3605.

11. Brickman, E., and J. Beckwith. 1975. Analysis of the regulation of Esche-richia coli alkaline phosphatase synthesis using deletions and 80 transduc-ing phages. J. Mol. Biol. 96:307–316.

12. Cerda-Maira, F. A., C. S. Ringelberg, and R. K. Taylor. 2008. The bileresponse repressor BreR regulates expression of the Vibrio cholerae breABefflux system operon. J. Bacteriol. 190:7441–7452.

13. Chatterjee, A., P. K. Dutta, and R. Chowdhury. 2007. Effect of fatty acids andcholesterol present in bile on expression of virulence factors and motility ofVibrio cholerae. Infect. Immun. 75:1946–1953.

14. Chatterjee, S. N., and K. Chaudhuri. 2003. Lipopolysaccharides of Vibriocholerae. I. Physical and chemical characterization. Biochim. Biophys. Acta1639:65–79.

15. Chatterjee, S. N., and K. Chaudhuri. 2004. Lipopolysaccharides of Vibriocholerae II. Genetics of biosynthesis. Biochim. Biophys. Acta 1690:93–109.

16. Chen, Y., J. A. Johnson, G. D. Pusch, J. G. Morris, Jr., and O. C. Stine. 2007.The genome of non-O1 Vibrio cholerae NRT36S demonstrates the presenceof pathogenic mechanisms that are distinct from those of O1 Vibrio. cholerae.Infect. Immun. 75:2645–2647.

17. Cornelis, G. R., and F. Van Gijsegem. 2000. Assembly and function of typeIII secretory systems. Annu. Rev. Microbiol. 54:735–774.

18. Crawford, J. A., J. B. Kaper, and V. J. DiRita. 1998. Analysis of ToxR-dependent transcription activation of ompU, the gene encoding a majorenvelope protein in Vibrio cholerae. Mol. Microbiol. 29:235–246.

19. Dalsgaard, A., M. J. Albert, D. N. Taylor, T. Shimada, R. Meza, O. Serichan-



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

talergs, and P. Echeverria. 1995. Characterization of Vibrio cholerae non-O1serogroups obtained from an outbreak of diarrhea in Lima, Peru. J. Clin.Microbiol. 33:2715–2722.

20. Dalsgaard, A., A. Forslund, L. Bodhidatta, O. Serichantalergs, C.Pitarangsi, L. Pang, T. Shimada, and P. Echeverria. 1999. A high proportionof Vibrio cholerae strains isolated from children with diarrhoea in Bangkok,Thailand are multiple antibiotic resistant and belong to heterogenous non-O1, non-O139 O-serotypes. Epidemiol. Infect. 122:217–226.

21. Dalsgaard, A., O. Serichantalergs, A. Forslund, W. Lin, J. Mekalanos, E.Mintz, T. Shimada, and J. G. Wells. 2001. Clinical and environmental iso-lates of Vibrio cholerae serogroup O141 carry the CTX phage and the genesencoding the toxin-coregulated pili. J. Clin. Microbiol. 39:4086–4092.

22. DiRita, V. J., C. Parsot, G. Jander, and J. J. Mekalanos. 1991. Regulatorycascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. U. S. A.88:5403–5407.

23. Donnenberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletionmutant of enteropathogenic Escherichia coli by using a positive-selectionsuicide vector. Infect. Immun. 59:4310–4317.

24. Dziejman, M., H. Kolmar, H.-J. Fritz, and J. J. Mekalnaos. 1999. ToxRoligomeric interactions are not modulated by environmental conditions orperiplasmic domain conformation. Mol. Microbiol. 31:305–317.

25. Dziejman, M., D. Serruto, V. C. Tam, D. Sturtevant, P. Diraphat, S. M.Faruque, M. H. Rahman, J. F. Heidelberg, J. Decker, L. Li, K. T. Montgom-ery, G. Grills, R. Kucherlapati, and J. J. Mekalanos. 2005. Genomic char-acterization of non-O1, non-O139 Vibrio cholerae reveals genes for a type IIIsecretion system. Proc. Natl. Acad. Sci. U. S. A. 102:3465–3470.

26. Faruque, S. M., M. J. Albert, and J. J. Mekalanos. 1998. Epidemiology,genetics, and ecology of toxigenic Vibrio cholerae. Microbiol. Mol. Biol. Rev.62:1301–1314.

27. Faruque, S. M., N. Chowdhury, M. Kamruzzaman, M. Dziejman, M. H.Rahman, D. A. Sack, G. B. Nair, and J. J. Mekalanos. 2004. Genetic diversityand virulence potential of environmental Vibrio cholerae population in acholera-endemic area. Proc. Natl. Acad. Sci. U. S. A. 101:2123–2128.

28. Faruque, S. M., and J. J. Mekalanos. 2003. Pathogenicity islands and phagesin Vibrio cholerae evolution. Trends Microbiol. 11:505–510.

29. Francis, M. S., H. Wolf-Watz, and A. Forsberg. 2002. Regulation of type IIIsecretion systems. Curr. Opin. Microbiol. 5:166–172.

30. Gardel, C. L., and J. J. Mekalanos. 1994. Modus operandi of Vibrio cholerae:swim to arrive stop to kill. The relationship among chemotaxis, motility andvirulence. J. Cell. Biochem. 18A:65.

31. Gunn, J. S. 2000. Mechanisms of bacterial resistance and response to bile.Microbes Infect. 2:907–913.

32. Gupta, S., and R. Chowdhury. 1997. Bile affects production of virulencefactors and motility of Vibrio cholerae. Infect. Immun. 65:1131–1134.

33. Henke, J. M., and B. L. Bassler. 2004. Quorum sensing regulates type IIIsecretion in Vibrio harveyi and Vibrio parahaemolyticus. J. Bacteriol. 186:3794–3805.

34. Honda, T., M. Arita, T. Takeda, M. Yoh, and T. Miwatani. 1985. Non-O1Vibrio cholerae produces two newly identified toxins related to Vibrio para-haemolyticus haemolysin and Escherichia coli heat-stable enterotoxin. Lancet2(8447):163–164.

35. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989.Engineering hybrid genes without the use of restriction enzymes: gene splic-ing by overlap extension. Gene 77:61–68.

36. Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogensof animals and plants. Microbiol. Mol. Biol. Rev. 62:379–433.

37. Hung, D. T., and J. J. Mekalanos. 2005. Bile acids induce cholera toxinexpression in Vibrio cholerae in a ToxT-independent manner. Proc. Natl.Acad. Sci. U. S. A. 102:3028–3033.

38. Ichinose, Y., K. Yamamoto, N. Nakasone, M. J. Tanabe, T. Takeda, T.Miwatani, and M. Iwanaga. 1987. Enterotoxicity of El Tor-like hemolysin ofnon-01 Vibrio cholerae. Infect. Immun. 55:1090–1093.

39. Johnson, J., P. Panigrahi, and J. G. Morris. 1992. Non-O1 Vibrio choleraeNRT36S produces a polysaccharide capsule that determines colony mor-phology, serum resistance, and virulence in mice. Infect. Immun. 60:864–869.

40. Kazmierczak, M. J., M. Wiedmann, and K. J. Boor. 2005. Alternative sigmafactors and their roles in bacterial virulence. Microbiol. Mol. Biol. Rev.69:527–543.

41. Krukonis, E. S., and V. J. DiRita. 2003. From motility to virulence: sensingand responding to environmental signals in Vibrio cholerae. Curr. Opin.Microbiol. 6:186–190.

42. Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying thehydropathic character of a protein. J. Mol. Biol. 157:105–132.

43. Larocque, R. C., J. B. Harris, M. Dziejman, X. Li, A. I. Khan, A. S. Faruque,S. M. Faruque, G. B. Nair, E. T. Ryan, F. Qadri, J. J. Mekalanos, and S. B.Calderwood. 2005. Transcriptional profiling of Vibrio cholerae recovereddirectly from patient specimens during early and late stages of human infec-tion. Infect. Immun. 73:4488–4493.

44. Lee, S. H., D. L. Hava, M. K. Waldor, and A. Camilli. 1999. Regulation andtemporal expression patterns of Vibrio cholerae virulence genes during in-fection. Cell 99:625–634.

45. Li, C. C., J. A. Crawford, V. J. DiRita, and J. B. Kaper. 2000. Molecular

cloning and transcriptional regulation of ompT, a ToxR-repressed gene inVibrio cholerae. Mol. Microbiol. 35:189–203.

46. Makino, K., K. Oshima, K. Kurokawa, K. Yokoyama, T. Uda, K. Tagomori,Y. Iijima, M. Najima, M. Nakano, A. Yamashita, Y. Kubota, S. Kimura, T.Yasunaga, T. Honda, H. Shinagawa, M. Hattori, and T. Iida. 2003. Genomesequence of Vibrio parahaemolyticus: a pathogenic mechanism distinct fromthat of V. cholerae. Lancet 361:743–749.

47. Manoil, C., and J. Beckwith. 1986. A genetic approach to analyzing mem-brane protein topology. Science 233:1403–1407.

48. Matson, J. S., J. H. Withey, and V. J. Dirita. 2007. Regulatory networkscontrolling Vibrio cholerae virulence gene expression. Infect. Immun. 75:5542–5549.

49. Mekalanos, J. J. 1992. Environmental signals controlling expression of vir-ulence determinants in bacteria. J. Bacteriol. 174:1–7.

50. Miller, V. L., and J. J. Mekalanos. 1984. Synthesis of cholera toxin is posi-tively regulated at the transcriptional level by toxR. Proc. Natl. Acad. Sci.U. S. A. 81:3471–3475.

51. Miller, V. L., and J. J. Mekalanos. 1985. Genetic analysis of the choleratoxin-positive regulatory gene toxR. J. Bacteriol. 163:580–585.

52. Miller, V. L., R. K. Taylor, and J. J. Mekalanos. 1987. Cholera toxin tran-scriptional activator ToxR is a transmembrane DNA binding protein. Cell48:271–279.

53. Morris, J. G. 1990. Non-O group 1 Vibrio cholerae: a look at the epidemi-ology of an occasional pathogen. Epidemiol. Rev. 12:179–191.

54. Mukhopadhyay, A. K., S. Garg, R. Mitra, A. Basu, K. Rajendran, D. Dutta,S. K. Bhattacharya, T. Shimada, T. Takeda, Y. Takeda, and G. B. Nair. 1996.Temporal shifts in traits of Vibrio cholerae strains isolated from hospitalizedpatients in Calcutta: a 3-year (1993 to 1995) analysis. J. Clin. Microbiol.34:2537–2543.

55. Okada, N., T. Iida, K.-S. Park, N. Goto, T. Yasunaga, H. Hiyoshi, S. Mat-suda, T. Kodama, and T. Honda. 2009. Identification and characterization ofa novel type III secretion system in trh-positive Vibrio parahaemolyticus strainTH3996 reveal genetic lineage and diversity of pathogenic machinery beyondthe species level. Infect. Immun. 77:904–913.

56. Osawa, R., E. Arakawa, T. Okitsu, S. Yamai, and H. Watanabe. 2002. Levelsof thermostable direct hemolysin produced by Vibrio parahaemolyticusO3:K6 and other serovars grown anaerobically with the presence of a bileacid. Curr. Microbiol. 44:302–305.

57. Ottemann, K. M., V. J. DiRita, and J. J. Mekalanos. 1992. ToxR proteinswith substitutions in residues conserved with OmpR fail to activate tran-scription from the cholera toxin promoter. J. Bacteriol. 174:6807–6814.

58. Peterson, K. M. 2002. Expression of Vibrio cholerae virulence genes in re-sponse to environmental signals. Curr. Issues Intest. Microbiol. 3:29–38.

59. Pope, L. M., K. E. Reed, and S. M. Payne. 1995. Increased protein secretionand adherence to HeLa cells by Shigella spp. following growth in the pres-ence of bile salts. Infect. Immun. 63:3642–3648.

60. Prouty, A. M., I. E. Brodsky, J. Manos, R. Belas, S. Falkow, and J. S. Gunn.2004. Transcriptional regulation of Salmonella enterica serovar Typhimuriumgenes by bile. FEMS Immunol. Med. Microbiol. 41:177–185.

61. Prouty, A. M., and J. S. Gunn. 2000. Salmonella enterica serovar Typhi-murium invasion is repressed in the presence of bile. Infect. Immun. 68:6763–6769.

62. Provenzano, D., and K. K. Klose. 2000. Altered expression of the ToxR-regulated porins OmpU and OmpT diminishes Vibrio cholerae bile resis-tance, virulence factor expression and intestinal colonization. Proc. Natl.Acad. Sci. U. S. A. 97:10220–10224.

63. Provenzano, D., D. A. Schuhmacher, J. Barker, and K. K. Klose. 2000. Thevirulence regulatory protein ToxR mediates enhanced bile resistance inVibrio cholerae and other pathogenic Vibrio species. Infect. Immun. 68:1491–1497.

64. Rahman, M. H., K. Biswas, M. A. Hossain, R. B. Sack, J. J. Mekalanos,and S. M. Faruque. 2008. Distribution of genes for virulence and eco-logical fitness among diverse Vibrio cholerae population in a choleraendemic area: tracking the evolution of pathogenic strains. DNA CellBiol. 27:347–355.

65. Reidl, J., and K. E. Klose. 2002. Vibrio cholerae and cholera: out of the waterand into the host. FEMS. Microbiol. Rev. 26:125–139.

66. Rivera, I. N., J. Chun, A. Huq, R. B. Sack, and R. R. Colwell. 2001. Geno-types associated with virulence in environmental isolates of Vibrio cholerae.Appl. Environ. Microbiol. 67:2421–2429.

67. Rudra, S., R. Mahajan, M. Mathur, K. Kathuria, and V. Talwar. 1996.Cluster of cases of clinical cholera due to Vibrio cholerae 010 in east Delhi.Indian J. Med. Res. 103:71–73.

68. Sack, D. A., R. B. Sack, G. B. Nair, and A. K. Siddique. 2004. Cholera.Lancet 363:223–233.

69. Saka, H. A., C. Bidinost, C. Sola, P. Carranza, C. Collino, S. Ortiz, J. R.Echenique, and J. L. Bocco. 2008. Vibrio cholerae cytolysin is essential forhigh enterotoxicity and apoptosis induction produced by a cholera toxingene-negative V. cholerae non-O1, non-O139 strain. Microb. Pathog. 44:118–128.

70. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

laboratory manual, second ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

71. Schuhmacher, D. A., and K. E. Klose. 1999. Environmental signals modulateToxT-dependent virulence factor expression in Vibrio cholerae. J. Bacteriol.181:1508–1514.

72. Shakhnovich, E. A., B. M. Davis, and M. K. Waldor. 2009. Hfq negativelyregulates type III secretion in EHEC and several other pathogens. Mol.Microbiol. 74:347–363.

73. Slauch, J. M., and T. J. Silhavy. 1991. cis-acting ompF mutations that resultin OmpR-dependent constitutive expression. J. Bacteriol. 173:4039–4048.

74. Stensrud, K. F., P. R. Adam, C. D. La Mar, A. J. Olive, G. H. Lushington, R.Sudharsan, N. L. Shelton, R. S. Givens, W. L. Picking, and W. D. Picking.2008. Deoxycholate interacts with IpaD of Shigella flexneri in inducing therecruitment of IpaB to the type III secretion apparatus needle tip. J. Biol.Chem. 283:18646–18654.

75. Tam, V. C., D. Serruto, M. Dziejman, W. Brieher, and J. J. Mekalanos. 2007.A type III secretion system in Vibrio cholerae translocates a formin/spirehybrid-like actin nucleator to promote intestinal colonization. Cell HostMicrobe 1:95–107.

76. Tampakaki, A. P., V. E. Fadouloglou, A. D. Gazi, N. J. Panopoulos, and M.Kokkinidis. 2004. Conserved features of type III secretion. Cell. Microbiol.6:805–816.

77. Wachsmuth, I. K., Ø. Olsvik, G. M. Evins, and T. Popovic. 1994. Molecularepidemiology of cholera, p. 357–370. In I. K. Wachsmuth, P. A. Blake, andØ. Olsvik (ed.), Vibrio cholerae and cholera: molecular to global perspectives.American Society for Microbiology, Washington, D.C.

78. Reference deleted.79. Yahr, T. L., and M. C. Wolfgang. 2006. Transcriptional regulation of the

Pseudomonas aeruginosa type III secretion system. Mol. Microbiol. 62:631–640.

Editor: A. Camilli



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

vttra and vttrb encode toxr family proteins that mediate ... · which is necessary for both the...

Documents