volume 29, n umber 1, 2013 - american red cross · immunohematology is published quarterly (march,...

Vo lu m e 29, Nu m b e r 1, 2013

42 Inst ruct I o ns fo r Au t h o rs

38 Adv ert Isem en ts

ImmunohematologyVolume 29, Number 1, 2013

C O N T E N T S

19 re v I e w

An update on the GLOB blood group system and collectionÅ. Hellberg, J.S. Westman, and M.L. Olsson

25 re v I e w

P1PK: the blood group system that changed its name and expandedÅ. Hellberg, J.S. Westman, B. Thuresson, and M.L. Olsson

34 co m m u n I cAt I o n

Letter to the Readers—new blood group allele report

1 cAse rep o rt

An AQP1 allele associated with Co(a–b–) phenotypeS. Vege, S. Nance, D. Kavitsky, X. Li, T. Horn, G. Meny, and C.M. Westhoff

5 rep o rt

Warm autoantibodies: time for a changeJ.R. Nobles and C. Wong

11 cAse rep o rt

Major non-ABO incompatibility caused by anti-Jka in a patient before allogeneic hematopoietic stem cell transplantationM.Y. Kim, P. Chaudhary, I.A. Shulman, and V. Pullarkat

15 cAse rep o rt

A case of autoimmune hemolytic anemia with anti-D specificity in a 1-year-old childR.S. Bercovitz, M. Macy, and D.R. Ambruso

35 An n ou n cem en ts

Immunohematology is published quarterly (March, June, September, and December) by the American Red Cross, National Headquarters, Washington, DC 20006.

Immunohematology is indexed and included in Index Medicus and MEDLINE on the MEDLARS system. The contents are also cited in the EBASE/Excerpta Medica and Elsevier

BIOBASE/Current Awareness in Biological Sciences (CABS) databases.

The subscription price is $50 for individual, $100 for institution (U.S.) and $60 for individual, $100 for institution (foreign) per year.

Subscriptions, Change of Address, and Extra Copies:

Immunohematology, P.O. Box 40325 Philadelphia, PA 19106

Or call (215) 451-4902

Web site: www.redcross.org/about-us/publications/immunohematology

Copyright 2013 by The American National Red Cross ISSN 0894-203X

ed I to r- I n-ch I ef

Sandra Nance, MS, MT(ASCP)SBBPhiladelphia, Pennsylvania

mA n Ag I n g ed I to r

Cynthia Flickinger, MT(ASCP)SBBPhiladelphia, Pennsylvania

sen I o r med I cA l ed I to r

Ralph R. Vassallo, MDPhiladelphia, Pennsylvania

tec h n I cA l ed I to rs

Christine Lomas-Francis, MScNew York City, New York

Dawn M. Rumsey, ART(CSMLT)Norcross, Georgia

sen I o r med I cA l ed I to r

Ralph Vassallo, MDPhiladelphia, Pennsylvania

As s o c I At e med I cA l ed I to rs

David Moolten, MDPhiladelphia, Pennsylvania

Joy Fridey, MDPomona, California

mo lec u l A r ed I to r

Margaret A. KellerPhiladelphia, Pennsylvania

ed I to r I A l As s IstA n t

Sheetal Patel

pro d u ct I o n As s IstA n t

Marge Manigly

co p y ed I to r

Mary L. Tod

pro o f r e A d er

Lucy Oppenheim

elect ro n I c pu b l Is h er

Paul Duquette

ed I to r I A l boA r d

Patricia Arndt, MT(ASCP)SBBPomona, California

James P. AuBuchon, MDSeattle, Washington

Lilian Castilho, PhDCampinas, Brazil

Martha R. Combs, MT(ASCP)SBBDurham, North Carolina

Geoffrey Daniels, PhDBristol, United Kingdom

Anne F. Eder, MDWashington, District of Columbia

George Garratty, PhD, FRCPathPomona, California

Brenda J. Grossman, MDSt. Louis, Missouri

Christine Lomas-Francis, MScNew York City, New York

Geralyn M. Meny, MDSan Antonio, Texas

Paul M. Ness, MDBaltimore, Maryland

Thierry Peyrard, PharmD, PhDParis, France

Joyce Poole, FIBMSBristol, United Kingdom

Mark Popovsky, MDBraintree, Massachusetts

S. Gerald Sandler, MDWashington, District of Columbia

Jill R. Storry, PhD Lund, Sweden

David F. Stroncek, MDBethesda, Maryland

Nicole ThorntonBristol, United Kingdom

em er I t us ed I to rs

Delores Mallory, MT(ASCP) SBBSupply, North Carolina

Marion E. Reid, PhD, FIBMSNew York City, New York

on ou r cov er

Grainstacks at the End of Summer, Evening Effect was one of 25 canvases of wheat or haystacks Claude Monet painted between 1890 and 1891, which explored the effect of variations in point of view, time of day, season, and weather on their common theme. These works were as a group commercially successful and popular with both critics and the public. They marked a turning point in Monet’s career not only in this regard, but also for his having painted them in the fields surrounding a house he purchased that year in Giverny. They represent the beginning of a more grounded life there and what would become a frequent serial approach to his subjects. The painting on the cover follows the impressionist strategy of focusing on archetypal shape and color rather than detail, here the warm shades with which Monet imbues the estivating ricks. In this issue Nobles and Wong report on a modified, more time-efficient method of warm autoantibody adsorption.

David Moolten, MD

IMMUNOHEMATOLOGY, Volume 29, Number 1, 2013 1

An AQP1 allele associated with Co(a–b–) phenotypeS. Vege, S. Nance, D. Kavitsky, X. Li, T. Horn, G. Meny, and C.M. Westhoff

The Colton (CO) blood group system consists of four antigens, Coa, Cob, Co3, and Co4, located on aquaporin-1 (AQP1), with Coa highly prevalent in all populations (99.8%). The Colton null phenotype, Co(a–b–), is very rare, and individuals with this phenotype lack the high-prevalence antigen Co3. To date, only six Co(a–b–) probands have been reported and four silencing alleles characterized. We identified an AQP1-null allele in a white woman with anti-Co3 caused by deletion of a G at nucleotide 601 (nt601delG) that results in a frameshift and premature termination (Val201Stop). Available family members were tested for the allele. Although anti-Co3 has been associated with mild to severe hemolytic disease of the fetus and newborn, the antibody was not clinically significant as evidenced by a low titer and delivery of asymptomatic newborns with moderate to weakly positive direct antiglobulin tests for all four pregnancies. Immunohematology 2013;29:1–4.

Key Words: Colton blood group, Co(a–b–), AQP1 Conull, anti-Co3

The Colton (CO) blood group system consists of four antigens, Coa, Cob, Co3, and Co4, located on aquaporin-1 (AQP1). The prevalence of Coa is high in all populations (99.8%). The antithetical antigen, Cob, is found in approximately 10 percent of Europeans and 5 percent of Hispanics and less frequently in Japanese.1–3 Co3 is the high-prevalence antigen absent in Co(a–b–) individuals. The Conull phenotype, Co(a−b−), Co:–3, is extremely rare. Co4 is a high-prevalence antigen that was reported in two samples that were initially thought to be phenotype Co(a−b−) with a possible anti-Co3. Further expression studies and reevaluation of antibody specificity indicated this antibody is associated with a new antigen, Co4.4,5

The AQP1 protein is a member of a large family of water transport channels expressed on the erythrocyte membrane. Individuals with the Co(a−b−) phenotype also lack AQP1 protein in other tissues. Although no severe clinical effects are associated with the null phenotype,6 it has been shown that such individuals, when in water-deprived conditions, have a limited ability to concentrate urine and have decreased pulmonary vascular permeability.7

The AQP1 gene, consisting of four exons, is located on the short arm of chromosome 7 (7q14). The gene encodes a protein of 268 amino acids with a 28-kDa relative molecular mass. The

Coa and Cob antigens correspond to a nucleotide (nt) 134C>T change, encoding an amino acid change at position 45 from alanine to valine.8 Only six probands with the rare Co(a−b−) phenotype have been reported, and five silencing alleles have been characterized: (1) deletion of most of exon 1 (CO*N.01),9 (2) insertion of T at nt 307 that results in a frameshift in the protein at Gly104 (CO*N.02),9 (3) an nt 576C>A change encoding Asn192Lys (CO*01N.03),10 (4) deletion of G at nt 232 causing a frameshift at amino acid 78 and a premature stop codon at position 119 (CO*01N.04),11 and (5) an nt 112C>T change encoding Pro38Ser (CO*01N.05).12 A homozygous 113C>T change (Pro38Leu) (CO*M.01) was found in an individual whose red blood cells (RBCs) typed Co(a–b–) with weak AQP1 expression (<1% of control) detected in RBC membrane immunoblots.9 Importantly, Conull individuals have been reported to make clinically significant anti-Co3, causing mild to severe hemolytic disease of the fetus and newborn (HDFN).11,13 Transfusion of patients with anti-Co3 is difficult because of the rarity of the type. Autologous donation and testing of family members are strongly recommended. The American Rare Donor Program has one Co:–3 donor. The World Health Organization International Panel has two donors listed in Canada and nine units frozen in France (number of donors not known).

Here, we identify a Colton null allele in a woman whose RBCs type as Co(a−b−) with anti-Co3 in her serum. We report results of testing family members and describe the clinical management of her pregnancies.

Case Report

Anti-Co3 was identified in a 33-year-old gravida 2 para 1 white woman of European descent. Her RBCs typed Co(a−b−) Co:–3. She had one pregnancy 14 years before and no history of blood transfusions. Her first pregnancy was unremarkable. During the course of the second pregnancy, the anti-Co3 was identified and she donated two autologous directed units for her or her baby’s potential need. These units were divided into two aliquots each and frozen. Only two aliquots per unit could be made because of her low hemoglobin levels at the time of

Case RepoRt

2 IMMUNOHEMATOLOGY, Volume 29, Number 1, 2013

S. Vege et al.

the donations. A baby girl (child 2) was delivered by cesarean delivery at 34 weeks’ gestation. The baby’s direct antiglobulin test (DAT) was 1+. Neither the baby nor the mother required transfusion. Nearly 2 years later, she delivered another baby (child 3). This baby’s DAT was weakly positive. Two years after the third child, she delivered a fourth child (child 4), whose RBCs showed a microscopically weakly positive DAT. The third and fourth pregnancies were managed with the same protocol for autologous unit collection; neither required transfusion.

Materials and Methods

EDTA-anticoagulated whole blood samples were obtained from the proband, her husband, child 2, and child 3. A buccal swab sample was obtained from child 4.

Serologic testing was performed on the husband’s sample; no DNA was isolated for molecular analysis.

SerologyAntibody identification and RBC typing were performed

using standard methods. Determination of antibody titers was performed with 6 percent albumin as a diluent on the proband’s serum at 4, 5, 6, 7, and 8 months’ gestation, before delivery, and 16 months after delivery of child 2. Samples were obtained during the third pregnancy at 4, 6, and 8 months’ estimated gestational age (EGA) and at the time of autologous donation in the fourth pregnancy.

Polymerase Chain Reaction Amplification and DNA Sequence Analysis

DNA was isolated with QIAamp Blood Mini Kit (QIAamp Blood Mini Kit, QIAGEN, Hilden, Germany). CO (AQP1) was amplified with previously published primers.5 Amplified polymerase chain reaction (PCR) products were purified (PCR Purification kit, Qiagen, Inc., Valencia, CA) and sequenced by the Children’s Hospital of Philadelphia Sequencing Facility.

Primers used for PCR amplification and DNA sequence analysis are listed in Table 1. For some samples, PCR products were cloned (TOPO TA-cloning kit, Invitrogen, Carlsbad, CA), and plasmids were sequenced using vector primers. Sequences were aligned to reference sequence (GenBank accession #NM_198098) with ClustalX software (ClustalX, Science Foundation Ireland and University College Dublin, Dublin, Ireland).14

Western Blot AnalysisRBC membranes were prepared by centrifugation of whole

blood for 10 minutes and removal of plasma and the buffy coat. Packed RBCs were washed with phosphate-buffered saline (PBS) and lysed in 5 mM Tris HCl/0.1 mM EDTA, pH 7.5, on ice for 15 minutes. Cell membranes were washed four times with 5 mM Tris HCl/0.1 mM EDTA and one time with PBS by centrifugation at 35,000 g. Protein concentration was determined using Pierce BCA Protein Assay Kit, Thermo Scientific, Rockford, IL). RBC membrane protein (100 μg) was separated on 13.5 percent nonreducing sodium dodecylsulfate (SDS) polyacrylamide gel electrophoresis, transferred to nitrocellulose membrane, and incubated first with anti-Co3 and then with horseradish peroxidase–conjugated goat anti-human IgG. Anti-Co3 was a gift from Peter Agre. The blot was visualized by chemiluminescence (ECL, Invitrogen).

Results

RBC Antigen Typing and Antibody TitrationsThe proband’s RBCs typed as group A, D+, C+, E−, c+,

e+; M+N−S–s+; P1+; Le(a−b+); K+ k+; Fy(a+b+); Jk(a−b+) and Co(a−b−) Co:–3. Family studies revealed that RBCs from her husband, two sisters, and mother all typed as Co(a+b−). Samples from the children were not made available for RBC typing. At prenatal presentation during the second pregnancy, the anti-Co3 was detected. This antibody reacted 1+ in the antiglobulin phase with albumin and ficin methods with anti-

IgG (Immucor, Norcross, GA), hereafter referred to as -IgG. The serum titer was 1 (score 9).15 At 5, 6, and 7 months’ EGA, the antibody was not detected (titer 0). At 8 months the titer was 2 (score 18), and at delivery, the titer showed a moderate increase to 4 (score 21). After delivery the titer decreased to 2 (score 11; Table 2).

Table 1. Primer sequences used for amplification and sequencing of CO (AQP1)

Primer name Sequence (5′–3′) Region Nucleotide position Exon Publication

CoP1 catccctaacatggcatgcagtg Promoter −611 to −589 1 Joshi et al., 200111

CoP2 aactgctggccaagcttattcc Intron 1 +291 to +270 1 Joshi et al., 200111

CoP3 gggctggagtttcattaacacag Intron 1 −215 to −193 2 to 4 Joshi et al., 200111

CoP4 cttcacctcctccacaacttcaag 3′ UTR 261 to 237 2 to 4 Joshi et al., 200111

CoIn2F gagcacagggacctcctg Intron 2 −169 to −152 Sequencing This study

CoIn3F cttaccatgggacaccaaagctt Intron 3 +29 to +51 Sequencing This study

UTR = untranslated region.


Novel AQP1 allele associated with Co(a–b–)

Two years later, when two autologous units were donated (see Case Report), the anti-Co3 was 2+ in antiglobulin tests with albumin (Immucor)-IgG and PEG (Sigma, St. Louis, MO) -IgG methods on the first donation and 1+ in albumin-IgG and 2+ in ficin (Sigma)-IgG.

At 4 months’ EGA in the third pregnancy, the anti-Co3 was 3+ in albumin-IgG and 2+ in ficin-IgG. The titer was 16 (score 44). At 6 months’ EGA, the antibody was 2+ in albumin-IgG with a titer of 8 (score 33). At delivery at 8 months’ EGA the albumin-IgG reactivity was 2+s and 3+ in ficin-IgG; a titration was not performed. A sample from child 3 showed a weakly positive (microscopic only) DAT with polyspecific antiglobulin sera (Immucor) only; anti-IgG and anti-C3 (Immucor) tests were negative.

At delivery of child 4, the proband’s sample showed the anti-Co3 to react 1+ by the albumin-IgG method and 1+s in ficin-IgG. A subsequent sample obtained and evaluated more than a year later when she donated an autologous unit was 2+ in albumin-IgG; titers were not performed in either the delivery sample from the fourth pregnancy or the autologous unit.

No additional antibodies were detected in any of the samples tested over the years, and none of the babies required treatment for HDFN.

Molecular AnalysisDNA sequence analysis of CO (AQP1) from the proband

revealed she was homozygous for a G nucleotide deletion at position 601 in exon 3 (nt601delG). This deletion is predicted to cause a premature stop (Val201Stop) in the protein and silencing of the antigen (Fig. 1). This deletion was on the CO*A allele, as evidenced by homozygosity for nt 134C/C in exon

1. Sequence analysis of the proband’s mother and one sister indicated both had two CO*A alleles, one with nt601delG. A second sister had only wild-type sequences and was homozygous for the conventional CO*A. Exon 3 products from children 2 and 3 of the proband were cloned, and plasmids representing the nt 601G and 601 deleted G were identified, indicating the two children were heterozygous for nt601delG (Fig. 2). Sequencing of the CO (AQP1) coding exons and flanking sequences found no additional changes, and all exon acceptor and donor splice sites were wild type.

To confirm loss of expression of AQP1 protein and a null phenotype, RBC membranes from the proband were immunoblotted with a Co3 antibody. A 25-kDa band, representing the AQP1 protein, was detected in the positive control but was not present in RBCs from the proband (Fig. 3).

Table 2. Anti-Co3 reactivity and titers, as available

Pregnancy SamplesAHG phase reactivity Titer Score

2nd 4 months’ gestation 1+ 1 9

5 months’ gestation 0 0 0



8 months’ gestation 1+ 2 18

At delivery 1+ 4 21

16 months after delivery 1+ 2 11

3rd 4 months’ gestation 3+ 16 44

6 months’ gestation 2+ 8 33

8 months’ gestation (delivery) 2+s NT NT

4th At delivery 1+ NT NT

12 months after delivery 2+ NT NT

AHG = anti-human globulin; NT = not tested.

Fig. 2 Inheritance of the CO*1N.06 (nt601delG) allele in the proband family. The proband is indicated with an arrow. The CO*1N.06 allele is designated in gray ( ) and CO*1 allele in white ( ). Family members that were not tested (NT) are indicated with diagonal lines ( ).

Co(a+b–)

NT

NT

NT

CO*01N.06/CO*01Co(a+b–)

CO*01N.06/CO*01N.06Co(a–b–), Co:–3

CO*01N.06/CO*01Co(a+b–)

CO*01N.06/CO*01Co(a+b–)

CO*01N.06/CO*01Co(a+b–)

CO*01/CO*01Co(a+b–)

Proband

NT

Fig. 1 DNA sequence electropherogram of AQP1 exon 3. (A) Proband (AQP1 null). (B) Consensus (conventional AQP1). The proband was homozygous for a G nucleotide deletion at position 601, which is predicted to cause a premature stop (Val201Stop) in the protein.

A B


S. Vege et al.

Discussion

An AQP1 null allele with a deletion of G at nt 601 (601delG) in exon 3 was identified in the proband, whose RBCs typed as Co(a−b−), Co:–3. The deletion is on a CO*A allele and causes a premature stop at position 201 (Val201Stop). Absence of the AQP1 protein in the RBCs from the proband was confirmed by Western blot. Molecular analysis of family members showed Mendelian inheritance, with the null allele present in the proband’s mother, one sibling, and two children.

The Co(a−b−) phenotype is extremely rare, and individuals with this phenotype can make anti-Co3, which has been associated with HDFN. In this report, the maternal titer was assessed throughout multiple pregnancies and did not exceed 16 during gestation. Child 2 had a positive DAT (1+) with anti-IgG and did not require treatment. Child 3 had a very weak DAT (microscopically positive) reactive with anti-IgG, with no treatment reported. Although autologous units were collected from the proband, no units were transfused. The antibody in this proband was not clinically significant as evidenced by a titer less than 32 and asymptomatic children. Because Co(a−b−) units are rare and anti-Co3 has been reported to cause complications in pregnancy, and no compatible family members were found, autologous units were recommended; however, none of the babies required treatment for HDFN.

While this paper was under review, the same allele was found in a Gypsy family; this AQP1 null CO*A(601delG) allele16 is provisionally designated CO*01N.06 and joins five other silencing null alleles that have been characterized for AQP1 to date.

References

1. Daniels G. Human blood groups. 1st ed. Oxford: Blackwell Science Ltd, 1995:507–13.

2. Reid ME, Lomas-Francis C. The blood group antigen factsbook. San Diego: Academic Press, 1997:268–74.

3. Halverson GR, Peyrard T. A review of the Colton blood group system. Immunohematology 2010;26:22–6.

4. Wagner FF, Flegel WA. A clinically relevant Co(a)-like allele encoded by AQP1 (Q47R) (abstract). Transfusion 2002;42(Suppl):24–5S.

5. Arnaud L, Helias V, Menanteau C, et al. A functional AQP1 allele producing a Co(a–b–) phenotype revises and extends the Colton blood group system. Transfusion 2010;50:2106–16.

6. Mathai, JC, Mori S, Smith BL, et al. Functional analysis of aquaporin-1 deficient red cells. The Colton-null phenotype. J Biol Chem1996;271:1309–13.

7. King, LS, Nielson S, Agre P, Brown RH. Decreased pulmonary vascular permeability in aquaporin-1-null humans. Proc Natl Acad Sci U S A 2002;99:1059–63.

8. Smith BL, Preston GM, Spring FA, Anstee DJ, Agre P. Human red cell aquaporin CHIP.I. Molecular characterization of ABH and Colton blood group antigens. J Clin Invest 1994;94:1043–9.

9. Preston GM, Smith BL, Zeidel ML, Moulds JJ, Agre P. Mutations in aquaporin-1 in phenotypically normal humans without functional CHIP water channels. Science 1994;265:1585–7.

10. Chrétien S, Catron JP. A single mutation inside the NPA motif of aquaporin-1 found in a Colton-null phenotype (letter). Blood 1999;93:4021–3.

11. Joshi SR, Wagner FF, Vasantha K, Panjwani SR, Flegel WA. An AQP1 null allele in an Indian woman with Co (a–b–) phenotype and high-titer anti-Co3 associated with mild HDN. Transfusion 2001;41:1273–8.

12. Karpasitout K, Frison S, Longhi E, et al. A silenced allele in the Colton blood group system. Vox Sang 2010;99:158–62.

13. Savona-Ventura C, Grech ES, Zieba A. Anti-Co3 and severe hemolytic disease of the newborn. Obstet Gynecol 1989;73 (5 Pt 2):870–2.

14. Larkin MA, Blackshields G, Brown NP, et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007;23:2947–8.

15. Marsh WL. Scoring of hemagglutination reactions. Transfusion 1972;12:352–3.

16. Saison C, Peyrard T, Landre C, et al. A new AQP1 null allele identified in a Gypsy woman who developed an anti-CO3 during her first pregnancy. Vox Sang 2012;103:137–44.

Sunitha Vege, MS (corresponding author), Immunohematology and Genomics Laboratory, New York Blood Center, 45-01 Vernon Boulevard, Long Island City, NY 11101; Sandra Nance, MS, SBB, and Donna Kavitsky, SBB, Immunohematology Reference Laboratory, American Red Cross, Philadelphia, PA; Xiaojin Li, PhD, Department of Molecular Medicine, Functional Genomics Core, Durate, CA; Trina Horn, MS, National Molecular Laboratory, American Red Cross, Philadelphia, PA; Geralyn Meny, MD, University of Texas Health Science Center at San Antonio, San Antonio, TX; and Connie M. Westhoff, PhD, Immunohematology and Genomics Laboratory, New York Blood Center Long Island City, NY.

Fig. 3 Western blot analysis. RBC membranes from the proband (Lane 1) and a normal control (Lane 2) immunoblotted with anti-Co3. The 25-kDa band, representing the AQP1 protein, was detected in the control but absent in the proband, as indicated.

75 kDa è

59 kDa è

37 kDa è

25 kDa è

15 kDa è

ç AQP1

ê Normal Controlê Proband


Warm autoantibodies: time for a changeJ.R. Nobles and C. Wong

Routine adsorption procedures to remove autoantibodies from patients’ serum often require many hours to perform. This time-consuming process can create significant delays that affect patient care. This study modified the current adsorption method to reduce total adsorption time to 1 hour. A ratio of one part serum to three parts red blood cells (RBCs; 1:3 method) was maintained for all samples. The one part serum was split into three tubes. Each of these three aliquots of serum was mixed with one full part RBCs, creating three adsorbing tubes. All tubes were incubated for 1 hour with periodic mixing. Adsorbed serum from the three tubes was harvested, combined, and tested for reactivity. Fifty-eight samples were evaluated using both the current method and the 1:3 method. Forty-eight (83%) samples successfully adsorbed using both methods. Twenty (34.5%) samples contained underlying alloantibodies. The 1:3 method demonstrated the same antibody specificities and strengths in all 20 samples. Eight samples failed to adsorb by either method. The 1:3 method found previously undetected alloantibodies in three samples. Two samples successfully autoadsorbed but failed to alloadsorb by either method. The 1:3 method proved to be efficient and effective for quick removal of autoantibodies while allowing for the detection of underlying alloantibodies. Immunohematology 2013;29:5–10.

Key Words: autoantibody, alloantibody, autoadsorption, alloadsorption

Red blood cell (RBC) autoantibodies, when present in the serum of a patient, will react with the patient’s RBCs as well as with all normal RBCs. These autoantibodies have the potential of masking the presence of underlying clinically significant alloantibodies. When a patient with warm autoantibodies in the serum is in urgent need of an RBC transfusion, the time-intensive adsorption process to remove autoantibodies can adversely impact patient care. The current published adsorption procedure1 (current method) used by reference laboratories and transfusion services can require 4 to 6 hours to complete and is not guaranteed to successfully remove the autoantibodies.

A less time-consuming alternative is needed to expedite the adsorption process and, at the same time, effectively remove the warm autoantibodies. One method would be to increase the RBC-to-serum ratio in an attempt to more effectively remove autoantibodies. Increasing the ratio of RBCs provides more antigen sites to adsorb the autoantibodies; however, this method has been reported to cause dilution of the serum.1

This study evaluated a modified, less time-consuming adsorption procedure that could potentially yield results comparable to those produced by the current method. The modified adsorption procedure involved adjusting the initial serum-to-RBC volumes to a 1:3 ratio (1:3 method) and thus making more antigen sites available to adsorb warm autoantibodies.


SamplesA total of 58 patient samples known to contain warm

autoantibodies were obtained at random. Samples were required to have exhibited autoantibody reactivity and to have had either autologous or allogeneic adsorptions performed using current methods. Three types of samples were used for comparison testing: (1) those that successfully autoadsorbed or alloadsorbed and demonstrated no underlying alloantibodies; (2) those that successfully autoadsorbed or alloadsorbed and demonstrated underlying alloantibodies; and (3) those that did not successfully autoadsorb or alloadsorb and required allogeneic adsorption using 20 percent polyethylene glycol (PEG) prepared in-house (Sigma-Aldrich, St. Louis, MO).

Ficin Treatment of Adsorbing CellsFicin-treated allogeneic RBCs for warm adsorption were

selected to match the patient’s Rh, K, Kidd, and Ss phenotype. The volume of RBCs was determined accordingly to yield the required volume; a 3-mL aliquot was generally used. RBCs were obtained from designated “adsorbing units.” The adsorbing RBCs were washed once with 0.9 percent normal saline in a large 16 × 100-mm test tube. The tube was centrifuged to pack the cells, and as much supernatant saline was removed as possible. The washed cells were treated with 1 percent ficin prepared in-house (MP Biomedicals, Solon, OH) in the ratio of 0.5 mL of ficin to 1 mL of cells. The tube was mixed several times by inversion and incubated at 37°C for 15 minutes with periodic mixing. The cells were washed three times with large volumes of saline. For the last wash, the tube was centrifuged for 10 minutes without a centrifuge brake to avoid disturbing the RBC-saline interface. As much supernatant saline as possible was removed to prevent subsequent dilution of serum.

RepoRt


Adsorption Using the Current Published MethodAll samples selected for this study had adsorptions

performed using the current method1 (Fig. 1). Equal volumes of patient serum and ficin-treated adsorbing RBCs were mixed and incubated at 37°C for 30 minutes to 1 hour with periodic mixing. The tube was centrifuged for 5 minutes, and the one-time adsorbed serum was harvested. Testing for adsorption effectiveness was performed in the same phases for which neat serum demonstrated reactivity and included the following: low-ionic-strength saline (LISS)-37°C (ImmuAdd, Low Ionic Strength Medium; Immucor, Norcross, GA), LISS-antihuman globulin (AHG), and PEG-AHG. Tubes were incubated at 37°C for 15 minutes for PEG and 20 minutes for LISS-AHG. After washing four times with saline, two drops of anti-IgG (Immucor) were added to each tube, and the tubes were centrifuged and read for agglutination. Testing that showed reactivity was followed with additional adsorptions. Adsorption was repeated by transferring the one-time adsorbed serum to another fresh aliquot of ficin-treated RBCs for a second adsorption. If necessary, a maximum of three total adsorptions were performed.

Adsorption Using the Modified 1:3 MethodAdsorption using the modified method was similar to that

using the current method except the initial serum-to-cell ratio was modified to a ratio of one part patient’s serum to three parts RBCs (1:3 method; Fig. 2). The same adsorbing RBCs used in the original case workup, if adsorbed with allogeneic RBCs, were ficin-treated and dispensed into three separate 12 × 75-mm test tubes. Using a plastic Pasteur pipette, for every three drops of RBCs, one drop of patient’s serum was added to yield a ratio of one part serum to three parts RBCs in each tube (1:3 ratio). The cell-serum mixture was mixed and incubated at 37°C for 1 hour with mixing every 10 minutes. An hour of incubation was allowed to best mimic the total adsorption time possible for a routine three-time adsorption.

The three tubes were centrifuged for 5 minutes, and the adsorbed serum from all three tubes was combined into a single test tube. Three separate adsorbing tubes, as opposed to only one, were created to best mimic the adsorption conditions used when performing a three-time adsorption following the current published method. Adsorptions using the modified 1:3 method were performed within 1 to 9 days after the original antibody workup (average, 3 days). Samples were stored at 2° to 4°C if testing was to be performed within 5 days. Samples were frozen if testing was to be performed longer than 5 days after the original antibody workup.

Testing of Adsorbed Serum from the 1:3 MethodThe adsorbed serum was tested against screening

cells if the original adsorbed patient sample demonstrated no underlying alloantibodies and against the selected cell panel used for the original antibody workup if the original patient sample demonstrated underlying alloantibodies. If alloantibody reactivity was detected with screening cells, a full panel and selected cells were tested to make identification. Testing was performed in the same phases that showed reactivity in the original case and included the following: LISS-37°C, LISS-AHG, and PEG-AHG. The effectiveness of the 1:3 method was then compared with previous results obtained from standard adsorption testing.

StatisticsAdsorption results of the 1:3 method were compared

with those of the current method. If present, reactivity of each alloantibody in the adsorbed serum was scored for each method using the published scoring system.1 Data were statistically analyzed using the paired t test. The level of significance was established at a probability value of less than 0.05.

J.R. Nobles and C. Wong

Fig. 1 Current adsorption procedure.

30- to 60-minute incubation



Time* per procedure = 105–195 minutes*Time for tests performed between adsorptions is not included.

1 part serum is added to 1 part red blood cells.

First tube is spun for 5 minutes and serum is added to second tube containing equal part of red blood cells.

Second tube is spun for 5 minutes and serum is added to third tube containing equal part of red blood cells.

Third tube is spun for 5 minutes and adsorbed serum is tested for adsorption effectiveness.

Fig. 2 Modified 1:3 adsorption procedure.

1 part serum is added to 3 parts red blood cells in 3 tubes at the same time.

Time per procedure = 65 minutes

A 60-minute incubation time is allowed. Tubes are spun and the adsorbed serum from all the tubes is recombined. Adsorbed serum is then tested for adsorption effectiveness.


Warm autoadsorption

Results

Results of the 1:3 method showed 48 of 58 samples (83%) successfully adsorbed, matching the current method (Table 1). Of those 48 samples with successful adsorptions, 20 (34.5%) were known from previous testing to contain alloantibodies. Eight samples failed to be fully adsorbed by either method. Three samples (26, 27, and 28) demonstrated underlying alloantibodies (two anti-E, one anti-f) with only the 1:3 method. Two samples (57 and 58), which previously were successfully adsorbed using autologous RBCs, failed to adsorb using allogeneic RBCs with both the current and 1:3 methods on parallel testing. Two samples (30 and 39) contained underlying IgG antibodies of unknown specificity. In the 20 samples known to contain underlying alloantibodies, the 1:3 method demonstrated the same antibody specificities and comparable reaction strengths as the current method (p = 0.82), with one sample (38) showing a stronger reaction by the 1:3 method than by the current method (Table 2). Sample 30 was reactive 1+ LISS-AHG with three of nine panel cells. Sample 39 was reactive 2+ LISS-AHG and PEG-AHG with four of eight panel cells.

Discussion

An important component of pretransfusion testing is to detect clinically significant alloantibodies.2 Patients with warm autoantibodies in their serum present a unique and challenging problem because the autoantibodies are broadly reactive, reacting with almost all RBCs tested. Warm autoantibodies are the most common cause of autoimmune hemolytic anemia (AIHA), with the incidence of these antibodies increasing with patient age.3 Although hemolytic transfusion reactions can occur when patients with clinically significant alloantibodies are transfused with RBCs carrying antigens corresponding to the alloantibodies,4 acute reactions are unlikely when RBC incompatibility is caused by autoantibody alone. Survival of transfused RBCs is generally the same as survival of the patient’s own RBCs, and transfusion can be expected to have significant temporary benefit.3,5,6

Patients with AIHA can have autoantibodies present in their serum. Warm autoantibodies can cause serologic anomalies including spontaneous agglutination that can result in discrepant ABO and Rh testing. More importantly, warm-reactive autoantibodies can mask the presence of clinically significant alloantibodies. Published data indicate that alloantibodies were detected in 209 of 647 serum samples (32%) of patients with AIHA.7 Undetected alloantibodies

may cause increased hemolysis after transfusion, which can be falsely attributed to an increase in the severity of AIHA.3,8 Furthermore, although fatalities caused by undetected clinically significant alloantibodies have declined in recent years,9 the detection of these alloantibodies is still necessary to prevent serious outcomes. When blood transfusion is ordered for a patient with autoantibodies in the serum, specialized serologic testing including adsorption studies, patient phenotyping, and eluate testing are helpful.10 A knowledge of the patient’s complete phenotype is useful to predict which clinically significant alloantibodies can potentially be present in the patient’s serum.

One of the most important testing procedures for a patient with AIHA, especially if the patient has a history of pregnancy or transfusion, is adsorption testing to remove autoantibody from the patient’s serum and allow for the detection and identification of clinically significant alloantibodies.1 Adsorption using autologous RBCs is the best procedure to detect clinically significant antibodies. However, autoadsorption should not be performed on samples from patients who have been recently transfused because transfused donor RBCs might adsorb alloantibodies, resulting in a falsely negative test result.

For patients with recent transfusions, the use of allogeneic RBCs is helpful in adsorbing autoantibodies, leaving behind alloantibodies in the adsorbed serum.1 If the patient’s phenotype is known, one allogeneic adsorbing cell can be selected to match the patient’s phenotype.1 The selection of cells is made easier by enzyme treating the allogeneic absorbing cells to destroy the MNS and Duffy antigens.1 When the patient’s phenotype is unknown, differential adsorption can be performed using group O RBCs of three different Rh phenotypes: R1R1, R2R2, and rr; one cell should lack the Jka antigen, and another should lack the Jkb antigen.1 Aliquots from each Rh phenotype are prepared and three separate adsorptions are performed, one with each Rh phenotype. Adsorbed serum from each adsorption can only be used to rule out alloantibodies corresponding to the antigens lacking on each adsorbing RBC phenotype. For example, R2R2 Jk(a–b+)-adsorbing RBCs can be used to rule out alloantibodies specific for C, e, f, and Jka and not D, E, c, or Jkb.

Adequate testing to detect alloantibodies in the serum of a patient with autoantibodies may take 4 to 6 hours. Adsorption testing using the current method1 is time consuming and often results in delay of patient transfusion. Also, should routine allogeneic adsorption fail to remove alloantibody reactivity, a PEG-allogeneic adsorption should be performed.11 PEG-allogeneic adsorption is a faster adsorption method involving



Table 1. Summary of data from all samples tested

SampleAutologous adsorption

Allogeneic adsorption

Number of adsorptions

requiredUnderlying alloantibodies detected by

current method

Underlying alloantibodies detected by 1:3 adsorption

method1:3 method successful at removing autoantibody

reactivity?

1 X 1 None None Yes 2 X 2 None None Yes3 X 2 None None Yes4 X 3 None None Yes5 X 2 None None Yes6 X 1 None None Yes7 X 3 None None Yes 8 X 3 None None Yes9 X 1 None None Yes10 X 1 None None Yes11 X 1 None None Yes12 X 2 None None Yes13 X 2 None None Yes14 X 1 None None Yes15 X 3 None None Yes16 X 1 None None Yes17 X 2 None None Yes18 X 1 None None Yes19 X 2 None None Yes20 X 1 None None Yes21 X 2 None None Yes22 X 1 None None Yes23 X 2 None None Yes24 X 3 None None Yes25 X 3 None None Yes26 X 3 None Anti-E Yes27 X 3 None Anti-f Yes28 X 2 None Anti-E Yes29 X 3 Anti-E Anti-E Yes30 X 3 Anti-K, unknown IgG Anti-K, unknown IgG Yes31 X 3 Anti-E Anti-E Yes32 X 1 Anti-E Anti-E Yes33 X 2 Anti-E Anti-E Yes34 X 3 Anti-E Anti-E Yes35 X 3 Anti-E Anti-E Yes36 X 3 Anti-E Anti-E Yes37 X 2 Anti-Jka Anti-Jka Yes38 X 1 Anti-E Anti-E Yes39 X 3 Unknown IgG Unknown IgG Yes40 X 1 Anti-S Anti-S Yes41 X 2 Anti-K Anti-K Yes42 X 1 Anti-E Anti-E Yes43 X 1 Anti-E, -Jkb, -S Anti-E, -Jkb, -S Yes44 X 2 Anti-E, -C Anti-E, -C Yes45 X 1 Anti-E Anti-E Yes46 X 2 Anti-E Anti-E Yes47 X 1 Anti-C, -E Anti-C, -E Yes48 X 2 Anti-C, -K, -S Anti-C, -K, -S Yes49 X (PEG) 2 None NA No - required PEG adsorption50 X (PEG) 2 None NA No - required PEG adsorption51 X (PEG) 2 None NA No - required PEG adsorption52 X (PEG) 3 Unknown IgG NA No - required PEG adsorption53 X (PEG) 3 Anti-C, -K, -Jkb, -M, -S NA No - required PEG adsorption54 X (PEG) 3 None NA No - required PEG adsorption55 X (PEG) 3 None NA No - required PEG adsorption56 X (PEG) 2 None NA No - required PEG adsorption57 X 2 None NA No - only autologous adsorption successful58 X 3 Anti-s NA No - only autologous adsorption successful

PEG = polyethylene glycol.


Warm autoadsorption

adsorption with one part RBCs, one part PEG, and one part serum for 15 minutes up to a total of three adsorptions. After adsorption, four to six drops of PEG-adsorbed serum are used to test with each panel cell originally reactive with neat serum. Additional enhancement media are not needed because of the PEG present in the PEG-adsorbed serum. Although PEG adsorption is a faster procedure than routine allogeneic adsorption, there is the risk that weak alloantibodies will not be detected.12 Knowing sooner whether PEG adsorption is necessary aids in reducing the overall turnaround time of making blood available for transfusion.

This study showed that the 1:3 method gave results comparable to those of the current adsorption method, and in much less time, for those samples that originally required more than one adsorption. Of the 58 serum samples selected at random for this study, 48 were successfully adsorbed using both the current and 1:3 methods. Of these 48 samples,

20 (34.5%) contained underlying alloantibodies, which is consistent with the average of 32 percent from published data.7 In all 20 samples with underlying alloantibodies, the 1:3 method demonstrated the same antibody specificities and reaction strengths as the current method, with one sample yielding stronger alloantibody reactivity in the 1:3 method. Eight samples that failed to be adsorbed by the current method also failed with the 1:3 method. The modified 1:3 method detected underlying alloantibodies in three samples that were not detected using the current method. Two samples that successfully adsorbed in previous testing using autologous RBCs failed to adsorb by the 1:3 method using allogeneic adsorbing RBCs. Further parallel adsorption testing using two separate allogeneic adsorbing RBCs showed both samples failed to adsorb using both the current and 1:3 methods. An explanation could not be found in either of the two samples that successfully autoadsorbed, but failed to alloadsorb by routine methods, as to why only autologous adsorption could remove autoantibody reactivity.

Other studies13–15 reported that reductions in adsorption incubation times to as little as 10 minutes are equally effective as currently accepted standard methods. Possible future studies could combine this 1:3 method with a shortened incubation time to evaluate whether autoantibodies could still be effectively removed without adverse impact on the final results.

Summary

Standard adsorptions can require 4 to 6 hours; the 1:3 method required approximately 1 to 1.5 hours for the entire adsorption process. In conclusion, this study showed the 1:3 method of using one part patient’s serum to three parts RBCs to be time efficient as well as effective for quick removal of autoantibodies while allowing for the detection of underlying alloantibodies.

References

1. Roback JD, Combs MR, Grossman BJ, Harris T, Hillyer CD. Technical manual. 17th ed. Bethesda, MD: AABB, 2011.

2. Carson TH, ed. Standards for blood banks and transfusion services. 27th ed. Bethesda, MD: AABB, 2011.

3. Petz LD, Garratty G. Immune hemolytic anemias. 2nd ed. New York: Churchill Livingstone, 2004.

4. Jenner PW, Holland PV. Diagnosis and management of transfusion reactions. In: Petz LD, Swisher SN, Kleinman S, eds. Clinical practice of transfusion medicine. 3rd ed. New York: Churchill-Livingstone, 1996:905–29.

5. Garratty G, Petz LD. Transfusing patients with autoimmune haemolytic anaemia. Lancet 1993;341:1220.

Table 2. Comparison of reactivity of alloantibodies in adsorbed serum using current and 1:3 methods

SampleAlloantibodies: current method Reaction* Score

Alloantibodies: 1:3 method Reaction* Score

29 Anti-E 1+ 5 Anti-E 1+ 5

30 Anti-KUnknown IgG

1+1+

55

Anti-KUnknown IgG

1+1+

55

31 Anti-E 1+ 5 Anti-E 1+ 5

32 Anti-E 3+ 10 Anti-E 3+ 10

33 Anti-E 3+ 10 Anti-E 3+ 10

34 Anti-E 2+ 8 Anti-E 2+ 8

35 Anti-E 2+ 8 Anti-E 2+ 8

36 Anti-E 3+ 10 Anti-E 3+ 10

37 Anti-Jka 2+ 8 Anti-Jka 2+ 8

38 Anti-E 1+ 5 Anti-E 2+ 8

39 Unknown IgG 2+ 8 Unknown IgG 2+ 8

40 Anti-S 2+ 8 Anti-S 2+ 8

41 Anti-K 2+ 8 Anti-K 2+ 8

42 Anti-E 2+ 8 Anti-E 2+ 8

43 Anti-EAnti-Jkb

Anti-S

2+1+1+

855

Anti-EAnti-Jkb

Anti-S

2+1+1+

855

44 Anti-EAnti-C

2+1+

85

Anti-EAnti-C

2+1+

85

45 Anti-E 3+ 10 Anti-E 3+ 10

46 Anti-E 2+ 8 Anti-E 2+ 8

47 Anti-EAnti-C

2+2+

88

Anti-EAnti-C

2+2+

88

48 Anti-CAnti-KAnti-S

2+3+1+

8105

Anti-CAnti-KAnti-S

2+3+1+

8105

* Reaction based on reactivity at the strongest phase (either low-ionic-strength saline [LISS]-antihuman globulin [AHG] or polyethylene glycol [PEG]-AHG).



Immunohematology is on the Web!

www.redcross.org/about-us/publications/immunohematology

For more information, send an e-mail to [email protected]

For information concerning the National Reference

Laboratory for Blood Group Serology, including the American

Rare Donor Program, contact Sandra Nance, by phone at

(215) 451-4362, by fax at (215) 451-2538, or by e-mail at

[email protected]

6. Salama A, Berghöfer H, Mueller-Eckhardt C. Red blood cell transfusion in warm-type autoimmune haemolytic anaemia. Lancet 1992;340:1515–17.

7. Branch DR, Petz LD. Detecting alloantibodies in patients with autoantibodies. Transfusion 1999;39:6–10.

8. Petz LD. Blood transfusion in acquired hemolytic anemias. In: Petz LD, Swisher SN, Kleinman S, eds. Clinical practice of transfusion medicine. 3rd ed. New York: Churchill Livingstone, 1996:469–99.

9. Fatalities reported to FDA following blood collection and transfusion: annual summary for fiscal year 2010. Available at http://www.fda.gov/BiologicsBloodVaccines/ SafetyAvailability/ReportaProblem/TransfusionDonation Fatalities/ucm254802.htm. Accessed February 6, 2012.

10. Blackall DP. How do I approach patients with warm-reactive autoantibodies? Transfusion 2011;51:14–17.

11. Barron CL, Brown MB. The use of polyethylene glycol (PEG) to enhance the adsorption of autoantibodies. Immunohematology 1997;13:119–22.

12. Judd WJ, Dake L. PEG adsorption of autoantibodies causes loss of concomitant alloantibody. Immunohematology 2001;17: 82–5.

13. McConnell G, Kezeor K, Kosanke J, Hinrichs M, Reddy R. Warm autoantibody adsorption time may be successfully shortened to 15 minutes (abstract). Transfusion 2008;48:232A.

14. Fueger J, Hamdan Z, Johnson S. Ten-minute autoantibody adsorptions: they really work! (abstract). Transfusion 2008;48: 230A.

15. Magtoto-Jocom J, Hodam J, Leger RM, Garratty G. Adsorption to remove autoantibodies using allogeneic red cells in the presence of low ionic strength saline for detection of alloantibodies (abstract). Transfusion 2011;51:174A.

J. Ryan Nobles, MT(CM)SBB(CM) (corresponding author), Consultation Specialist, Training Coordinator, and Clare Wong, MT(ASCP)SBB,SLS, Manager, SBB School External Education, Gulf Coast Regional Blood Center, Consultation and Reference Laboratory, 1400 La Concha Lane, Houston, TX 77054.

Attention: State Blood Bank Meeting Organizers

If you are planning a state meeting and would like copies of Immunohematology for distribution, please send request, 4 months in advance, to [email protected]

Notice to Readers

All articles published, including communications and book reviews, reflect the opinions of the authors and do not necessarily reflect the official policy of the American Red Cross.


Major non-ABO incompatibility caused by anti-Jka in a patient before allogeneic hematopoietic stem cell transplantationM.Y. Kim, P. Chaudhary, I.A. Shulman, and V. Pullarkat

Case RepoRt

A 49-year-old white man with blood group AB, D+ was found to have alloanti-Jka and -K when he developed a delayed hemolytic transfusion reaction before allogeneic hematopoietic stem cell transplant (HSCT). Given that his stem cell donor was blood group O, D+, Jk(a+), K–, rituximab was added to his conditioning regimen of fludarabine and melphalan to prevent hemolysis of engrafting Jk(a+) donor red blood cells. The patient proceeded to receive a peripheral blood stem cell transplant from a matched unrelated donor with no adverse events. To our knowledge, this is the first case of successful management of major non-ABO incompatibility caused by anti-Jka in a patient receiving an allogeneic HSCT reported in the literature. Immunohematology 2013;29: 11–14.

Key Words: anti-Jka, major incompatibility, hematopoietic stem cell transplantation

ABO mismatch is well characterized in the setting of hematopoietic stem cell transplant (HSCT). Because of the disparate genetic locations of HLA and ABO genes, ABO mismatch occurs in 30 to 50 percent of transplants.1 Red blood cell (RBC)–incompatible transplantation does not seem to have an adverse effect on transplant outcomes, such as engraftment, graft-versus-host disease (GVHD), relapse, or survival.2 However, it does carry the risk of hemolytic transfusion reactions (HTR), and it must be managed appropriately with interventions such as graft processing and proper blood component support.

RBC incompatibility can be classified into two categories. Major incompatibility is when the recipient has antibodies directed against donor RBC antigens. Minor incompatibility is defined as a donor having antibodies directed against recipient RBC antigens. Bidirectional incompatibility, usually in a group A donor with a group B recipient or vice versa, is when there is both major and minor incompatibility. Major incompatibility carries the risk of acute HTR and also delayed RBC recovery after transplant. Minor incompatibility can result in “passenger lymphocyte syndrome,” in which the donor B lymphocytes produce antibodies against recipient RBCs that cause a delayed hemolytic transfusion reaction 7 to 12 days after transplantation.

Patients undergoing HSCT require frequent RBC transfusions owing to both the underlying disease and treatment with chemotherapy or radiation.3 Frequent transfusions predispose patients to developing alloantibodies to non-ABO RBC antigens. RBC alloantibodies may become undetectable over time and with restimulation can cause a delayed HTR if their past existence is not known before transfusion.4 Non-ABO antigens such as those in the Rh, Kell, and Kidd blood group systems have been implicated as targets for passenger lymphocyte syndrome after transplant.5–8

We present a patient who developed an unusual form of bidirectional incompatibility in the form of minor ABO incompatibility, being a group AB recipient with a group O donor, and major non-ABO incompatibility, with preformed anti-Jka directed against the donor’s Jk(a+) RBCs.

Case Report

A 49-year-old man was diagnosed with primary myelofibrosis in 2007. He was treated with hydroxyurea until May 2011, when he developed worsening anemia and thrombocytopenia that did not improve after hydroxyurea was discontinued. Bone marrow biopsy revealed advanced reticulin fibrosis. The patient had massive splenomegaly of 26 cm. His blood group was AB, D+, and he had a negative screening test for RBC alloantibodies. He had received 38 units of group AB, D+ RBC transfusions over a period of 8 months. Because his antibody screening test was negative, neither the patient nor any of the 38 RBC units were phenotyped for antigens beyond the standard A, B, and D. At this point it was decided that the patient needed an allogeneic HSCT.

The patient was admitted to our hospital for a matched unrelated donor HSCT. He received reduced-intensity conditioning with fludarabine 25 mg/m2/day given intravenously from Day –9 to Day –5 and melphalan 140 mg/m2 given intravenously on Day –4. GVHD prophylaxis was initiated with tacrolimus 0.02 mg/kg/day continuous infusion starting on Day –3 and sirolimus 12 mg on Day –3 and 4 mg


M.Y. Kim et al.

daily thereafter. Peripheral blood stem cells were mobilized from the donor with granulocyte colony-stimulating factor, and 8 × 106 CD34+ cells/kg were infused into patient. Patient and donor were 10 of 10 HLA matched, with minor ABO incompatibility as the donor was group O, D+.

On admission to our hospital, the patient’s screening test for unexpected RBC antibodies was positive, but no specific antibody could be identified. Because of the positive antibody screen and because the prospective stem cell donor was group O, RBC units selected for transfusion were group O, D+ and crossmatched using an indirect antiglobulin test. On pretransplant Day –8, the patient was transfused with one RBC unit as his hemoglobin was 7.3 g/dL. On pretransplant Day –6, the patient received an additional two units of RBCs as his hemoglobin was again low, 6.8 g/dL. On pretransplant Day –5, the patient was found to have an anti-Jka. On further review it was found that one of the RBC units transfused on Day –6 was Jk(a+). At this point the patient’s direct antiglobulin test (DAT) was positive with IgG and C3 coating his RBCs. An eluate prepared from his RBCs contained anti-Jka. On Day –4, the patient’s hemoglobin dropped from 8.4 g/dL to 6 g/dL, his lactate dehydrogenase (LDH) rose to 942

IU/L, and his total bilirubin rose to 2.8 mg/dL, all consistent with a delayed HTR (Fig. 1). He required five units of RBCs to maintain an adequate hemoglobin level over the next 3 days. Given that the donor was Jk(a+), one dose of rituximab 375 mg/m2 intravenously was added on Day –3 to prevent hemolysis after donor cell engraftment, as well as to reduce likelihood of passenger lymphocyte engraftment given the minor ABO incompatibility.

On pretransplant Day –2, the patient was also found to have an anti-K. No RBC units transfused during this admission were positive for K and the donor was K–, so this was not investigated further.


The patient’s ABO/D status was verified using monoclonal anti-A, -B, and -D reagents (BioClone, Ortho Clinical Diagnostics, Inc., Raritan, NJ). Initial screens for RBC antibodies were performed using the gel test (MTS Anti-IgG Card, Micro Typing Systems, Inc., Pompano Beach, FL). Monoclonal anti-Jka typing reagent (BioClone) was used to detect circulating Jk(a+) RBCs. Monoclonal anti-IgG,

Fig. 1 Patient’s hemoglobin (Hb), lactate dehydrogenase (LDH), and bilirubin (T-bili) trend during transplant (occurring on Day 0). Each arrow at the top of the graph represents one transfused unit of red blood cells (RBCs). Solid arrows represent group O, D+, Jk(a–) RBC units; dashed arrow represents the one group O, D+, Jk(a+) RBC unit the patient received on Day –6. Anti-Jka was detected on Day –5.


Non-ABO incompatibility in transplant by anti-Jka

-C3d, polyspecific AHG (BioClone) were used to perform the DAT. Monoclonal Anti-AB containing the ES4 clone (anti-A,B Murine Monoclonal Blend Series 1, Immucor Gamma, Norcross, GA) was used to type the patient’s ABO status after transplant. Both the gel test (MTS, Anti-IgG card, Ortho) and automated solid-phase capture assay (Galileo Echo; Immucor Gamma) were used to serially monitor the patient’s anti-Jka.

Results

By the day of transplantation, the patient’s hemoglobin had stabilized, and LDH and bilirubin were back to baseline. After transplantation, the patient received daily RBC transfusions with group O, D+, Jk(a–), K– RBCs from Day +4 to Day +10; during this time there was no increase in markers of hemolysis, and the DAT remained negative. The patient achieved neutrophil engraftment on Day +11. On the same day, the patient first typed macroscopically as group O, D+ Jk(a–), a reflection of the 11 units of matched RBCs transfused during the preceding 2 weeks. On Day +21, the patient typed as O+, Jk(a+), indicating successful RBC reconstitution with donor erythropoiesis. Of note, with standard anti-A and anti-B typing, the patient forward typed as group O; however, with anti-A/B from an ES4 clone, the patient continued to show 1+ reactivity.

The patient’s anti-Jka was initially detected at a titer of 2 on Day –5. On serial monitoring, the titer decreased to 1 on Day +14 and became undetectable using gel-column assay (MTS Anti-IgG card, Ortho) on Day +17. Using solid-phase adherence assay (Capture, Immucor) the antibody was still detected until Day +40, converted to negative on Day +49, and remained so thereafter. Despite the persistence of detectable antibody, the patient required only two additional units of RBCs, one each on Day +24 and Day +40, and his posttransplant course remained uneventful otherwise.

Discussion

In this case, we report a patient who developed alloantibodies to both Jka and K before allogeneic HSCT. Neither of these antibodies was detectable during the time leading up to his admission for HSCT, during which period his transfusion support was provided outside of our institution. Although we do not know the Jka status of his prior transfusions, the prevalence of Jka and K suggest that at least 15 of the 20 units he received in the 3 months before admission would have been Jk(a+), and 2 units would have been K+. Unfortunately, the patient had almost completed his

conditioning regimen for HSCT when the anti-Jka and -K were identified. This example of anti-Jka detected in our patient was clinically significant as evidenced by its ability to cause a delayed HTR, necessitating aggressive RBC transfusion support for a short time before transplant. There is scant literature available about the management of this type of situation.

The paucity of data regarding this issue likely is because patients undergoing HSCT have a low incidence of alloantibodies relative to the number of RBC transfusions they receive.9 The lack of alloimmunization is thought to be related to the intense chemotherapy given to patients for their underlying hematologic disease before transplant. Patients like ours constitute a minority of HSCT candidates who did not receive chemotherapy other than hydroxyurea before transplant, and this may have increased his likelihood of developing RBC alloantibodies.

Even when patients have alloantibodies, the traditional conditioning regimen before HSCT with chemotherapy or radiation will usually prevent these antibodies from being able to act effectively against donor RBCs. In one study, of 14 patients who were found to have alloantibodies before transplant, all but one no longer had detectable antibodies after transplant,9 supporting the hypothesis that RBC alloantibodies can be eradicated in patients with HSCT.

However, as the indications for HSCT expand to include nonmalignant diseases such as thalassemia and sickle cell disease, and the use of reduced-intensity conditioning regimens continues to increase, non-ABO incompatibility issues may become a more prevalent problem in the future. For example, Borge et al.10 reported a patient with sickle cell disease who also had anti-Jka and received HSCT from a Jk(a+) donor. In this case the recipient had delayed RBC engraftment that persisted for more than 180 days after transplant. A nonmyeloablative conditioning regimen was used, consisting of alemtuzumab 1 mg/kg and a single dose of total body irradiation 300 cGy, while oral sirolimus was used for prevention of GVHD.11

Although we also used a reduced-intensity conditioning regimen, we believe that in our patient the immunosuppressive agents, fludarabine and rituximab, were key in preventing potential problems. Fludarabine, a purine nucleoside analog, is a highly immunosuppressive agent that causes myelo-suppression and prolonged reduction of CD4+ lymphocytes.12 Rituximab is an anti-CD20 monoclonal antibody that selectively depletes circulating B cells, thus preventing antibody production.13 These two agents in combination effectively target all the immune cells required to generate an HTR. Eventually, with achievement of complete donor chimerism,


the donor immune cells would be expected to completely eliminate any residual alloantibody-producing cells.

For ABO-incompatible HSCT, delayed RBC engraftment has been associated with the length of time for the isohemagglutinin titers to decrease to clinically insignificant levels (1+ or lower in strength).14 In our case, the initial anti-Jka titer was 2 and became 1+ on Day +14, while donor erythropoiesis was established on Day +21. Thus, it may be useful to monitor antibody titers in the non-ABO–incompatible HSCT setting as an early indicator of whether successful donor erythropoiesis may be achieved. Whether high initial titers or persistent antibody detection warrants further intervention has yet to be determined.

Of note, the increased sensitivity of laboratory methods used in the detection of RBC antigens and antibodies may also cause RBC compatibility issues in HSCT to become more prevalent in the future. For instance, the anti-Jka in our patient could be detected on solid-phase capture assay up to 32 days after the gel-column assay became negative. Also, although the patient first typed as blood group O on Day +11, he continued to have detectable A and B on his RBCs when using the more sensitive assay with the ES4 clone.

In conclusion, we present the case of a patient with minor ABO and major non-ABO mismatch who successfully received matched unrelated donor HSCT. We believe that major non-ABO mismatch is an underreported phenomenon that usually does not lead to clinically significant consequences, and clinicians should not be discouraged from using a major non-ABO–incompatible donor if such an incompatibility is discovered before HSCT. However, close monitoring of the recipients with markers for serum hemolysis should be performed during HSCT because severe hemolysis can occur in such situations. Monitoring antibody titers may also be helpful in predicting its clinical relevance. Depending on the level of concern, rituximab may be an additional strategy to use in this situation to avoid hemolysis and ensure successful RBC engraftment. We feel that this is a clinical situation that may become more common in the future given changing patterns of HSCT and the increased sensitivity of assays used to detect RBC antigens and antibodies.

References

1. Mielcarek M, Leisenring W, Torok-Storb B, Storb R. Graft-versus-host disease and donor-directed hemagglutinin titers after ABO-mismatched related and unrelated marrow allografts: evidence for a graft-versus-plasma cell effect. Blood 2000;96:1150–6.

M.Y. Kim et al.

2. Rowley SD, Donato ML, Bhattacharyya P. Red blood cell-incompatible allogeneic hematopoietic progenitor cell transplantation. Bone Marrow Transplant 2011;46:1167–85.

3. Schonewille H, Haak HL, van Zijl AM. Alloimmunization after blood transfusion in patients with hematologic and oncologic diseases. Transfusion 1999;39:763–71.

4. Ramsey G, Larson P. Loss of red cell alloantibodies over time. Transfusion 1988;28:162–5.

5. Leo A, Mytilineos J, Voso MT, et al. Passenger lymphocyte syndrome with severe hemolytic anemia due to an anti-Jka after allogeneic PBPC transplantation. Transfusion 2000;40:632–6.

6. Young PP, Goodnough LT, Westervelt P, Diersio JF. Immune hemolysis involving non-ABO/RhD alloantibodies following hematopoietic stem cell transplantation. Bone Marrow Transplant 2001;27:1305–10.

7. Adams BR, Miller AN, Costa LJ. Self-limited hemolysis due to anti-D passenger lymphocyte syndrome in allogeneic hematopoietic stem cell transplantation. Bone Marrow Transplant 2009;45:772–3.

8. López A, de la Rubia J, Arriaga F, et al. Severe hemolytic anemia due to multiple red cell alloantibodies after an ABO-incompatible allogeneic bone marrow transplant. Transfusion 1998;38:247–51.

9. Perseghin P, Balduzzi A, Galimberti S, et al. Red blood cell support and alloimmunization rate against erythrocyte antigens in patients undergoing hematopoietic stem cell transplantation. Bone Marrow Transplant 2003;32:231–6.

10. Borge PD, Stroka-Lee AH, Hsieh MM, et al. Delayed red blood cell chimerism in an HSC transplant for sickle cell disease associated with a non-ABO alloantibody (abstract). Transfusion 2010;50(Suppl 2):155A.

11. Hsieh MM, Kang EM, Fitzhugh CD, et al. Allogeneic hematopoietic stem-cell transplantation for sickle cell disease. N Engl J Med 2009;361:2309–17.

12. Fenchel K, Bergmann L, Wijermans P, et al. Clinical experience with fludarabine and its immunosuppressive effects in pretreated chronic lymphocytic leukemias and low-grade lymphomas. Leuk Lymphoma 1995;18:485–92.

13. Zecca M, Nobili B, Ramenghi U, et al. Rituximab for the treatment of refractory autoimmune hemolytic anemia in children. Blood 2003;101:3857–61.

14. Bolan CD, Leitman SF, Griffith LM, et al. Delayed donor red cell chimerism and pure red cell aplasia following major ABO-incompatible nonmyeloablative hematopoietic stem cell transplantation. Blood 2001;98:1687–94.

Miriam Y. Kim, MD (corresponding author), Hematology/Oncology Fellow, and Preeti Chaudhary, MD, Hematology/Oncology Fellow, Jane Anne Nohl Division of Hematology, Keck School of Medicine, University of Southern California, 1441 Eastlake Ave, NOR 3461, Los Angeles, CA 90033; Ira A. Shulman, MD, Director of Laboratories, Department of Pathology, Los Angeles County-University of Southern California Medical Center, Los Angeles, CA; and Vinod Pullarkat, MD, Associate Professor of Clinical Medicine, Jane Anne Nohl Division of Hematology, Keck School of Medicine, University of Southern California, Los Angeles, CA.


A case of autoimmune hemolytic anemia with anti-D specificity in a 1-year-old childR.S. Bercovitz, M. Macy, and D.R. Ambruso

Although antibodies to antigens in the Rh blood group system are common causes of warm autoimmune hemolytic anemia, specificity for only the D antigen is rare in autoimmune hemolysis in pediatric patients. This case reports an anti-D associated with severe hemolytic anemia (Hb = 2.1 g/dL) in a previously healthy 14-month-old child who presented with a 3-day history of low-grade fevers and vomiting. Because of his severe anemia, on admission to the hospital he was found to have altered mental status, metabolic acidosis, abnormal liver function tests, and a severe coagulopathy. He was successfully resuscitated with uncrossmatched units of group O, D– blood, and after corticosteroid therapy he had complete resolution of his anti-D-mediated hemolysis. Immunohematology 2013;29:15-18.

Key Words: autoimmune hemolytic anemia, pediatrics, anti-D

Autoimmune hemolytic anemia (AIHA) is the pathological destruction of red blood cells (RBCs) by antibodies produced against self-erythrocyte surface antigens. Its prevalence is estimated to be approximately 1 to 3 per 100,000 per year, although it may be lower in pediatric patients.1–4 Warm AIHA is usually caused by immunoglobulin G (IgG) antibodies that bind to RBC antigens and result in erythrophagocytosis by splenic macrophages or hepatic Kupffer cells. In many cases, antigen specificity cannot be determined, or patients express pan-reactivity across antigen groups. However, there have been reports of specificity to as many as 50 RBC antigens with anti-e being one of the most common specificities cited in reviews.4–6

AIHA can be either a primary or a secondary disease, usually as a result of an underlying autoimmune disease, primary immunodeficiency, or lymphoid malignancy; it can present in a known primary process or as part of its initial presentation.4,7,8 In adult patients primary AIHA represents approximately 60 percent of cases.9 In case series of pediatric patients, the proportion of patients with primary AIHA has ranged from 7 to 64 percent.4,5,10 This case of AIHA is unusual because of the D specificity of the autoantibody and its occurrence in a 14-month-old child without an underlying immune or autoimmune disorder and with no long-term sequelae.

Case Report

A previously healthy 14-month-old white male born after a term pregnancy without perinatal problems and with no prior history of blood transfusion presented to the emergency department with lethargy and jaundice. He had a history of low-grade fevers, vomiting, and fatigue for 3 days before presentation. On the day of admission he was noted to have occasional episodes of shallow breathing with decreased responsiveness. His vital signs showed he was tachycardic, normotensive, and not hypoxic. He was noted to be pale, jaundiced, and responsive to painful stimulus only. In addition, he was found to have an intermittent gallop and hepatosplenomegaly.

His initial blood work showed he was severely anemic with a hemoglobin (Hb) of 2.1 g/dL, hematocrit (Hct) of 7.1 percent, and an elevated reticulocyte count of 32 percent. His white blood cell count was elevated, and his platelet count was normal. The pertinent laboratory evaluations are summarized in Table 1. In addition to his severe anemia, the patient had a bilirubin that was greater than 3 times the upper limit of normal and a lactate dehydrogenase, which is a marker for rapid cell turnover, that was almost 6 times the upper limit of normal. The results were consistent with the diagnosis of an acute hemolytic anemia.

Further laboratory testing demonstrated significant end-organ ischemia secondary to his severe anemia. He was acidotic on admission, with a pH of 7.19. He had evidence of prerenal insufficiency and hepatic dysfunction with elevated hepatocellular enzymes. Although he did not have any clinical signs of bleeding, he had a prolonged prothrombin time, but a normal partial thromboplastin time. Further evaluation of coagulation factors demonstrated a deficiency in factors II, V, and VII, an elevated factor VIII, and normal fibrinogen. His D dimer was 1390 ng/mL. Although there was evidence of activation of coagulation, the patient did not have severe consumption, and his coagulopathy was most likely attributable to decreased hepatic synthesis. Vitamin K deficiency could not be documented.

Case RepoRt


R.S. Bercovitz et al.

He was resuscitated with both crystalloid fluids and emergency units of unmatched, group O, D– packed RBCs. After this resuscitation the patient’s mental status and cardiovascular status improved. His renal and liver function tests improved, and he had prompt resolution of his metabolic acidosis.

Further testing showed that the patient was group B, D+ with warm-reacting autoantibodies. His direct antiglobulin test (DAT) was 2+ positive for IgG, and an eluate from the cells demonstrated anti-D specificity and no reactivity with D+ LW– RBCs. Extended Rh phenotype by serology indicated that the patient was D+, C–/c+, E+/e– (likely R2R2); however DNA testing revealed that the patient’s genotype was D heterozygote, C–/c+, and E+/e+ (likely R2r). There was no evidence of anti-C/c or anti-E/e alloantibodies or autoantibodies. Sequencing

of his RHD gene showed he was negative for the RHD-inactivating pseudogene and had none of the 18 most common partial D genotypes. The discrepancy between his positive e genotype and negative phenotype for e is likely caused by an altered RHCE gene, although complete sequencing could not be performed.

After his initial resuscitation, the patient’s hemoglobin remained stable with no additional evidence of hemolysis, and he did not require any additional RBC transfusions. On the day of admission, he was started on a 10-day course of prednisone (2 mg/kg per day) and was successfully tapered off the medication without recrudescence of his hemolysis. Infectious disease testing was performed, including a respiratory virus direct stain for adenovirus, influenza A and B, parainfluenza 1 through 3, and respiratory syncytial virus, which was negative. There was no evidence of current or prior infection with Epstein-Barr virus. The patient had no underlying conditions such as another autoimmune disorder (negative antinuclear antibody), immunodeficiency (normal serum immunoglobulins), or malignancy, making this a primary AIHA.

Samples from the patient exhibited a weakly positive DAT for 2 to 3 months after his initial presentation. Subsequently, the DAT became negative, and he had complete resolution of his hemolysis 1 year after his initial presentation without evidence of any autoimmune or immune disorders.

Discussion

AIHA is caused by antibodies to a specific antigen on the patient’s own erythrocytes, resulting in either intravascular or extravascular hemolysis. Warm AIHA is caused by IgG antibodies and results in antibody-mediated erythrophagocytosis by splenic macrophages. Cold AIHA is caused by IgM antibodies and results in intravascular hemolysis secondary to complement fixation on the RBC surface. The thermal amplitude of the antibodies determines their clinical significance; cold agglutinins that are reactive at temperatures lower than body temperature are generally of little clinical significance. Biphasic IgG antibodies that bind RBCs at colder temperatures and then fix complement in warmer temperatures cause paroxysmal cold hemoglobinuria (PCH).

Table 1. Selected abnormal laboratory values in this patient consistent with a brisk hemolytic process and end-organ ischemia caused by severe anemia

Laboratory test Patient’s results Normal range

Complete blood count

White blood cells (WBC) 39.4 × 103/µL 5–13 × 103/µL

Hemoglobin (Hb) 2.1 g/dL 9.5–14 g/dL

Hematocrit (Hct) 7.1% 30–41%

Platelet count 376 × 103/µL 150–500 × 103/µL

Reticulocyte count 32% 0.56–2.72%

Blood chemistries

Venous blood gas

pH 7.19 7.32–7.42

PCO2 19 mm Hg 40–50 mm Hg

Bicarbonate (HCO3) 7 mEq/L 22–25 mEq/L

Glucose 36 mg/dL 60–105 mg/dL

Blood urea nitrogen (BUN) 50 mg/dL 6–17 mg/dL

Creatinine 0.7 mg/dL 0.2–0.6 mg/dL

Lactate dehydrogenase (LDH) 2042 U/L 150–360 U/L

Liver function tests

Bilirubin (total) 3.7 mg/dL 0.2–1.2 mg/dL

Aspartate transaminase (AST, SGOT) 1388 U/L 20–60 U/L

Alanine transaminase (ALT, SGPT) 689 U/L 0–33 U/L

Coagulation tests

Prothrombin time (PT) 49 seconds 10.8–13.8 seconds

Partial thromboplastin time (PTT) 27 seconds 25.4–35 seconds

Factor II 38% 50–150%

PIVKA II 0 U/dL 0 U/dL

Factor V 14% 63–116%

Factor VII 4% 52–120%

Factor VIII 363% 58–132%

Fibrinogen 276 mg/dL 202–404 mg/dL

D dimer 1390 ng/mL >255 ng/mL

PIVKA II =protein-induced by vitamin K absence or antagonist II.


AIHA with anti-D specificity

The incidence of both warm and cold AIHA increases with patient age. But in pediatric patients the highest incidence of cold AIHA, including cold agglutinin syndrome and PCH, is in patients younger than the age of 4, likely because of their association with common childhood infections such as viral respiratory infections and Mycoplasma pneumoniae.9 In most case series, warm AIHA constitutes about 60 percent of the cases in pediatric patients.10 Some series report that primary AIHA is more common, whereas others demonstrate that secondary AIHA is more common in pediatric patients.5,9,10

One of the largest series showed that the majority of cases of AIHA are caused by warm antibodies, 64 percent, versus 26 percent attributable to cold antibody and 10 percent attributable to mixed antibodies (n = 100).10 This series also demonstrated that approximately half of the patients (54%) had an underlying disease process such as autoimmune disease, idiopathic thrombocytopenia, neoplasia, or hemoglobinopathy, whereas the remaining 46 percent of patients had primary (idiopathic) AIHA. The most common autoimmune disorders associated with AIHA include lupus, Evan’s syndrome, autoimmune lymphoproliferative syndrome (ALPS), and other immunodeficiencies. The majority of patients with warm antibody disease, 59 percent (38/64), had primary AIHA,10 similar to a series of 26 children in India that showed that 65 percent had primary AIHA.11 Children with primary AIHA are more likely than adults to have a self-resolving, relatively short course (less than 6 months). Patients who present at younger than 2 years and older than 12 years are at risk for a chronic course.12

The discrepancy between the patient’s e negative phenotype and e positive genotype likely represents an altered RHCE gene. This altered gene may place the patient at a higher risk of developing alloantibodies to the e antigen; however, it should not play a role in the development of autoantibodies to D. D is the most immunogenic antigen when development of alloantibodies occurs after an exposure; however, it is not commonly associated with autoantibody development. Antibodies against antigens in the Rh system, such as anti-e, anti-E, and anti-c, are most commonly implicated in warm AIHA.2–5,10,11,13,14 Patients frequently have multiple anti-Rh antibodies or panreactive Rh antibodies, but having only anti-D is rare in AIHA.15

There are case reports of patients developing anti-D after solid-organ transplant, although these are not true autoantibodies as they were passively transferred by donor lymphocytes.16 Autoantibodies to D have been found in the setting of myelodysplasia17 and as a paraneoplastic syndrome associated with breast carcinoma and ovarian teratoma.18,19

There was an additional case report of IgM anti-D in the setting of non-Hodgkin lymphoma.20 To date, there is only one case of primary AIHA caused by anti-D in an adult patient.15 To our knowledge, the case presented here is a unique case of primary AIHA with an IgG antibody toward the D antigen in a pediatric patient.

Acknowledgments

The authors wish to acknowledge the staff of the Reference Laboratory at Bonfils Blood Center and Karen Evans, MT(ASCP)SBB, for their work in performing the serologic studies on the patient, and Christian Snyder for his help in manuscript preparation.

References

1. Laski B, Wake EJ, Bain HW, Gunson HH. Autohemolytic anemia in young infants. J Pediatr 1961;59:42–6.

2. Gross S, Newman AJ. Auto-immune anti-D specificity in infancy. Am J Dis Child 1964;108:181–3.

3. Gehrs BC, Friedberg RC. Autoimmune hemolytic anemia. Am J Hematol 2002;69:258–71.

4. Blackall DP. Warm-reactive autoantibodies in pediatric patients: clinical and serologic correlations. J Pediatr Hematol Oncol 2007;29:792–6.

5. Petz LD, Garratty G. Immune hemolytic anemias. 2nd ed. Philadelphia: Churchill Livingstone, 2004:231–44, 341–4.

6. Leddy JP, Falany JL, Kissel GE, Passador ST, Rosenfeld SI. Erythrocyte membrane proteins reactive with human (warm-reacting) anti-red cell autoantibodies. J Clin Invest 1993; 91:1672–80.

7. Notarangelo LD. Primary immunodeficiencies (PIDs) presenting with cytopenias. Hematology Am Soc Hematol Educ Program 2009:139–43.

8. Aladjidi N, Leverger G, Leblanc T, et al. New insights into childhood autoimmune hemolytic anemia: a French national observational study of 265 children. Haematologica 2011;96:655–63.

9. Sokol RJ, Booker DJ, Stamps R. The pathology of autoimmune haemolytic anaemia. J Clin Pathol 1992;45:1047–52.

10. Vaglio S, Arista MC, Perrone MP, et al. Autoimmune hemolytic anemia in childhood: serologic features in 100 cases. Transfusion 2007;47:50–4.

11. Naithani R, Agrawal N, Mahapatra M, Kumar R, Pati HP, Choudhry VP. Autoimmune hemolytic anemia in children. Pediatr Hematol Oncol 2007;24:309–15.

12. Sackey K. Hemolytic anemia: part 1. Pediatr Rev 1999;20: 152–9.

13. Packman CH. Hemolytic anemia due to warm autoantibodies. Blood Rev 2008;22:17–31.

14. Garratty G. Specificity of autoantibodies reacting optimally at 37 degrees C. Immunohematology 1999;15:24–40.

15. Adams J, Moore VK, Issitt PD. Autoimmune hemolytic anemia caused by anti-D. Transfusion 1973;13:214–18.


Notice to ReadersImmunohematology is printed on acid-free paper.

For information concerning Immunohematology or the Immunohematology Methods and Procedures manual, contact us by e-mail at [email protected]

R.S. Bercovitz et al.

16. Schwartz D, Götzinger P. Immune-haemolytic anaemia (IHA) after solid organ transplantation due to rhesus antibodies of donor origin: report of 5 cases. Beitr Infusionsther 1992; 30:367–9.

17. Yermiahu T, Dvilansky A, Avinoam I, Benharroch D. Acquired auto-anti D in a patient with myelodysplastic syndrome. Sangre (Barc) 1991;36:47–9.

18. Adorno G, Girelli G, Perrone MP, et al. A metastatic breast carcinoma presenting as autoimmune hemolytic anemia. Tumori 1991;77:447–8.

19. Schönitzer D, Kilga-Nogler S. Apparent ‘auto’-anti-DE of the IgA and IgG classes in a 16-year-old girl with a mature cystic ovarian teratoma. Vox Sang 1987;53:102–4.

20. Longster GH, Johnson E. IgM anti-D as auto-antibody in a case of ‘cold’ auto-immune haemolytic anaemia. Vox Sang 1988;54:174–6.

Rachel S. Bercovitz, MD, Transfusion Medicine Fellow, Bonfils Blood Center, Denver, CO, University of Colorado Denver, Anschutz Medical Campus, and the Center for Cancer and Blood Disorders, Children’s Hospital Colorado, Aurora, CO;. Margaret Macy, MD, Assistant Professor of Pediatrics, University of Colorado Denver, Anschutz Medical Campus, and Pediatric Oncologist, Center for Cancer and Blood Disorders, Children’s Hospital Colorado, Aurora, CO; and Daniel R. Ambruso, MD (corresponding author), Medical Director for Research and Education, Bonfils Blood Center, 717 Yosemite Street, Denver, CO, 80230, Professor of Pediatrics, University of Colorado Denver, Anschutz Medical Campus, and Pediatric Hematologist, Center for Cancer and Blood Disorders, Children’s Hospital Colorado, Aurora, CO.

Important Notice About Manuscripts for Immunohematology

Please e-mail all manuscripts to [email protected]

Attention: SBB and BB Students

You are eligible for a free 1-year subscription to

Immunohematology.

Ask your education supervisor to submit the name and

complete address for each student and the inclusive dates

of the training period to [email protected]


An update on the GLOB blood group system and collectionÅ. Hellberg, J.S. Westman, and M.L. Olsson

Revie w

The P blood group antigen of the GLOB system is a glycolipid structure, also known as globoside, on the red blood cells (RBCs) of almost all individuals worldwide. The P antigen is intimately related to the Pk and NOR antigens discussed in the review about the P1PK blood group system. Naturally occurring anti-P is present in the serum of individuals with the rare globoside-deficient phenotypes p, P1

k, and P2k and has been implicated in

hemolytic transfusion reactions as well as unfavorable outcomes of pregnancy. The molecular genetic basis of globoside deficiency is absence of functional P synthase as a result of mutations at the B3GALNT1 locus. Other related glycolipid structures, the LKE and PX2 antigens, remain in the GLOB blood group collection pending further evidence about the genes and gene products responsible for their synthesis. Immunohematology 2013;29:19–24.

History

Reading the early literature about what are currently known as the P1PK and GLOB blood group systems is a bit complicated because of evolving name changes based on increasing knowledge that has improved previously drawn conclusions. The P antigen is also known as globoside, a name given because it was discovered and characterized first on red blood cells (RBCs) (globule rouge is French for red blood cell). The antibody now referred to as anti-P1 was originally called anti-P and was initially recognized in 1955 as a component of anti-Tja (now designated anti-PP1Pk), the mix of naturally occurring antibodies in sera of people with the p phenotype.1 The first globoside-deficient individual described had the rare P1

k phenotype and was reported in 1959 by Matson et al.2 However, the first paper highlighting the relationship between the P1, Pk, and P antigens, as well as determining the biochemical structure of these glycolipids, was published by Naiki et al.3 15 years later.

Terminology and Nomenclature

The P antigen is so far the only member of the GLOB blood group system acknowledged by the International Society of Blood Transfusion (ISBT) Working Party for Red Cell Immunogenetics and Blood Group Terminology as system number 028. The antigen was first assigned to the P blood

group system (as antigen no. 003002), which is the former name of what is now known as the P1PK system (ISBT no. 003), today housing the P1, Pk, and NOR antigens. Thereafter, P was moved to the GLOB blood group collection (ISBT no. 209, antigen no. 209001) when it was clear that P1 and P were only distant relatives. Finally, it was promoted to form a blood group system of its own when the molecular genetic basis for P antigen synthesis was established in 2002 (antigen no. 028001).4 Other names sometimes used instead of P, especially in the biochemical and glycobiological literature, include globoside, globotetraosylceramide, and Gb4. It should be noted that P was the name formerly used for what is now known as the P1 antigen. The LKE antigen remains in the GLOB collection (ISBT no. 209), together with the newly added PX2 antigen.5 The current terminology of the GLOB blood group system and collection is summarized in Table 1.

Molecular Genetic Basis of P Antigen

A gene, first cloned in 1998 as a member of the 3-β-galactosyltransferase family6 but later shown to be a 3-β-N-acetylgalactosaminyltransferase, was suggested as the globoside (Gb4, P) synthase.7 This gene (B3GALNT1, formerly known as B3GALT3) is located on the long arm of chromosome 3 (3q26.1) and has at least five exons with the entire coding region in the last exon (Fig. 1). The gene encodes the enzyme that synthesizes the P antigen. So far, 12 mutations have been found to abolish P synthase activity (Table 2).4,8,9 Only one noncritical polymorphism has been described in the exons of this gene, in contrast to the Pk synthase gene (A4GALT), which varies more in the population.

Table 1. The GLOB blood group system and collection*

Antigen ISBT system no. ISBT collection no. ISBT antigen no.

P GLOB 028 028001

LKE GLOB 209 209003

PX2 GLOB 209 209004

*209001 and 209002 are obsolete (previously used for P and Pk).


Antigens and Antibodies in the System

The P antigen is present on RBCs of all individuals except ones with the rare phenotypes p, P1

k, or P2k. The P1

k phenotype lacks the P antigen on the cell surface, whereas the P2

k phenotype lacks both the P and P1 antigens. The p phenotype, on the other hand, lacks Pk, P, and P1 antigens. Additional phenotypes might exist as Kundu et al. described individuals with either a weak P or weak Pk antigen,10,11 but the genetic basis of this is not known and such individuals appear to be rare.

The P1k and P2

k phenotypes are even rarer than the p phenotype but appear to be more common in Japan.12 The first individual described with the Pk phenotype was of Finnish origin, and it also appears that Finland has a higher prevalence of the rare P1

k and P2k phenotypes than do other

populations.13,14

The antigen is well developed at birth13 and is the most abundant neutral glycolipid in the RBC membrane with approximately 15 × 106 antigens per cell,15 probably the

highest antigen site density for any blood group antigen. None of the enzymes or chemicals used to treat test RBCs for antigen modification can abolish its expression, but many, including papain and trypsin, markedly enhance it. RBCs from P1 individuals express more Pk antigen compared with P2 individuals, but the amount of P antigen is similar for both phenotypes.15 However, because the Pk antigen constitutes the precursor for P synthase, it is possible that the P antigen site density is somewhat lower on P2 individuals, but substantial interindividual variation exists.

Naturally occurring antibodies of IgM or IgG classes are formed when the P antigen is missing. In analogy with ABO antibodies, anti-P can cause hemolytic transfusion reactions of the acute intravascular type, although no clinically significant hemolytic disease of the fetus and newborn has been reported. Nevertheless, early spontaneous abortions occur with a higher frequency among women with p and P1

k or P2k phenotype; this

is a phenomenon most likely attributable to the IgG component of anti-P attacking certain cells in the placenta, where globoside

Table 2. A summary of all mutations found to date in the B3GALNT1 gene4,8,9

nt. position 202 203 292–293 433 449 456 537–538 598 648 797 811 959

Consensus C G A C A T A T A A G G

ISBT allele name Origin Acc. no.

GLOB*01N.01 Finland T AF494103

GLOB*01N.09 Mahgreb delG FR871173

GLOB*01N.02 Italy insA AY505344

GLOB*01N.03 USA T AY505345

GLOB*01N.12 Turkish G FR871174

GLOB*01N.11 Saudi Arabian G FR871176

GLOB*01N.04 Arabic insA AF494104

GLOB*01N.10 French Caucasian delT* FR871175

GLOB*01N.05 Canada C AY505346

GLOB*01N.06 France C AF494106

GLOB*01N.07 Europe A AF494105

GLOB*01N.08 Switzerland A AY505347

aa position 68 68 98 145 150 152 180 200 216 266 271 320

Consensus R R R R D Y D S R E G W

Change stop fs fs stop G stop fs fs S A R stop

nt = nucleotide, Acc. no. = accession number, aa = amino acid, fs = frameshift. *Additional mutation present in allele 376G>A (D126N).

Å. Hellberg et al.

Fig. 1 The genomic organization of the P (B3GALNT1) gene, not drawn to scale. The numbers in the boxes represent the exon number and numbers below boxes represent the number of base pairs in the exon. The black box shows the open reading frame (ORF).

1 2 3 4 55′ 3′

90 2906

ATG TAA331 aa

88 91 95

B3GALNT1

ORF


GLOB blood group system review

is highly expressed.16,17 Plasmapheresis to reduce the maternal antibody titer has been successfully used in selected cases.18 Autoanti-P can be formed after viral infections (see Disease Associations).

Biochemistry

P antigen belongs to the globoseries of glycolipids. Its structure was first elucidated by Naiki et al., and it was later shown by Yang et al. that glycolipids are the sole carriers of P antigen on RBCs.3,19 The P antigen is made with the addition of N-acetylgalactosamine (GalNAc) by a 3-β-N-acetylgalactosaminyltransferase (β3GalNAc-T1 classified as EC 2.4.1.79 but also known as P or Gb4 synthase) using Pk (Gb3) as a precursor (Fig. 2). This enzyme is a type II transmembrane glycoprotein with 331 amino acids and five potential N-glycosylation sites. Similar to other glyco-syltransferases, it resides in the Golgi apparatus, where it is part of the glycosylation machinery of the cell. The crystal structure of this enzyme has not yet been solved, and regulation of its transcription is not well understood either.

Tissue Distribution

Expression of the P antigen has been studied in several species.20–22 Studies of mouse tissues show expression patterns similar to those of humans, although there are some differences.21

The P antigen is expressed on a number of other cells in addition to RBCs, but various studies using different antibodies or methods have come to different conclusions about where it is expressed. Soluble P substance has also been detected in plasma.23,24 Small amounts of Pk, together with higher amounts of P, are present on intestinal epithelial cells.25 P antigen expression is also seen on megakaryocytes and fibroblasts but not on lymphocytes and granulocytes according to von dem Borne et al.,26 whereas Shevinsky et al.27 could not detect P on fibroblasts. In another study, P was detected in 11 of 16 investigated tissues, especially those of mesodermal origin.28 Placenta and fetal heart and kidney are other tissues where P is present.17 The P antigen is expressed on embryonal carcinoma cells and, according to Song et al.,29 is a possible initiator of signal transduction through AP-1 and CREB, associated with cell adhesion. High expression of the B3GALNT1 gene has been demonstrated in brain and heart, moderate expression in lung, placenta, and testis, and low expression in kidney, liver, spleen, and stomach.7

Disease Associations

Parvovirus B19, which causes the so-called fifth disease, uses erythroid precursor cells expressing high levels of P antigen for its replication.30,31 Infection during pregnancy with B19 can give rise to fetal anemia and, in some cases, fetal loss as a result of inhibition of hematopoiesis.32 Paroxysmal cold hemoglobinuria, which can be seen in children after a viral infection, can be caused by an autoanti-P. This complement-fixing and cold-reactive antibody, also called Donath-Landsteiner antibody, lyses autologous P-positive erythrocytes.33 P-fimbriated uropathogenic Escherichia coli that express Pap-encoded adhesins bind to glycolipid structures containing the Gal4Gal motif and can cause urinary tract infections such as cystitis and pyelonephritis. This includes the P antigen and other globoseries antigens like Pk, as well as the neolactoseries P1 antigen.34,35

Related Antigens in the GLOB Collection

The LKE (Luke) AntigenThe Luke (LKE, also known as SSEA-4 or

monosialogalactosylgloboside, MSGG) antigen was found in 196536 and named LKE in 1986 after the first patient with anti-LKE. Since 1990, LKE belongs to the GLOB collection (ISBT no. 209). The antigen, which was given number 209003, is formed by sequential addition of a galactose (Gal) moiety and thereafter sialic acid (NeuAc) to the P antigen to form

Fig. 2 Schematic summary of the synthesis of P antigen. The a- or β-linkages are shown along with the informative numbers in the 1,3 or 1,4 glycosidic bonds.

Glucose (Glc) Galactose (Gal) N-acetylgalactosamine (GalNAc)


Å. Hellberg et al.

galactosylgloboside (Gb5) and LKE, respectively. Although the enzyme responsible for Gb5 synthesis is thought to be encoded by B3GALT5, Gb5 is not known to elicit an antibody response and is therefore not classified as a blood group antigen. On the other hand, anti-LKE is found in LKE-negative individuals, but the enzyme responsible for synthesis of LKE has not yet been identified, which means LKE remains in the GLOB collection. Anti-LKE is a rare finding, and no clinically significant reactions have been reported. There are three different LKE phenotypes: strongly positive (80–90% of individuals), weakly positive (10–20%), and negative (1–2%). In addition to RBCs, LKE is expressed on endothelial cells, smooth muscle cells, kidney cells, platelets, and mesenchymal stem cells.37–39 Individuals with the LKE-negative phenotype express more Pk antigen compared with individuals with LKE-positive phenotype.40

The PX2 AntigenThe PX2 antigen, a high-prevalence antigen originally

designated as the x2 glycolipid, was first mentioned by Kannagi et al.,41 and the structure was later characterized further by Thorn et al.,42 who also found it elevated on RBCs with the p phenotype. It is formed by addition of a β3GalNAc to paragloboside, the same precursor used by the FUT1 enzyme to make H antigen or P1 synthase to make P1. There are also sialylated variants of x2 described.42

In individuals with the P1k phenotype only anti-P is

expected in plasma according to textbooks, but it was recently reported that another naturally occurring antibody specificity could give rise to a weak or variable crossmatch reactivity with p phenotype RBCs owing to their elevated amounts of x2 glycolipid.5 At the same time, all P1

k and P2k RBCs

were compatible. In the absence of a functional β3GalNAc transferase because of B3GALNT1 mutations in P1

k and P2k

phenotype individuals, it is hypothesized that paragloboside can no longer be extended to form PX2 but this has yet to be proved. In the meantime, the PX2 antigen has been assigned to the GLOB collection (ISBT no. 209).43

The biochemical and genetic relationship between the GLOB system and collection antigens discussed in this review is summarized in Figure 3.

Summary

The GLOB blood group system currently consists of only one antigen, P, or globoside, but is closely associated with the antigens in the P1PK blood group system as well as the GLOB collection antigens. The P antigen can act as a receptor for

various pathogens and anti-P can cause hemolytic transfusion reactions, spontaneous recurrent abortions, and autoimmune anemia as a result of lysis of erythroid progenitors.

References

1. Sanger R. An association between the P and Jay systems of blood groups. Nature 1955;176:1163–4.

2. Matson GA, Swanson J, Noades J, Sanger R, Race RR. A new antigen and antibody belonging to the P blood group system. Amer J Hum Genet 1959;11:26–34.

3. Naiki M, Marcus DM. Human erythrocyte P and Pk blood group antigens: identification as glycosphingolipids. Biochem Biophys Res Commun 1974;60:1105–11.

4. Hellberg Å, Poole J, Olsson ML. Molecular basis of the globoside-deficient P(k) blood group phenotype. Identification of four inactivating mutations in the UDP-N-acetylgalactosamine: globotriaosylceramide 3-beta-N-acetylgalactosaminyltransferase gene. J Biol Chem 2002;277: 29455–9.

5. Olsson ML, Peyrard T, Hult AK, et al. PX2: a new blood group antigen with implications for transfusion recommendations in P1k and P2k individuals (abstract). Vox Sang 2011;101 (Suppl 1):53.

6. Amado M, Almeida R, Carneiro F, et al. A family of human beta3-galactosyltransferases. Characterization of four members of a UDP-galactose:beta-N-acetyl-glucosamine/beta-N-acetyl-galactosamine beta-1,3-galactosyltransferase family. J Biol Chem 1998;273:12770–8.

7. Okajima T, Nakamura Y, Uchikawa M, et al. Expression cloning of human globoside synthase cDNAs. Identification of beta3Gal-T3 as UDP-N-acetylgalactosamine:globotriao-sylceramide beta1,3-N-acetylgalactosaminyltransferase. J Biol Chem 2000;275:40498–503.

Ceramide

ß-Glucosylceramide

Lactosylceramide

Lactotriaosylceramide

Paragloboside

PX2H

A B

P1 FORS

P, Gb4

Gb5

Globo-H

Globo-A Globo-B

LKE

NOR

Pk, Gb33-ß-N-acetylgalactosaminyl-transferase (B3GALNT1)

Fig. 3 The biochemical and genetic relationship between the antigens discussed in this review and other related carbohydrate antigens.


GLOB blood group system review

8. Hellberg Å, Ringressi A, Yahalom V, Säfwenberg J, Reid ME, Olsson ML. Genetic heterogeneity at the glycosyltransferase loci underlying the GLOB blood group system and collection. Br J Haematol 2004;125:528–36.

9. Westman JS, Hellberg Å, Peyrard T, Hustinx H, Thuresson B, Olsson ML. Molecular dissection of rare phenotypes in the P1PK and GLOB histo-blood group systems with novel genetic markers (abstract). Transfusion 2011;51(Suppl 3):24A.

10. Kundu SK, Steane SM, Bloom JE, Marcus DM. Abnormal glycolipid composition of erythrocytes with a weak P antigen. Vox Sang 1978;35:160–7.

11. Kundu SK, Evans A, Rizvi J, Glidden H, Marcus DM. A new Pk phenotype in the P blood group system. J Immunogenet 1980;7:431–9.

12. Nakajima H, Yokota T. Two Japanese families with Pk members. Vox Sang 1977;32:56–8.

13. Race RR, Sanger R. Blood groups in man. Oxford, UK: Blackwell Scientific Publications, 1975.

14. Kortekangas AE, Kaarsalo E, Melartin L, et al. The red cell antigen Pk and its relationship to the P system: the evidence of three more Pk families. Vox Sang 1965;10:385–404.

15. Fletcher KS, Bremer EG, Schwarting GA. P blood group regulation of glycosphingolipid levels in human erythrocytes. J Biol Chem 1979;254:11196–8.

16. Cantin G, Lyonnais J. Anti-PP1Pk and early abortion. Transfusion 1983;23:350–1.

17. Lindström K, Von Dem Borne AE, Breimer ME, et al. Glycosphingolipid expression in spontaneously aborted fetuses and placenta from blood group p women. Evidence for placenta being the primary target for anti-Tja-antibodies. Glycoconj J 1992;9:325–9.

18. Fernández-Jiménez MC, Jiménez-Marco MT, Hernández D, González A, Omeñaca F, de la Cámara C. Treatment with plasmapheresis and intravenous immunoglobulin in pregnancies complicated with anti-PP1Pk or anti-K immunization: a report of two patients. Vox Sang 2001;80: 117–20.

19. Yang Z, Bergström J, Karlsson KA. Glycoproteins with Gal alpha 4Gal are absent from human erythrocyte membranes, indicating that glycolipids are the sole carriers of blood group P activities. J Biol Chem 1994;269:14620–4.

20. Keusch JJ, Manzella SM, Nyame KA, Cummings RD, Baenziger JU. Cloning of Gb3 synthase, the key enzyme in globo-series glycosphingolipid synthesis, predicts a family of alpha 1, 4-glycosyltransferases conserved in plants, insects, and mammals. J Biol Chem 2000;275:25315–21.

21. Fujii Y, Numata S, Nakamura Y, et al. Murine glycosyltransferases responsible for the expression of globo-series glycolipids: cDNA structures, mRNA expression, and distribution of their products. Glycobiology 2005;15:1257–67.

22. Zoja C, Corna D, Farina C, et al. Verotoxin glycolipid receptors determine the localization of microangiopathic process in rabbits given verotoxin-1. J Lab Clin Med 1992;120:229–38.

23. Issitt PD, Anstee DJ. Applied blood group serology. 4th ed. Miami, FL: Montgomery Scientific Publications, 1998.

24. Svennerholm E, Svennerholm L. The separation of neutral blood-serum glycolipids by thin-layer chromatography. Biochim Biophys Acta 1963;70:432–41.

25. Zumbrun SD, Hanson L, Sinclair JF, et al. Human intestinal tissue and cultured colonic cells contain globotriaosylceramide

synthase mRNA and the alternate Shiga toxin receptor globotetraosylceramide. Infect Immun 2010;78:4488–99.

26. von dem Borne AE, Bos MJ, Joustra-Maas N, et al. A murine monoclonal IgM antibody specific for blood group P antigen (globoside). Br J Haematol 1986;63:35–46.

27. Shevinsky LH, Knowles BB, Damjanov I, Solter D. Monoclonal antibody to murine embryos defines a stage-specific embryonic antigen expressed on mouse embryos and human teratocarcinoma cells. Cell 1982;30:697–705.

28. Cooling LL, Koerner TA, Naides SJ. Multiple glycosphingolipids determine the tissue tropism of parvovirus B19. J Infect Dis 1995;172:1198–205.

29. Song Y, Withers DA, Hakomori S. Globoside-dependent adhesion of human embryonal carcinoma cells, based on carbohydrate-carbohydrate interaction, initiates signal transduction and induces enhanced activity of transcription factors AP1 and CREB. J Biol Chem 1998;273:2517–25.

30. Brown KE, Hibbs JR, Gallinella G, et al. Resistance to parvovirus B19 infection due to lack of virus receptor (erythrocyte P antigen). N Engl J Med 1994;330:1192–6.

31. Young NS, Brown KE. Parvovirus B19. N Engl J Med 2004; 350:586–97.

32. de Jong EP, Walther FJ, Kroes AC, Oepkes D. Parvovirus B19 infection in pregnancy: new insights and management. Prenat Diagn 2011;31:419–25.

33. Heddle NM. Acute paroxysmal cold hemoglobinuria. Transfus Med Rev 1989;3:219–29.

34. Moulds JM, Moulds JJ. Blood group associations with parasites, bacteria, and viruses. Transfus Med Rev 2000;14:302–11.

35. Ziegler T, Jacobsohn N, Fünfstück R. Correlation between blood group phenotype and virulence properties of Escherichia coli in patients with chronic urinary tract infection. Int J Antimicrob Agents 2004;24(Suppl 1):S70–5.

36. Tippett P, Sanger R, Race RR, Swanson J, Busch S. An agglutinin associated with the P and the ABO blood group systems. Vox Sang 1965;10:269–80.

37. Gillard BK, Jones MA, Marcus DM. Glycosphingolipids of human umbilical vein endothelial cells and smooth muscle cells. Arch Biochem Biophys 1987;256:435–45.

38. Stroud MR, Stapleton AE, Levery SB. The P histo-blood group-related glycosphingolipid sialosyl galactosyl globoside as a preferred binding receptor for uropathogenic Escherichia coli: isolation and structural characterization from human kidney. Biochemistry 1998;37:17420–8.

39. Cooling LL, Zhang D, Koerner TA. Human platelets express gangliosides with LKE activity and ABH blood group activity. Transfusion 2001;41:504–16.

40. Cooling LL, Kelly K. Inverse expression of P(k) and Luke blood group antigens on human RBCs. Transfusion 2001;41: 898–907.

41. Kannagi R, Fukuda MN, Hakomori S. A new glycolipid antigen isolated from human erythrocyte membranes reacting with antibodies directed to globo-N-tetraosylceramide (globoside). J Biol Chem 1982;257:4438–42.

42. Thorn JJ, Levery SB, Salyan ME, et al. Structural characterization of x2 glycosphingolipid, its extended form, and its sialosyl derivatives: accumulation associated with the rare blood group p phenotype. Biochemistry 1992;31:6509–17.

43. Storry JR, Castilho L, Daniels G, et al. International Society of Blood Transfusion Working Party on red cell immunogenetics


and blood group terminology: Berlin report. Vox Sang 2011;101:77–82.

Åsa Hellberg, PhD (corresponding author), Coordinator at the Nordic Reference Laboratory for Genomic Blood Group Typing, Department of Clinical Immunology and Transfusion Medicine, University and Regional Laboratories, SE-221 85 Lund, Sweden, and Division of Hematology and Transfusion Medicine, Department of Laboratory Medicine, Lund University, SE-221 00 Lund, Sweden, Julia S. Westman, MSc, PhD student, Division of Hematology and

Å. Hellberg et al.

Transfusion Medicine, Department of Laboratory Medicine, Lund University, and Martin L. Olsson, MD, PhD, Medical Director of the Nordic Reference Laboratory for Genomic Blood Group Typing, Professor and Senior Consultant at the Department of Clinical Immunology and Transfusion Medicine, University and Regional Laboratories, and Division of Hematology and Transfusion Medicine, Department of Laboratory Medicine, Lund University, Lund, Sweden.


P1PK: The blood group system that changed its name and expandedÅ. Hellberg, J.S. Westman, B. Thuresson, and M.L. Olsson

Revie w

The antigens in the P1PK blood group system are carried on glycosphingolipids. The system currently includes three different antigens, P1, Pk, and NOR. The P1 antigen was disovered in 1927 by Landsteiner and Levine, and Pk and NOR were described in 1951 and 1982, respectively. As in the ABO system, naturally occurring antibodies of the immunoglobulin (Ig) M or IgG class, against the missing carbohydrate structures, can be present in the sera of people lacking the corresponding antigen. Anti-P1 is generally a weak and cold-reactive antibody not implicated in hemolytic transfusion reaction (HTR) or hemolytic disease of the fetus and newborn while Pk antibodies can cause HTR, and anti-NOR is regarded as a polyagglutinin. A higher frequency of miscarriage is seen in women with the rare phenotypes p, P1

k, and P2

k. Furthermore, the Pk and P1 antigens have wide tissue distributions and can act as host receptors for various pathogens and toxins. Why p individuals lack not only Pk and P expression but also P1 has been a longstanding enigma. Recently, it was shown that the same A4GALT-encoded galactosyltransferase synthesizes both the P1 and Pk antigens and that a polymorphism in a new exon in this gene predicts the P1 and P2 phenotypes. Immunohematology 2013;29:25–33.

Historical Aspects

In 1927, Landsteiner and Levine1 found antibodies to an antigen they called P (now known as the P1 antigen). In 1951, the Jay blood group “system” was discovered, containing one antigen, Tja, and its corresponding antibody, anti-Tja.2 Four years later, Sanger3 found a relationship between the P (P1) and the Jay systems. The P (P1) antigen was absent from all red blood cells (RBCs) with the rare Tj(a–) phenotype. The antigen P was then renamed to P1 and the Tj(a–) phenotype became the p (or PP1Pknull) phenotype.3 Anti-P was originally recognized in 1955 as a component of anti-Tja (now designated anti-PP1Pk), the mix of naturally occurring antibodies in sera of people with the p phenotype.3 The first individual lacking the P antigen was described in 1959 by Matson et al.,4 and in the same paper the Pk antigen and anti-Pk were first mentioned. The authors also noted the association with the P blood group system.4

Nevertheless, the relationship between the different antigens was not fully understood at that time. In the fifth edition of Blood Groups in Man,5 the authors declare “we began to feel lost in amazement at the complexity of the P system.”

Indeed, this feeling has lingered (and still does) among many of us who work with these questions. However, the first paper explaining the relationship between the P1, Pk, and P antigens, as well as determining the biochemical structure of these glycolipids, was published in 1974 by Naiki et al.6 See Figure 1 for a schematic representation of the antigens discussed in this review.

Nomenclature

The history of nomenclature for the P1 and Pk antigens is complicated and sometimes confusing. The P1 antigen, originally called P, used to belong to the P blood group system and the Pk antigen to the GLOB collection (ISBT no. 209). However, the P antigen (globoside, Gb4) did not belong to the original P system, but has now been made the only antigen in the GLOB blood group system (ISBT no. 028).7,8 Now that it is clear that the A4GALT gene is responsible for both the P1 and Pk antigens (see later section), the Pk antigen has joined the P1 antigen and the system name has been changed to the P1PK blood group system (ISBT no. 003) to reflect the two

P1 Pk P NOR

Gal

Gal

Cer

Glc

Gal

Cer

Glc

Gal

GalNAc

Gal

Gal

Gal

Cer

Glc

GlcNAc Gal

Cer

Glc

Gal

Gal

GalNAc

Fig. 1 The antigens in the P1PK blood group system, together with the related P antigen.


major antigens in it (Table 1).9 The NOR antigen was assigned to the P1PK system by the ISBT Working Party on Red Cell Immunogenetics and Blood Group Terminology at the 2012 annual meeting in Cancun (Table 1).10 The related antigens LKE and PX2, as well as P, are discussed in the GLOB blood group system review also published in this issue.11

Table 1. The P1PK blood group system

Antigen Blood group system ISBT number

P1 P1PK 003001

Pk P1PK 003003

NOR P1PK 003004

003002 is obsolete.

The Pk antigen is also known as the Burkitt lymphoma antigen and has been classified as CD77.12 Yet another name, Gb3, is often used when the Pk structure is expressed on cells other than RBCs. This is in analogy with Gb4 being an alternative and more biochemically useful name for P.

Biochemistry

The P1PK and GLOB antigens are related and are structurally of a glycan nature. Depending on which carbohydrate residues are added to lactosylceramide (LacCer), different series of glycosphingolipids are formed. Glycosphingolipids were first described by Thudichum in 1884, and he named them after the inscrutable Egyptian Sphinx, as both the structure and the function were unknown at the time.13 These molecules consist of a sugar moiety with a lipid ceramide tail; they make up the outer leaflet of cell membranes together with phospholipids, cholesterol, and glycerolipids. Lipids are organised in microdomains such as glycosynapses and lipid rafts.14

The P1PK antigens, as well as the GLOB system and collection antigens, are formed on the same precursor, LacCer, which is the most common precursor for glycosphingolipids in mammals and birds.15 Pk (other names include globotriaosylceramide, Gb3, ceramide trihexoside, and CTH) belongs to the globo-series, and P1 (also known as nLc5) to the neolacto/paraglobo-series.

The biochemistry of the P1 blood group antigen was partially elucidated by Morgan and Watkins16 in the 1960s by a series of experiments on hydatid cyst fluid from sheep infected by the tapeworm Echinococcus granulosus. They purified P1-specific components and showed that a glycoprotein containing the Galα1-4Galβ1-4GlcNAc trisaccharide reacted as a P1 determinant. Some years later, Marcus17 managed to

extract P1 glycolipids from RBCs. In 1974, the Pk structure was identified as CTH by Naiki and Marcus.6

The 4-α-galactosyltransferase (α4Gal-T/P1Pk synthase) catalyzes the transfer of galactose to the galactose residue on LacCer, producing the Pk antigen. In another pathway, the P1 antigen is formed by three sequential glycosylation reactions, the last one performed by the P1Pk synthase. Furthermore, other glycosyltransferases form additional blood group antigens associated with the P1PK/GLOB systems and collection, such as Forssman (FORS1), globo-H, and globo-A (Fig. 2).18–20

It has been debated whether the Pk and P1 antigens exist on glycoproteins in the human RBC membrane, but according to Yang et al.21 glycolipids are the sole carriers of these antigens on RBCs.

Antigens and Antibodies in the System

Different combinations of the P1, P, and Pk antigens give rise to the following phenotypes: P1, P2, P1

k, P2k, and p (Table

2). The prevalence of the P1 phenotype varies among different ethnic groups, ranging from 90 percent among Africans to 80 percent in whites down to 20 percent in Asians.10,23 On RBCs, P1 expression changes during fetal development. The antigen is found as early as week 12 but weakens during gestation.24 At birth the expression is low, and it takes up to 7 years before full expression is reached.25 The strength of the antigen expression can differ from one person to another, and it was proposed

Ceramide

ß-Glucosylceramide

Lactosylceramide

Lactotriaosylceramide

Paragloboside

PX2H

A B

P1 FORS

P, Gb4

Gb5

Globo-H

Globo-A Globo-B

LKE

NOR

Pk, Gb3

4-α-galactosyltransferase (A4GALT)

4-α-galactosyl-transferase

(A4GALT with Gln211Glu)

4-α-galactosyl-transferase (A4GALT exon 2a 42C>T)

Fig. 2 The biochemical and genetic relationship between the antigens (black boxes) of the P1PK blood group system and other related carbohydrate antigens.

Å. Hellberg et al.


as early as 1953 to be dependent on dosage.26 The discovery of a P1/P2-predictive single-nucleotide polymorphism (SNP) did indeed prove this proposal to be correct, and it could be confirmed with traditional serology, antigen site density measurement by flow cytometry, and quantification of transcription levels by real-time polymerase chain reaction.27

Table 2. A summary of phenotypes and possible antibodies for the P1PK/GLOB blood groups

Phenotype Prevalence Antigens present on RBC Antibodies in serum

P1 20–90% P1, Pk, P —

P2 10–80% Pk, P Anti-P1*

p rare — Anti-PP1Pk

P1k rare P1, Pk Anti-P**

P2k rare Pk Anti-P and P1**

*Not always present, detectable, or both.**Anti-PX2 can be present.22

Individuals with the In(Lu) phenotype express lower amounts of P1 antigen.28 In 2008 Singleton et al.29 found that the majority (21 of 24) of such individuals are heterozygous for mutations in their EKLF gene. This suggests that expression of Pk and P1 on RBCs may depend on binding of the erythroid transcription factor EKLF to the A4GALT promoter.

The Pk antigen was first thought to be a low-prevalence antigen, but later it was understood that nearly all the antigens are masked by addition of β3GalNAc to form globoside, the P antigen.30 RBCs from P1 individuals express more Pk antigen compared with those from P2 individuals.27,31 The rare null phenotype, p, lacks the Pk, P, and P1 antigens (Table 2). However, additional phenotypes might exist: Kundu et al.32,33 described individuals with either a weak P or a weak Pk antigen.

The frequency of the p phenotype has been estimated at 5.8 per million in Europeans,34 but for Swedes in Västerbotten county in Northern Sweden the number of p individuals is significantly higher (141 per million).35 The phenotype also seems to be more common in Japan and among Amish people.36,37 The frequency of p in the donor population in Israel is comparable to that in other populations, but among Jews who immigrated to Israel from North Africa the p phenotype prevalence is 10 times as high.38

Naturally occurring antibodies of the IgM, IgG, or both classes are formed against the missing P1/Pk carbohydrate structures (Table 2), in the same way as they are against the A/B carbohydrate structures in the ABO blood group system.

Anti-P1 is usually a weak and cold-reactive antibody not implicated in hemolytic transfusion reaction (HTR) or hemolytic disease of the fetus and newborn (HDFN). However, some antibodies against P1 have been reported to

react at 37˚C, bind complement, and cause both immediate and delayed HTRs.39–41

Anti-PP1Pk can cause HTR, but HDFN has not been reported. Instead, some of the women with anti-PP1Pk, or with anti-P in the globoside-deficient null phenotypes of the GLOB blood group system, suffer from recurrent spontaneous abortions.42,43 The fetus as well as the newborn express low amounts of the P1, P, and Pk antigens, but the placenta shows high expression and is therefore a possible target of the antibodies that may be the cause of the miscarriages.43 It has been suggested that it is mainly the IgG anti-P component in women with the p phenotype that attacks the fetally derived cells in the placenta.42,43 In a group of 17 female Swedish p individuals, 11 had experienced at least one spontaneous abortion.44

The anti-PP1Pk found in individuals with the p phenotype was previously called anti-Tja, named after Mrs. J in whose serum this antibody specificity was first found in association with a tumor.2

NOR antigen expression, a low-prevalence polyaggluti-nable state, was first described in 1982 in a patient living in Norton, Virginia, hence the name.45 So far, it has only been found in two families, one in the United States and one in Poland.45,46 The RBCs of the initial patient were agglutinated by 75 percent of tested ABO-compatible sera but were not agglutinated by any lectin known to react with other types of polyagglutinable RBCs. The polyagglutination was inhibited by avian P1 substance, and a possible relation to the P1PK blood group system was suggested.45 Family studies showed that the antigen was inherited and that anti-NOR is present in most adult human sera; it has therefore been called a polyagglutinin. It is unknown whether this kind of antibody is clinically significant, because transfusion of NOR+ blood is such a rare event.10

Genetics and Molecular Basis

The P1PK (A4GALT) GeneThe gene encoding the implicated 4-α-galactosyl-

transferase (α4Gal-T, EC 2.4.1.228) was cloned in 2000 by three independent research groups47–49 and was originally only found to give rise to the Pk antigen. The gene is located on the long arm of chromosome 22 and consists of four exons with the whole coding region in the last exon (Fig. 3). This gene encodes a type II transmembrane glycoprotein with 353 amino acids and is highly conserved among different species.48,50 The protein sequence contains a characteristic DXD motif (amino acids 192–194), which is a conserved motif existing in nearly all glycosyltransferases.51 It has been

P1PK blood group system review


proposed that this motif participates in the coordination of the metal ion and therefore also in the binding of the nucleotide part of the uridine diphosphate donor sugar.51 The crystal x-ray structure of the enzyme has not been solved yet, and the type of cation A4GALT required for its function has not been clarified. The promoter region of the gene has binding sequences for the transcription factor AP-1 (TGAGTCA), 160 bp upstream of the transcription start according to a computer search done by Hughes et al.52 In another study, it was shown that the promoter contains three binding sites for Sp1, four GC boxes, but no TATA or CCAAT boxes.53 However, a specific reason why this gene is expressed in erythroid tissues has not been reported.

A major enigma has been why the P1 antigen is always absent in the p phenotype. Different theories have been proposed. One model suggested that the same enzyme, α4Gal-T, is able to transfer galactosyl residues to both LacCer and paragloboside, but to use the latter as the acceptor, a regulatory protein is required.54 Another hypothesis suggested that two different enzymes exist, both of which must be inactivated to cause the p phenotype.54 This model was supposedly supported by a study showing that microsomal enzymes from P1 kidneys could synthesize both P1 and Pk, whereas enzymes from P2 kidneys could only produce Pk.55 A third model proposed a single gene with three alleles, one allele coding for a α4Gal-T using LacCer and paragloboside as the possible acceptors, one allele using LacCer only, and the third allele coding for an inactive form of the transferase.56 However, no polymorphisms in the coding region of the A4GALT gene appeared to explain the P1/P2 phenotypes. Hence the theory with one gene encoding for both P1 and Pk was temporarily abandoned.47 Iwamura et al.57 proposed that transcriptional regulation, caused by two different polymorphisms in the 5 -́regulatory region of A4GALT, might instead be the underlying reason for the P1/P2 phenotypes. However, these findings could not be verified in their own transcription assay or in two other independent studies.58,59

In 2010, it was demonstrated that the A4GALT product could also synthesize P1 antigen.60 A genetic marker with which prediction of P1 versus P2 phenotype could be achieved was reported when a novel A4GALT transcript, containing

exon 1 and a new exon, designated exon 2a, was discovered.27 This exon contains a P1- versus P2-associated polymorphism (42C/T), which also opens a short potential reading frame in P2 alleles. However, the mechanism by which this SNP operates is still unknown, even if 42T was shown to be correlated to lower A4GALT-mRNA levels.27 The authors hypothesize that either the new transcript, the hypothetical P2-related peptide, or the SNP in the genomic sequence itself may downregulate the transcription of A4GALT in P2 individuals. Alternatively, yet other polymorphisms closely linked in cis with this SNP could be involved. Several candidate SNPs occur in close proximity to exon 2a and 42C/T, as do potential binding sites for erythroid transcription factors. No matter which mechanism is active, typing for the 42C/T polymorphism correctly predicted the P1/P2 phenotype in 207 of 208 common Swedish blood donors, and full concordance was recently obtained also in 200 Asian donors (100 P1 and 100 P2).27,61

To date, 29 mutations in 33 alleles of the A4GALT gene have been found to cause the p phenotype.44,62,63 For a complete list of these mutations and alleles, see the homepage of the International Society of Blood Transfusion (ISBT; www.isbtweb.org). Two silent polymorphisms, 903G>C (P301P) and 987G>A (T329T), as well as one missense mutation, 109A>G (M37V), with no apparent effect on the α4Gal-T, have also been documented.47 These polymorphisms were found to be organized into different haplotypes and linked to upstream and downstream SNPs.58 In addition, a few other noncritical polymorphisms have been found in combination with enzyme-crippling, p-associated mutations.

A missense mutation in the A4GALT gene causing an amino acid change, Gln211Glu, was found in individuals positive for the rare NOR antigen.64 This is believed to make the A4GALT-encoded enzyme add a galactose to the P antigen, thereby forming NOR. Thus, in addition to making P1 and Pk antigen, the Gln211Glu form of α4Gal-T also makes NOR. We sequenced the A4GALT genes of NOR+ family members and found that the NOR-specific SNP (631C>G) was linked to the P1-associated exon 2a SNP 42C.64 Further elongation of the NOR antigen (also called NOR1) can give rise to NORint and NOR2,65 two glycolipid structures not yet given blood group status by the ISBT.

1 2 32a5′ 3′

30/60 145 1876

ATG TGA353 aa

347

A4GALT

ORF

Fig. 3 The genomic organization of the A4GALT gene (not drawn to scale). The numbers in the boxes represent the exon number and numbers below the boxes represent the number of base pairs in the exon. The black box shows the open reading frame (ORF).

Å. Hellberg et al.


Tissue Distribution

The expression of glycosphingolipids often shows a wide histological distribution but varies among tissues and species. Expression of the A4GALT-derived Pk and P1 antigens has been studied in several species.48,66,67 Studies on mouse tissues show expression patterns similar to those found in humans, although some differences have been noted.66

The P1 structure is found as glycolipids, glycoproteins, or both in many organisms such as the nematode (Ascaris suum), tapeworm (Echinococcus granulosus), earthworm (Lumbricus terrestris), liver fluke (Fasciola hepatica), bacterium (Neisseira gonorrhoe), and pigeon.68 The Pk antigen is also expressed in several strains of bacteria.69

In humans, glycosphingolipids can be useful as surface markers of normal erythrocyte differentiation and of erythroleukemias.70 The Pk and P1 antigens are expressed on a number of other cells in addition to RBCs, but various studies using different antibodies or methods have come to different conclusions about where they are expressed. Pk has been detected in plasma,41,71 but no such reports about P1 in plasma or about Pk and P1 in secretions are available.

The P1 antigen is expressed on B lymphocytes, granulocytes, and monocytes.72 The Pk antigen has been found on all leucocytes (except NK cells),72 fibroblasts,30 platelets, and smooth muscle cells of the digestive tract and urogenital system73 and is a differentiation antigen expressed on a subset of tonsillar B cells in the germinal center.74 High expression of Pk in the kidney has been implicated in susceptibility to hemolytic uremic syndrome (HUS), further discussed in the section on disease associations. The mechanism behind the high renal expression might be related to enhanced A4GALT gene transcription and reduced α-galactosidase gene activity.52 Recently, it has also been shown that small amounts of Pk together with higher amounts of P are present on intestinal epithelial cells.75

Northern blot studies of human organs showed high expression of the A4GALT gene in kidney and heart in one study,47 while another report described high expression in spleen, liver, testis, and placenta, in addition to kidney and heart.49

Disease Associations

The Pk and P1 antigens can act as membrane receptors for several pathogens and toxins, summarized in Table 3.

VirusesAlthough initial studies implied a facilitating role for Pk in

human immunodeficiency virus (HIV) infection, recent work has suggested that Pk is protective when accumulated owing to reduced activity of α-galactosidase A in Fabry disease, an X-linked lysosomal storage disorder.84 In addition, a soluble analogue of Pk prevents HIV infection in vitro.77,85 Another study showed that peripheral blood mononuclear cells (PBMCs) with P1

k phenotype were highly resistant to infection, whereas PBMCs with the p phenotype showed increased susceptibility to infection.76 Furthermore, Pk-liposome fusion into the Pk-deficient Jurkat T-cell line reduced productive X4 HIV-1 infection, as did overexpression of Pk synthase. Accordingly, siRNA silencing of the Pk synthase gene increased the cells’ HIV susceptibility.76

BacteriaUropathogenic Escherichia coli expressing pap-encoded

PapG adhesins bind to Pk and P1,78,79 and both the Streptococcus suis adhesin and the PA-IL lectin from Pseudomonas aeruginosa use Pk (Gb3) and P1 as receptors.79,80,83,86 Furthermore, Pk is the receptor for Shiga toxin from Shigella dysenteriae (Stx) or certain E. coli strains (Stx1 and Stx2) on renal epithelium, platelets, and endothelium.81,82

A disease connected to the Pk antigen is Fabry disease, in which deficiency of the lysosomal enzyme α-galactosidase A causes accumulation of sphingolipids, mainly Pk, in some cell types and body fluids.87 It has been shown that mice with Fabry disease are protected against Stx from enterohemorrhagic E. coli (EHEC).88 These data are surprising because Pk is the cellular receptor for Stx and therefore a higher sensitivity would be expected. The authors hypothesize that the excess Pk can work as a toxin sink, which allows the toxin to bind to Pk in tissues that normally do not have high expression

Table 3. A selection of pathogens and toxins with a relationship to the Pk and P1 antigens

Pathogen/toxin DiseaseAntigen involved Reference

HIV AIDS Pk 76,77

Uropathogenic Escherichia coli UTI Pk, P1 78,79

Streptococcus suis Meningitis Pk, P1 80

Shigella dysenteriae (Shiga toxin) Dysentery Pk 81

Escherichia coli O157 (Stx 1/2) HUS, hemorrhagic colitis

Pk 81,82

Pseudomonas aeruginosa (PA-IL lectin)

Opportunistic human pathogen

Pk, P1 83

HIV = human immunodeficiency virus; AIDS = acquired immune deficiency syndrome; UTI = urinary tract infection; HUS = hemolytic uremic syndrome.



and cannot be affected by the toxin. EHEC infection can induce HUS, which leads to hemolytic anemia, renal failure, and thrombocytopenia.89 According to Furukawa et al.,90 the mechanism behind the thrombocytopenia might be that Stx binds to Pk in immature megakaryoblasts and induces their apoptosis, leading to the restraint of platelet production in the bone marrow. The Pk antigen has been shown to mediate apoptotic signals after the binding of both Stx and anti-Pk (CD77 monoclonal antibody). These ligands trigger two completely different apoptotic pathways, one caspase- and mitochondria-dependent and one reactive oxygen species–dependent.91 It has also been shown that patients with HUS have lower levels of Pk glycolipid in their sera compared with a healthy control group.92 These authors propose that circulating Stx could bind to Pk glycolipids in sera during infection, which may reduce the amount of Stx binding to the target cells. Consequently, patients with low serum levels of Pk would have a higher susceptibility to EHEC infections. Another study states that only Pk and not P1, as earlier believed, is the receptor for Stx, and mice without Pk lose sensitivity to Stx.93

CancerAltered glycosylation patterns of glycosphingolipids

such as neoexpression, underexpression, or overexpression are characteristic of cancer cells.94 One example is the first described p individual (lacking Pk, P, and P1 antigens), who had a gastric tumor that expressed P1 antigen. Levine95 proposed that the antibodies made against the Pk, P, and P1 antigens prevented further growth of the tumor. Altered expression of Pk antigen has also been described in ovarian carcinomas, colon cancer, breast cancer, and B-cell lymphomas.96 It has even been suggested that Stx, which specifically binds to Pk, could be used as a targeted cancer therapy.96

Summary

The history of the P1PK blood group system is complex and not easy to grasp because of several changes of nomenclature. In addition, the biochemical background and genetic basis have caused long debates, and even today many basic questions remain to be solved. However, step by step the biochemical and genetic basis underlying the antigens expressed in this system has been revealed. The most recent but certainly not the final step came when it was clarified that the A4GALT gene is responsible not only for Pk expression but also for P1 and even NOR expression. As a result, the Pk and later the NOR antigen joined the P1 antigen, and the system name was changed to P1PK.

Å. Hellberg et al.

References

1. Landsteiner K, Levine P. Further observations on individual differences of human blood. Proc Soc Exp Biol 1927;24:941–2.

2. Levine P, Bobbitt OB, Waller RK, Kuhmichel A. Isoimmunization by a new blood factor in tumor cells. Proc Soc Exp Biol Med 1951;77:403–5.

3. Sanger R. An association between the P and Jay systems of blood groups. Nature 1955;176:1163–4.

4. Matson GA, Swanson J, Noades J, Sanger R, Race RR. A “new” antigen and antibody belonging to the P blood group system. Amer J Hum Genet 1959;11:26–34.

5. Race RR, Sanger R. Blood groups in man. 5th ed. Oxford, Edinburgh: Blackwell Scientific, 1968.

6. Naiki M, Marcus DM. Human erythrocyte P and Pk blood group antigens: identification as glycosphingolipids. Biochem Biophys Res Commun 1974;60:1105–11.

7. Hellberg Å, Poole J, Olsson ML. Molecular basis of the globoside-deficient Pk blood group phenotype. Identification of four inactivating mutations in the UDP-N-acetylgalactosamine: globotriaosylceramide 3-beta-N-acetylgalactosaminyltrans-ferase gene. J Biol Chem 2002;277:29455–9.

8. Daniels GL, Fletcher A, Garratty G, et al. Blood group terminology 2004: from the International Society of Blood Transfusion committee on terminology for red cell surface antigens. Vox Sang 2004;87:304–16.

9. Storry JR, Castilho L, Daniels G, et al. International Society of Blood Transfusion Working Party on red cell immunogenetics and blood group terminology: Berlin report. Vox Sang 2011; 101:77–82.

10. Reid ME, Lomas-Francis C, Olsson ML. The blood group antigen factsbook. 3rd ed. London: Academic Press, 2012.

11. Hellberg Å, Westman JS, Olsson ML. An update on the GLOB blood group system and collection. Immunohematology 2013;29:19–24.

12. Knapp W, Dorken B, Rieber P, Schmidt RE, Stein H, Von Dem Borne AE. CD antigens 1989. Blood 1989;74:1448–50.

13. Thudichum JLW. A treatise on the chemical constituents of the brain (a facsimile edition of the original, 1962), London: Baillière, Tindall and Cox, 1884.

14. Hakomori S. Structure, organization, and function of glycosphingolipids in membrane. Curr Opin Hematol 2003; 10:16–24.

15. Sandhoff K, Kolter T. Biosynthesis and degradation of mammalian glycosphingolipids. Philos Trans R. Soc Lond B Biol Sci 2003;358:847–61.

16. Morgan WT, Watkins WM. Blood group P1 substance. I. Chemical properties. Bibl Haematol 1964;19:225–9.

17. Marcus DM. Isolation of a substance with blood-group P1 activity for human erythrocyte stroma. Transfusion 1971; 11:16–8.

18. Siddiqui B, Hakomori S. A revised structure for the Forssman glycolipid hapten. J Biol Chem 971;246: 5766–9.

19. Svensson L, Hult AK, Stamps R, Angstrom J, Teneberg S, Storry JR, Jorgensen R, Rydberg L, Henry SM, Olsson ML. Forssman expression on human erythrocytes: biochemical and genetic evidence of a new histo-blood group system. Blood 2013;121:1459–68.

20. Rydberg L, Cedergren B, Breimer ME, Lindstrom K, Nyholm PG, Samuelsson BE. Serological and immunochemical


characterization of anti-PP1Pk (anti-Tja) antibodies in blood group little p individuals. Blood group A type 4 recognition due to internal binding. Mol Immunol 1992;29:1273–86.

21. Yang Z, Bergström J, Karlsson KA. Glycoproteins with Gal alpha 4Gal are absent from human erythrocyte membranes, indicating that glycolipids are the sole carriers of blood group P activities. J Biol Chem 1994;269:14620–4.

22. Olsson ML, Peyrard T, Hult AK, et al. PX2: A new blood group antigen with implications for transfusion recommendations in P1k and P2k individuals. Vox Sang 2011;101:1–79.

23. Mourant AE, Kopec AC, Domaniewska-Sobczak K. The distribution of human blood groups and other polymorphisms: (monographs on medical genetics). 2nd ed. London: Oxford University Press, 1976.

24. Ikin EW, Kay HEM, Playfair JHL, Mourant AE. P1 antigen in the human fetus. Nature 1961;192:883–4.

25. Heiken A. Observations on the blood group receptor P1 and its development in children. Hereditas 1966;56:83–98.

26. Fisher R. The variation in the strength of the human blood group P. Heredity 1953;7:81–9.

27. Thuresson B, Westman JS, Olsson ML. Identification of a novel A4GALT exon reveals the genetic basis of the P1/P2 histo-blood groups. Blood 2011;117:678–87.

28. Crawford MN, Tippett P, Sanger R. Antigens Aua, i and P1 of cells of the dominant type of Lu(a–b–). Vox Sang 1974; 26:283–7.

29. Singleton BK, Burton NM, Green C, Brady RL, Anstee DJ. Mutations in EKLF/KLF1 form the molecular basis of the rare blood group In(Lu) phenotype. Blood 2008;112:2081–8.

30. Fellous M, Gerbal A, Tessier C, Frezal J, Dausset J, Salmon C. Studies on the biosynthetic pathway of human P erythrocyte antigens using somatic cells in culture. Vox Sang 1974; 26:518–36.

31. Fletcher KS, Bremer EG, Schwarting GA. P blood group regulation of glycosphingolipid levels in human erythrocytes. J Biol Chem 1979;254:11196–8.

32. Kundu SK, Steane SM, Bloom JE, Marcus DM. Abnormal glycolipid composition of erythrocytes with a weak P antigen. Vox Sang 1978;35:160–7.

33. Kundu SK, Evans A, Rizvi J, Glidden H, Marcus DM. A new Pk phenotype in the P blood group system. J Immunogenet 1980;7:431–9.

34. Race RR, Sanger R. Blood Groups in Man. Oxford, UK: Blackwell Scientific Publications, 1975.

35. Cedergren B. Population studies in northern Sweden. IV. Frequency of the blood type p. Hereditas 1973;73:27–30.

36. Miwa S, Matuhasi T, Yasuda J. p phenotype in two successive generations of a Japanese family. Vox Sang 1974;26:565–7.

37. Obregon E, McKeever BG. Studies on offspring of pp mothers (abstract). Transfusion 1980;20:621–2.

38. Levene C, Shinar E, Yahalom V. Rare blood group p Tj(a–) in Israel 1975–1999 (abstract). Vox Sang 2000;78S1:P010.

39. Arndt PA, Garratty G, Marfoe RA, Zeger GD. An acute hemolytic transfusion reaction caused by an anti-P1 that reacted at 37 degrees C. Transfusion 1998;38:373–7.

40. Chandeysson PL, Flye MW, Simpkins SM, Holland PV. Delayed hemolytic transfusion reaction caused by anti-P1 antibody. Transfusion 1981;21:77–82.

41. Issitt PD, Anstee DJ. Applied Blood Group Serology. Miami, FL, USA: Montgomery Scientific Publications, 1998.

42. Cantin G, Lyonnais J. Anti-PP1Pk and early abortion. Transfusion 1983;23:350–1.

43. Lindstrom K, Von Dem Borne AE, Breimer ME, et al. Glyco-sphingolipid expression in spontaneously aborted fetuses and placenta from blood group p women. Evidence for placenta being the primary target for anti-Tja-antibodies. Glycoconj 1992;9:325–9.

44. Hellberg Å, Steffensen R, Yahalom V, et al. Additional molecular bases of the clinically important p blood group phenotype. Transfusion 2003;43:899–907.

45. Harris PA, Roman GK, Moulds JJ, Bird GW, Shah NG. An inherited RBC characteristic, NOR, resulting in erythrocyte polyagglutination. Vox Sang 1982;42:134–40.

46. Kusnierz-Alejska G, Duk M, Storry JR, et al. NOR polyagglutination and Sta glycophorin in one family: relation of NOR polyagglutination to terminal alpha-galactose residues and abnormal glycolipids. Transfusion 1999;39:32–8.

47. Steffensen R, Carlier K, Wiels J, et al. Cloning and expression of the histo-blood group Pk UDP-galactose: Gal-beta1-4Glc-beta1-Cer alpha1,4-galactosyltransferase. Molecular genetic basis of the p phenotype. J Biol Chem 2000;275:16723–9.

48. Keusch JJ, Manzella SM, Nyame KA, Cummings RD, Baenziger JU. Cloning of Gb3 synthase, the key enzyme in globo-series glycosphingolipid synthesis, predicts a family of alpha 1, 4-glycosyltransferases conserved in plants, insects, and mammals. J Biol Chem 2000;275:25315–21.

49. Kojima Y, Fukumoto S, Furukawa K, et al. Molecular cloning of globotriaosylceramide/CD77 synthase, a glycosyltransferase that initiates the synthesis of globo series glycosphingolipids. J Biol Chem 2000;275:15152–6.

50. Paulson JC, Colley KJ. Glycosyltransferases. Structure, localization, and control of cell type-specific glycosylation. J Biol Chem 1989;264:17615–18.

51. Breton C, Imberty A. Structure/function studies of glycosyltransferases. Curr Opin Struct Biol 1999;9:563–71.

52. Hughes AK, Ergonul Z, Stricklett PK, Kohan DE. Molecular basis for high renal cell sensitivity to the cytotoxic effects of shigatoxin-1: upregulation of globotriaosylceramide expression. J Am Soc Nephrol 2002;13:2239–45.

53. Okuda T, Nakayama K. Identification and characterization of the human Gb3/CD77 synthase gene promoter. Glycobiology 2008;18:1028–35.

54. Naiki M, Marcus DM. An immunochemical study of the human blood group P1, P, and PK glycosphingolipid antigens. Biochemistry 1975;14:4837–41.

55. Bailly P, Piller F, Gillard B, Veyrières A, Marcus D, Cartron JP. Biosynthesis of the blood group Pk and P1 antigens by human kidney microsomes. Carbohyd Res 1992;228:277–87.

56. Graham HA, Williams AN. A genetic model for the inheritance of the P, P1 and Pk antigens. Immunol Commun 1980;9: 191–201.

57. Iwamura K, Furukawa K, Uchikawa M, et al. The blood group P1 synthase gene is identical to the Gb3/CD77 synthase gene. A clue to the solution of the P1/P2/p puzzle. J Biol Chem 2003; 278:44429–38.



58. Hellberg Å, Chester MA, Olsson ML. Two previously proposed P1/P2-differentiating and nine novel polymorphisms at the A4GALT (Pk) locus do not correlate with the presence of the P1 blood group antigen. BMC Genet 2005;6:49.

59. Tilley L, Green C, Daniels G. Sequence variation in the 5′ untranslated region of the human A4GALT gene is associated with, but does not define, the P1 blood-group polymorphism. Vox Sang 2006;90:198–203.

60. Suzuki N, Yamamoto K. Molecular cloning of pigeon UDP-galactose:beta-D-galactoside alpha1,4-galactosyltransferase and UDP-galactose:beta-D-galactoside beta1,4-galactosyl-transferase, two novel enzymes catalyzing the formation of Gal alpha1-4Gal beta1-4Gal beta1-4GlcNAc sequence. J Biol Chem 2010;285:5178–87.

61. Wang Y, Lin K, Lin K, Hung C, Lin T. P1/P2 Genotype Screening in Southern Taiwan (abstract). Transfusion 2012;52 (Suppl):161A.

62. Hellberg Å, Ringressi A, Yahalom V, Säfwenberg J, Reid ME, Olsson ML. Genetic heterogeneity at the glycosyltransferase loci underlying the GLOB blood group system and collection. Br J Haematol 2004;125:528–36.

63. Hellberg Å, Schmidt-Melbye AC, Reid ME, Olsson ML. Expression of a novel missense mutation found in the A4GALT gene of Amish individuals with the p phenotype. Transfusion 2008;48:479–87.

64. Suchanowska A, Kaczmarek R, Duk M, et al. A single point mutation in the gene encoding Gb3/CD77 synthase causes a rare inherited polyagglutination syndrome. J Biol Chem 2012;287:38220–30.

65. Duk M, Singh S, Reinhold VN, Krotkiewski H, Kurowska E, Lisowska E. Structures of unique globoside elongation products present in erythrocytes with a rare NOR phenotype. Glycobiology 2007;17:304–12.

66. Fujii Y, Numata S, Nakamura Y, et al. Murine glycosyl-transferases responsible for the expression of globo-series glycolipids: cDNA structures, mRNA expression, and distribution of their products. Glycobiology 2005;15:1257–67.

67. Zoja C, Corna D, Farina C, et al. Verotoxin glycolipid receptors determine the localization of microangiopathic process in rabbits given verotoxin-1. J Lab Clin Med 1992;120:229–38.

68. Daniels G. Human blood groups. Oxford, UK: Blackwell Scientific, 2002.

69. Mandrell RE. Further antigenic similarities of Neisseria gonorrhoeae lipooligosaccharides and human glycosphingo-lipids. Infection Immun 1992;60:3017–20.

70. Suzuki A, Karol RA, Kundu SK, Marcus DM. Glycosphingolipids of K562 cells: a chemical and immunological analysis. Int J Cancer 1981;28:271–6.

71. Svennerholm E, Svennerholm L. The separation of neutral blood-serum glycolipids by thin-layer chromatography. Biochim Biophys Acta 1963;70:432–41.

72. Ingolfsdottir R, Hult A, Olsson ML. Flow cytometric assessment of carbohydrate histo-blood group expression on leucocyte subpopulations (abstract). Vox Sang 2010;99:394.

73. Kasai K, Galton J, Terasaki PI, et al. Tissue distribution of the Pk antigen as determined by a monoclonal antibody. J Immunogenet 1985;12:213–20.

74. Mangeney M, Richard Y, Coulaud D, Tursz T, Wiels J. CD77: an antigen of germinal center B cells entering apoptosis. Eur J Immunol 1991;21:1131–40.

75. Zumbrun SD, Hanson L, Sinclair JF, et al. Human intestinal tissue and cultured colonic cells contain globotriaosylceramide synthase mRNA and the alternate Shiga toxin receptor globotetraosylceramide. Infect Immun 2010;78:4488–99.

76. Lund N, Olsson ML, Ramkumar S, Sakac D, Yahalom V, Levene C, Hellberg Å, Ma XZ, Binnington B, Jung D, Lingwood CA, Branch DR. The human P(k) histo-blood group antigen provides protection against HIV-1 infection. Blood 2009; 113:4980–91.

77. Harrison AL, Olsson ML, Jones RB, et al. A synthetic globotriaosylceramide analogue inhibits HIV-1 infection in vitro by two mechanisms. Glycoconj J 2010;27:515–24.

78. Moulds JM, Moulds JJ. Blood group associations with parasites, bacteria, and viruses. Transfus Med Rev 2000;14: 302–11.

79. Ziegler T, Jacobsohn N, Funfstuck R. Correlation between blood group phenotype and virulence properties of Escherichia coli in patients with chronic urinary tract infection. Int J Antimicrob Agents 2004;24(Suppl 1):S70–5.

80. Haataja S, Tikkanen K, Liukkonen J, Francois-Gerard C, Finne J. Characterization of a novel bacterial adhesion specificity of Streptococcus suis recognizing blood group P receptor oligosaccharides. J Biol Chem 1993;268:4311–7.

81. Johannes L, Romer W. Shiga toxins—from cell biology to biomedical applications. Nat Rev Microbiol 2010;8:105–16.

82. Lingwood CA, Law H, Richardson S, Petric M, Brunton JL, De Grandis S, Karmali M. Glycolipid binding of purified and recombinant Escherichia coli produced verotoxin in vitro. J Biol Chem 1987;262:8834–9.

83. Blanchard B, Nurisso A, Hollville E, Tetaud C, Wiels J, Pokorna M, Wimmerova M, Varrot A, Imberty A. Structural basis of the preferential binding for globo-series glycosphingolipids displayed by Pseudomonas aeruginosa lectin I. J Mol Biol 2008;383:837–53.

84. Lund N, Branch DR, Sakac D, Lingwood CA, Siatskas C, Robinson CJ, Brady RO, Medin JA. Lack of susceptibility of cells from patients with Fabry disease to productive infection with R5 human immunodeficiency virus. AIDS 2005;19:1543–6.

85. Lund N, Branch DR, Mylvaganam M, Chark D, Ma XZ, Sakac D, Binnington B, Fantini J, Puri A, Blumenthal R, Lingwood CA. A novel soluble mimic of the glycolipid, globotriaosyl ceramide inhibits HIV infection. AIDS 2006;20:333–43.

86. Imberty A, Wimmerova M, Mitchell EP, Gilboa-Garber N. Structures of the lectins from Pseudomonas aeruginosa: insight into the molecular basis for host glycan recognition. Microbes Infect 2004;6:221–8.

87. Bekri S, Lidove O, Jaussaud R, Knebelmann B, Barbey F. The role of ceramide trihexoside (globotriaosylceramide) in the diagnosis and follow-up of the efficacy of treatment of Fabry disease: a review of the literature. Cardiovasc Hematol Agents Med Chem 2006;4:289–97.

88. Cilmi SA, Karalius BJ, Choy W, Smith RN, Butterton JR. Fabry disease in mice protects against lethal disease caused by Shiga toxin-expressing enterohemorrhagic Escherichia coli. J Infect Dis 2006;194:1135–40.

89. Proulx F, Seidman EG, Karpman D. Pathogenesis of Shiga toxin-associated hemolytic uremic syndrome. Pediatric Research 2001;50:163–71.

Å. Hellberg et al.


90. Furukawa K, Yokoyama K, Sato T, Wiels J, Hirayama Y, Ohta M. Expression of the Gb3/CD77 synthase gene in megakaryoblastic leukemia cells: implication in the sensitivity to verotoxins. J Biol Chem 2002;277:11247–54.

91. Tétaud C, Falguieres T, Carlier K, et al. Two distinct Gb3/CD77 signaling pathways leading to apoptosis are triggered by anti-Gb3/CD77 mAb and verotoxin-1. J Biol Chem 2003;278:45200–8.

92. Watarai S, Yokota K, Tana, Kishimoto T, Kanadani T, Taketa K, Oguma K. Relationship between susceptibility to hemolytic-uremic syndrome and levels of globotriaosylceramide in human sera. J Clin Microbiol 2001;39:798–800.

93. Okuda T, Tokuda N, Numata S, et al. Targeted disruption of Gb3/CD77 synthase gene resulted in the complete deletion of globo-series glycosphingolipids and loss of sensitivity to verotoxins. J Biol Chem 2006;281:10230–5.

94. Dwek MV, Brooks SA. Harnessing changes in cellular glycosylation in new cancer treatment strategies. Curr Cancer Drug Targets 2004;4:425–42.

95. Levine P. Illegitimate blood group antigens P1, A, and MN (T) in malignancy—a possible therapeutic approach with anti-Tja, anti-A, and anti-T. Ann Aca Sci 1976;277:428–35.

96. Engedal N, Skotland T, Torgersen ML, Sandvig K. Shiga toxin and its use in targeted cancer therapy and imaging. Microb Biotechnol 2011;4:32–46.


Åsa Hellberg, PhD (corresponding author), Coordinator at the Nordic Reference Laboratory for Genomic Blood Group Typing, Department of Clinical Immunology and Transfusion Medicine, University and Regional Laboratories, SE-221 85 Lund, Sweden, and Division of Hematology and Transfusion Medicine, Department of Laboratory Medicine, Lund University, SE-221 00 Lund, Sweden, Julia S. Westman, MSc, PhD student, Division of Hematology and Transfusion Medicine, Department of Laboratory Medicine, Lund University, Britt Thuresson, PhD, Postdoc, Department of Clinical Immunology and Transfusion Medicine, University and Regional Laboratories, SE-221 85 Lund, Sweden, and Division of Hematology and Transfusion Medicine, Department of Laboratory Medicine, Lund University, SE-221 00 Lund, Sweden, and Martin L. Olsson, MD, PhD, Medical Director of the Nordic Reference Laboratory for Genomic Blood Group Typing, Professor and Senior Consultant at the Department of Clinical Immunology and Transfusion Medicine, University and Regional Laboratories, and Division of Hematology and Transfusion Medicine, Department of Laboratory Medicine, Lund University, Lund, Sweden.


CommuniCation

In this issue of Immunohematology, we introduce the New Blood Group Allele Report. This is a mechanism for describing a blood group allele that has not been described in a peer-reviewed publication. Genetic variation in blood groups is extensive, and although the Human Genome Project and HapMap Projects have been completed, there continue to be new discoveries of blood group alleles associated with a serologic phenotype and, in some cases, found in individuals with an antibody to the associated antigen. Oftentimes, these alleles are shared with the blood banking and molecular immunohematology community through abstracts at scientific meetings. However, in many cases the discovery of these alleles is not subjected to peer review nor published in a journal, where it can be found via a literature search (PubMed). Another avenue to communicate the new finding is through the International Society of Blood Transfusion (ISBT) Working Party on Blood Group Allele Terminology (http://www.isbtweb.org/working-parties/red-cell-immunogenetics-and-blood-group-terminology/blood-group-terminology/blood-group-allele-terminology/), where new alleles can be assigned an allele number, using a standard nomenclature format, and posted on a Web site for easy reference. However, this venue does not capture important supporting information about the allele, such as in what ethnic group it was discovered, what methods were used to identify it, and any references that include more detail.

With the New Blood Group Allele Report, Immunohematology is filling a need to communicate these new alleles to the community. The format for these submissions is designed to be straightforward, capturing parameters about the new allele that are pertinent, and to allow the information to be shared efficiently. Refer to the Instructions for Authors page. We hope our readers will use this forum to share their discoveries.

Letter to the Readers


announCements

Free Classified Ads and Announcements

Immunohematology will publish classified ads and announcements (SBB schools, meetings, symposia, etc.) without charge.

E-mail information to [email protected] or fax to (215) 451-2538

The editorial staff of Immunohematology welcomes manuscripts pertaining to blood group serology and education for consideration for publication. We are especially interested in case reports, papers on platelet and white cell serology, scientific articles covering original investigations, and papers on new methods for use in the blood bank. For instructions for scientific articles, case reports,

and review articles, see Instructions for Authors in every issue of Immunohematology or e-mail a request to [email protected]. Include fax and phone numbers and e-mail address with all manuscripts and correspondence. E-mail all manuscripts to [email protected]

Manuscripts

University of Southern California Keck School of Medicine

Transfusion Medicine | Clinical Track—Open Rank

The Department of Pathology and Laboratory Medicine of the Keck School of Medicine at the University of Southern California invites applicants for a faculty position in the Division of Transfusion Medicine in the clinical professorial series, open rank. Candidates for appointment must hold an M.D. degree and a California Medical license, be certified in Clinical Pathology, and be board eligible or certified in Transfusion Medicine. Candidates should have a demonstrated commitment to teaching and clinical service with expertise in Blood Banking and Transfusion Medicine. Additional experience/expertise in coagulation and hemostasis is highly desirable. The University of Southern California is an Affirmative Action/Equal Opportunity Employer.

Academic rank and salary are commensurate with qualifications. Interested candidates should apply on line at http://jobs.usc.edu/applicants/Central?quickFind=68370 and submit their curriculum vitae, four academic references, and a synopsis of recent activities.


Announcements, cont.


Announcements, cont.

Masters (MSc) in Transfusion and Transplantation Sciences at

The University of Bristol, England

Applications are invited from medical or science graduates for the Master of Science (MSc) degree in Transfusion and Transplantation Sciences at the University of Bristol. The course starts in October 2013 and will last for 1 year. A part-time option lasting 2 or 3 years is also available. There may also be opportunities to continue studies for PhD or MD following the MSc. The syllabus is organized jointly by The Bristol Institute for Transfusion Sciences and the University of Bristol, Department of Pathology and Microbiology. It includes:

• Scientific principles of transfusion and transplantation

• Clinical applications of these principles

• Practical techniques in transfusion and transplantation

• Principles of study design and biostatistics

• An original research project

Application can also be made for Diploma in Transfusion and Transplantation Science or a Certificate in Transfusion and Transplantation Science.

The course is accredited by the Institute of Biomedical Sciences.

Further information can be obtained from the Web site:http://ibgrl.blood.co.uk/MSc/MscHome.htm

For further details and application forms please contact:

Dr Patricia Denning-Kendall

University of Bristol

Paul O’Gorman Lifeline Centre

Department of Pathology and Microbiology

Southmead Hospital

Westbury-on-Trym, Bristol BS10 5NB, England

Fax +44 1179 595 342, Telephone +44 1779 595 455, e-mail: [email protected].


adveRtisements

Antibody identification and problem resolution

HLA-A, B, C, and DR typing

HLA-disease association typing

Paternity testing/DNA

For inFormation, contact:

Mehdizadeh Kashi

at (503) 280-0210

or write to:

Tissue Typing Laboratory

American Red Cross Biomedical Services

Pacific Northwest Region

3131 North Vancouver

Portland, OR 97227

Reference and Consultation Services

CLIA licensed, ASHI accredited

IgA and anti-IgA testing are available to do the

following:

• Identify IgA-deficient patients

• Investigate anaphylactic reactions

• Confirm IgA-deficient donors

Our ELISA for IgA detects protein to 0.05 mg/dL.

For additional inFormation contact:

Janet Demcoe at (215) 451-4914,

or e-mail:

[email protected]

or write to:


Musser Blood Center

700 Spring Garden Street

Philadelphia, PA 19123-3594

ATTN: Janet Demcoe

IgA/Anti-IgA Testing

CLIA licensed

• Effective tool for screening large volumes of donors

• Gel diffusion test that has a 15-year proven track record:

Approximately 90 percent of all donors identified as

IgA deficient by this method are confirmed by the more

sensitive testing methods

For additional inFormation:

Kathy Kaherl

at (860) 678-2764

e-mail:

[email protected]

or write to:

Reference Laboratory


Connecticut Region

209 Farmington Ave.

Farmington, CT 06032

Donor IgA Screening

CLIA licensed

Immunohematology Reference LaboratoryAABB, ARC, New York State, and CLIA licensed

24-hour phone number: (215) 451-4901

Fax: (215) 451-2538

American Rare Donor Program24-hour phone number:

(215) 451-4900Fax: (215) [email protected]

ImmunohematologyPhone, business hours:

(215) 451-4902Fax: (215) 451-2538

[email protected]

Quality Control of Cryoprecipitated–AHFPhone, business hours:

(215) 451-4903Fax: (215) 451-2538

National Reference Laboratory for Blood Group Serology


Advertisements, cont.



Diagnostic testing for:• Neonatal alloimmune thrombocytopenia (NAIT)• Posttransfusion purpura (PTP)• Refractoriness to platelet transfusion• Heparin-induced thrombocytopenia (HIT)• Alloimmune idiopathic thrombocytopenia purpura (AITP)

Medical consultation available

Test methods:• GTI systems tests — detection of glycoprotein-specific platelet antibodies — detection of heparin-induced antibodies (PF4 ELISA)• Platelet suspension immunofluorescence test (PSIFT)• Solid phase red cell adherence (SPRCA) assay• Monoclonal immobilization of platelet antigens (MAIPA)• Molecular analysis for HPA-1a/1b

For Further inFormation, contact:

Platelet Serology Laboratory (215) 451-4205

Janet Demcoe (215) 451-4914 [email protected]

Sandra Nance (215) 451-4362 [email protected]

American Red Cross Biomedical ServicesMusser Blood Center

700 Spring Garden StreetPhiladelphia, PA 19123-3594

National Platelet Serology Reference Laboratory

CLIA licensed

Our laboratory specializes in granulocyte antibody detection and granulocyte antigen typing.

Indications for granulocyte serology testing include:• Alloimmune neonatal neutropenia (ANN)• Autoimmune neutropenia (AIN)• Transfusion-related acute lung injury (TRALI)

Methodologies employed:• Granulocyte agglutination (GA)• Granulocyte immunofluorescence by flow cytometry (GIF)• Monoclonal antibody immobilization of neutrophil antigens

(MAINA)

TRALI investigations also include:• HLA (PRA) Class I and Class II antibody detection

For Further inFormation, contact:

Neutrophil Serology Laboratory (651) 291-6797

Randy Schuller (651) 291-6758 [email protected]

American Red Cross Biomedical ServicesNeutrophil Serology Laboratory

100 South Robert StreetSt. Paul, MN 55107

National Neutrophil Serology Reference Laboratory

CLIA licensed



Program Contact Name Phone Contact E-mail Contact Web Site

Onsite or : Online Program

Blood Systems Laboratories Marie P. Holub 602-996-2396 [email protected] www.bloodsystemslaboratories.org :Walter Reed Army Medical Center William Turcan 301-295-8605 [email protected]

[email protected]/Fellow/default.aspx

American Red Cross, Southern California Region Catherine Hernandez 909-859-7496 [email protected] www.redcrossblood.org/socal/communityeducation

ARC-Central OH Region Joanne Kosanke 614-253-2740 ext. 2270 [email protected] none

Blood Center of Wisconsin Phyllis Kirchner 414-937-6271 [email protected] www.bcw.edu

Community Blood Center/CTS Dayton, Ohio Nancy Lang 937-461-3293 [email protected] www.cbccts.org/education/sbb.htm :Gulf Coast Regional Blood Center Clare Wong 713-791-6201 [email protected] www.giveblood.org/services/education/sbb-distance-program :Hoxworth Blood Center, University of Cincinnati Medical Center

Pamela Inglish 513-558-1275 [email protected] www.grad.uc.edu

Indiana Blood Center Jayanna Slayten 317-916-5186 [email protected] www.indianablood.org :Johns Hopkins Hospital Lorraine N. Blagg 410-502-9584 [email protected] http://pathology.jhu.edu/department/divisions/transfusion/sbb.cfm

Medical Center of Louisiana Karen Kirkley 504-903-3954 [email protected] www.mclno.org/webresources/index.html

NIH Clinical Center Blood Bank Karen Byrne 301-496-8335 [email protected] www.cc.nih.gov/dtm

Rush University Yolanda Sanchez 312-942-2402 [email protected] www.rushu.rush.edu/cls :Transfusion Medicine Center at Florida Blood Services Marjorie Doty 727-568-5433 ext. 1514 [email protected] www.fbsblood.org :Univ. of Texas Health Science Center at San Antonio Linda Myers 210-731-5526 [email protected] www.sbbofsa.org

University of Texas Medical Branch at Galveston Janet Vincent 409-772-3055 [email protected] www.utmb.edu/sbb :University of Texas SW Medical Center Lesley Lee 214-648-1785 [email protected] www.utsouthwestern.edu/education/school-of-health-professions/

programs/certificate-programs/medical-laboratory-sciences/index.html:

Revised May 2012

What is a certified Specialist in Blood Banking (SBB)?• Someone with educational and work experience qualifications who successfully passes the American Society for Clinical Pathology

(ASCP) Board of Certification (BOC) examination for the Specialist in Blood Banking.• This person will have advanced knowledge, skills, and abilities in the field of transfusion medicine and blood banking.

Individuals who have an SBB certification serve in many areas of transfusion medicine: • Serve as regulatory, technical, procedural, and research advisors• Perform and direct administrative functions • Develop, validate, implement, and perform laboratory procedures• Analyze quality issues preparing and implementing corrective actions to prevent and document nonconformances• Design and present educational programs• Provide technical and scientific training in transfusion medicine• Conduct research in transfusion medicine

Who are SBBs?Supervisors of Transfusion Services Executives and Managers of Blood Centers LIS Coordinators EducatorsSupervisors of Reference Laboratories Research Scientists Consumer Safety OfficersQuality Assurance Officers Technical Representatives Reference Lab Specialists

Why become an SBB?Professional growth Job placement Job satisfaction Career advancement

How does one become an SBB?CAAHEP-accredited SBB Technology program or grandfather the exam based on ASCP education and experience criteria.

Fact: In recent years, a greater percentage of individuals who graduate from CAAHEP-accredited programs pass the SBB exam compared to individuals who grandfather the exam. The BEST route for obtaining an SBB certification is to attend a CAAHEP-accredited Specialist in Blood Bank Technology Program.

Which approach are you more compatible with?

Contact the following programs for more information:

Additional information can be found by visiting the following Web sites: www.ascp.org, www.caahep.org, and www.aabb.org

Becoming a Specialist in Blood Banking (SBB)


I. GENERAL INSTRUCTIONSBefore submitting a manuscript, consult current issues of Immunohematology for style. Number the pages consecutively, beginning with the title page.

II. SCIENTIFIC ARTICLE, REVIEW, OR CASE REPORT WITH LITERATURE REVIEW

A. Each component of the manuscript must start on a new page in the following order:1. Title page2. Abstract3. Text4. Acknowledgments5. References6. Author information7. Tables8. Figures

B. Preparation of manuscript 1. Title page

a. Full title of manuscript with only first letter of first word capitalized (bold title)

b. Initials and last name of each author (no degrees; all CAPS), e.g., M.T. JONES, J.H. BROWN, AND S.R. SMITH

c. Running title of ≤40 characters, including spacesd. Three to ten key words

2. Abstracta. One paragraph, no longer than 300 wordsb. Purpose, methods, findings, and conclusion of study

3. Key wordsa. List under abstract

4. Text (serial pages): Most manuscripts can usually, but not necessarily, be divided into sections (as described below). Survey results and review papers may need individualized sectionsa. Introduction — Purpose and rationale for study, including pertinent

background referencesb. Case Report (if indicated by study) — Clinical and/or hematologic data and

background serology/molecularc. Materials and Methods — Selection and number of subjects, samples, items,

etc. studied and description of appropriate controls, procedures, methods, equipment, reagents, etc. Equipment and reagents should be identified in parentheses by model or lot and manufacturer’s name, city, and state. Do not use patient’s names or hospital numbers.

d. Results — Presentation of concise and sequential results, referring to pertinent tables and/or figures, if applicable

e. Discussion — Implication and limitations of the study, links to other studies; if appropriate, link conclusions to purpose of study as stated in introduction

5. Acknowledgments: Acknowledge those who have made substantial contributions to the study, including secretarial assistance; list any grants.

6. Referencesa. In text, use superscript, Arabic numbers.b. Number references consecutively in the order they occur in the text.

7. Tablesa. Head each with a brief title; capitalize the first letter of first word (e.g., Table

1. Results of…) use no punctuation at the end of the title.

b. Use short headings for each column needed and capitalize first letter of first word. Omit vertical lines.

c. Place explanation in footnotes (sequence: *, †, ‡, §, ¶, **, ††).8. Figures

a. Figures can be submitted either by e-mail or as photographs (5 ×7ʺ glossy).b. Place caption for a figure on a separate page (e.g. Fig. 1 Results of…), ending

with a period. If figure is submitted as a glossy, place first author’s name and figure number on back of each glossy submitted.

c. When plotting points on a figure, use the following symbols if possible: l l s s n n.

9. Author informationa. List first name, middle initial, last name, highest degree, position held,

institution and department, and complete address (including ZIP code) for all authors. List country when applicable. Provide e-mail addresses of all authors.

III. EDUCATIONAL FORUM

A. All submitted manuscripts should be approximately 2000 to 2500 words with pertinent references. Submissions may include:1. An immunohematologic case that illustrates a sound investigative approach with

clinical correlation, reflecting appropriate collaboration to sharpen problem solving skills

2. Annotated conference proceedings

B. Preparation of manuscript1. Title page

a. Capitalize first word of title.b. Initials and last name of each author (no degrees; all CAPs)

2. Texta. Case should be written as progressive disclosure and may include the

following headings, as appropriatei. Clinical Case Presentation: Clinical information and differential diagnosisii. Immunohematologic Evaluation and Results: Serology and molecular

testingiii. Interpretation: Include interpretation of laboratory results, correlating

with clinical findingsiv. Recommended Therapy: Include both transfusion and nontransfusion-

based therapiesv. Discussion: Brief review of literature with unique features of this casevi. Reference: Limited to those directly pertinentvii. Author information (see II.B.9.)viii. Tables (see II.B.7.)

IV. LETTER TO THE EDITOR

A. Preparation1. Heading (To the Editor)2. Title (first word capitalized)3. Text (written in letter [paragraph] format)4. Author(s) (type flush right; for first author: name, degree, institution, address

[including city, state, Zip code and country]; for other authors: name, degree, institution, city and state)

5. References (limited to ten)6. Table or figure (limited to one)

Send all manuscripts by e-mail to [email protected]

ImmunohematologyInstructions for Authors


A. For describing an allele which has not been described in a peer-reviewed publication and for which an allele name or provisional allele name has been assigned by the ISBT Working Party on Blood Group Allele Terminology (http://www.isbtweb.org/working-parties/red-cell-immunogenetics-and-blood-group-terminology/blood-group-terminology/blood-group-allele-terminology/)

B. Preparation

1. Title: Allele Name (Allele Detail)

ex. RHCE*01.01 (RHCE*ce48C)

2. Author Names (initials and last name of each (no degrees, ALL CAPS)

C. Text

1. Case Report

i. Clinical and immunohematologic data

ii. Race/ethnicity and country of origin of proband, if known

2. Materials and Methods

Description of appropriate controls, procedures, methods, equipment, reagents, etc. Equipment and reagents should be identified in parentheses by model or lot and manufacturer’s name, city, and state. Do not use patient names or hospital numbers.

3. Results Complete the Table Below:

Phenotype Allele Name Nucleotide(s) Exon(s) Amino Acid(s) Allele Detail References

e weak RHCE*01.01 48G>C 1 Trp16Cys RHCE*ce48C 1

Column 1: Describe the immunohematologic phenotype (ex. weak or negative for an antigen).

Column 2: List the allele name or provisional allele name.

Column 3: List the nucleotide number and the change, using the reference sequence (see ISBT Blood Group Allele Terminology Pages for reference sequence ID).

Column 4: List the exons where changes in nucleotide sequence were detected.

Column 5: List the amino acids that are predicted to be changed, using the three-letter amino acid code.

Column 6: List the non-consensus nucleotides after the gene name and asterisk.

Column 7: If this allele was described in a meeting abstract, please assign a reference number and list in the Reference section.

4. Additional Information

i. Indicate whether the variant is listed in the dbSNP database (http://www.ncbi.nlm.nih.gov/snp/); if so, provide rs number and any population frequency information, if available.

ii. Indicate whether the authors performed any population screening and if so, what the allele and genotype frequencies were.

iii. Indicate whether the authors developed a genotyping assay to screen for this variant and if so, describe in detail here.

iv. Indicate whether this variant was found associated with other variants already reported (ex. RHCE*ce48C,1025T is often linked to RHD*DIVa-2)

D. Acknowledgments

E. References

F. Author Information

List first name, middle initial, last name, highest degree, position held, institution and department, and complete address (including ZIP code) for all authors. List country when applicable.

ImmunohematologyInstructions for Authors | New Blood Group Allele Reports

NON PROFITU.S. POSTAGE

PAIDAMERICAN

RED CROSSMusser Blood Center700 Spring Garden StreetPhiladelphia, PA 19123-3594

(Place Label Here)

volume 29, n umber 1, 2013 - american red cross · immunohematology is published quarterly (march,...

Documents