vesicular glutamate transporters define two sets of glutamatergic afferents to the somatosensory...

Vesicular Glutamate Transporters DefineTwo Sets of Glutamatergic Afferents tothe Somatosensory Thalamus and Two

Thalamocortical Projections in theMouse

ALESSANDRO GRAZIANO, XIAO-BO LIU, KARL D. MURRAY,

AND EDWARD G. JONES*

Center for Neuroscience, University of California Davis, Davis, California 95616-8798

ABSTRACTThe ventral posterior nucleus of the thalamus (VP) receives two major sets of excitatory

inputs, one from the ascending somatosensory pathways originating in the dorsal horn,dorsal column nuclei, and trigeminal nuclei, and the other originating from the cerebralcortex. Both systems use glutamate as neurotransmitter, as do the thalamocortical axonsrelaying somatosensory information from the VP to the primary somatosensory cortex (SI).The synapses formed by these projection systems differ anatomically, physiologically, and intheir capacity for short-term synaptic plasticity. Glutamate uptake into synaptic vesicles andits release at central synapses depend on two isoforms of vesicular glutamate transporters,VGluT1 and VGluT2. Despite ample evidence of their complementary distribution, someinstances exist of co-localization in the same brain areas or at the same synapses. In thethalamus, the two transcripts coexist in cells of the VP and other nuclei but not in theposterior or intralaminar nuclei. We show that the two isoforms are completely segregated atVP synapses, despite their widespread expression throughout the dorsal and ventral thala-mus. We present immunocytochemical, ultrastructural, gene expression, and connectionalevidence that VGluT1 in the VP is only found at corticothalamic synapses, whereas VGluT2is only found at terminals made by axons originating in the spinal cord and brainstem. Bycontrast, the two VGluT isoforms are co-localized in thalamocortical axon terminals targetinglayer IV, but not in those targeting layer I, suggesting the presence of two distinct projectionsystems related to the core/matrix pattern of organization of thalamocortical connectivitydescribed in other mammals. J. Comp. Neurol. 507:1258–1276, 2008. © 2008 Wiley-Liss, Inc.

Indexing terms: BNPI; DNPI; corticothalamic; medial lemniscus; spinothalamic; core-matrix;

synapses

L-glutamate is the predominant neurotransmitter agentof the somatosensory system, being released from afferentfiber terminals at all synaptic stations in the ascendingpathways from the dorsal horn, dorsal column nuclei, andthalamus to the cerebral cortex. Reciprocal descendingpathways, such as the corticothalamic, are also glutama-tergic (reviewed in Kaneko and Mizuno, 1988; Broman,1994). In the ventral posterior nucleus (VP) of the thala-mus, two glutamatergic inputs, the medial lemniscal andthe corticothalamic, converge. The axon terminals of thetwo inputs differ considerably in size, morphology, distri-bution on the dendritic tree of relay neurons, and themanner in which they can shape the activity of thalamo-cortical relay neurons (reviewed in Jones, 2007). The two

inputs also differ in their capacity for short-term plastic-ity, with the synapses formed by lemniscal axons on tha-lamic relay neurons displaying paired-pulse depression,

Grant sponsor: National Institutes of Health; Grant number: NS 21377.*Correspondence to: Edward G. Jones, Center for Neuroscience, Univer-

sity of California Davis, 1544 Newton Ct., Davis, CA 95616-8798.E-mail: [email protected]

Received 9 July 2007; Revised 18 September 2007; 16 November 2007DOI 10.1002/cne.21592Published online January 7, 2008 in Wiley InterScience (www.

interscience.wiley.com).

THE JOURNAL OF COMPARATIVE NEUROLOGY 507:1258–1276 (2008)

© 2008 WILEY-LISS, INC.

and those formed by corticothalamic axons on the sameneurons paired-pulse facilitation (Lindstrom and Wrobel,1990; Castro-Alamancos and Calcagnotto, 1999; vonKrosigk et al., 1999; Golshani et al., 2001; Castro-Alamancos, 2002).

The ability of synapses to undergo short-term changesdepends, at least in part, on presynaptic mechanisms thathave been linked to the probability of neurotransmitterrelease (Regher and Stevens, 2001). The amount of gluta-mate contained within synaptic vesicles and available forrelease is controlled by vesicular glutamate transporters(VGluTs) located on the membrane of the vesicles; over- orunderexpression of VGluTs can affect the amplitude of apostsynaptic response (Wojcik et al., 2004; Wilson et al.,2005; Moechars et al., 2006). Two of the three knownVGluT isoforms, VGluT1 and VGluT2, are relativelyabundant throughout the central nervous system, wherethey are expressed by specific glutamatergic neuronalpopulations and, with significant exceptions, do not co-localize in the same synaptic terminals (Fremeau et al.,2001; Fujiyama et al., 2001; Herzog et al., 2001; Kaneko etal., 2002; Varoqui et al., 2002; Hartig et al., 2003; Landryet al., 2004; Zhou et al., 2007). It has been suggested thatVGluT1 is primarily found at synapses characterized bylow-release probability and a capacity for long-term poten-tiation (LTP), whereas VGluT2 is primarily found at syn-apses characterized by high-release probability and a ca-pacity for long-term depression (LTD) (Varoqui et al.,2002; Fremeau et al., 2004a,b).

The generality of this proposal has, however, been ques-tioned, mainly because both VGluT1 and VGluT2 can beco-localized in some populations of axon terminals in thedentate gyrus, neocortex and other sites (Sakata-Haga etal., 2001; Hisano et al., 2002; Hioki et al., 2003; Li et al.,2003b; Todd et al., 2003; Boulland et al., 2004; Billups,2005; De Gois et al., 2005; Herzog et al., 2006; Liguz-Lecznar and Skangiel-Kramska, 2007)

VGluTs 1 and 2 are differentially localized in specificsets of primary afferent fiber terminals in the spinal cordand medulla oblongata (Li et al., 2003a; Todd et al., 2003;Alvarez et al., 2004; Landry et al., 2004; Persson et al.,2006) and in certain sets of ascending fibers (Commons etal., 2005; Raju et al., 2006). In the thalamus, retinogenicu-late fiber terminals contain only VGluT2, whereas othersmaller axon terminals, postulated to be those of cortico-thalamic fibers, contain only VGluT1 (Fujiyama et al.,2003). VGluT1 and VGluT2 mRNAs are both expressed indorsal thalamic nuclei, but VGluT2 is expressed at higherlevels than VGluT1 in adult animals (Barroso-Chinea etal., 2007). Geniculocortical axon terminals containVGluT2 (Nahmani and Erisir, 2005).

The presence of strong immunoreactivity for VGluT2 inlayer IV of the somatosensory cortex has implied that theVGluT2-expressing neurons of the VP nucleus are thesource of the somatosensory thalamocortical projection(Kaneko et al., 2002; Fujiyama et al., 2004), but this hasnot been specifically confirmed. The relationships ofVGluT1-expressing neurons in the VP to the cerebral cor-tex and the relationships of the two transporters to thetwo principal sets of fibers innervating the VP, the lem-niscal and the corticothalamic, remain to be determined.

The present study demonstrates the distribution of cellsexpressing the genes for the two VGluTs isoforms in thesomatosensory cortex, thalamus, brainstem, and spinalcord and shows that the terminals of axons arising from

cells located in the cortex or brainstem contain VGluT1 orVGluT2, respectively. We also show that in thalamocorti-cal axon terminals the two VGluTs isoforms are co-expressed in those reaching layer IV of the primary so-matosensory cortex, but not in those reaching layer I,which express only VGluT2. In addition, lesions of thesomatosensory cortex or the ascending somatosensorytracts, together with immunocytochemical detection of thetwo VGluT isoforms, reveal other potential sources con-tributing VGluT1 or VGluT2 terminals in the VP.

MATERIALS AND METHODS

This study was conducted on Swiss Webster mice inaccordance with U.S. Public Health Service Policy on Hu-mane Care and Use of Laboratory Animals and the NIHGuide for the Care and Use of Laboratory Animals, andwith approval of the Institutional Animal Care and UseCommittee.

Surgery

Animals were anesthetized with 5% isoflurane and 1%nitrous oxide and maintained on 2% isoflurane for theduration of the surgery. The head was held in a stereo-taxic apparatus. The pial surface of the brain was exposed.In four animals a glass micropipette (20-�m-tip) contain-ing the anterograde tracer tetramethyl rhodamine isothio-cyanate (TRITC)-conjugated dextran (Molecular Probes,Eugene, OR) diluted 10% in 0.1 M phosphate buffer (pH7.4), was inserted in the first somatosensory area (S1) ofthe cerebral cortex (n � 2) or in the dorsal column nuclei(n � 2). Then 1 �l of tracer solution was delivered bypressure through an oil-filled hydraulic system (PrecisionSampling, Baton Rouge, LA) in successive steps while thepipette was retracted; the pipette was left in place for atleast 3 minutes after each ejection. Two mice receivedlesions of the ascending somatosensory tracts; in theseanimals, a microscalpel was inserted dorsoventrally at themesencephalic level and guided in a mediolateral direc-tion to interrupt ascending fiber tracts. In two additionalmice the somatosensory cortex was removed by suctionwith a glass pipette. After appropriate survival times (3–5days for injected mice; 28–30 days for lesioned mice), theanimals were deeply anesthetized with Nembutal and per-fused transcardially with cold normal saline followed by4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4).

After removal, the brains were postfixed for 3 hours,infiltrated with 30% sucrose in 0.1 M phosphate buffer,blocked, and frozen in dry ice. Blocks of the thalamus weresectioned serially at 25 �m (for the immunoperoxidasereaction) or 15 �m (for immunofluorescence) in the frontalplane on a sliding microtome; All sections were collected incold 0.1 M phosphate buffer, and alternating series ofsections were stained with the Nissl stain or for immuno-cytochemistry

Immunocytochemistry

Sections for immunocytochemistry were preincubatedfor 1 hour in blocking solution (0.1 M phosphate buffer,0.25% Triton X-100, and 5% normal serum from the spe-cies in which the secondary antibodies were produced).After preincubation, the sections were incubated over-night in the same solution containing one or two primaryantibodies. All antibodies have been previously character-ized and are commercially available (see below and Table

The Journal of Comparative Neurology. DOI 10.1002/cne

1259VGLUTS IN THE THALAMOCORTICAL SYSTEM

1). The different primary antibodies against VGluT1 orVGluT2 resulted in identical patterns of immunostainingindependent of their use with different secondary antibod-ies. After rinsing in 0.1 M phosphate buffer, sections weretransferred to a solution containing the appropriate sec-ondary immunoglobulins conjugated to one of the follow-ing: TRITC (Chemicon, Temecula, CA), Alexa Fluor 488,594, and 647 (Molecular Probes), Rhodamine Red-X (RRX;Jackson ImmunoResearch, West Grove, PA), or biotin(Vector, Burlingame, CA).

Sections incubated with the fluorescent secondary anti-bodies were rinsed in phosphate buffer, mounted on glassslides, and coverslipped with Vectastain Hardening Set,with or without DAPI (Vector). Sections incubated withbiotinylated secondary antibodies were rinsed in 0.1 Mphosphate buffer, incubated in avidin-biotin-peroxidasecomplex (ABC, Vector), rinsed, and reacted in 0.1 M phos-phate buffer containing 0.02% 3,3� diaminobenzidine4HCl (DAB; Sigma, St. Louis, MO) and 0.03% hydrogenperoxide.

After rinsing, sections were mounted on glass slides,dried, dehydrated in increasing concentrations of alcohol,cleared in xylene, and coverslipped with DPX mountingmedium (BDH, Poole, UK).

Selected sections through the thalamus were also sub-jected to double-immunofluorescence staining for VGluT1and for one or another of four neuroglial antigens (Table1). Other sections were co-immunostained for VGluT1 orVGluT2 and the vesicular acetyl choline transporter(VAChT; Table 1).

Antibody characterization

All the antibodies used in this study were previouslycharacterized and are summarized in Table 1. Gargini etal. (2007) used immunoblotting on brain extracts to con-firm the specificity of the glial fibrillary acidic protein(GFAP) polyclonal antibody developed in rabbit by usingGFAP purified from human brain as the immunizing an-

tigen. In an extensive study aimed at characterizingmonoclonal antibodies developed by using either the full-length human myelin basic protein (MBP) or syntheticpeptides corresponding to different regions of the sameprotein as the immunizing antigens, Groome et al. (1988)showed, by both inhibition enzyme-linked immunosorbentassay (ELISA) and inhibition radioimmunoassay on brainextracts, that the antibody anti-MBP used in the presentstudy (clone 22; see Table 1) reacts equally well with thefull-length protein in many species, including mouse andhuman.

Dyer et al. (1991) immunostained a variety of culturesystems with monoclonal antibody against myelin/oligodendrocyte-specific protein (MOSP; clone CE-1), todetermine the specific cell types expressing MOSP, includ-ing enriched mouse oligodendrocyte, mixed rat glial cells,meningeal rat fibroblast, rat neurons, and Schwann cells.In these cultures, only oligodendrocytes were labeled, withall other cell types negative. Because blotting with mono-clonals was difficult, either by loss of epitopes followingdenaturation or by reduced availability of reactiveepitopes after binding to nitrocellulose, Dyer et al. (1991)performed immunoaffinity column chromatography andimmunoprecipitation with CE-1 to isolate MOSP. Thisprocedure resulted in the isolation of a peak of 48 kDa,which corresponds to the molecular weight of MOSP. Le-vine and Stallcup (1987) showed that polyclonal NG-2antibody in vitro labeled cells with phenotypic propertiesof astrocytes and that the cells were not co-labeled bysurface markers characteristic of mature oligodendro-cytes.

Using an analogous approach, Levine et al. (1993)showed that NG-2-expressing cells in vivo are more het-erogeneous and appear to include cells with morphologicaland neurochemical characteristics found in astrocytes andoligodendrocytes but not in neurons. Gilmor et al. (1996)used a rat VAChT fusion protein, corresponding to aminoacid residues 478–530 in the C-terminus region of the

TABLE 1. Primary Antibodies Used and Working Dilutions

AntibodyType

(clone) Host Source Cat # Dilution Antigen (specificity)

Glial fibrillary acidic protein(GFAP)

Polyclonal Rabbit Sigma, St. Louis, MO G 9269 1:300 GFAP purified from human brain (Gargini etal., 2007)

Myelin basic protein (MBP) Monoclonal(22)

Rat Chemicon, Temecula,CA

MAB387 1:500 Human MBP AA 84-89 (DENPVV) (Groome etal., 1988)

Myelin/oligodendrocytespecific protein (MOSP)

Monoclonal(CE-1)

Mouse Chemicon MAB328 1:1,000 Rat glial membranes and whole brain whitematter (Dyer et al., 1991)

NG2 chondroitin sulfateproteoglycan

Polyclonal Rabbit Chemicon AB5320 1:500 Immunoaffinity purified NG2 chondroitinsulfate proteoglycan from rat (Levine andStallcup, 1987; Levine et al., 1993)

Vesicular acetyl cholinetransporter (VAChT)

Polyclonal Goat BD Biosciences-Pharmingen, SanDiego, CA

556337 1:8,000 Rat VAChT C-terminus (AA 478-530) fusionprotein (Gilmor et al., 1996)

Vesicular glutamatetransporter 1 (VGluT1)

Polyclonal Guinea pig Chemicon AB5905 1:10,000 (EM1:5,000)

Synthetic peptide from rat VGLUT1 C-terminus(AA 542-560: GATHSTVQPPRPPPPVRDY)(Melone et al., 2005)1

Vesicular glutamatetransporter 1 (VGluT1)3

Polyclonal Rabbit Sigma V 0389 1:1,000 Synthetic peptide corresponding to a regionnear the C-terminus of human VGLUT1 (AA504-520; immunoblot, 60-kDa band);preadsorption with immunizing peptide(manufacturer’s data); IHC1

Vesicular glutamatetransporter 2 (VGluT2)3

Polyclonal Guinea pig Chemicon AB5907 1:3,000 (EM1:5,000)

Synthetic peptide from rat VGLUT2 C-terminus(AA 565-582) (Montana et al., 2004)2

Vesicular glutamatetransporter 2 (VGluT2)

Polyclonal Rabbit Synaptic Systems,Goettingen,Germany

135 403 1:500 Rat VGLUT2/DNPI (AA 510-582) Strep-Tag�fusion protein (Zhou et al., 2007)2

1,2Identical IHC staining patterns.3Antibodies used in the double-immunofluorescence study.Abbreviations: AA, amino acid residues; EM, electron microscopy; IHC, immunohistochemistry.


1260 A. GRAZIANO ET AL.

native peptide, as the immunizing antigen. “Affinity-purified antibodies against the C terminus were charac-terized by Western blotting against GST [glutathione-S-transferase] protein, GST/Ct-fusion protein, and mem-branes from HeLa cells transfected with pBlue-script orrat VAChT cDNA. The antibodies were strongly immuno-reactive with the GST/Ct-fusion protein, which migratedat an apparent molecular weight (MW) of 35 kDa, al-though they did not react with GST, indicating thataffinity-purified antibodies were specifically reactive withepitopes on the VAChT C-terminus portion of the fusionprotein” (Gilmor et al., 1996). The authors also studied theregional distribution of VAChT immunoreactivity in therat brain by Western blot analysis and immunocytochem-istry, and their results correspond well to the knowndistribution of choline acetyl transferase (ChAT)-immunoreactive cells and areas of cholinergic innervation(Gilmor et al., 1996).

For the VGluT1 antibody from Chemicon (Cat. #AB5905), Melone et al. (2005) were able to purchase andsequence the immunogen peptide (Chemicon; Cat. #AG208; see Table 1). Antibody specificity was verified byWestern blot analysis, in which the antibody recognized asingle band with the appropriate molecular weight of �60kDa. The authors also performed a double-labeling studywith the Chemicon VGluT1 antibody and a previouslywell-characterized antibody against the same VGluT iso-form (Bellocchio et al., 1998) and found virtually completeoverlap of immunostaining in rat cerebral cortex. Further-more, Wassle et al. (2006) confirmed antibody specificityby blocking the antiserum with the immunogen peptide.

For the VGluT1 antibody from Sigma (Cat. # V 0839),the manufacturer’s data shows immunoblotting with la-beling limited to a single band with a molecular weight of�60 kDa. The same documentation reports that pread-sorption with the immunizing peptide completely abol-ishes immunostaining. We confirmed the specificity of thisantibody by immunostaining mouse brain sections andobtained a pattern of immunolabeling identical to thatobtained with the Chemicon antibody. Wassle et al. (2006)reported that preadsorption of the VGluT2 antiserumfrom Chemicon (Cat. # AB5907) with the immunogen pep-tide (Chemicon, Cat. # AG209; see Table 1) eliminated allimmunostaining. Similarly, Montana et al. (2004) showedthat in Western blot experiments, preadsorption of theVGluT2 antiserum with the immunogen peptide pre-vented immunolabeling of the appropriate band at �65kDa. The VGluT2 antibody from Synaptic Systems (Cat. #135 403) was characterized by Zhou et al. (2007) by West-ern blot of protein extracted from the cochlear nucleus andcerebellum of guinea pig, in which VGluT2 antibody la-beled a single band at �65 kDa, corresponding to themolecular weight predicted for VGluT2. Preincubation ofthe VGluT2 antibody with immunogen peptide (Cat. # 1354P; see Table 1) blocked immunolabeling.

We obtained identical staining patterns with the twoVGluT2 antibodies, and both corresponded to labeling dis-tributions described in studies that used different well-characterized VGluT2 antibodies (Fremeau et al., 2001;Fujiyama et al., 2001; Sakata-Haga et al., 2001; Kaneko etal., 2002). In double immunostaining experiments, we didnot observe any cross reactivity of VGluT1 and VGluT2,confirming previous observations (Bellocchio et al., 1998;Takamori et al., 2001), and the staining pattern for either

isoform did not differ from those obtained by using the twoantisera separately.

Confocal microscopy

Images of thalamic sections labeled by fluorescenttracer and single or double immunofluorescence were cap-tured by using a Zeiss LSM 510 scanning confocal micro-scope. The immunostained sections were scanned throughtheir thickness by using a Zeiss Plan-Apochromat 63�/1.4oil immersion lens, 4� zoom factor, and 0.80 �s pixel time.Laser wavelengths for the green and red channels were488 nm and 543 nm, respectively. We obtained stacks of1,024 � 1,024 pixel images, with a pixel size of 0.04 �m inthe x and y axes. Lateral resolution of the system was0.178 �m, corresponding to 4.45 pixels in the final images,for the green channel and 0.198 �m (4.95 pixels) for thered channel. These values are five- to tenfold smaller thanthe average size range of thalamocortical synaptic boutons(1–1.5 �m). Axial resolution (depth resolution) was 0.370,corresponding to the thickness of each optical slice. Al-though this value is about three to five times smaller thanthe average size of the particles under study, to take intoaccount the lower value of axial resolution we consideredas co-localized only particles with geometrical ormaximum-intensity centers lying in the same optical slice(see below, Object-based co-localization).

The images were exported into Volocity software (Im-provision, Lexington, MA) for deconvolution and 3D ren-dering or into Photoshop CS2 (Adobe Systems, San JoseCA) for graphical optimization (adjustment of brightnessand contrast), composed in Illustrator CS2 (Adobe Sys-tems), and finally edited in Photoshop for publication.Images of DAB-immunostained sections were acquiredeither through a Nikon Eclipse 1000 microscope (Nikon,Tokyo, Japan) by a Quantix CCD camera (Photometrics,Tucson, AZ) interfaced to a PC and operated by SimplePCIsoftware (Compix, Cranberry Township, PA) or by scan-ning the slides at 0.46 �m/pixel (55 k dpi) resolution in aT3 ScanScope scanner (Aperio, Vista, CA). The imagesobtained were optimized in Photoshop and composed inIllustrator, and the final editing was performed in Photo-shop as described above.

Co-localization analysis

To quantify co-localization of VGluT1 and VGluT2 im-munostaining and co-localization of the two VGluTs withanterograde fluorescent tracer, the red and green chan-nels of confocal optical slices were split in LSM ImageBrowser (Carl Zeiss Microimaging, Thornwood, NY) andexported into Photoshop; 8-bit grayscale images were gen-erated for each channel and saved as TIFF files. All sub-sequent analyses were performed in ImageJ (http://rsb.info.nih.gov/ij). Background noise and largeimmunostaining artifacts were removed by using theGranFilter plug-in in ImageJ, with minimum and maxi-mum radii of the structuring element set at 5 and 15pixels, respectively. These values ensured that subresolu-tion particles were filtered out from the processed images(see Fig. 3C–F).

Pixel-based co-localization

For each set of filtered images the amount of overlapbetween the green and red channels was calculated by theOverlap and M2 coefficients (Manders et al., 1992) byusing the JACoP plugin in ImageJ. Overlap coefficient is



calculated as a modified Pearson’s coefficient (rp) with theterm relative to the mean value of each channel removedfrom rp equation; M2 is defined as the ratio of the summedintensities of pixels from the red image for which theintensity in the green channel is above zero to the totalintensity in the red channel (for details on the formulasused, see Manders et al., 1992; http://rsb.info.nih.gov/ij/plugins/track/jacop.html). The thresholds necessary toperform this and object-based co-localization analysis (seebelow) were automatically computed in ImageJ by usingthe isodata iterative algorithm based on the pixel-valuehistogram for each image (Ridler and Calvard, 1978). M2and overlap coefficients in layer I and layer IV of thecerebral cortex were compared with two two-tailed inde-pendent samples t-tests by using SPSS 15.0 (SPSS, Chi-cago, IL). When Levene’s tests for equality of varianceswas significant (overlap coefficient, F � 11.509, P � 0.01),results were reported for equality of variances not as-sumed.

Object-based co-localization

By using the automatic thresholding described above,particles were identified in the 3D stacks of filtered im-ages for the red and green channels, and the coordinates oftheir geometrical centers and centers of maximum inten-sity were calculated. To evaluate object co-localization, weused two approaches (Bolte and Cordelieres, 2006). Forthe first approach, we calculated object co-localization ra-tio, defined as the ratio between number of particles in thered channel (VGluT2; see Fig. 3J–L) containing withintheir perimeter the geometrical center of a particle in thegreen channel (VGluT1; see Fig. 3J–L) over the total num-ber of particles in the red channel (VGluT2). For thesecond approach, we performed a nearest-neighbor (NN)analysis to calculate the minimum distance of each centerof maximum intensity in the red channel from a center ofmaximum intensity in the green channel (see Fig. 3M–O).The ratio between the number of subresolution NN dis-tances (� 5 pixels; see above) and the total number ofparticles in the red channel was calculated. SubresolutionNN distances were included in the analysis only if the redand green centers of maximum intensity were containedwithin the same z level (optical slice). The significance ofthe differences between means of the two ratios (objectco-localization and subresolution NN distance) in layer Iand layer IV was assessed with two two-tailed indepen-dent samples t-tests by using SPSS.

Electron microscopy

For immunoelectron microscopy (EM), two animalswere anesthetized and perfused transcardially as de-scribed above, with the addition of 0.5% glutaraldehyde tothe fixative solution. Brains were postfixed for 4–6 hoursin 4% paraformaldehyde in 0.1 M phosphate buffer (pH7.2) at 4°C and sectioned at 50–70 �m with a LeicaVT1000 S vibrating microtome (Leica Microsystems, Ban-nockburn, IL). Sections were collected and stored in icecold 0.1 M phosphate buffer. They were preincubated in

normal blocking serum and then placed in the primaryantibodies anti-VGLUT1 and anti-VGLUT2 (Table 1) for48 hours at 4°C. After washing in 0.1 M phosphate buffer,sections were incubated in a solution containing biotinyl-ated secondary antibodies (1:200, Vector) and further pro-cessed by using an ABC kit followed by the DAB reaction,as described above. Dense immunolabeled sections wereselected for electron microscopy. They were osmicated in1% OsO4 and dehydrated in graded ethanol and acetone;they were then flat-embedded in Araldite (Ted Pella, Red-ding, CA). Serial ultrathin sections (70–80 nm) were cuton a Leica Ultramicrotome and collected on Formvar-coated single-slot grids (EMS, Hatfield, PA).

Sections were lightly stained with uranyl acetate and leadcitrate and examined in a Philips CM120 electron micro-scope at 80 KV. Electron microscopic images were acquiredby a 2 K � 2 K ppi resolution CCD camera attached to themicroscope (Gatan, Pleasanton, CA). Images were processedby using an EM software program (DigitalMicrograph, Ga-tan) and composed in Adobe Photoshop. For 3D reconstruc-tion, serial EM images were traced, reconstructed in Recon-struct 2.4 (http://synapses.bu.edu, Boston University), andrendered by using 3D Studio Max (Discreet, Montreal, Que-bec, Canada). For quantitative analysis, the perimeter andnumber of postsynaptic densities (PSDs) of 33 VGluT1-immunopositive profiles and 22 VGluT2-immunopositiveprofiles were calculated. Only profiles containing at least onePSD were included in the analysis. Mean profile perimeterlength and mean number of PSDs in the two groups ofimmunostained terminals were compared with two two-tailed independent samples t-tests by using SPSS. Becausein both analyses, variances differed between the two groups(Levene’s tests: Perimeter, F � 78.97, P � 0.001; PSD num-ber, F � 39.78, P � 0.001), results were reported for equalityof variances not assumed.

In situ hybridization histochemistry

Three animals were perfused with 4% paraformalde-hyde as above, and the brains were frozen in the samemanner. Then 25-�m-thick frontal sections were cut asdescribed above and placed in 4% paraformaldehyde at4°C for a minimum of 7 days. For construction of comple-mentary sense and antisense RNA probes, VGluT1 andVGluT2 clones were obtained by polymerase chain reac-tion amplification of mouse genomic DNA with two oligo-nucleotides prepared based on the cDNA sequence ofVGluT1 and VGluT2 as detailed in Table 2. The primerswere chosen to produce inserts included in the codingregion of both genes.

Genomic DNA (1 pg) from mouse was amplified by Taqpolymerase with 35 cycles of 95°C denaturation, 55°Cannealing, and 72°C extension. Polymerase chain reactionproducts migrating at the expected size after polyacryl-amide gel electrophoresis were purified and then cloned byusing the TOPO TA Cloning Kit with One Shot TOP10Chemically Competent E. coli (Invitrogen, Carlsbad, CA).Four independent clones each of mouse VGluT1 andVGLuT2 sequences were characterized by dideoxy se-

TABLE 2. Oligonucleotide Primers Used for In Situ Hybridization Histochemistry.

Transcript NCBI accession # Sense primer (5�–3�) Antisense primer (5�–3�) Fragment position

VGluT1 NM_020309.2 ATGGCTGTGTCATCTTCGTG GGGAGTGCTAAACTTCGTGA 653–1029VGluT2 NM_080853.2 TGCTGGAAAATCCCTCGGAC AACGATCCGTGGATCATCCC 624–959



quence analysis with T7 DNA polymerase (Davis Sequenc-ing, Davis, CA). The inserts contained 376 bp (VGluT1)and 335 bp (VGluT2) sequences within the two pairs ofprimers that were specific for mouse cDNA.

After sequence verification, cDNAs were linearized andused as templates for generating riboprobes. All probeswere labeled by in vitro transcription by using �-33P-UTPor �-35S-UTP. Sections were incubated overnight in hy-bridization solution containing antisense cRNA probes, at60°C. The following day, sections were sequentiallywashed in the following solutions: 4X saline sodium ci-trate (SSC) at 60°C, twice, 30 minutes each (1X SSC �0.15 M NaCl, 0.015 M sodium citrate, pH 7.0); ribonucle-ase A (0.02 mg/ml in 0.01 M Tris HCl buffer, pH 8.0, and1 mM EDTA, 2.9% NaCl) at 45°C, 1 hour; 2X SSC, roomtemperature, twice, 30 minutes each. Finally, sectionswere mounted on gelatin-coated glass slides and exposedto �-Max autoradiographic film (Amersham Biosciences,Piscataway, NJ) for 2–10 days at 4°C. As controls, sensestrand-specific RNA probes were generated for each geneand hybridized to adjacent sections.

Images of autoradiographic films (10,500 � 12,600pixels) were acquired through a 4x5 Power Phase FXdigital camera (Phase One, Melville, NY). Images wereoptimized in Photoshop and composed in Illustrator asdescribed above. After exposure to autoradiographicfilm, some of the slides were coated with autoradio-graphic emulsion and, after appropriate exposure time,depending on the intensity of residual radioactivity,processed in photographic developer and fixer to revealsilver grains in areas of mRNA expression. These andthe remaining sections were counterstained with thi-onin to reveal cell bodies and cytoarchitectural bound-aries of the regions of interest.

RESULTS

VGlut immunostaining in thalamus andcerebral cortex

Figure 1 shows the distribution of VGluT1 and VGluT2protein in representative frontal sections through the VPand adjacent regions of the thalamus. VGluT1 immuno-staining is heavy in all nuclei of both the dorsal thalamusand ventral thalamus (the reticular nucleus, ventral lat-eral geniculate nucleus, and zona incerta). VGluT1 immu-nostaining produces a dense, homogeneous reaction prod-uct in which many tiny puncta are visible (Fig. 1B, insets)but is never found in structures that can be identified ascell bodies, dendrites, or fiber tracts. None of the VGluT1-immunoreactive puncta co-stain for the neuroglial mark-ers neurogranin2, GFAP, MBP, or MOSP (Fig. 2A–D; seealso Fig. 6). Neither VGluT1 nor VGluT2 immunoreactiv-ity could be co-localized with immunoreactivity for VAChT(Fig. 2E,F), a marker of one of the major systems of non-specific afferents to the thalamus and cortex.

In the primary somatosensory cortex (SI), VGluT1 im-munostaining is found in all layers but is more dense inthe supra- and infragranular layers than in layer IV (Fig.1D). Layers I, II, and III show particularly heavy immu-nostaining.

VGluT2 immunostaining is also enriched in a number ofdiencephalic structures, although its distribution is lessuniform in comparison with that for VGluT1 (Fig. 2). Inposterior regions of the thalamus, nuclei heavily immuno-

stained for VGluT2 include the VP, the ventral lateralnucleus (VL), and the posterior medial nucleus (PO) of thedorsal thalamus, as well as the reticular nucleus (RTN)and zona incerta (ZI) of the ventral thalamus. In the VP,VL, and PO, VGluT2 background immunostaining is light,but imposed upon it are numerous, large immunostainedpuncta that are much larger than VGluT1-immunostainedpuncta. VGluT2-immunostained puncta in the RTN andSI cortex are smaller than those in the nuclei of the dorsalthalamus. VGluT2 immunostaining in the SI has a clearlaminar distribution, with the densest staining being inlayers IV and deep III, in upper layer VI, and with a thinbut dense band immediately beneath the pia mater inlayer I.

Double-fluorescence immunostaining for VGluT1 andVGluT2 revealed no co-localization of the two proteinsin the VP (data not shown). In the SI cortex (Fig. 3),VGluT1-immunoreactive puncta were intermingled inthe thin subpial zone marked by overlap of immunore-activity for the two proteins in layer I (Fig. 3A), but noco-localization could be detected. In layer IV, by con-trast, not only was there overlap of puncta immuno-stained for one or other of the two proteins but the twoproteins showed a high degree of co-localization (Fig.3B). Quantitative analysis of pixel-based co-localization(Fig. 3I) revealed significant differences between layer Iand layer IV in both overlap coefficient (t(9.4) � 8.144,P � 0.001) and M2 coefficient (t(21) � 7.426, P ��0.001). To control for the possibility that such an effectcould be attributed to the limited resolution of confocalmicroscopy, we performed object-based co-localizationanalysis on 3D stacks of confocal images (Fig. 3J–P).Statistical comparisons of the means of the two object-based co-localization ratios in layer I and layer IV werehighly significant (object co-localization ratio: t(21) �6.343, P � 0.001; subresolution NN ratio: t(21) �3.336, P � 0.01).

Electron microscopy

Electron micrographs (Fig. 4A–F) reveal that synapticterminals containing VGluT1 or VGluT2 in VP are ul-trastructurally different. VGluT1-immunopositive ter-minals are small (�1 �m in diameter) and containspherical synaptic vesicles, and the asymmetrical syn-aptic membranes typically show a single postsynapticdensity (PSD) reflecting the presence of a single vesiclerelease site (Fig. 4A,E). They typically end on dendritesof small diameter. Adjacent symmetrical synapses (Fig.4A), characterized by lack of a prominent postsynapticdensity and by the presence of flattened vesicles, are notlabeled for VGluT1 or VGLuT2. VGlut2-immunopositiveterminals are large (�2 �m in diameter), contain spher-ical synaptic vesicles, make multiple synaptic contactswith two or more postsynaptic processes that are com-monly dendrites of large diameter, and show the mor-phological features of medial and trigeminal lemniscalsynapses. The PSDs are typically multiple, reflectingthe presence of more than one vesicle release site (Fig.4B). The 3D reconstructions (Fig. 4C) from series ofelectron micrographs show the relative sizes of VGluT1-and VGluT2-immunoreactive synaptic terminals.

In reconstructions in which the presynaptic terminalis rendered transparent to reveal underlying structures(Fig. 4E,F), theVGluT1-immunopositive terminal hasa simple structure with a single PSD, whereas the



VGluT2-immunopositive terminal is more complex, withnumerous PSDs, completely enclosing an appendage ofthe postsynaptic dendrite. It also shows a second, smallerpostsynaptic dendrite, also bearing a PSD at the point ofsynaptic contact with the same presynaptic terminal.Quantitative analysis of two variables that describe themorphological differences between VGluT1- and VGluT2-immunopositive synaptic terminals, namely, profile pe-

rimeter length and number of PSDs, revealed highly sig-nificant differences between the two groups of terminals(profile perimeter: t(22.106) � 10.420, P � 0.001; num-ber of PSDs: t(21) � 7.902, P � 0.001; Fig. 4D). None ofthe VGluT1-immunopositive profiles made contact withpostsynaptic profiles bearing more than one PSD. No cellsomata or axonal or dendritic processes were immuno-stained for VGluT1 or for VGluT2.

Fig. 1. VGluT immunoreactivity in the thalamus and cortex.A: Series of coronal sections through the posterior thalamus arrangedfrom anterior (A1) to posterior (A3) and stained by the Nissl methodor immunostained for VGluT1 or VGluT2. Both the cortex and thal-amus are densely immunostained for VGluT1. VGluT2 immunostain-ing appears less homogeneous across the diencephalon and lighterthan VGLuT1 in the cortex. B,C: VGluT1 (B) and VGluT2 (C) immu-nostaining in the ventral posterior thalamus at higher magnification.VGluT2 immunostaining in the VP (C) reveals numerous large,darkly immunostained puncta over a light background (C, left inset),much larger than VGluT1-immunostained puncta (B, left inset).These are small and densely packed in both the dorsal and ventralthalamus. VGluT2-immunostained puncta in the RTN (C, right inset)

are much smaller than those in the VP. D: Sections through the SIstained by the Nissl method or immunostained for VGluT1 or VGluT2.Roman numerals designate cortical layers. Dense VGluT1 immuno-staining is present in all layers, especially supragranular layers I–III,whereas it is less dense in layer IV. VGluT2 immunostaining has aclear laminar distribution, densest in layer III–IV and VI, and a thinsubpial zone in layer I. Abbreviations: A1, primary auditory cortex; H,hippocampus; Hy, hypothalamus; LG, lateral geniculate nucleus; Po,posterior nucleus; R, RTN, reticular nucleus; S1, primary somatosen-sory cortex; ST, striate body; VP, ventral posterior nucleus; ZI, zonaincerta. Scale bar in A � 1.5 mm in A; 350 �m in B,C (20 �m in insets);180 �m in D.



In situ hybridization histochemistry

The VGluT proteins are localized at synapses; cell so-mata are devoid of detectable levels of protein. Parentcells expressing the two isoforms were revealed by local-ization of the VGluT mRNAs by in situ hybridizationhistochemistry (Fig. 5). VGluT1 mRNA is weakly ex-pressed only in certain thalamic nuclei. Labeled neuronsare evident in the VP, dorsal lateral geniculate, and lat-eral posterior nuclei but not in many others, especially notin the intralaminar nuclei (Fig. 5A). The nuclei of theventral thalamus do not express VGluT1 mRNA. VGluT1mRNA is heavily expressed in layers II, III, V, and VI of

the SI cortex. In layers I and IV, the main targets ofthalamic axons, VGluT1 mRNA signal is singularly weak(Fig. 5C).

The cellular distribution of VGluT2 mRNA displays apattern complementary to that of VGluT1. In the thal-amus it is densely expressed in all dorsal thalamicnuclei and is particularly dense in the VP and in theintralaminar nuclei (Fig. 5A,B). The nuclei of the ven-tral thalamus do not express the mRNA. In the SIcortex, expression is also complementary to that ofVGluT1, only deep layer III showing high levels of ex-pression (Fig. 5A,C). Layers I and II are virtually devoid

Fig. 2. Double immunofluorescence for VGluT1 or VGluT2 (green) and four glial markers (MBP,mOSP, NG2, GFAP) or VAChT (magenta) in sections through the VP. A–D: None of the glial markersused is co-localized with VGluT1-immunopositive profiles. E,F: VAChT-immunopositive terminals in VPare sparse and do not express either VGluT isoform. Scale bar � 5 �m in F (applies to A–F).



Fig. 3. Double immunofluorescence for VGluT1 (green) andVGluT2 (magenta) in sections through the primary somatosensorycortex (SI). A,B: Original images of confocal optical slices in layer I (A)and layer IV (B). Profiles in which the two VGluTs are co-localizedappear white. Note the almost complete absence of white profiles inthe merged (right) panel in A, whereas many white profiles are readilydiscernible in B. C–F: Granulometry filtering: the original image in Cwas filtered by using structuring elements of increasing sizes, from Dto F. The final result chosen is represented in E, with minimum andmaximum radii of the structuring elements (SEs) set at 5 and 15pixels, respectively, ensuring that subresolution particles were fil-tered out from the processed images, effectively reducing backgroundsignal; smaller SE radii (D) completely filtered out larger particlesand increased the number of small particles; larger SE radii (E)significantly increased the size of all particle. Weaker particles in thefiltered images were excluded from quantitative co-localization anal-ysis by automatic iterative thresholding. G,H: Co-localization ofVGluT1 and VGluT2 in filtered optical sections. Arrows point toVGluT2-immunopositive puncta (magenta) that do not contain anygreen signal (VGluT1). Double arrowheads point to double-immunofluorescent puncta. In layer I (G), virtually none of theVGluT2-immunofluorescent puncta display co-labeling for VGluT1.

Double arrowheads point to two marginally overlapping punctadeeper in layer I. (Pial surface is at top left corner in G.) In layer IV(H) magenta and green signals overlap extensively, with only sporadicevidence of VGluT2-immunofluorescent puncta that do not displayany VGluT1 signal (single arrow). I: Pixel-based co-localization anal-ysis. Box plots representing the distributions of M2 (black lines) andOverlap (blue lines) coefficients. **, P � 0.001. J–O: Diagrams illus-trating object-based co-localization analysis of VGluT1- and VGLuT2-immunopositive particles in the three dimensions of confocal z stacks.J–L: Object co-localization ratio expressing the relative number ofVGluT2-positive particles (K) containing the geometrical center of aVGluT1-immunopositive particle (J, merged in L). M–O: Subresolu-tion nearest-neighbor distance ratio, expressing the relative numberof centers of maximum intensity of VGluT2-positive particles (N)within subresolution distance (5 pixels) from the center of maximumintensity of a VGluT1-immunopositive particle (M, merged in O).P: Object-based co-localization analysis results for object co-localization ratio (black) and subresolution NN ratio (blue). Barsrepresent mean � SEM. *, P � 0.01; **, P � 0.001. Scale bar � 5 �min A (applies to A,B) and G (applies to G,H); 2 �m in C (applies toC–F); 1 �m in J (applies to J–O).



of VGluT2 mRNA, and expression in layers IV–VI isconfined to a few widely scattered cells.

On-slide in-situ hybridization of Nissl-counterstainedsections in the VP (Fig. 6) shows that both VGluT1 andVGluT2 transcripts are expressed in neurons (large paleprofiles), whereas the smaller, denser profiles of glial cellsshow background labeling only.

In the brainstem and spinal cord (Fig. 7A–C), neuronsin all the structures known to contribute axons to thesomatosensory thalamus are devoid of VGluT1 mRNA butshow intense expression of VGluT2 mRNA. These includeall layers of the dorsal horn of the spinal cord and spinaltrigeminal nucleus, the principal sensory trigeminal nu-cleus, and the gracile and cuneate nuclei. The deep cere-bellar nuclei, containing cells that project axons to the VLnucleus of the thalamus, also express high levels ofVGluT2 mRNA and display a lack of VGluT1 expression(Fig. 7C).

Tracing of thalamopetal pathways

Unilateral injections of anterograde tracer in the dorsalcolumn nuclei or SI cortex labeled terminals of lemniscalor corticothalamic fibers in the VP (Fig. 8A–F). Axon ter-minals labeled from injections in the brainstem displaythe typical morphology of lemniscal afferents, with largeen passant and terminal boutons (Fig. 8F). Co-immunostaining of the same sections shows that labeledlemniscal terminals invariably co-localize with vGluT2immunoreactivity, whereas the portions of labeled axonsthat lack en passant or terminal boutons do not (Fig. 8F).In sections immunostained for VGluT1, lemniscal axonsand varicosities systematically “fill in” the gaps located inthe otherwise very dense background of VGluT1-immunostained puncta. We could not detect any lemniscalaxon terminal immunostained for VGluT1 (Fig. 8E).

Injections of tracer in the SI cortex led to labeling ofnumerous corticothalamic axons, as well as retrogradefilling of thalamic relay neurons in the VP (Fig. 8C,D). Enpassant and terminal boutons on labeled corticothalamicaxons co-localize with VGluT1 immunoreactivity (Fig.8C); labeled processes belonging to retrogradely labeledrelay neurons are devoid of VGluT1 immunostaining, con-firming the selective localization of VGluT protein at syn-aptic terminals (Fig. 8C). We could not detect any labeledcorticothalamic axon terminals co-stained for VGluT2 im-munoreactivity (Fig. 8D). VGluT1-immunostained bou-tons are often found in close apposition to intermediateand distal dendrites of retrogradely labeled thalamocorti-cal relay neurons.

3D reconstruction of stacks of deconvolved confocal im-ages reveal that the shape and relation of VGluT2-immunopositive terminals to the dendrites of backfilledrelay neurons in the VPL (Fig. 8D) are identical to theaxon terminals reconstructed from electron micrographsand shown in Figure 4. Quantitative analysis of co-localization of the two VGluTs with anterogradely labeledaxon terminal reveals a clear-cut segregation of the pro-teins in the two sets of thalamic afferents (Fig. 8B). Afterinjection of tracer in the SI, the M2 coefficient was signif-icantly higher for VGluT1 than VGluT2 (t(33.188) �8.616, P � 0.001), whereas the M2 coefficient was signif-icantly higher for VGluT2 in lemniscal axon terminals(t(32.581) � 8.079, P � 0.001)

Deafferentation experiments

Immunostaining for VGluT1 and VGluT2 was carriedout after selective lesions of ascending somatosensorypathways or of the SI cortex (Fig. 9A–D). Unilateral le-sions of the SI cortex caused complete loss of VGluT1immunostaining in the ipsilateral VP nucleus (Fig. 9A,B),with no appreciable effect on VGluT2 immunostaining(Fig. 9C,D). The cortical ablation was followed by completeloss of the dense, punctate VGluT1 immunostaining. Uni-lateral interruption of the medial and trigeminal lemnisciand of the spinothalamic tract at mesencephalic levelscompletely abolished VGluT2 immunostaining in the VPnucleus ipsilateral to the lesion (Fig. 9C,D). ResidualVGluT2 immunostaining located anterior and medial tothe VP was contributed by axons of cerebellar originreaching the VL and those from the taste and visceralrelays reaching the basal ventral medial nucleus. Thelesions did not produce any detectable effect on VGluT1immunostaining in the VP (Fig. 9A,B).

DISCUSSION

This study reveals that the principal ascending anddescending glutamatergic pathways innervating the so-matosensory thalamus, the lemniscal and spinothalamicon the one hand and the corticothalamic on the other, arecharacterized by axon terminals that utilize distinctly dif-ferent VGluT isoforms. VGluT2 is the transporter for thelarge lemniscal and spinothalamic terminals, whereasVGluT1 is the transporter for the smaller and more nu-merous corticothalamic terminals. By contrast, both iso-forms are co-localized in the terminals of the relay cellaxons in layer IV of the SI cortex. The small thalamicinput to layer I, putatively arising from the intralaminarnuclei, is, however, distinguished by terminals that con-tain only VGluT2. The complementarity in the localizationof the two VGluT isoforms in cortical and subcortical af-ferents to the VP is reflected in the complementarity ofexpression of the mRNAs for the two genes.

VGluT1 mRNA is expressed in neurons of layers V andVI of the SI cortex from which corticothalamic afferentsarise, whereas VGluT2 is expressed in brainstem andspinal cells that give rise to the medial and trigeminallemnisci and the spinothalamic and spinotrigeminotha-lamic projections to VP (Ni et al., 1994; Herzog et al., 2001;Oliveira et al., 2003). It is worth noting that in our exper-iments the highest concentration of VGluT2 mRNA in thecortex is centered on layer III, and not on layer IV, assuggested by some previous reports. We doubt that thediscrepancy depends on a difference in the specificity ofour probes. Hisano et al. (2000) reported that the stron-gest VGluT2 mRNA signal in their experiments was inlayer IV but did not provide any cytoarchitectonic evi-dence to support their statement, relying solely on non-counterstained autoradiograms to identify cortical layers.Similar considerations apply to the study by DeGois et al.(2005), who paired VGluT2 in situ hybridization imageswith VGluT1 in situ hybridization images, without directidentification of layers by cytoarchitecture. Our resultsare based on direct comparison of autoradiographic im-ages with images of the same sections used to generate theautoradiograms, counterstained by the Nissl method, giv-ing a reliable cytoarchitectonic reference for identifyingthe cortical layers.



Figure 4



In the case of the corticothalamic fibers, our experi-ments could not distinguish between those arising fromlayer VI cells, which end in multiple small terminals inthe VP, and those arising from layer V cells, which end insmaller numbers of large, lemniscal-like terminals(Hoogland et al., 1987; Yeterian and Pandya, 1994;Bourassa and Deschenes, 1995; Bourassa et al., 1995).However, VGluT1 immunostaining was characterized bymany tiny puncta and at the EM level by its presence intypically small terminals ending in single PSDs on distaland intermediate dendrites. These features are typical ofthe terminals of fibers arising from layer VI cells (Ojima,1994; Bourassa and Deschnes, 1995). The absence ofVGluT1 immunoreactivity from large boutons in theVP and the disappearance of all the large VGluT2-immunoreactive boutons following interruption of the as-cending somatosensory pathways may imply that the cor-ticothalamic fibers arising from layer V cells lack bothVGluT1 and VGluT2 isoforms. The presence of significantVGluT1 mRNA expression in layer V neurons, however,makes it impossible to rule out that VGluT1 is character-istic of both sets of corticothalamic fibers.

The complementarity in VGluT expression exhibited bythe somatosensory pathways is a reflection of a more wide-spread general complementarity of expression that hasbeen described in other investigations (Fujiyama et al.,2001; Herzog et al., 2001; Varoqui et al., 2002; Fremeau etal., 2004a). There are a number of significant instances,however, in which VGluT1 and VGluT2 transcripts haveproved to be co-expressed in the same population of neu-rons (Herzog et al., 2001; Danik et al., 2005; Barroso-Chinea et al., 2007) and the proteins co-localized in thesame axon terminals (Hioki et al., 2003; Miyazaki et al.,2003; Boulland et al., 2004; Fyk-Kolodziej et al., 2004;Conti et al., 2005; Nakamura et al., 2005; Billups, 2005;Herzog et al., 2006). Our results extend these findings tothe somatosensory cortex of adult mice.

The inability of previous studies to detect immunocyto-chemical co-localization of the two isoforms in the adultbrain may have depended on technical issues. Melone etal. (2005) showed that differences in protocol can signifi-cantly affect immunocytochemical detection of pre- andpostsynaptic proteins, including VGluTs. For instance,Nakamura et al. (2005), who specifically addressed theissue of co-localization of VGluT1 and VGluT2, were un-able to detect co-localization in S1 by using an antibodyretrieval technique. This methodology, although useful forexposing otherwise concealed postsynaptic epitopes, mayadversely affect the integrity of presynaptic proteinsand/or interfere with their detection by altering in unpre-dictable ways the presynaptic environment. These consid-erations must be taken into account, before explaining thelack of immunocytochemical colocalization of VGluTs byinvoking mechanisms, such as differential synaptic tar-geting of the two proteins within the same neuron, espe-cially in view of the mounting evidence for co-localizationof VGluT1 and VGluT2 at the same synaptic terminals.

In the present study, the visualization of both VGluTtranscripts in VP neurons and the high degree of co-localization of the proteins in the presumed terminals ofthalamocortical fibers arising from the VP and terminat-ing in layer IV of the SI, confirms the evidence for co-expression obtained by Barroso-Chinea et al. (2007) andreveals that the two proteins are transported to the axonterminals of these neurons in layer IV of the SI.

A number of previous studies have provided indirect(Fujiyama et al., 2001; Varoqui et al., 2002) or direct(Nahmani and Erisir, 2005; Hur and Zaborszky, 2005)evidence for the presence of VGluT2 in thalamocorticalfibers arising from the VP or the dorsal lateral geniculatenucleus, and this is confirmed in the present study. How-ever, unlike in the parent cells of the two afferent path-ways to the VP, both VGluT1 and VGluT2 mRNAs areexpressed by thalamic relay cells in the VP nucleus andthe proteins are found in thalamocortical axon terminalsin layer IV.

The new evidence for localization of both transporters atthe same thalamocortical terminals raises questionsabout the functional relevance of their co-localization. It isnot known whether selective trafficking at the terminalmay permit one or the other to be inserted into different orthe same synaptic vesicles, with implications for theamount of glutamate incorporated into each vesicle andfor the magnitude of a postsynaptic response when thevesicles are released. Co-localization of both VGluTs in thesame synaptic vesicle has recently been reported in hip-pocampal mossy fibers during development (Herzog et al.,2006). However, the possibility that the two VGluT iso-forms target different sets of vesicles in the same synapticterminal in adult cortex cannot be excluded based oncurrent evidence. If the original suggestion of Fremeau etal. (2004a) that VGluT1 is found at synapses character-ized by low-vesicle release probabilities and long-termpotentiation, whereas VGluT2 is found at those character-ized by high-release probability and long-term depression,should hold up, the presence of the two in the samethalamocortical terminals could confer on their synapses acapacity for a remarkable degree of plasticity, especiallybecause evidence points to VGluT1 and VGluT2 beingdifferentially up- or downregulated by neuronal activity(De Gois et al., 2005).

Fig. 4. Electron microscopy of VGluT1- and VGluT2-immuno-positive axon terminals in the ventral posterior nucleus of the thala-mus. A,B: Electron micrographs through the axon terminals recon-structed in C, E, and F color-shaded according to the palette in (C).A: VGluT1-immunopositive synaptic terminal (red-shaded) is small(�1 �m), contains round vesicles, and forms a single asymmetricalsynapse (arrow) with a small-diameter postsynaptic dendrite (green-shaded). The double arrowhead points to a symmetrical synapse onthe same postsynaptic process, in which the presynaptic elementcontains flattened vesicles and is not labeled for VGluT1 or VGluT2.B: VGluT2-immunopositive synaptic terminal (red-shaded) is large(�2 �m), forms numerous asymmetrical synapses (arrows) with alarge-diameter postsynaptic dendrite (green-shaded) and with a sec-ond, smaller postsynaptic process (blue-shaded). C: 3D reconstructionfrom two series of micrographs of the VGluT1- (left) and VGluT2-immunopositive synaptic terminals represented in A and B, respec-tively. The two terminals are displayed in their relative size (samescale bar). D: Quantitative analysis of the differences betweenVGluT1- and VGluT2-immunopositive terminals in profile perimeterand PSD number. Bars and circles represent means � SEM. **, P �0.001. E,F: The presynaptic elements have been rendered transparentto reveal underlying structures. Compare the simple organization ofthe VGluT1-immunopositive terminal (E), which has a single postsyn-aptic density, with the complexity of the VGluT2-immunopositiveterminal (F), in which the presynaptic element completely encloses anappendage of one postsynaptic dendrite and forms numerous synapticcontacts with at least two postsynaptic dendrites. (VRML files of the3D reconstructions in E and F are available upon request to theauthors.) Scale bar � 1 �m in A,B,C,E,F.



In the dorsal thalamus, co-expression of the two VGluTtranscripts is not generalized; the two isoforms coexist inthe VP, VL, MD, and other nuclei, but VGluT1 mRNA isabsent from the PO complex and the intralaminar nuclei,in which only VGluT2 mRNA is expressed (Barroso-Chinea et al., 2007). This pattern of expression corre-

sponds with the differential distribution of thalamocorti-cal axons containing one or both VGluT proteins. Layer I,with its thin line of VGluT2-expressing terminals, re-ceives its major thalamic input from cells located in theintralaminar and posterior nuclei, which contain onlyVGluT2 mRNA.

Fig. 5. VGluT mRNA expression in the thalamus and cortex.A: Series of coronal sections arranged from anterior (A1) to posterior(A3) stained with the Nissl method or by in situ hybridization histo-chemistry for VGluT1 or VGluT2 mRNAs. The distributions of the twoVGluTs are generally complementary, with VGluT1 mRNA highlyexpressed in the cortex, and VGluT2 mRNA in the dorsal thalamus.B: VGluT1 and VGluT2 mRNA in the ventral posterior thalamus athigher magnification. The dashed lines outline the VP. VGluT1mRNA is expressed in certain nuclei of the posterior thalamus, in-cluding the VP and LG, but it is absent from the PO and more medialnuclei. VGluT2 mRNA is highly expressed in the whole dorsal thala-mus, particularly in the VP and LG. The RTN and ZI do not containany cells expressing either VGluT transcript. C: Coronal sections

through the SI stained with the Nissl method or by in situ hybridiza-tion histochemistry for VGluT1 or VGluT2 mRNAs. Roman numeralsdesignate cortical layers. Both transcripts have a clear laminar pat-tern. VGluT1 mRNA is highly expressed throughout the cortex, withthe important exception of layers I and IV, the main targets ofthalamocortical axons. High level of VGluT2 mRNA expression isconfined to deep layer III, whereas it is minor in all other layers.Abbreviations: H, hippocampus; Hy, hypothalamus; LD: lateral dorsalnucleus; LG, lateral geniculate nucleus; Po, posterior nucleus; R,reticular nucleus; S1, primary somatosensory cortex; ST, striate body;VP, ventral posterior nucleus; ZI, zona incerta. Scale bar in A � 1.5mm in A; 500 �m in B; 180 �m in C.



Conversely, the main cortical target of VP cells, whichexpress both VGluT1 and VGluT2 transcripts, is layer IV,where the two proteins are almost universally co-localizedin axon terminals. Although some VGluT2-only-immunopositive puncta might belong to axons arisingfrom cortical cells, the nearly absolute lack of doubly im-munostained puncta in layer I, especially its outermostlamina, is in line with the existence of two highly segre-gated thalamocortical projection systems one of whicharises in the intralaminar and certain other nuclei andselectively targets layer I. Such duality of thalamocorticalprojections parallels that observed in other mammals. InCarnivora and Primates a matrix of calbindin-expressingthalamic cells, which includes the intralaminar nuclei andthe posterior complex and extends across nuclear bound-aries, projects diffusely to layer I of the cortex. Upon thismatrix is superimposed a core of parvalbumin-expressingcells, enclosed by the classically defined sensory and motorrelay nuclei, that project to the middle layers of the cortexin strict topographic order (Jones, 1998, 2007).

VGluT2 is present in the terminals of retinal fibers in thedorsal lateral geniculate nucleus of the rat (Fujiyama et al.,2003). The present study reveals that VGluT2 is also typicalof lemniscal and spinal terminals in the somatosensory thal-amus, and observations made in passing imply that VGluT2will also be found in the terminals of cerebellar afferents tothe motor thalamus. VGluT2 may therefore be typical of allthe major ascending pathways to the principal relay nuclei ofthe dorsal thalamus. The disappearance of all VGluT2 im-munoreactivity from the VP after interruption of the ascend-ing somatosensory pathways and the lack of any appreciablechange in VGluT1 immunoreactivity in the same nucleussuggest that all components of these ascending pathwaysutilize VGluT2. In the dorsal horn of the spinal cord, mech-anosensory primary afferents ending in deeper laminae are

characterized by the presence of VGluT1 immunoreactivity,whereas those ending in superficial laminae contain VGluT2or neither of the VGluTs (Landry et al., 2004).

Although cells in both superficial and deep laminae giverise to spinothalamic fibers, many of which end in the VP(Willis et al., 2001; Graziano and Jones, 2004), the domi-nant VGluT1 of the primary afferents does not seem to becarried upward as the dominant VGluT of the spinotha-lamic fibers that end in the VP. Targeted deletions of oneor both VGluT2 alleles in mice lead to alterations in theamplitudes of postsynaptic responses to single-vesicle fu-sion in isolated thalamic neurons, suggesting that VGluT2is critical for determining quantal size at the terminals ofascending somatosensory afferents in the VP (Moechars etal., 2006). These deletions of VGluT2 are also associatedwith the acquisition of a neuropathic pain syndrome,which may imply the importance of VGluT2 to the spino-thalamic pathways.

Deafferentation of the VP nucleus by brainstem lesionsresulted in disappearance of all VGluT2 immunoreactivityfrom the nucleus. In addition to the somatosensory path-ways, VP is innervated by the nonspecific cholinergic,serotoninergic, and noradrenergic pathways that arise inthe brainstem and diffusely innervate the thalamus. Thecholinergic pathway arises from cells of the peribrachialregion, some of which also utilize glutamate as a trans-mitter (Steriade et al., 1988). Many cholinergic cells arealso glutamatergic (Clements et al., 1991; Lavoie and Par-ent, 1994), and both glutamate and acetyl choline can beco-released in the thalamus after stimulation of the peri-brachial region; our control studies revealed no co-localization of immunoreactivity for VGluT2 (or forVGlut1) with that for VAChT.

Just as VGluT2 dominates the ascending somatosensorypathways, so VGluT1 dominates the descending corticotha-lamic pathway to the somatosensory thalamus. Althoughsome studies have reported that VGluT1 immunostaining isvirtually absent from the VP (Varoqui et al., 2002; Fremeauet al., 2004b), we found that the protein is present at remark-ably high levels, not only in the VP, but in the whole dorsaland ventral thalamus, including the principal relay nuclei ofthe former and the reticular nucleus (RTN) of the latter. Thehigh level of immunostaining for VGluT1 is indicative of thedensity of the corticothalamic projection to the relay nucleiand to the RTN (Jones, 1975; Liu et al., 1995; Van Horn etal., 2000; Golshani et al., 2001). The only other subcorticalstructure displaying comparably dense immunostaining forVGluT1 is the striatum, which is also known to receivemassive innervation from the cerebral cortex (Graybiel andRagsdale, 1979). We obtained our results by using a numberof different primary antibodies. All produced comparablepatterns of VGluT1 immunoreactivity consistent with otherreports that have described significant VGluT1 immunore-activity in the thalamus (Fremeau et al., 2001; Kaneko et al.,2002; Land et al., 2004; Nakamura et al., 2005).

VGluT1 immunoreactivity disappeared from both theVP nucleus and the reticular nucleus after cortical lesions.Both nuclei are densely innervated by corticothalamic fi-bers that arise from layer VI cells (Hoogland et al., 1987).The corticothalamic projection to the reticular nucleusplays a key role in entraining ensembles of reticular nu-cleus neurons and in promoting the low-frequency oscilla-tions of the thalamocortical network during sleep, espe-cially those in the spindle frequency range (7–14 Hz) thatare engendered in the reticular nucleus (Steriade, 2000).

Fig. 6. On-slide in situ hybridization for VGluT1 (A) and VGLuT2(B) in the VP. Emulsion-dipped autoradiograms show that for bothtranscripts, accumulations of silver grains are selectively found overlarge, pale profiles, corresponding to neuronal cell bodies. Smaller,darker profiles, belonging to glial cell bodies, are devoid of overlyingsilver grains. Scale bar � 10 �m in B (applies to A,B).



The capacity of corticothalamic fibers to sustain oscilla-tory activity in the network under these two conditions isalso facilitated by the proven capacity of the corticotha-lamic synapses, at least in the VP, for paired-pulse facil-itation (Castro-Alamancos and Calcagnotto, 1999; Gols-hani et al., 2001).

In this paradigm, the first stimulus of a pair is thoughtto leave a residual level of Ca2 in a terminal, thus en-hancing the probability of transmitter release and an en-hanced synaptic response when a second stimulus arriveswithin a short following time period (Katz and Miledi,1968; Regehr and Atluri, 1995; Helmchen et al., 1997).

Fig. 7. VGluT mRNA expression in the spinal cord and brainstem.Nissl-stained sections and film autoradiograms of the same sections.A: Spinal cord. Superficial and deep dorsal horn, containing cellscontributing axons to the spinothalamic tract, are virtually devoid ofVGluT1 mRNA, while expressing high levels of VGluT2 mRNA.B: Lower brainstem. Both the SpV, containing cells of origin of thespinal trigeminothalamic tract, and dorsal column nuclei (Gr and Cu),origin of medial lemniscal axons, are rich in VGluT2 mRNA only.C: Upper brainstem. Cells in the principal trigeminal nucleus, pro-jecting axons to the medial part of the VP in the thalamus, express

high levels of VGluT2 but not VGluT1 mRNA. The deep cerebellarnuclei, which contain cells projecting to the ventral lateral nucleus ofthe thalamus, display high levels of VGluT2 mRNA and are devoid ofVGluT1 mRNA. Abbreviations: cu and Cu: cuneate fasciculus andnucleus; CN: cochlear nucleus; DCbN: deep cerebellar nuclei; DH:dorsal horn; ECu: external cuneate nucleus; gr and Gr: gracile fascic-ulus and nucleus; PrV: principal trigeminal nucleus; SpV: spinaltrigeminal nucleus; VH; ventral horn; VNC: vestibular nuclear com-plex. Scale bar � 1 mm in A–C.



Fig. 8. VGluT expression (green) in axon terminals in the VPlabeled by unilateral injections of anterograde tracer (magenta) in theSI (C,D) or dorsal column nuclei (E,F). A: Diagram representing theloci where fluorescent tracer was injected and the target of antero-grade axonal transport in the VP. Injections in the SI were centeredbetween hindlimb and forelimb representations and involved all cor-tical layers, sparing the underlying white matter. Injections in theDCN involved both cuneate and gracile nuclei, which project to thecontralateral thalamus. B: Quantitative analysis of co-localization ofthe two VGluTs in tracer-labeled axon terminals in the VP illustratedin C and D. Box plots represent the distributions of M2 coefficients forthe two sets of labeled thalamic afferents. **, P � 0.001. C: Tracerinjections in the SI label many corticothalamic axon terminals, whichco-localize with VGluT1 immunoreactivity (double arrowheads). Ret-rogradely labeled processes of thalamic relay neurons (arrows) do notexpress VGluT1. D: Anterogradely labeled corticothalamic axon ter-minals and retrogradely labeled relay cells do not co-localize with

VGluT2 immunoreactivity. Note the complex, often perforated shapeof VGluT2-immunofluorescent axon terminals and their relation toproximal dendrites of retrogradely labeled relay cells, comparable tothe lemniscal axon terminal reconstructed in Figure 4. E: Labeledlemniscal axon terminals in VP never co-localize with VGluT1-immunopositive puncta. F: Labeled lemniscal axon terminals, both enpassant and terminal boutons, express VGluT2 (double arrowheads).Labeled portions of axons that do not bear synaptic specializations(arrows) do not contain VGluT2 immunoreactivity. Abbreviations:Acc, nucleus accumbens; CB, cerebellum; cc, corpus callosum; CPu,caudate-putamen; DCN, dorsal columns nuclei; HF, hippocampal for-mation; H, hypothalamus; ic, internal capsule; IC, inferior colliculus;M, motor cortex; ml, medial lemniscus; OB, olfactory bulb; R, reticularnucleus; RN, red nucleus; PN, pontine nuclei; S1, primary somatosen-sory cortex; SC, superior colliculus; VPL, ventral posterior lateralnucleus; VPM, ventral posterior medial nucleus; V, visual cortex.Scale bar � 10 �m in C–F.



Fremeau et al. (2004a) found that VGluT1 is generallyfound at synapses exhibiting a low probability of releaseand a capacity for long-term potentiation, so the presenceof VGluT1 in corticothalamic terminals can be seen as alikely facilitator of repetitive, oscillatory activity in thenetwork and of short-term synaptic plasticity. VGluT2, bycontrast, was found to be generally associated with syn-apses exhibiting a higher probability of release and a

capacity for long-term depression. In this regard it is to benoted that lemniscal synapses, which are associated spe-cifically with VGluT2, exhibit not only a high probabilityof transmitter release but also paired-pulse depression(Castro-Alamancos, 2002). These may be important ele-ments in the capacity of lemniscal synapses to relay suc-cessfully barrages of activity arriving from peripheral sen-sory receptors. In the cerebral cortex, increased neuronal

Fig. 9. Effects of lesions of the SI or medial lemniscus (ML) onVGluT immunoreactivity in the thalamus. Boxes in A and C mark VPareas shown at higher magnification in the corresponding panels in Band D, respectively. A: SI lesion causes complete loss of VGluT1immunoreactivity in the ipsilateral ventral posterior and reticularnuclei, whereas no change is seen in the contralateral thalamus. TheML lesion has no effect on VGluT1 immunostaining in the VP. B: Thedense, punctate immunostaining completely surrounding unstainedcells bodies in the VP is lost after SI lesion. C: Lesion of the ascendingsomatosensory fiber tracts causes complete loss of VGluT2 immuno-

staining in the ipsilateral VP, with no effect on the contralateral VP.Residual VGluT2 immunostaining medial and dorsal to the VP iscontributed by gustatory and cerebellar afferents unaffected by thelesion. SI lesions do not affect VGluT2 immunoreactivity in the VP. Inthe ventral thalamus, ML lesion causes loss of immunopositive ter-minals in the ZI but leaves the RT unchanged. D: The large, darklystained VGluT2-immunopositive puncta disappear from the VP afterlesion of the ascending somatosensory axons. Scale bar � 250 �m inC (applies to A,C); 18 �m in D (applies to B,D).



activity tends to decrease VGluT1 expression and increaseVGluT2 expression (De Gois et al., 2005). If this effect is alsoexhibited by the parent cells of corticothalamic and lemnis-cal terminals, then there is further capacity for differentialplasticity at the synapses formed by the two sets of afferentsto the VP and other relay nuclei of the thalamus.

ACKNOWLEDGMENTS

We are grateful to Mr. Phong L. Nguyen, Ms. XiaohangFan, and Ms. Malalai Ysufzai for technical assistance, Dr.Shawn A. Mikula for the acquisition of digital images withthe T3 ScanScope scanner, and Dr. James M. Stone for thedevelopment of nearest-neighbor analysis software.

LITERATURE CITED

Alvarez FJ, Villalba RM, Zerda R, Schneider SP. 2004. Vesicular gluta-mate transporters in the spinal cord, with special reference to sensoryprimary afferent synapses. J Comp Neurol 472:257–280.

Barroso-Chinea P, Castle M, Aymerich MS, Perez-Manso M, Erro E, TunonT, Lanciego JL. 2007. Expression of the mRNAs encoding for thevesicular glutamate transporters 1 and 2 in the rat thalamus. J CompNeurol 501:703–715.

Bellocchio EE, Hu H, Pohorille A, Chan J, Pickel VM, Edwards RH. 1998.The localization of the brain-specific inorganic phosphate transportersuggests a specific presynaptic role in glutamatergic transmission.J Neurosci 18: 8648–8659.

Billups B. 2005. Colocalization of vesicular glutamate transporters in therat superior olivary complex. Neurosci Lett 382:66–70.

Bolte S, Cordelieres FP. 2006. A guided tour into subcellular colocalizationanalysis in light microscopy. J Microsc 224:213–232.

Boulland JL, Qureshi T, Seal RP, Rafiki A, Gundersen V, Bergersen LH,Fremeau RT Jr, Edwards RH, Storm-Mathisen J, Chaudhry FA. 2004.Expression of the vesicular glutamate transporters during develop-ment indicates the widespread corelease of multiple neurotransmit-ters. J Comp Neurol 480:264–280.

Bourassa J, Deschenes M. 1995. Corticothalamic projections from theprimary visual cortex in rats: a single fiber study using biocytin as ananterograde tracer. Neuroscience 66:253–263.

Bourassa J, Pinault D, Deschenes M. 1995. Corticothalamic projectionsfrom the cortical barrel field to the somatosensory thalamus in rats: asingle-fibre study using biocytin as an anterograde tracer. Eur J Neu-rosci 7:19–30.

Broman J. 1994. Neurotransmitters in subcortical somatosensory path-ways. Anat Embryol (Berl) 189:181–214.

Castro-Alamancos MA. 2002. Properties of primary sensory (lemniscal)synapses in the ventrobasal thalamus and the relay of high-frequencysensory inputs. J Neurophysiol 87:946–953.

Castro-Alamancos MA, Calcagnotto ME. 1999. Presynaptic long-term po-tentiation in corticothalamic synapses. J Neurosci 19:9090–9097.

Clements JR, Toth DD, Highfield DA, Grant SJ. 1991. Glutamate-likeimmunoreactivity is present within cholinergic neurons of the lat-erodorsal tegmental and pedunculopontine nuclei. Adv Exp Med Biol295:127–142.

Commons KG, Beck SG, Bey VW. 2005. Two populations of glutamatergicaxons in the rat dorsal raphe nucleus defined by the vesicular gluta-mate transporters 1 and 2. Eur J Neurosci 21:1577–1586.

Conti F, Candiracci C, Fattorini G. 2005. Heterogeneity of axon terminalsexpressing VGLUT1 in the cerebral neocortex. Arch Ital Biol 143:127–132.

Danik M, Cassoly E, Manseau F, Sotty F, Mouginot D, Williams S. 2005.Frequent coexpression of the vesicular glutamate transporter 1 and 2genes, as well as coexpression with genes for choline acetyltransferaseor glutamic acid decarboxylase in neurons of rat brain. J Neurosci Res81:506–521.

De Gois S, Schafer MK, Defamie N, Chen C, Ricci A, Weihe E, Varoqui H,Erickson JD. 2005. Homeostatic scaling of vesicular glutamate andGABA transporter expression in rat neocortical circuits. J Neurosci25:7121–7133.

Dyer CA, Hickey WF, Geisert EE Jr. 1991. Myelin/oligodendrocyte-specific

protein: a novel surface membrane protein that associates with micro-tubules. J Neurosci Res 28:607–613.

Fremeau RT Jr, Troyer MD, Pahner I, Nygaard GO, Tran CH, Reimer RJ,Bellocchio EE, Fortin D, Storm-Mathisen J, Edwards RH. 2001. Theexpression of vesicular glutamate transporters defines two classes ofexcitatory synapse. Neuron 31:247–260.

Fremeau RT Jr, Kam K, Qureshi T, Johnson J, Copenhagen DR, Storm-Mathisen J, Chaudhry FA, Nicoll RA, Edwards RH. 2004a. Vesicularglutamate transporters 1 and 2 target to functionally distinct synapticrelease sites. Science 304:1815–1819.

Fremeau RT Jr, Voglmaier S, Seal RP, Edwards RH. 2004b. VGLUTsdefine subsets of excitatory neurons and suggest novel roles for gluta-mate. Trends Neurosci 27:98–103.

Fujiyama F, Furuta T, Kaneko T. 2001. Immunocytochemical localizationof candidates for vesicular glutamate transporters in the rat cerebralcortex. J Comp Neurol 435:379–387.

Fujiyama F, Hioki H, Tomioka R, Taki K, Tamamaki N, Nomura S,Okamoto K, Kaneko T. 2003. Changes of immunocytochemical local-ization of vesicular glutamate transporters in the rat visual systemafter the retinofugal denervation 1. J Comp Neurol 465:234–249.

Fujiyama F, Kuramoto E, Okamoto K, Hioki H, Furuta T, Zhou L, NomuraS, Kaneko T. 2004. Presynaptic localization of an AMPA-type gluta-mate receptor in corticostriatal and thalamostriatal axon terminals.Eur J Neurosci 20:3322–3330.

Fyk-Kolodziej B, Dzhagaryan A, Qin P, Pourcho RG. 2004. Immunocyto-chemical localization of three vesicular glutamate transporters in thecat retina. J Comp Neurol 475:518–530.

Gargini C, Terzibasi E, Mazzoni F, Strettoi E. 2007. Retinal organizationin the retinal degeneration 10 (rd10) mutant mouse: a morphologicaland ERG study. J Comp Neurol 500:222–238.

Gilmor ML, Nash NR, Roghani A, Edwards RH, Yi H, Hersch SM, LeveyAI. 1996. Expression of the putative vesicular acetylcholine transporterin rat brain and localization in cholinergic synaptic vesicles. J Neurosci16:2179–2190.

Golshani P, Liu XB, Jones EG. 2001. Differences in quantal amplitude reflectGluR4- subunit number at corticothalamic synapses on two populations ofthalamic neurons. Proc Natl Acad Sci U S A 98:4172–4177.

Graybiel AM, Ragsdale CW Jr. 1979. Fiber connections of the basal gan-glia. Prog Brain Res 51:237–283.

Graziano A, Jones EG. 2004. Widespread thalamic terminations of fibersarising in the superficial medullary dorsal horn of monkeys and theirrelation to calbindin immunoreactivity. J Neurosci 24:248–256.

Groome N, Dawkes A, Barry R, Hruby R, Alvord E. 1988. New monoclonalantibodies reactive with defined sequential epitopes in human myelinbasic protein. J Neuroimmunol 19:305–315.

Hartig W, Riedel A, Grosche J, Edwards RH, Fremeau RT Jr, Harkany T,Brauer K, Arendt T. 2003. Complementary distribution of vesicularglutamate transporters 1 and 2 in the nucleus accumbens of rat:relationship to calretinin-containing extrinsic innervation andcalbindin-immunoreactive neurons. J Comp Neurol 465:1–10.

Helmchen F, Borst JG, Sakmann B. 1997. Calcium dynamics associatedwith a single action potential in a CNS presynaptic terminal. BiophysJ 72:1458–1471.

Herzog E, Bellenchi GC, Gras C, Bernard V, Ravassard P, Bedet C,Gasnier B, Giros B, El Mestikawy S. 2001. The existence of a secondvesicular glutamate transporter specifies subpopulations of glutama-tergic neurons. J Neurosci 21:RC181.

Herzog E, Takamori S, Jahn R, Brose N, Wojcik SM. 2006. Synaptic andvesicular co-localization of the glutamate transporters VGLUT1 andVGLUT2 in the mouse hippocampus. J Neurochem 99:1011–1018.

Hioki H, Fujiyama F, Taki K, Tomioka R, Furuta T, Tamamaki N, KanekoT. 2003. Differential distribution of vesicular glutamate transporters inthe rat cerebellar cortex. Neuroscience 117:1–6.

Hisano S, Hoshi K, Ikeda Y, Maruyama D, Mizuki K, Ichijo H, Kojima I,Takeda J, Nogami H. 2000. Regional expression of a gene encoding aneuron-specific Na-dependent inorganic phosphate cotransporter(DNPI) in the rat forebrain. Brain Res Mol Brain Res 83:34–43.

Hisano S, Sawada K, Kawano M, Kanemoto M, Xiong G, Mogi K, Sakata-Haga H, Takeda J, Fukui Y, Nogami H. 2002. Expression of inorganicphosphate/vesicular glutamate transporters (BNPI/VGLUT1 andDNPI/VGLUT2) in the cerebellum and precerebellar nuclei of the rat.Brain Res Mol Brain Res 107:23–31.

Hoogland PV, Welker E, Van der Loos H. 1987. Organization of the pro-jections from barrel cortex to thalamus in mice studied with Phaseolusvulgaris-leucoagglutinin and HRP. Exp Brain Res 68:73–87.



Hur EE, Zaborszky L. 2005. VGluT2 afferents to the medial prefrontal andprimary somatosensory cortices: a combined retrograde tracing in situhybridization. J Comp Neurol 483:351–373.

Jones EG. 1975. Some aspects of the organization of the thalamic reticularcomplex. J Comp Neurol 162:285–308.

Jones EG. 1998. Viewpoint: the core and matrix of thalamic organization.Neuroscience 85:331–345.

Jones EG. 2007. The thalamus, 2nd ed. Cambridge, UK: Cambridge Uni-versity Press.

Kaneko T, Mizuno N. 1988. Immunohistochemical study of glutaminase-containing neurons in the cerebral cortex and thalamus of the rat.J Comp Neurol 267:590–602.

Kaneko T, Fujiyama F, Hioki H. 2002. Immunohistochemical localizationof candidates for vesicular glutamate transporters in the rat brain.J Comp Neurol 444:39–62.

Katz B, Miledi R. 1968. The role of calcium in neuromuscular facilitation.J Physiol 195:481–492.

Land PW, Kyonka E, Shamalla-Hannah L. 2004. Vesicular glutamatetransporters in the lateral geniculate nucleus: expression of VGLUT2by retinal terminals. Brain Res 996:251–254.

Landry M, Bouali-Benazzouz R, El Mestikawy S, Ravassard P, Nagy F. 2004.Expression of vesicular glutamate transporters in rat lumbar spinal cord,with a note on dorsal root ganglia. J Comp Neurol 468:380–394.

Lavoie B, Parent A. 1994. Pedunculopontine nucleus in the squirrel mon-key: distribution of cholinergic and monoaminergic neurons in themesopontine tegmentum with evidence for the presence of glutamate incholinergic neurons. J Comp Neurol 344:190–209.

Levine JM, Stallcup WB. 1987. Plasticity of developing cerebellar cells invitro studied with antibodies against the NG2 antigen. J Neurosci7:2721–2731.

Levine JM, Stincone F, Lee YS. 1993. Development and differentiation ofglial precursor cells in the rat cerebellum. Glia 7:307–321.

Li JL, Fujiyama F, Kaneko T, Mizuno N. 2003a. Expression of vesicularglutamate transporters, VGluT1 and VGluT2, in axon terminals ofnociceptive primary afferent fibers in the superficial layers of themedullary and spinal dorsal horns of the rat

13. J Comp Neurol 457:236–249.Li JL, Xiong KH, Dong YL, Fujiyama F, Kaneko T, Mizuno N. 2003b.

Vesicular glutamate transporters, VGluT1 and VGluT2, in the trigem-inal ganglion neurons of the rat, with special reference to coexpression.J Comp Neurol 463:212–220.

Liguz-Lecznar M, Skangiel-Kramska J. 2007. Vesicular glutamate trans-porters VGLUT1 and VGLUT2 in the developing mouse barrel cortex.Int J Dev Neurosci 25:107–114.

Lindstrom S, Wrobel A. 1990. Frequency dependent corticofugal excitationof principal cells in the cat’s dorsal lateral geniculate nucleus. ExpBrain Res 79:313–318.

Liu XB, Honda CN, Jones EG. 1995. Distribution of four types of synapseon physiologically identified relay neurons in the ventral posteriorthalamic nucleus of the cat. J Comp Neurol 352:69–91.

Manders EM, Stap J, Brakenhoff GJ, van Driel R, Aten JA. 1992. Dynam-ics of three-dimensional replication patterns during the S-phase, ana-lysed by double labelling of DNA and confocal microscopy. J Cell Sci103:857–862.

Melone M, Burette A, Weinberg RJ. 2005. Light microscopic identificationand immunocytochemical characterization of glutamatergic synapsesin brain sections. J Comp Neurol 492:495–509.

Miyazaki T, Fukaya M, Shimizu H, Watanabe M. 2003. Subtype switchingof vesicular glutamate transporters at parallel fibre-Purkinje cell syn-apses in developing mouse cerebellum. Eur J Neurosci 17:2563–2572.

Moechars D, Weston MC, Leo S, Callaerts-Vegh Z, Goris I, Daneels G,Buist A, Cik M, van der SP, Kass S, Meert T, D’Hooge R, RosenmundC, Hampson RM. 2006. Vesicular glutamate transporter VGLUT2 ex-pression levels control quantal size and neuropathic pain. J Neurosci26:12055–12066.

Montana V, Ni Y, Sunjara V, Hua X, Parpura V. 2004. Vesicular glutamatetransporter-dependent glutamate release from astrocytes. J Neurosci24: 2633–2642.

Nahmani M, Erisir A. 2005. VGluT2 immunochemistry identifies thalamo-cortical terminals in layer 4 of adult and developing visual cortex.J Comp Neurol 484:458–473.

Nakamura K, Hioki H, Fujiyama F, Kaneko T. 2005. Postnatal changes ofvesicular glutamate transporter (VGluT)1 and VGluT2 immunoreac-

tivities and their colocalization in the mouse forebrain. J Comp Neurol492:263–288.

Ni B, Rosteck PR, Jr., Nadi NS, Paul SM. 1994. Cloning and expression ofa cDNA encoding a brain-specific Na()-dependent inorganic phos-phate cotransporter. Proc Natl Acad Sci U S A 91:5607–5611.

Ojima H. 1994. Terminal morphology and distribution of corticothalamicfibers originating from layers 5 and 6 of cat primary auditory cortex.Cereb Cortex 4:646–663.

Oliveira AL, Hydling F, Olsson E, Shi T, Edwards RH, Fujiyama F, KanekoT, Hokfelt T, Cullheim S, Meister B. 2003. Cellular localization of threevesicular glutamate transporter mRNAs and proteins in rat spinal cordand dorsal root ganglia. Synapse 50:117–129.

Persson S, Boulland JL, Aspling M, Larsson M, Fremeau RT Jr, EdwardsRH, Storm-Mathisen J, Chaudhry FA, Broman J. 2006. Distribution ofvesicular glutamate transporters 1 and 2 in the rat spinal cord, with anote on the spinocervical tract. J Comp Neurol 497:683–701.

Raju DV, Shah DJ, Wright TM, Hall RA, Smith Y. 2006. Differential synap-tology of vGluT2-containing thalamostriatal afferents between the patchand matrix compartments in rats. J Comp Neurol 499:231–243.

Regehr WG, Atluri PP. 1995. Calcium transients in cerebellar granule cellpresynaptic terminals. Biophys J 68:2156–2170.

Regher WG, Stevens CF. 2001. Physiology of synaptic transmission andshort-term plasticity. In Sudhof TC, Stevens CF, editors. Synapses.Baltimore, MD: The Johns Hopkins University Press.

Ridler T, Calvard S. 1978. Picture thresholding using an iterative selectionmethod. IEEE Trans Systems Man Cybernet 8:629–632.

Sakata-Haga H, Kanemoto M, Maruyama D, Hoshi K, Mogi K, Narita M,Okado N, Ikeda Y, Nogami H, Fukui Y, Kojima I, Takeda J, Hisano S.2001. Differential localization and colocalization of two neuron-types ofsodium-dependent inorganic phosphate cotransporters in rat forebrain.Brain Res 902:143–155.

Steriade M. 2000. Corticothalamic resonance, states of vigilance and men-tation. Neuroscience 101:243–276.

Steriade M, Pare D, Parent A, Smith Y. 1988. Projections of cholinergic andnon-cholinergic neurons of the brainstem core to relay and associationalthalamic nuclei in the cat and macaque monkey. Neuroscience 25:47–67.

Takamori S, Rhee JS, Rosenmund C, Jahn R. 2001. Identification ofdifferentiation-associated brain-specific phosphate transporter as a sec-ond vesicular glutamate transporter (VGluT2). J Neurosci 21: RC182.

Todd AJ, Hughes DI, Polgar E, Nagy GG, Mackie M, Ottersen OP, MaxwellDJ. 2003. The expression of vesicular glutamate transporters VGLUT1and VGLUT2 in neurochemically defined axonal populations in the ratspinal cord with emphasis on the dorsal horn. Eur J Neurosci 17:13–27.

Van Horn SC, Erisir A, Sherman SM. 2000. Relative distribution of syn-apses in the A-laminae of the lateral geniculate nucleus of the cat.J Comp Neurol 416:509–520.

Varoqui H, Schafer MK, Zhu H, Weihe E, Erickson JD. 2002. Identificationof the differentiation-associated Na/PI transporter as a novel vesic-ular glutamate transporter expressed in a distinct set of glutamatergicsynapses. J Neurosci 22:142–155.

von Krosigk M, Monckton JE, Reiner PB, McCormick DA. 1999. Dynamicproperties of corticothalamic excitatory postsynaptic potentials andthalamic reticular inhibitory postsynaptic potentials in thalamocorticalneurons of the guinea-pig dorsal lateral geniculate nucleus. Neuro-science 91:7–20.

Wassle H, Regus-Leidig H, Haverkamp S. 2006. Expression of the vesicu-lar glutamate transporter vGluT2 in a subset of cones of the mouseretina. J Comp Neurol 496:544–555.

Willis WD, Zhang X, Honda CN, Giesler GJ. 2001. Projections from themarginal zone and deep dorsal horn to the ventrobasal nuclei of theprimate thalamus. Pain 92:267–276.

Wilson NR, Kang J, Hueske EV, Leung T, Varoqui H, Murnick JG, Erick-son JD, Liu G. 2005. Presynaptic regulation of quantal size by thevesicular glutamate transporter VGLUT1. J Neurosci 25:6221–6234.

Wojcik SM, Rhee JS, Herzog E, Sigler A, Jahn R, Takamori S, Brose N,Rosenmund C. 2004. An essential role for vesicular glutamate trans-porter 1 (VGLUT1) in postnatal development and control of quantalsize. Proc Natl Acad Sci U S A 101:7158–7163.

Yeterian EH, Pandya DN. 1994. Laminar origin of striatal and thalamicprojections of the prefrontal cortex in rhesus monkeys. Exp Brain Res99:383–398.

Zhou J, Nannapaneni N, Shore S. 2007. Vesicular glutamate transporters1 and 2 are differentially associated with auditory nerve and spinaltrigeminal inputs to the cochlear nucleus. J Comp Neurol 500:777–787.



vesicular glutamate transporters define two sets of glutamatergic afferents to the somatosensory...

Documents