uva-dare (digital academic repository) stepping into the ring: … · stepping into the ring rinske...

UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Stepping into the RING: preclinical models in the fight against hereditary breast cancer

Drost, R.M.

Link to publication

Citation for published version (APA):Drost, R. M. (2012). Stepping into the RING: preclinical models in the fight against hereditary breast cancer.Amsterdam: Het Nederlands Kanker Instituut - Antoni van Leeuwenhoek Ziekenhuis.

General rightsIt is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, statingyour reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Askthe Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,The Netherlands. You will be contacted as soon as possible.

Download date: 10 Mar 2020

https://dare.uva.nl/personal/pure/en/publications/stepping-into-the-ring-preclinical-models-in-the-fight-against-hereditary-breast-cancer(568b6c89-3b2a-444b-a0d3-f7a9034ca085).html

Stepping intothe RING

Rinske Drost

Preclinical models in the fight against hereditary breast cancer

Rinske Drost

2012


door Rinske Drost

op vrijdag 14 september 2012om 14:00 uur

in de Agnietenkapel van deUniversiteit van AmsterdamOudezijds Voorburgwal 231

Na afloop van de verdediging bent u van harte welkom op de receptie ter plaatse

Rinske DrostDen Brielstraat 113554 XD Utrecht

[email protected]

PArANimfeN

Ute Boon06-13308076

[email protected]

Karlijn Drost06-50894020

[email protected]

Uitnodigingvoor het bijwonen van

de openbare verdediging van het proefschrift:

Stepping into the RING

Preclinical models in the fight against

hereditary breast cancer

Stepping into the RING:


Rinske Marlien Drost

Copyright © Rinske Drost, 2012

ISBN: 978-94-6108-324-1

The research described in this thesis was conducted in the division of Molecular Pathology at the Netherlands Cancer Institute, and was supported by grants from the Dutch Cancer Society (KWF) to J. Jonkers.

Cover design: Esther Ris, www.proefschriftomslag.nl Published by: Het Nederlands Kanker Instituut - Antoni van Leeuwenhoek ZiekenhuisPrinted by: Gildeprint Drukkerijen, Enschede, the Netherlands

This thesis was printed with financial support from the Netherlands Cancer Institute, the Dutch Cancer Society (KWF) and the Amsterdam Academic Medical Center (AMC).

Stepping into the RING:


Academisch proefschrift

ter verkrijging van de graad van doctoraan de Universiteit van Amsterdamop gezag van de Rector Magnificus

prof. dr. D.C. van den Boomten overstaan van een door het collegevoor promoties ingestelde commissie,

in het openbaar te verdedigen in de Agnietenkapelop vrijdag 14 september 2012, te 14:00 uur

door

Rinske Marlien Drost

geboren te Utrecht

Promotiecommissie:

Promotor: Prof. dr. A.J.M. BernsCo-promotor: Dr. J.M.M. Jonkers Overige leden: Prof. dr. P. Borst Prof. dr. P. Devilee Prof. dr. J.H.J. Hoeijmakers Prof. dr. M.M.S van Lohuizen Prof. dr. M.J. van de Vijver

Faculteit der Geneeskunde

"Inside a ring or out , ain't nothing wrong with going down. It's staying down that's wrong."

Muhammad Ali (American former professional boxer)

Table of contents

Abbreviations

Chapter 1 Preclinical mouse models for BRCA1-associated breast cancer.

Chapter 2 Selective inhibition of BRCA2-deficient mammary tumor cell growth by AZD2281 and cisplatin.

Chapter 3 BRCA1-deficient mouse mammary tumor cells are dependent on EZH2 expression and sensitive to Polycomb Repressive Complex 2-inhibitor 3-deazaneplanocin A.

Chapter 4 Loss of p53 partially rescues embryonic development of Palb2 knockout mice but does not foster haploinsufficiency of Palb2 in tumour suppression.

Chapter 5 BRCA1 RING function is essential for tumor suppression but dispensable for therapy resistance.

Chapter 6 BRCA1185delAG tumors may acquire therapy resistance through expression of a RING-less BRCA1 protein via internal translation reinitiation.

Chapter 7 General discussion

Appendix English summary

Nederlandse samenvatting

Curriculum vitae

Publications

Dankwoord

9

13

29

49

69

95

133

169

193

197

200

201

202

Abbreviations

5-FU 5-fluorouracilaa amino acidsABC ATP-binding cassetteaCGH array comparative genomic hybridizationATM ataxia-telangiectasia mutatedBAC bacterial artificial chromosomeBACH1 BRCA1-interacting protein C-terminal helicase 1BARD1 BRCA1-associated RING domain protein 1BER base excision repairBIC breast cancer information coreBLG beta-lactoglobinBrdU bromodeoxyuridineCK cytokeratinCNA copy number aberrationCOBRA-FISH combined binary ratio labelling-fluorescence in situ hybridizationCtIP CtBP-interacting protein 1DDR DNA damage responseDOPPCR degenerate-oligonucleotide priming polymerase chain reactionDSB double-strand breakDZNep 3-deanzaneplanocin AE embryonic dayER estrogen receptorES embryonic stemFA fanconi anaemiaFA-N fanconi anaemia subtype NFA-D1 fanconi anaemia subtype D1GEMM genetically engineered mouse modelH3-K27me3 histone H3 lysine 27 trimethylationHBOC hereditary breast and ovarian cancerHER2 human epidermal growth factor receptor type 2HR homologous recombinationHRD homologous recombination deficiencyHU hydroxyureaICL interstrand crosslinkIDC invasive ductal carcinomaIR ionizing radiationIRIFs irradiation-induced fociKB1(185stop)P K14cre;Brca1F/185stop;p53F/F

KB1(5382stop)P K14cre;Brca1F/5382stop;p53F/F

KB1C61GP K14cre;Brca1F/C61G;p53F/F

KB1P K14cre;Brca1F/F;p53F/F

KB2P K14cre;Brca2F/F;p53F/F

KP K14cre;p53F/F

LIF leukaemia inhibitory factorLOH loss of heterozygositymESCs mouse embryonic stem cellsMMC mitomycin CMMR mismatch repairMMS methylmethane sulphonateMMTV mouse mammary tumor virus MTD maximum tolerable doseNER nucleotide excision repairNES nuclear export sequenceNLS nuclear localization signalNMD nonsense-mediated mRNA decayOS overall survivalPALB2 partner and localizer of BRCA2PARP poly(ADP-ribose) polymerase-1PDX patient-derived xenograftPI3K phospho-inositol-3 kinasePR progesterone receptorPRC2 polycomb repressive complex 2RMCE recombinase-mediated cassette exchangeSCD SQ/TQ cluster domainSCE sister chromatid exchangeSCM stem cell mediumshRNA short hairpin RNASKY spectral karyotypingSNP small nucleotide polymorphismSRB sulforhodamine BSSB single-strand breakssDNA single-stranded DNATFS tumor-free survivalTNBC triple negative breast cancerTSA trichostatin AWAP whey acidic protein

Chapter 1 Preclinical mouse models for BRCA1-associated breast cancer

Rinske Drost1 and Jos Jonkers1

British Journal of Cancer 2009 (101):1651-1657

1 Division of Molecular Biology, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands

Chapter 1

1

14

A substantial part of all hereditary breast cancer cases is caused by BRCA1 germ-line mutations. In this review, we will discuss the insights into BRCA1 functions we have obtained from mouse models with conventional and conditional mutations in Brca1. The most advanced models closely resemble human BRCA1-related breast cancer and may therefore be useful to address clinically relevant questions.

Introduction

Breast cancer is by far the most frequent cancer in women, accounting for over 20% of all cancer cases. Familial breast cancers, including those associated with heterozygous germline mutations in the major susceptibility genes BRCA1 and BRCA2, account for 5-10% of breast cancer cases in the western world. BRCA1 mutation carriers have a lifetime risk of about 80% for developing breast cancer and a 40% life time risk for developing ovarian cancer. Most BRCA1-associated tumours display loss of heterozygosity (LOH) at the BRCA1 locus, leading to loss of the wild-type allele, which is consistent with a tumour suppressor function of BRCA1 (Narod and Foulkes, 2004). Since the discovery of the BRCA1 gene in 1994 (Miki et al., 1994), several genetically engineered mouse models have been generated to study the in vivo functions of BRCA1. Initial studies used conventional knockout mice with germline mutations in the mouse Brca1 gene. These conventional Brca1 mouse mutants have taught us a lot about the biological roles of BRCA1. Because of embryonic lethality of homozygous animals carrying two defective Brca1 alleles and lack of mammary tumour development in heterozygous mice carrying one defective and one wild-type Brca1 allele, these models could not be used to study the role of BRCA1 in tumorigenesis. To overcome these problems, investigators generated conditional Brca1 knockout mice that enable tissue-specific inactivation of BRCA1 by Cre recombinase-mediated deletion of one or more Brca1 exons flanked by loxP recombination sites (Jonkers and Berns, 2002). The most recently developed conditional Brca1 mammary tumour models closely mimic several important aspects of human BRCA1-associated breast cancer and therefore serve as important tools for the development of novel therapies for this disease. Before elaborating on the Brca1 conventional and conditional mouse models that have been generated to date, we will discuss the characteristics of human BRCA1-related breast cancer in more detail.

Human BRCA1-associated breast cancerBRCA1-associated breast tumours are mostly high-grade invasive ductal carcinomas (IDCs) that lack expression of estrogen receptor (ER), progesterone receptor (PR) and ERRB2/HER2, which is referred to as ‘triple-negative’ breast cancer (Jóhannsson et al., 1997). Consequently, most patients with BRCA1-mutated breast cancer do not benefit from therapeutics that target ER- or ERBB2/HER2-expressing tumour cells. Gene expression profiling revealed a strong resemblance between BRCA1-mutated tumours and sporadic basal-type breast cancer (Sorlie et al., 2003). BRCA1-related tumours commonly express basal cytokeratins (CK5, CK6, CK14 and CK17), are highly proliferative and show pushing margins (Foulkes et al., 2003). BRCA1-mutated tumours also display a significantly higher degree of genomic instability than sporadic breast cancers (Tirkkonen et al., 1997), which is likely due to the functions of BRCA1 in cell cycle regulation and DNA repair (see below). Mutations in BRCA1 are not confined to certain functional domains, but are scattered throughout the gene (Breast Cancer Information Core; http://research.nhgri.nih.

Preclinical mouse models for BRCA1-associated breast cancer

1

15

gov/bic/). Approximately half of all BRCA1 mutations are protein truncating or deleterious missense mutations, whereas the pathogenic potential of the remainder is unknown (Chenevix-Trench et al., 2006). Mutations in the tumour suppressor gene TP53 are more frequent in BRCA1-associated breast tumours than in sporadic cases (Greenblatt et al., 2001), mainly due to a selective increase in protein truncating TP53 mutations (Holstege et al., 2009; Manié et al., 2009).

Insights into the biological functions of BRCA1BRCA1 has been implicated in a remarkably broad range of cellular processes and has also been reported to interact with a large number of different proteins. In this section we will briefly describe some of the known functions of BRCA1 and we will also review some recent data that point towards novel functions of BRCA1. First of all, BRCA1 has been found to co-localize and interact with proteins involved in DNA repair, like RAD51 (Scully et al., 1997). This interaction led to the suggestion that BRCA1 is involved in the maintenance of genomic stability through a function in DNA damage repair. Direct proof for this notion was provided by Moynahan and colleagues, who demonstrated that BRCA1-deficient mouse embryonic stem cells are impaired in homology-directed repair of DNA double-strand breaks (DSBs) (Moynahan et al., 1999). Further indications for a role of BRCA1 in DNA repair are the increased chromosomal instability and high sensitivity to DNA damaging agents of BRCA1-deficient cells (Kennedy et al., 2004). Besides its role in DNA repair, BRCA1 has been implicated in transcriptional regulation (via its interaction with RNA polymerase II and known transcription factors), cell cycle progression (Deng, 2006), ubiquitination and chromatin remodelling (Mullan et al., 2006), as well as in maintenance of X-chromosome inactivation (Ganesan et al., 2002). Recent work in the group of Wicha revealed that BRCA1 may play a role in the differentiation of ER-negative stem/progenitor cells to ER-positive luminal cells (Liu et al., 2008). Inhibition of BRCA1 in primary breast epithelial cells by RNA interference leads to an increase in ALDH1-positive stem/progenitor cells and a decrease in ER-positive luminal cells. Thus, loss of BRCA1 appears to induce a block in epithelial differentiation and expansion of the undifferentiated stem/progenitor cell compartment. These results might explain why most BRCA1-mutated breast tumours have an undifferentiated basal-like phenotype.

Conventional Brca1 mouse modelsA range of conventional Brca1 knockout mouse models has been generated in an attempt to study the effects of BRCA1 loss. Until now, a total of 10 different conventional Brca1 mouse mutants have been generated and characterized, each carrying a mutation in a different part of the gene (Xu et al., 1999a; Evers and Jonkers, 2006; Kim et al., 2006). In contrast to women with heterozygous BRCA1 germ-line mutations, none of the heterozygous Brca1 mouse mutants developed spontaneous mammary tumours. Although the reason for this inconsistency is still unclear, it could point to a species difference: the lifespan of a mouse might simply be too short or the rate of LOH might be too low for heterozygous Brca1 mice to acquire additional mutations necessary for tumour development. Alternatively, there might be (tissue-specific) differences in haplo-insufficiency of the heterozygous Brca1 allele between humans and mice. Embryonic lethality is observed for most homozygous

Chapter 1

1

16

Brca1 mouse mutants. In line with the embryonic lethality of Brca1 mouse mutants, no homozygous BRCA1 mutation carriers have been described (Kuschel et al., 2001). Most homozygous Brca1 mouse mutants die at mid-gestation, between embryonic day 7.5 and 13.5, due to reduced cellular proliferation without signs of increased apoptosis (Evers and Jonkers, 2006). The variation in time point and penetrance of embryonic lethality could be a consequence of different genetic backgrounds of various Brca1 mouse strains. However, also differences in protein truncation and alternative splicing of Brca1 could play an important role in the observed phenotypic variation between these models. A comprehensive characterization of the regulation and function of alternative splice variants is necessary for accurate interpretation of the different Brca1 mutant phenotypes. Evolutionary conservation may be a good indication for functionality of specific splice variants. Thus far, three Brca1 splice variants have been demonstrated and functionally analysed in mice: Brca1-Δ11 (Xu et al., 1999b; Kim et al., 2006), Brca1-Iris and Brca1-Δ22 (Pettigrew et al., 2010). Mouse embryos carrying Brca1 mutations that abolish expression of full-length Brca1 without affecting Brca1-Δ11 expression, survive significantly longer than embryos harbouring Brca1 mutations that abolish expression of both transcripts (Evers and Jonkers, 2006). Mouse BRCA1-Δ11, alike full-length BRCA1, is localized in nuclear foci and exhibits a cell cycle-regulated expression pattern (Huber et al., 2001). However, BRCA1-Δ11 is not phosphorylated and does not promote formation of RAD51 foci upon DNA damage. Indeed, homozygous Brca1Tr mouse mutants that express BRCA1-Δ11 are viable on a BALB/c genetic background, but develop various tumours including mammary carcinomas after long latency (Ludwig et al., 2001). Similarly, mice with mammary gland-specific deletion of full length Brca1 but retention of Brca1-Δ11 develop mammary adenocarcinomas characterized by genetic instability (Xu et al., 1999a). Thus, BRCA1-Δ11 may compensate for some of the functions of full-length BRCA1 during embryogenesis, but is unable to fully execute the functions of full-length BRCA1 in maintenance of genomic stability and tumour suppression. The BRCA1-IRIS transcript comprises of exons 1-11 and a part of intron 11, encoding for a protein with the same N-terminus as full-length BRCA1, but with a unique C-terminus (ElShamy and Livingston, 2004). BRCA1-IRIS was shown to be exclusively chromatin-associated and to have a positive influence on DNA replication. Recently Brca1-Iris, the mouse orthologue of human BRCA1-IRIS, was identified (Pettigrew et al., 2010). Most BRCA1 mouse models generated to date have deleted Brca1-Iris in addition to full-length Brca1 (Evers and Jonkers, 2006). Interestingly, the only Brca1 mutation that disrupts full-length Brca1 and Brca1-Δ11 transcripts but not Brca1-Iris, causes embryonic lethality at E10.5 (Hohenstein et al., 2001), suggesting that BRCA1-IRIS cannot compensate for the loss of full-length BRCA1 and BRCA1-D11 expression. Pettigrew and colleagues al identified BRCA1-Δ22 in both human and mouse cells (Pettigrew et al., 2010). Skipping of exon 22 leads to loss of the second BRCT repeat and functional analysis revealed that the BRCA1-Δ22 protein is no longer capable of transcriptional activation. In line with this, a Brca1 truncation mutant lacking the second BRCT repeat displays delayed embryonic lethality compared to Brca1-null mutants (Hohenstein et al., 2001). Similar to the differences in time point and penetrance of embryonic lethality observed for different Brca1 mouse mutants, also rescue of embryonic lethality by loss of p53 was subject to phenotypic variation. In Brca1-null mutants, p53-deficiency resulted


1

17

in only partial rescue of embryonic lethality (Hakem et al., 1997; Ludwig et al., 1997). In hypomorphic Brca1 mutants, the effects of a Trp53-null or Trp53-heterozygous background were more pronounced, leading to survival of Brca1 and Trp53 compound mutant mice to adulthood (Cressman et al., 1999; Xu et al., 2001). In conclusion, several Brca1 conventional mouse mutants have been generated that show phenotypic variation, ranging from early embryonic lethality to viable mice that develop tumours. This phenotypic variation is likely due to differences in expression of BRCA1 splice variants and BRCA1-IRIS in the various Brca1 mouse mutants.

Conditional Brca1 mouse modelsWhile conventional Brca1 mouse models have taught us a lot about the biological functions of BRCA1, the observed embryonic lethality of homozygous animals and lack of mammary tumour development in heterozygous mice made it difficult to study the role of BRCA1 in tumour suppression. For this purpose, investigators turned to conditional mouse models to study the effects of BRCA1 loss. To date five different conditional Brca1 alleles have been generated (Table 1): Brca1F11 (Xu et al., 1999a), Brca1F5-6 (Mak et al., 2000), Brca1F5-13 (Liu et al., 2007), Brca1F22-24

(McCarthy et al., 2007) and Brca1F2 (Shakya et al., 2008). While Cre-mediated deletion completely abrogates BRCA1 function for the Brca1F5-6, the Brca1F5-13 and the Brca1F22-24

allele, deletion of exon 11 in the Brca1F11 allele does not affect expression of the BRCA1-Δ11 isoform. Different tissue-specific promoters were used in combination with these conditional Brca1 alleles to achieve Cre expression in mammary epithelium. Xu and coworkers used transgenic mice expressing Cre from the whey acidic protein (WAP) or mouse mammary tumour virus (MMTV) promoter to induce mammary-specific recombination of the Brca1F11 alleles (Xu et al., 1999a). In both models different types of mammary tumours developed with a long latency and these tumours displayed genomic instability and altered Trp53 expression. The vast majority of these tumours were negative for ER, but a large proportion overexpressed ERBB2 (Table 1). Removal of one Trp53 allele significantly reduced mammary tumour latency (Brodie et al., 2001). These results proved that BRCA1 functions as a tumour suppressor and cooperates with TP53 in tumorigenesis. More evidence for interaction of BRCA1 and TP53 in tumorigenesis was provided by our lab. They have generated a conditional mouse model with K14cre-mediated deletion of both Brca1 and Trp53 in several epithelial tissues including mammary epithelium (Liu et al., 2007). Female mice of this strain showed a high incidence of mammary carcinomas that displayed important hallmarks of human BRCA1-associated breast tumours: Tumours were poorly differentiated, highly proliferative, genomically instable, ER-negative and showed increased expression of basal epithelial markers (Table 1). Another mouse model for basal-like breast cancer was generated by conditional deletion of Brca1 exons 22-24 (which harbour the second BRCT domain) in the mammary gland by using beta-lactoglobin (BLG)-cre (McCarthy et al., 2007). When combined with heterozygosity for a Trp53 mutation, this led to mammary tumour formation. The resulting mammary tumours were characterized by high histological grade, central necrotic areas and expression of basal-like markers. In addition, they frequently lack expression of ER, PR and ERBB2 (Table 1). Because of their strong resemblance to human BRCA1-related breast cancer, especially the mouse models of Liu and McCarthy should prove useful in preclinical therapeutic intervention studies.

Chapter 1

1

18

BRCA1 also interacts with BARD1, a protein which is structurally related to BRCA1 in that it contains a N-terminal RING domain and C-terminal BRCT repeats (Wu

Table 1. Conditional Brca1 mouse models

Brca

1 m

utat

ion

p53

co-m

utat

ion

Cre

tran

sgen

e

Gen

etic

bac

kgro

und

Mea

n tu

mor

late

ncy

(mon

ths)

Trip

le n

egat

ive

tum

ours

Basa

l lik

e tu

mou

rs

Init

ial p

lati

num

sen

siti

vity

Plat

inum

resi

stan

ce

Init

ial P

ARP

i sen

siti

vity

PAPR

i res

ista

nce

MMTVcre;Brca1F11/Δ11

WAPcre;Brca1F11/Δ11

(Xu et al., 1999a)

D11 NoMMTVcre

or WAPcreNIH-BL(S) >13 – No(1) – – – –

MMTVcre;Brca1F11/F11;p53+/-

WAPcre;Brca1F11/F11 ;p53+/-

(Brodie et al., 2001)

D11 NullMMTVcre

or WAPcre

NIH-BL(S),

C57BL/6,

129/Sv

8 No(2) No(1) – – – –

WAPcrec;Brca1F11/F11;

p53F5-6/F5-6

(Poole et al., 2006)

D11 D5-6 WAPcrec

C57BL/6,

129/Sv or

C57BL/6,

BALB/c

7 No(3) No(1) Yes Yes – –

BLGcre;Brca1F22-24/F22-24 ;p53+/-

(McCarthy et al., 2007)

D22-

24Null BLGcre

C57BL/6,

129/Sv7 Yes Yes – – – –

K14cre;Brca1F5-13/F5-13;

p53F2-10/F2-10

(Liu et al., 2007)

D5-

13

D2-

10K14cre

FVB,

129/Ola7 Yes Yes Yes No Yes Yes

WAPcre;Brca1F1/F1

(Shakya et al., 2008)D1 No WAPcre

C57BL/6,

129/Sv17 Yes Yes – – – Yes

–: Not determined; (1): Heterogeneous mammary tumor spectrum; (2): ERBB2-positive and ER-negative, PR status not determined; (3): PR-positive, ER and ERBB2 status not determined.

et al., 1996). The BRCA1/BARD1 heterodimer functions as a ubiquitin E3 ligase which can target proteins for destruction by transferring ubiquitin to these proteins (Hashizume et al., 2001). Until recently, the role of the BRCA1/BARD1 heterodimer in tumour suppression had not been evaluated. To address this question, Shakya and coworkers generated mouse strains carrying conditional alleles of Bard1 and/or Brca1 and used Cre-mediated recombination to inactivate these genes specifically in mammary epithelial cells (Shakya et al., 2008). Breast tumours arising in these conditional Bard1- and/or Brca1-mutant mice were indistinguishable from each other. These findings indicate that BARD1 itself is a tumour suppressor and that the tumour suppressor activities of BRCA1 are mediated by the BRCA1/BARD1 heterodimer. Recent experiments showed that ES cells expressing a ubiquitin ligase-deficient BRCA1-I26A mutant are viable and do not undergo spontaneous chromosomal


1

19

rearrangements (Reid et al., 2008). These cells display higher levels of genomic rearrangements after mitomycin C (MMC) treatment, but do not show hypersensitivity to MMC. Brca1I26A mutant ES-cells form Rad51 foci in response to irradiation and are capable of repairing double-strand breaks by homologous recombination. These results suggest that the function of BRCA1 in maintenance of genomic stability is not dependent on its ubiquitin ligase activity. Mouse models carrying ubiquitin ligase-deficient Brca1 alleles should reveal whether this activity is also dispensable for the tumour suppressor activity of BRCA1.

Chemoprevention studies in Brca1 modelsWhile genetic testing for inherited BRCA1 mutations provides valuable information to women at high risk of breast cancer, carriers of BRCA1 mutations have few clinical options to reduce their cancer risk. Prophylactic surgery is still one of the most important measures of breast cancer prevention for BRCA1 mutation carriers. The rationale for antihormonal therapy as an alternative for prophylactic surgery comes from the observation that oophorectomy prevents breast cancer in BRCA1 mutation carriers (Narod and Offit, 2005). These data indicate that, despite the fact that most BRCA1-mutated tumours are ER-negative, tumour development in BRCA1 mutation carriers is hormone-dependent. This hormone dependency might also be the reason why BRCA1 specifically functions as a tumour suppressor in hormone-sensitive tissues like breast and ovaries. Although the mechanistic basis for the hormone dependency and tissue specificity of BRCA1-associated tumorigenesis is still unknown, BRCA1 has been shown to interact directly with ERa and PR and to modulate their transcriptional activities (Fan et al., 1999; Katiyar et al., 2006). To address the role of PR signaling in BRCA1-mediated carcinogenesis, Poole and coworkers made use of the WAPcre;Brca1F11/F11;Trp53F5-6/F5-6 mouse model (Poole et al., 2006). Treatment of 3-4 month old mice with the PR inhibitor mifeprestone (RU 486) prevented mammary tumour formation in these mice. Although the results obtained with this conditional Brca1 mouse model hold promise for the development of anti-progesterones as prophylactic therapy for BRCA1-associated breast cancer, the jury is still out on this for several reasons. First, mifeprestone is not a selective PR antagonist because it binds also with high affinity to glucocorticoid receptors. It is therefore possible that the prevention of mammary tumours is (in part) caused by the antiglucocorticoid effects of mifeprestone. Second, it is not clear whether the mammary tumours arising in this WAPcre;Brca1F11/F11;Trp53F5-6/F5-6

mouse model do or do not express ER, PR and ERBB2. The status of ER, PR and ERBB2 could play an important role in the effectiveness of anti-progesterone therapy. Most human BRCA1-mutated breast cancers are ‘triple-negative’ tumours that do not express ER, PR and ERBB2. It is unclear whether anti-progesterone therapy will also protect against development of triple-negative breast tumours in BRCA1-mutation carriers. It may therefore be important to evaluate the effects of PR antagonists in BRCA1 mouse models that certainly recapitulate development of triple-negative BRCA1-associated breast cancer.

Chemotherapeutic interventions in Brca1 modelsBreast cancers of BRCA1 mutation carriers frequently show poor responses to neoadjuvant therapy with docetaxel, while platinum-based chemotherapy appeared to be highly effective (Byrski et al., 2008, 2009). Similarly, BRCA1/2 mutation carriers with ovarian cancer show higher response rates and longer overall survival following platinum-based

Chapter 1

1

20

chemotherapy than nonhereditary patients (Ben David et al., 2002; Tan et al., 2008). Unfortunately, experiments studying drug response and especially drug resistance in human patients are very time-consuming. Regarding this time issue, conditional Brca1 mouse models that develop mammary tumours with strong resemblance to human BRCA1-mutated breast tumours (Liu et al., 2007; McCarthy et al., 2007) can be very helpful in predicting response and resistance to conventional and targeted therapeutics. Our K14cre;Brca1F5-13/F5-13;Trp53F2-10/F 2-10 mouse model was used to study responses to various conventional chemotherapeutics, like doxorubicin, docetaxel and cisplatin, and to investigate mechanisms of acquired resistance (Rottenberg et al., 2007). Like in the human situation, heterogeneity in the response of individual mouse mammary tumours was observed, but eventually all tumours became resistant to doxorubicin and docetaxel. Up-regulation of ATP-binding cassette (ABC) drug transporters appeared to be the main mechanism responsible for resistance to doxorubicin. Remarkably, acquired resistance to platinum compounds was never observed. However, the tumours could also not be completely eradicated: even after dose-dense platinum therapy, the tumours appeared to regrow from a small fraction of surviving cells. Currently, these platinum-resistant tumour remnants are being further characterized. Also attempts are being made to achieve eradication of this small fraction of surviving cells by combination therapies. Especially intriguing is the observation that platinum resistance is never observed in these mouse tumours, whereas resistance is a major problem in the clinic. As described earlier, BRCA1 plays an important role in the error-free repair of double-stranded DNA breaks that occur after platinum therapy. These mouse tumour data raise the question whether platinum resistance can occur at all in BRCA1-deficient tumours that are completely defective in homology-directed DNA repair. This question became even more evident when Swisher and coworkers showed that acquired resistance to platinum compounds in BRCA1-mutated human ovarian tumours is associated with secondary mutations in BRCA1 that restore the open reading frame in platinum-resistant tumours (Swisher et al., 2008). Three out of five platinum-resistant tumours displayed secondary genetic changes in BRCA1, while no BRCA1 alterations were observed in three platinum-sensitive tumours. The main difference between the human situation and the K14cre;Brca1F5-13/F5-13;Trp53F2-10/F 2-10 mouse model is that the mouse tumours have a homozygous deletion of Brca1 exons 5-13. As a result of this large deletion, secondary mutations in Brca1 can not restore Brca1 function and serve as a mechanism for platinum resistance in the mouse tumours. Together, the human and mouse data suggest that BRCA1 not only functions as a tumour suppressor, but is also required for development of resistance to therapy. Intervention studies with conventional chemotherapeutics were also carried out in WAPcre;Brca1F11/F11;Trp53F5-6/F5-6 and MMTVcre;Brca1F11/F11;Trp53F5-6/F5-6 models (Shafee et al., 2008). In line with data obtained from the K14cre;Brca1F5-13/F5-13;Trp53F2-10/F 2-10 model, also Brca1D11/D11;Trp53D5-6/D5-6 tumours responded better to platinum compounds than to doxorubicin. Following initial regression, tumours relapsed at the same site 2-3 months after treatment. Whereas platinum resistance was never observed in the K14cre;Brca1F5-13/

F5-13;Trp53F2-10/F 2-10 model, Shafee and coworkers observed platinum resistance in their Brca1F11/F11;Trp53F5-6/F5-6 models. After a second round of treatment with platinum drugs, tumours recurred with a faster growth rate. This rapid recurrence could suggest the existence of a population of platinum-resistant cells which are selected during a second round of platinum treatment. An important difference between the two studies described


1

21

above is that Rottenberg and coworkers used a mouse model with a conditional Brca1 null allele, whereas Shafee and colleagues employed a Brca1 hypomorphic allele which still expresses the Brca1Δ11 isoform after cre-mediated deletion of exon 11. Furthermore, the platinum treatment regime differs considerably between the two studies. It would be informative to see whether Brca1D11/D11;Trp53D5-6/D5-6 tumours would acquire full resistance to platinum drugs during additional rounds of therapy and if so, by which mechanism.

Interventions with targeted therapeutics in Brca1 modelsUntil now, targeted therapeutics are only available for ER- and ERBB2-positive breast cancer, and no tailored therapy exists for triple-negative breast cancer. As mentioned earlier, BRCA1 deficiency causes defects in homology-directed DSB repair. A few years ago, BRCA1/2-deficient cells were shown to be highly sensitive to chemical inhibitors of Poly(ADP-ribose) polymerase-1 (PARP1), a key molecule in the repair of DNA single-strand breaks (SSBs) (Farmer et al., 2005). It is thought that, upon inactivation of SSB repair by PARP inhibition, DSBs are induced by replication fork collapse at SSBs during S-phase. Therefore, PARP inhibition may be synthetically lethal with BRCA1 loss and serve as a specific therapy for BRCA1-mutated tumours. The K14cre;Brca1F5-13/F5-13;Trp53F2-10/F2-10 mouse model was used to study the effects of PARP inhibition in a ‘realistic’ in vivo setting (Rottenberg et al., 2008). The BRCA1-deficient tumours arising in this model displayed a prolonged response to the clinical PARP inhibitor olaparib without signs of toxicity. Eventually, long-term treatment with olaparib resulted in resistance as a consequence of up-regulation of the P-glycoprotein drug efflux pump. Combining platinum therapy with PARP inhibition increased the relapse-free survival compared to platinum monotherapy, suggesting that PARP inhibition enhances the effects of DNA-damaging agents. Recently was shown that olaparib has antitumour activity in patients with BRCA1- or BRCA2-associated malignancies (Fong et al., 2009). These findings illustrate how Brca1 conditional mouse models can be of use for preclinical assessment of new targeted therapeutics.

Next-generation Brca1 modelsDespite the fact that current Brca1 mouse models have taught us a lot about BRCA1 function in normal development and tumorigenesis, improvements can still be made. For instance, nearly all existing mouse models for BRCA1-associated breast cancer described earlier are based on co-mutation of Trp53 and Brca1. It might be possible that mutations in yet other genes, such as Pten (Saal et al., 2008), are required to effectively model BRCA1-mutated breast cancer in mice. Current BRCA1 mouse models are also not ideally suited to study mechanisms of acquired resistance to conventional and targeted therapeutics. Rottenberg and coworkers showed that upregulation of drug efflux pumps is the most prevalent mechanism of acquired resistance to conventional and targeted therapies for mammary tumours arising in the K14cre;Brca1F5-13/F5-13;Trp53F2-10/F2-10 mouse model (Rottenberg et al., 2007, 2008). Currently, treatment responses in this K14cre;Brca1F/F;Trp53F/F mouse model are being studied in a P-glycoprotein-deficient background to unravel P-glycoprotein-independent mechanisms of drug resistance (Table 2). Mouse models based on deleterious missense or protein-truncating Brca1 mutations mimicking human BRCA1 germ-line mutations will be useful to study tumorigenesis, treatment responses and acquired resistance associated with known pathogenic BRCA1 mutations. These mouse models could for example be used to

Chapter 1

1

22

study the role of genetic reversion in therapy resistance (Table 2). Since the number of therapy-resistant tumour samples from patients with specific BRCA1 founder mutations is low, mouse models carrying these mutations could offer a larger platform to study if and how genetic reversion occurs as a mechanism of drug resistance for different BRCA1 founder mutations. Eventually, insights gained from mouse models carrying specific Brca1 mutations could lead to tailored therapy for people with a particular BRCA1 mutation. Another option is to study the consequences of individual mutations in the human BRCA1 gene in vivo by creating mice that express human BRCA1. Already in 2001 it was shown that human BRCA1 is able to rescue embryonic lethality in Brca1 knockout mice (Chandler et al., 2001). This shows that it may be possible to introduce human BRCA1 BAC clones harbouring specific mutations in an intact animal model system. This system would provide the best possible in vivo analysis of the phenotypic consequences of specific BRCA1 mutations.

Table 2. Next-generation Brca1 mouse models to study drug resistance mechanisms

Resistance mechanism

Conditional Brca1 mouse models

carrying Brca1 truncation alleles

carrying large Brca1 deletions

on a Pgp1-deficient background

Genetic reversion Yes No No

Pgp1 activation Yes Yes No

Other Yes Yes Yes

Concluding remarks

Genetically engineered mouse models for BRCA1 deficiency have proven to be of critical importance for gathering insights on the diverse biological functions of BRCA1, both in normal development and tumorigenesis. In the past years, these mouse models have been further improved to recapitulate the salient features of human BRCA1-associated breast cancer, such as ‘triple negative’ status, increased genomic instability and increased expression of basal epithelial markers. Recapitulation of these characteristics in mouse models is crucial for preclinical development of chemoprevention strategies and tailored therapies for BRCA1-associated breast cancer. The first studies with targeted therapeutics in validated BRCA1 models have been conducted, showing excellent initial responses but P-glycoprotein-mediated drug resistance upon prolonged treatment with the PARP inhibitor olaparib (Rottenberg et al., 2008). Of course, it is important to keep in mind that data obtained from mouse tumour models are not necessarily predictive for clinical responses and acquired resistance in human cancer patients. Although genetically engineered mice for BRCA1 deficiency are promising preclinical models, their predictive value remains to be determined. The PARP inhibitor olaparib was recently evaluated in a phase I clinical trial and displayed anti-tumour activity in BRCA1 or BRCA2 mutation carriers with ovarian, breast or prostate cancer (Fong et al., 2009). In this case, the mouse data did seem to reflect the clinical response quite accurately. It will be of great interest to see whether the acquired resistance to the PARP inhibitor we observe in the mouse model, will also arise in the human situation.


1

23

Of course, current mouse models are not perfect yet and can still be further improved to mimic additional aspects of human BRCA1-related breast cancer, in order to study for example the role of genetic reversion in therapy resistance. It can be expected that the resulting models will be of even greater use in the development of therapies directed against various aspects of the disease.

Acknowledgements

We wish to thank Piet Borst, Peter Bouwman, Bastiaan Evers and Janneke Jaspers for critically reading the manuscript and providing helpful suggestions. We acknowledge financial support from the Dutch Cancer Society (NKI2007-3772 and NKI2008-4116).

References

Ben David, Y., Chetrit, A., Hirsh-Yechezkel, G., Friedman, E., Beck, B.D., Beller, U., Ben-Baruch, G., Fishman, A., Levavi, H., Lubin, F., et al. (2002). Effect of BRCA mutations on the length of survival in epithelial ovarian tumors. J. Clin. Oncol. 20, 463–466.

Brodie, S.G., Xu, X., Qiao, W., Li, W.M., Cao, L., and Deng, C.X. (2001). Multiple genetic changes are associated with mammary tumorigenesis in Brca1 conditional knockout mice. Oncogene 20, 7514–7523.

Byrski, T., Gronwald, J., Huzarski, T., Grzybowska, E., Budryk, M., Stawicka, M., Mierzwa, T., Szwiec, M., Wiśniowski, R., Siolek, M., et al. (2008). Response to neo-adjuvant chemotherapy in women with BRCA1-positive breast cancers. Breast Cancer Res. Treat. 108, 289–296.

Byrski, T., Huzarski, T., Dent, R., Gronwald, J., Zuziak, D., Cybulski, C., Kladny, J., Gorski, B., Lubinski, J., and Narod, S.A. (2009). Response to neoadjuvant therapy with cisplatin in BRCA1-positive breast cancer patients. Breast Cancer Res. Treat. 115, 359–363.

Chandler, J., Hohenstein, P., Swing, D.A., Tessarollo, L., and Sharan, S.K. (2001). Human BRCA1 gene rescues the embryonic lethality of Brca1 mutant mice. Genesis 29, 72–77.

Chenevix-Trench, G., Healey, S., Lakhani, S., Waring, P., Cummings, M., Brinkworth, R., Deffenbaugh, A.M., Burbidge, L.A., Pruss, D., Judkins, T., et al. (2006). Genetic and histopathologic evaluation of BRCA1 and BRCA2 DNA sequence variants of unknown clinical significance. Cancer Res. 66, 2019–2027.

Cressman, V.L., Backlund, D.C., Avrutskaya, A.V., Leadon, S.A., Godfrey, V., and Koller, B.H. (1999). Growth retardation, DNA repair defects, and lack of spermatogenesis in BRCA1-deficient mice. Mol. Cell. Biol. 19, 7061–7075.

Deng, C.-X. (2006). BRCA1: cell cycle checkpoint, genetic instability, DNA damage response and cancer evolution. Nucleic Acids Res. 34, 1416–1426.

ElShamy, W.M., and Livingston, D.M. (2004). Identification of BRCA1-IRIS, a BRCA1 locus product. Nat. Cell Biol. 6, 954–967.

Evers, B., and Jonkers, J. (2006). Mouse models of BRCA1 and BRCA2 deficiency: past lessons, current understanding and future prospects. Oncogene 25, 5885–5897.

Fan, S., Wang, J., Yuan, R., Ma, Y., Meng, Q., Erdos, M.R., Pestell, R.G., Yuan, F., Auborn, K.J., Goldberg, I.D., et al. (1999). BRCA1 inhibition of estrogen receptor signaling in transfected cells. Science 284, 1354–1356.

Farmer, H., McCabe, N., Lord, C.J., Tutt, A.N., Johnson, D.A., Richardson, T.B., Santarosa, M., Dillon, K.J., Hickson, I.,

Chapter 1

1

24

Knights, C., et al. (2005). Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917–921.

Fong, P.C., Boss, D.S., Yap, T.A., Tutt, A., Wu, P., Mergui-Roelvink, M., Mortimer, P., Swaisland, H., Lau, A., O’Connor, M.J., et al. (2009). Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. N Engl J Med 361, 123–134.

Foulkes, W.D., Stefansson, I.M., Chappuis, P.O., Begin, L.R., Goffin, J.R., Wong, N., Trudel, M., and Akslen, L.A. (2003). Germline BRCA1 mutations and a basal epithelial phenotype in breast cancer. J Natl Cancer Inst 95, 1482–1485.

Ganesan, S., Silver, D.P., Greenberg, R.A., Avni, D., Drapkin, R., Miron, A., Mok, S.C., Randrianarison, V., Brodie, S., Salstrom, J., et al. (2002). BRCA1 supports XIST RNA concentration on the inactive X chromosome. Cell 111, 393–405.

Greenblatt, M.S., Chappuis, P.O., Bond, J.P., Hamel, N., and Foulkes, W.D. (2001). TP53 mutations in breast cancer associated with BRCA1 or BRCA2 germ-line mutations: distinctive spectrum and structural distribution. Cancer Res. 61, 4092–4097.

Hakem, R., de la Pompa, J.L., Elia, A., Potter, J., and Mak, T.W. (1997). Partial rescue of Brca1 (5-6) early embryonic lethality by p53 or p21 null mutation. Nat.Genet. 16, 298–302.

Hashizume, R., Fukuda, M., Maeda, I., Nishikawa, H., Oyake, D., Yabuki, Y., Ogata, H., and Ohta, T. (2001). The RING heterodimer BRCA1-BARD1 is a ubiquitin ligase inactivated by a breast cancer-derived mutation. J Biol Chem 276, 14537–14540.

Hohenstein, P., Kielman, M.F., Breukel, C., Bennett, L.M., Wiseman, R., Krimpenfort, P., Cornelisse, C., van Ommen, G.J., Devilee, P., and Fodde, R. (2001). A targeted mouse Brca1 mutation removing the last BRCT repeat results in apoptosis and embryonic lethality at the headfold stage. Oncogene 20, 2544–2550.

Holstege, H., Joosse, S.A., van Oostrom, C.T., Nederlof, P.M., de, V.A., and Jonkers, J. (2009). High incidence of protein-truncating TP53 mutations in BRCA1-related breast cancer. Cancer Res. 69, 3625–3633.

Huber, L.J., Yang, T.W., Sarkisian, C.J., Master, S.R., Deng, C.X., and Chodosh, L.A. (2001). Impaired DNA damage response in cells expressing an exon 11-deleted murine Brca1 variant that localizes to nuclear foci. Mol. Cell. Biol. 21, 4005–4015.

Jóhannsson, O.T., Idvall, I., Anderson, C., Borg, A., Barkardóttir, R.B., Egilsson, V., and Olsson, H. (1997). Tumour biological features of BRCA1-induced breast and ovarian cancer. Eur. J. Cancer 33, 362–371.

Jonkers, J., and Berns, A. (2002). Conditional mouse models of sporadic cancer. Nat. Rev. Cancer 2, 251–265.

Katiyar, P., Ma, Y., Fan, S., Pestell, R.G., Furth, P.A., and Rosen, E.M. (2006). Regulation of progesterone receptor signaling by BRCA1 in mammary cancer. Nucl Recept Signal 4, e006.

Kennedy, R.D., Quinn, J.E., Mullan, P.B., Johnston, P.G., and Harkin, D.P. (2004). The role of BRCA1 in the cellular response to chemotherapy. J. Natl. Cancer Inst. 96, 1659–1668.

Kim, S.S., Cao, L., Lim, S.-C., Li, C., Wang, R.-H., Xu, X., Bachelier, R., and Deng, C.-X. (2006). Hyperplasia and spontaneous tumor development in the gynecologic system in mice lacking the BRCA1-Delta11 isoform. Mol. Cell. Biol. 26, 6983–6992.

Kuschel, B., Gayther, S.A., Easton, D.F., Ponder, B.A., and Pharoah, P.D. (2001). Apparent human BRCA1 knockout caused by mispriming during polymerase chain reaction: implications for genetic testing. Genes Chromosomes Cancer 31, 96–98.

Liu, S., Ginestier, C., Charafe-Jauffret, E., Foco, H., Kleer, C.G., Merajver, S.D., Dontu, G., and Wicha, M.S. (2008).


1

25

BRCA1 regulates human mammary stem/progenitor cell fate. Proc. Natl. Acad. Sci. U.S.A. 105, 1680–1685.

Liu, X., Holstege, H., van der Gulden, H., Treur-Mulder, M., Zevenhoven, J., Velds, A., Kerkhoven, R.M., van Vliet, M.H., Wessels, L.F., Peterse, J.L., et al. (2007). Somatic loss of BRCA1 and p53 in mice induces mammary tumors with features of human BRCA1-mutated basal-like breast cancer. Proc Natl Acad Sci U S A 104, 12111–12116.

Ludwig, T., Chapman, D.L., Papaioannou, V.E., and Efstratiadis, A. (1997). Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes Dev. 11, 1226–1241.

Ludwig, T., Fisher, P., Ganesan, S., and Efstratiadis, A. (2001). Tumorigenesis in mice carrying a truncating Brca1 mutation. Genes Dev. 15, 1188–1193.

Mak, T.W., Hakem, A., McPherson, J.P., Shehabeldin, A., Zablocki, E., Migon, E., Duncan, G.S., Bouchard, D., Wakeham, A., Cheung, A., et al. (2000). Brca1 required for T cell lineage development but not TCR loci rearrangement. Nat. Immunol. 1, 77–82.

Manié, E., Vincent-Salomon, A., Lehmann-Che, J., Pierron, G., Turpin, E., Warcoin, M., Gruel, N., Lebigot, I., Sastre-Garau, X., Lidereau, R., et al. (2009). High frequency of TP53 mutation in BRCA1 and sporadic basal-like carcinomas but not in BRCA1 luminal breast tumors. Cancer Res. 69, 663–671.

McCarthy, A., Savage, K., Gabriel, A., Naceur, C., Reis-Filho, J.S., and Ashworth, A. (2007). A mouse model of basal-like breast carcinoma with metaplastic elements. J Pathol 211, 389–398.

Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P.A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L.M., and Ding, W. (1994). A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266, 66–71.

Moynahan, M.E., Chiu, J.W., Koller, B.H., and Jasin, M. (1999). Brca1 controls homology-directed DNA repair. Mol Cell 4, 511–518.

Mullan, P.B., Quinn, J.E., and Harkin, D.P. (2006). The role of BRCA1 in transcriptional regulation and cell cycle control. Oncogene 25, 5854–5863.

Narod, S.A., and Foulkes, W.D. (2004). BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer 4, 665–676.

Narod, S.A., and Offit, K. (2005). Prevention and management of hereditary breast cancer. J. Clin. Oncol. 23, 1656–1663.

Pettigrew, C.A., French, J.D., Saunus, J.M., Edwards, S.L., Sauer, A.V., Smart, C.E., Lundström, T., Wiesner, C., Spurdle, A.B., Rothnagel, J.A., et al. (2010). Identification and functional analysis of novel BRCA1 transcripts, including mouse Brca1-Iris and human pseudo-BRCA1. Breast Cancer Res. Treat. 119, 239–247.

Poole, A.J., Li, Y., Kim, Y., Lin, S.-C.J., Lee, W.-H., and Lee, E.Y.-H.P. (2006). Prevention of Brca1-mediated mammary tumorigenesis in mice by a progesterone antagonist. Science 314, 1467–1470.

Reid, L.J., Shakya, R., Modi, A.P., Lokshin, M., Cheng, J.T., Jasin, M., Baer, R., and Ludwig, T. (2008). E3 ligase activity of BRCA1 is not essential for mammalian cell viability or homology-directed repair of double-strand DNA breaks. Proc Natl Acad Sci U S A 105, 20876–20881.

Rottenberg, S., Jaspers, J.E., Kersbergen, A., van der Burg, E., Nygren, A.O., Zander, S.A., Derksen, P.W., de Bruin, M., Zevenhoven, J., Lau, A., et al. (2008). High sensitivity of BRCA1-deficient mammary tumors to the PARP inhibitor AZD2281 alone and in combination with platinum drugs. Proc Natl Acad Sci U S A 105, 17079–17084.

Rottenberg, S., Nygren, A.O., Pajic, M., van Leeuwen, F.W., van der Heijden, I., van de Wetering, K., Liu, X., de Visser, K.E., Gilhuijs, K.G., van Tellingen, O., et al. (2007). Selective induction of chemotherapy resistance of mammary

Chapter 1

1

26

tumors in a conditional mouse model for hereditary breast cancer. Proc Natl Acad Sci U S A 104, 12117–12122.

Saal, L.H., Gruvberger-Saal, S.K., Persson, C., Lövgren, K., Jumppanen, M., Staaf, J., Jönsson, G., Pires, M.M., Maurer, M., Holm, K., et al. (2008). Recurrent gross mutations of the PTEN tumor suppressor gene in breast cancers with deficient DSB repair. Nat. Genet. 40, 102–107.

Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., Ashley, T., and Livingston, D.M. (1997). Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 88, 265–275.

Shafee, N., Smith, C.R., Wei, S., Kim, Y., Mills, G.B., Hortobagyi, G.N., Stanbridge, E.J., and Lee, E.Y. (2008). Cancer stem cells contribute to cisplatin resistance in Brca1/p53-mediated mouse mammary tumors. Cancer Res 68, 3243–3250.

Shakya, R., Szabolcs, M., McCarthy, E., Ospina, E., Basso, K., Nandula, S., Murty, V., Baer, R., and Ludwig, T. (2008). The basal-like mammary carcinomas induced by Brca1 or Bard1 inactivation implicate the BRCA1/BARD1 heterodimer in tumor suppression. Proc Natl Acad Sci U S A 105, 7040–7045.

Sorlie, T., Tibshirani, R., Parker, J., Hastie, T., Marron, J.S., Nobel, A., Deng, S., Johnsen, H., Pesich, R., Geisler, S., et al. (2003). Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acad Sci U S A 100, 8418–8423.

Swisher, E.M., Sakai, W., Karlan, B.Y., Wurz, K., Urban, N., and Taniguchi, T. (2008). Secondary BRCA1 mutations in BRCA1-mutated ovarian carcinomas with platinum resistance. Cancer Res 68, 2581–2586.

Tan, D.S.P., Rothermundt, C., Thomas, K., Bancroft, E., Eeles, R., Shanley, S., Ardern-Jones, A., Norman, A., Kaye, S.B., and Gore, M.E. (2008). “BRCAness” syndrome in ovarian cancer: a case-control study describing the clinical features and outcome of patients with epithelial ovarian cancer associated with BRCA1 and BRCA2 mutations. J. Clin. Oncol. 26, 5530–5536.

Tirkkonen, M., Johannsson, O., Agnarsson, B.A., Olsson, H., Ingvarsson, S., Karhu, R., Tanner, M., Isola, J., Barkardottir, R.B., Borg, A., et al. (1997). Distinct somatic genetic changes associated with tumor progression in carriers of BRCA1 and BRCA2 germ-line mutations. Cancer Res 57, 1222–1227.

Wu, L.C., Wang, Z.W., Tsan, J.T., Spillman, M.A., Phung, A., Xu, X.L., Yang, M.C., Hwang, L.Y., Bowcock, A.M., and Baer, R. (1996). Identification of a RING protein that can interact in vivo with the BRCA1 gene product. Nat Genet 14, 430–440.

Xu, X., Qiao, W., Linke, S.P., Cao, L., Li, W.M., Furth, P.A., Harris, C.C., and Deng, C.X. (2001). Genetic interactions between tumor suppressors Brca1 and p53 in apoptosis, cell cycle and tumorigenesis. Nat. Genet. 28, 266–271.

Xu, X., Wagner, K.U., Larson, D., Weaver, Z., Li, C., Ried, T., Hennighausen, L., Wynshaw-Boris, A., and Deng, C.X. (1999a). Conditional mutation of Brca1 in mammary epithelial cells results in blunted ductal morphogenesis and tumour formation. Nat. Genet. 22, 37–43.

Xu, X., Weaver, Z., Linke, S.P., Li, C., Gotay, J., Wang, X.W., Harris, C.C., Ried, T., and Deng, C.X. (1999b). Centrosome amplification and a defective G2-M cell cycle checkpoint induce genetic instability in BRCA1 exon 11 isoform-deficient cells. Mol. Cell 3, 389–395.


1

27

Chapter 2 Selective inhibition of BRCA2-deficient mammary tumor cell growth by AZD2281 and cisplatin

Bastiaan Evers1, Rinske Drost1, Eva Schut1, Michiel de Bruin1, Eline van der Burg1, Patrick W.B. Derksen1,2, Henne Holstege1, Xiaoling Liu1, Ellen van Drunen3, H. Berna Beverloo3, Graeme C.M. Smith4, Niall M.B. Martin4, Alan Lau4, Mark J. O’Connor4 and Jos Jonkers1

Clinical Cancer Research 2008 (14):3916-3925

1 Division of Molecular Biology, the Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, the Netherlands

2 Current address: Department of Medical Oncology, Laboratory of Experimental Oncology, UMC Utrecht, Stratenum 2.121, PO Box 85060, 3508 AB Utrecht, The Netherlands

3 Department of Clinical Genetics, Erasmus Medical Center, 3000 CA Rotterdam, the Netherlands

4 KuDOS Pharmaceuticals Ltd., Cambridge, United Kingdom

Chapter 2

2

30

PurposeTo assess efficacy of the novel, selective poly(ADP-ribose) polymerase-1 (PARP) inhibitor AZD2281 against newly established BRCA2-deficient mouse mammary tumor cell lines and to determine potential synergy between AZD2281 and cisplatin.

Experimental DesignWe established and thoroughly characterized a panel of clonal cell lines from independent BRCA2-deficient mouse mammary tumors and BRCA2-proficient control tumors. Subsequently, we assessed sensitivity of these lines to conventional cytotoxic drugs and the novel PARP-inhibitor AZD2281. Finally, in vitro combination studies were performed to investigate interaction between AZD2281 and cisplatin.

ResultsGenetic, transcriptional and functional analyses confirmed the successful isolation of BRCA2-deficient and BRCA2-proficient mouse mammary tumor cell lines. Treatment of these cell lines with 11 different anti-cancer drugs or with γ-irradiation showed that AZD2281, a novel and specific PARP inhibitor, caused the strongest differential growth inhibition of BRCA2-deficient vs. BRCA2-proficient mammary tumor cells. Finally, drug combination studies showed synergistic cytotoxicity of AZD2281 and cisplatin against BRCA2-deficient cells but not against BRCA2-proficient control cells.

ConclusionWe have successfully established the first set of BRCA2-deficient mammary tumor cell lines, which form an important addition to the existing preclinical models for BRCA-mutated breast cancer. The exquisite sensitivity of these cells to the PARP inhibitor AZD2281, alone or in combination with cisplatin, provides strong support for AZD2281 as a novel targeted therapeutic against BRCA-deficient cancers.

Introduction

Mutations in the breast cancer susceptibility genes BRCA1 and BRCA2 are responsible for the majority of hereditary breast cancers (Ford et al., 1998). Tumors in patients with heterozygous BRCA1 or BRCA2 germ-line mutations typically show somatic loss of heterozygosity (LOH) at the BRCA1 or BRCA2 locus, respectively, resulting in loss of the wild-type allele (Smith et al., 1992; Collins et al., 1995). Functionally, involvement of BRCA2 in the repair of DNA damage, especially DSBs has been firmly established by several groups (Patel et al., 1998; Moynahan et al., 2001; Xia et al., 2001). The primary role of BRCA2 in this process appears to be the regulation of damage-induced RAD51 protein filaments that are required for DSB repair by homologous recombination (HR) (Davies et al., 2001). In the absence of BRCA2, repair of DSBs by error-prone mechanisms (Tutt et al., 2001) and chromosomal instability due to improper centrosome maintenance (Tutt et al., 1999) result in genomic instability (Tutt et al., 2002), which renders cells susceptible to acquiring additional cancer initiating genetic lesions. The absence of error-free DSB repair mechanisms may prove to be the Achilles heel of BRCA2-deficient tumors, as increased sensitivity to γ-irradiation or DNA damaging agents is observed in cells with dysfunctional BRCA2 (Sharan et al., 1997; Patel et al., 1998; Donoho et al., 2003; Bartz et al., 2006). Clinical

Inhibition of BRCA2-deficient mammary tumor cell growth

2

31

trials exploiting the sensitivity of BRCA-mutated breast cancers to platinum-based DNA damaging drugs have been started recently (Silver et al., 2010). Since platinum based monotherapy is associated with toxicity (Kelland, 2007), alternative strategies to stress the DSB repair pathway are urgently needed. An attractive strategy, which has recently gained momentum, is based on inhibition of poly(ADP-ribose) polymerase 1 (PARP-1), which binds to DNA strand breaks and helps regulate base excision repair (BER). Upon binding, both the protein itself and surrounding histones are poly ADP-ribosylated, which may help in attracting repair factors, such as the single-strand break (SSB) repair factor XRCC1 (El-Khamisy et al., 2003; Helleday et al., 2005). The fact that Parp1-/- mice, in contrast to Xrcc1 mutants, are viable and fertile suggests these mice are not completely deficient in the repair of SSBs (Wang et al., 1995; Tebbs et al., 1999). In the absence of efficient SSB repair, endogenously created lesions may persist through to S-phase, where they are converted to DSBs (Arnaudeau et al., 2001). DSB repair is normally intact in PARP-1-/- cells (Yang et al., 2004) but not in BRCA1/2 deficient cells (Moynahan et al., 1999, 2001). As such, inhibition of PARP-1 may confer selective cytotoxicity to tumor cells with attenuated BRCA function, while not impacting on the BRCA-proficient cells of the patient. In support of this, two groups demonstrated selective cytotoxicity of PARP inhibitors against cells with dysfunctional BRCA1/2 (Bryant et al., 2005; Farmer et al., 2005). In vitro analysis of PARP inhibitors in CAPAN-1 tumor cells, derived from a liver metastasis of a human BRCA2 defective pancreas carcinoma (Fogh et al., 1977) and thus far the only tumor cell line available with abrogated BRCA2 function, yielded conflicting results (Gallmeier and Kern, 2005; McCabe et al., 2005). These experiments in pancreatic tumor cells call for evaluation of PARP inhibitor efficacy in additional BRCA2-deficient tumor cells, specifically of mammary epithelial origin. The latter is important considering the cell type-intrinsic differences between mammary epithelial cells and other cells, which have been postulated to - at least partially - explain the tumor spectrum in BRCA-carriers (Evers and Jonkers, 2006). Unfortunately, no BRCA2-deficient mammary tumor cell lines have been published until now. Here, we report the successful establishment of clonal cell lines from two independent BRCA2-deficient mouse mammary tumors. Thorough characterization of these cell lines confirmed complete loss of BRCA2 function and increased sensitivity towards DNA damaging agents was shown for BRCA2-deficient cells as compared to BRCA2-proficient control cells. Using a novel, specific and potent inhibitor of PARP enzymatic activity, AZD2281 (Menear et al., 2008), we show growth inhibition of BRCA2-deficient mammary tumor cells. Since both PARP inhibition and cisplatin confer selective toxicity to BRCA2-deficient mammary tumor cells, and since PARP inhibition was recently shown to potentiate cisplatin-mediated cytotoxicity (Donawho et al., 2007), we also performed drug combination studies. AZD2281 synergized with cisplatin in inhibiting the growth of BRCA2-deficient mammary tumor cells, while this combination was additive in the BRCA2-proficient tumor cells. These data warrant further preclinical evaluation of AZD2281 as monotherapy or in combination with cisplatin in animal models for BRCA-deficient breast cancer.

Chapter 2

2

32

Materials and methods

Establishment and maintenance of tumor cell linesTumor bearing female mice of the K14-Cre;Brca2F11/F11;p53F2-10/F2-10 (KB2P) or K14-Cre;Brca2w.t./w.t.;p53F2-10/F2-10 (KP) genotype (Jonkers et al., 2001) were sacrificed and the tumors were isolated. Small (3x3 mm) pieces were subsequently minced and digested for 1 hour in Leibovitz L15 medium with 3g/l Collagenase A and 1.5g/l porcine pancreatic trypsine with rigorous shaking at 37°C. Aggregates were plated out and cultured under low oxygen conditions (3% O2, 5% CO2, 37°C) using DMEM-F12 medium (Gibco, Carlsbad, CA) supplemented with 10% fetal calf serum, 50U/ml penicillin, 50mg/ml streptomycin (Gibco, Carlsbad, CA), 5 mg/ml insulin (Sigma, St. Louis, MO), 5ng/ml EGF (Gibco, Carlsbad, CA) and 5ng/ml cholera toxin (Gentaur, Brussels, Belgium). To remove contaminating fibroblasts, cultures were differentially trypsinized until homogeneous cell morphology indicated pure epithelial cultures.

Detection of Brca2 expression by qPCRTotal RNA (1.25mg) isolated from cell cultures using a Qiagen RNeasy kit, was used as input for a first strand reaction (Invitrogen, Carlsbad, CA, according to manufacturer’s protocol). Subsequently, 12ng cDNA was used for a qPCR reaction using the SYBR-Green PCR Mastermix (Applied biosystems, Foster City, CA), performed on an ABI Prism 7000. HPRT Levels were used as internal control. Brca2 primer sequences were as follows: Exon2-3 FW: gaaatttttaaggcgagatgcag; Exon2-3 RV: ccaattgaggcttatcggtcc; Exon10-11 FW: gaagcaagtgcttttgaag; Exon10-11 RV: cagaagaatctggtatacctg; Exon18-19 FW: ctcctgatgcctgtgcacc; Exon18-19 RV: cacgaaagaaccccagcct.

Detection of p53 proteinProtein extraction of cultured cells was performed using ELB buffer (150mM NaCl, 50mM Hepes pH 7.5, 5mM EDTA, 0.1% NP-40) complemented with a protease inhibitor cocktail (Roche, Basel, Switzerland). Primary antibodies used in subsequent Western blot assays: polyclonal sheep anti p53 (1:5000, Calbiochem, San Diego, CA); polyclonal goat anti β-Actin (1:2000, Santa Cruz Biotechnology, Santa Cruz, CA). Secondary antibody: Rabbit-anti-Goat HRP (1:2000, Dakocytomation, Glostrub, Danmark).

γH2A.X/RAD51 colocalizationCells grown on cover slips were exposed to 20Gy γ-irradiation and fixed eight hours later using 1% paraformaldehyde in PBS. Cells were permeabilized 5’ in 0.1% Triton and preincubated for 1 hour at RT in staining buffer (PBS/0.5% BSA/0.15% Glycine), which was used as solvent in all subsequent steps. Incubation with primary polyclonal rabbit-anti-RAD51 antibody (a generous gift by Roland Kanaar, Erasmus medical center, Rotterdam, the Netherlands) followed for 2 hours. Secondary goat-anti-rabbit Alexa 568 (Molecular Probes, Carlsbad, CA, 1:400 dilution) was then co-incubated with FITC-conjugated monoclonal mouse-anti-γH2A.X antibody (Upstate, Billerica, MA, clone JBW301, 1:50 dilution) for 1 hour at RT. Finally, DNA was stained using 1:5000 To-Pro-3 (Molecular Probes, Carlsbad, CA). All incubations were followed by at least three wash steps using staining buffer. Slides were mounted using Vectashield (Vector Laboratories, Burlingame, CA). Images were acquired on a Leica TCS TNT system (Leica Microsystems, Wetzlar, Germany).


2

33

Array comparative genomic hybridizationGenomic DNA isolated from primary tumors or cell lines was labeled and hybridized to 3K mouse BAC microarrays using spleen DNA originating from the same animal as a reference, as described (Chung et al., 2004).

KaryotypingMetaphases were prepared by culturing sub-confluent cells for 30 min. in the presence of 100ng/ml colcemid (Gibco, Carlsbad, CA). Cells were harvested and hypotonic swelling was induced for 10 min. in 0.075M KCl. Subsequently, cells were fixed using three short incubations in 3:1 dry methanol:glacial acetic acid solution and dropped on a microscope slide. Ploidy analysis was performed by mounting metaphase slides in DAPI containing Vectashield (Vector laboratories, Burlingame, CA) and images were acquired using a Zeiss Axiovert 200M fluorescence microscope, mounted with a Zeiss Axiocam MRm Rev. 2 camera. Spectral karyotyping (SKY) analysis was performed as described (Loonstra et al., 2001), using the spectracube 300. Between 6 and 9 metaphases were analyzed for each cell line using Skyview software version 2.1.1.

DrugsAZD2281 was synthesized by KuDos Pharmaceuticals (Cambridge, UK) (Menear et al., 2008). Other compounds were obtained from Mayne Pharma, Brussels, Belgium (cisplatin); Sigma-Aldrich, St. Louis, MO (mitomycin-C [MMC], methylmethane sulphonate [MMS], 5-fluorouracil [5-FU], hydroxyurea [HU], nocodazole, valproic acid); Schering-Plough, Kenilworth, NJ (temozolomide); Pharmacia Netherlands, Woerden, The Netherlands (doxorubicin); and Aventis, Antony Cedex, France (docetaxel).Temozolomide was dissolved in 10% ethanol (v/v) in saline to a concentration of 5 mg/ml.

Sulforhodamine B growth inhibition assaysCells were typically plated out in 96-well microplates on day 0 and either irradiated or supplied with twofold serial drug dilutions on day 1. All drugs were left on the cells for the duration of the experiment, except for MMS, which was removed from the cells after 1 hour incubation in serum-free medium. On day 5, the cells were fixed by adding trichloroacetic acid to a final concentration of 5% (v/v). After 1 hour at 4°C, plates were washed 5 times with demi water, dried and stained for 30 min. with 50ml sulforhodamine B (SRB), 0.4% (w/v). Following three wash steps with 1% acetic acid, 150ml 10mM Tris was added to dissolve the staining. Absorbance at 540nm was measured using a Tecan infinite m200 plate reader (Tecan, Salzburg, Austria). After correction for medium-only and no-drug controls, datapoints were fitted using the general formula for a sigmoid curveusing the sigmoidity (m) and IC50 as fit parameters and Matlab software (The Mathworks, Inc., Natick, MA).

50][1

1

ICDrug mSurvival

At least three independent IC50 values were measured for each drug/cell line combination.

Chapter 2

2

34

Results

Establishment of BRCA2-deficient mammary tumor cell linesIn vitro studies on BRCA2-associated breast cancer have been hampered by the lack of appropriate BRCA2-deficient mammary tumor cell lines (Bryant et al., 2005; Farmer et al., 2005). We therefore set out to establish BRCA2-deficient mammary tumor cell lines by taking into culture 12 tumors from K14Cre;Brca2F11/F11;p53F2-10/F2-10 (KB2P) mice that develop BRCA2-deficient mammary cancer (Jonkers et al., 2001). As controls for functional assays, we also established cell lines from 3 BRCA2-proficient mammary tumors harvested from K14Cre;p53F2-10/F2-10 (KP) mice (Liu et al., 2007). Histopathological examination of the parental tumors confirmed their resemblance to invasive ductal carcinomas (IDCs), the main tumor type in human BRCA2-mutation carriers (Figure S1). Low oxygen (3%) culturing conditions were continuously applied to minimize oxidative DNA damage and thereby prevent specific depletion of BRCA2-deficient cells in KB2P cultures (Halliwell and Aruoma, 1991). When cultures showed homogeneous epithelial characteristics upon visual inspection, the KB2P lines were probed for Cre-mediated recombination of the Brca2F11 alleles using Southern analysis (Figure 1A). Whereas all corresponding primary tumors showed homozygous switching of both Brca2F11 alleles (with a residual Brca2F11 band derived from non-switched stromal cells), one or two functional Brca2F11 alleles were retained in cell lines established from 10 out of 12 tumors, suggesting strong selection against BRCA2-deficient mammary epithelial cells during in vitro culture. Nevertheless, homozygous Brca2 loss was detected in 2 independent tumor cell lines (KB2P-1 and KB2P-3, Figure 1A). Limiting dilution culturing resulted in 5 clonal cell lines with homozygously switched Brca2F11 alleles (Figure 1B) and 3 clonal cell lines derived from BRCA2-proficient KP tumors (KP-3.33, KP-6.3, KP-7.7). The latter served as controls in subsequent experiments. Loss of Brca2 expression in KB2P cell lines was confirmed by quantitative RT-PCR. In contrast to BRCA2-proficient KP-6.3 cells, both clonal BRCA2-deficient cell lines displayed complete absence of full-length Brca2 expression (Figure 1C). Interestingly, however, absolute levels of the truncated Brca2Δ11 transcript, which is produced after recombination, appeared to be higher in the KB2P lines, suggesting increased transcription of the Brca2 gene upon loss of functional BRCA2 (Figure 1C). Western blot analysis showed p53 to be absent in all established clonal cell lines, confirming Cre-mediated recombination of both p53F2-10 alleles (Figure 1D). Epithelial identity of all clonal cell lines was confirmed using Cytokeratin 8 and E-Cadherin staining of cultured cells (Figure S2).

BRCA2-deficient cell lines do not form irradiation-induced RAD51 fociCre-mediated recombination within the Brca2F11 allele results in loss of exon 11, which encodes the BRC repeats necessary for proper regulation of RAD51 protein filament formation during DSB repair by HR (Davies et al., 2001; Shivji et al., 2006). In BRCA2-proficient cells, induction of DSBs by ionizing radiation results in rapid re-localization of both RAD51 and γH2A.X to sites of DNA damage (Paull et al., 2000). In contrast, re-localization of RAD51 does not occur in irradiated CAPAN-1 cells with dysfunctional BRCA2 (Yuan et al., 1999). To ascertain that Brca2D11/D11;p53D2-10/D2-10 KB2P cells were incapable of carrying out HR-mediated DSB repair, we assessed radiation-induced co-localization of RAD51 with γH2A.X in nuclear foci. BRCA2-proficient cells, subjected to 20Gy of γ-irradiation and harvested 8 hours later, showed profound co-localization of RAD51 and γH2A.X. In contrast, complete absence of IR-induced RAD51 foci was seen in the KB2P cells


2

35

lacking wildtype BRCA2 (Figure 2).

Figure 1. Brca2 and p53 status in cell lines from BRCA2-deficient mammary tumors. A. Southern blot analysis of primary tumors and cell lines for Brca2. At the top is the genomic structure of the Brca2 locus, along with the probe location and BlnI (B) / NheI (N) restriction sites. LoxP sites are shown by triangles. Expected sizes of bands of all possible alleles detected by Southern blot analysis are indicated. All tumors analyzed showed strong Brca2D bands and no or weak Brca2F bands. In contrast, most of the resulting cell lines contained equal amounts of switched/unswitched DNA, as expected for heterozygous Brca2F11/∆11 cells. Only KB2P-1 and KB2P-3 cell lines showed homozygous deletion of Brca2. B. Several clones of the KB2P-3 and KB2P-1 lines were re-analyzed using Southern blot analysis and still showed Brca2 loss. C. qPCR analysis of BRCA2-deficient clones KB2P-1.21 and KB2P-3.4 and BRCA2-proficient clonal line KP-6.3 confirm complete loss of full-length Brca2 expression. Three different regions of the Brca2 transcript were analyzed by real-time RT-PCR using different primer pairs spanning intron/exon boundaries. D. Western blot analysis showed that all clonal KP and KB2P cell lines have lost p53 expression. NIH-3T3 cells were used as a positive control for p53 detection. Immunoblotting for b-actin was used as loading control.

KB2P-1.21 KB2P-3.4 KP-6.30

0.5

1

1.5

2

2.5

3

3.5

4

Line

Nor

mal

ized

exp

ress

ion

rela

tive

to K

P-6.

3

Exons 2-3Exons 10-11Exons 18-19

KB

2P-3

.4K

B2P

-3.7

KB

2P-3

.11

KB

2P-1

.21

KB

2P-1

.22

Δ11

/w.t.

F11/

F11

FΔw.t.

11 12 1314 15 1617 1918 20 21 22-24 25 26 2712 3 5-7 8 9 104

NBNN

NNN

NN

w.t.:

F:

Δ:

7.3kb

13.3kb

9.6kb

Exon 14 probe

KB

2P-1

KB

2P-3

KB

2P-4

KB

2P-5

KB

2P-6

KB

2P-7

KB

2P-8

KB

2P-9

KB

2P-1

0

KB

2P-1

1

KB

2P-1

2

KB

2P-1

3

FΔw.t.

Tumors

Cell lines

Brc

a2Δ

11/w

.t. c

ontro

l

Brc

a2F1

1/F1

1 co

ntro

l

FΔw.t.

P53

β-Actin

KP

-3.3

3K

P-6

.3K

P-7

.7K

B2P

-1.2

1K

B2P

-3.4

NIH

-3T3

A

B C D

Chapter 2

2

36

Figure 2. BRCA2-deficient tumor cells show loss of γH2A.X / RAD51 colocalization after irradiation. Upon irradiation with 20Gy, BRCA2-proficient KP mammary tumor cells showed co-localization of γH2A.X(green) and RAD51(red) at sites of DNA damage (DNA is indicated in blue). In contrast, BRCA2-deficient KB2P cells show complete absence of RAD51 signals at IR-induced γH2A.X nuclear foci.

BRCA2-deficient mammary tumor cell lines display genomic instabilityAbsence of proper DSB repair (Tutt et al., 2001), centrosome regulation (Tutt et al., 1999) and cytokinesis (Daniels et al., 2004) upon loss of BRCA2 is thought to result in a mutator phenotype driving additional oncogenic events. Indeed, BRCA2-deficient tumors have been shown to contain high amounts of genetic aberrations (Tirkkonen et al., 1997). To investigate the extent of genomic gains and losses, we performed genome-wide array CGH analysis of both the parental BRCA2 tumors and the clonal cell lines derived thereof (Figure 3A). Many genomic regions were found to be significantly amplified (red) or deleted (green) as compared to control DNA harvested from the spleen of the tumor-bearing animal. In general, the BRCA2-deficient tumors showed much more aberrations than the BRCA2-proficient control tumors, similar to the situation in BRCA1-deficient tumors (Liu et al., 2007). Unsupervised hierarchical clustering of all parental tumors and KB2P cell lines showed co-clustering of the KB2P-1 clones together with their ancestral tumor 1, but not of KB2P-3 clones with tumor 3 (Figure 3A). For subsequent ploidy analysis, metaphase spreads were prepared and stained with DAPI to count at least 18 spreads. All but one cell line (KP-6.3) were shown to be aneuploid, a general hallmark of solid tumors (Rajagopalan and Lengauer, 2004) (Figure 3B). To determine the contribution of individual chromosomes to the increased ploidy as well as the amount of chromosome rearrangements, we performed spectral karyotyping (SKY) analysis. BRCA2-deficient KB2P cells showed large amounts of complex translocations and in addition displayed many other structural aberrations such as deletions and the presence of satellite and marker

KP-6.3KP-3.33 KP-7.7 KB2P-1.21 KB2P-3.4

γH2A.X

Rad51

DNA

Overlay

BRCA2 Proficient BRCA2 Deficient


2

37

chromosomes (Figure 3C, D). Besides the expected increase in structural chromosomal aberrations in the KB2P cells vs. the KP cells, we observed more clonal variation within the BRCA2 negative cells than in the controls (Figure 3C). The complete composite karyotype of several cells analyzed is shown in Supplementary Table 1.

Figure 3. Brca2 mutated cell lines display genomic instability. A. Array-CGH analysis was carried out on DNA of primary tumors and clonal cell lines derived from these. Top panels show Log2 ratios of DNA copy number changes as compared to spleen control DNA are indicated. Significant copy number gains are represented by red dots, significant copy number losses are indicated by green dots. Bottom panels show unsupervised hierarchical clustering of CGH profiles of all primary KB2P tumors and the clonal cell lines KB2P-1.21 (derived from tumor KB2P-1) and KB2P-3.4 (derived from tumor KB2P-3). Increasing vertical distance indicates larger differences in CGH profiles. B. Ploidy analysis of clonal KP and KB2P cell lines. A minimum of 18 DAPI-stained metaphases were photographed and chromosomes were counted. Error bars represent S.D. C. SKY analysis revealed large amounts of structural and non-clonal aberrations in KB2P cell lines compared to KP controls. Aberrations were considered clonal if more than 2 metaphases contained a specific aberration or gain, or more than 3 losses were detected. The graph depicts the average numbers of clonal and non-clonal aberrations per cell, both for numerical (red) and structural (blue) aberrations. D. A representative SKY example of BRCA2-deficient clone KB2P-3.4, showing both numerical and structural chromosomal aberrations.

Selective sensitivity of BRCA2-deficient mammary tumor cell lines to DNA damaging drugsAbsence of proper repair of damaged DNA leads to hypersensitivity to agents affecting DNA structure. Indeed, the specific hypersensitivity of BRCA2-deficient tumor cells to DNA damaging drugs is the basis for several clinical trials in BRCA2 mutation carriers with breast or ovarian cancer (Silver et al., 2010). To evaluate the utility of our mammary tumor cell lines to model BRCA2-deficient breast cancer, sensitivity to both γ-irradiation and cisplatin was determined in growth inhibition assays. Both treatments clearly resulted in

Tum

or K

B2P

-3

Tum

or K

B2P

-10

Tum

or K

B2P

-4

Tum

or K

B2P

-13

Tum

or K

B2P

-9

Tum

or K

B2P

-6

Tum

or K

B2P

-7

Tum

or K

B2P

-12

Tum

or K

B2P

-11

Tum

or K

B2P

-5

Tum

or K

B2P

-7

Tum

or K

B2P

-8

Line

KB

2P-1

.21

Tum

or K

B2P

-1

Line

KB

2P-1

.22

Line

KB

2P-3

.4

Line

KB

2P-3

.7

Line

KB

2P-3

.11

Tumor KB2P-3

Tumor KB2P-1 Line KB2P-1.21

Line KB2P-3.4

KP-3.33 KP-6.3 KP-7.7 KB2P-1.21 KB2P-3.40

10

20

30

40

50

60

70

80

Cell line

Ave

rage

num

ber o

f chr

omos

omes

KP-3.33 KP-6.3 KP-7.7 KB2P-1.21 KB2P-3.40

2

4

6

8

10

12

14

16

18

Ave

rage

abe

rratio

ns p

er c

ell

Cell line

Clonal numericalNon-clonal numericalClonal structuralNon-clonal structural

Log2

(Rat

io)

Log2

(Rat

io)

Log2

(Rat

io)

Log2

(Rat

io)

Genomic position Genomic position

Genomic position Genomic position

A

B C

D

Chapter 2

2

38

strong specific growth inhibition in the BRCA2 mutant KB2P lines as compared to the KP controls (Figure 4).

Figure 4. BRCA2 dysfunction strongly sensitizes cells to the effects of AZD2281 and DNA damaging drugs. Representative growth inhibitory curves for AZD2281, temozolomide, MMC, cisplatin, γ-irradiation and MMS. Data from BRCA2-deficient cells is displayed in blue, whereas data from BRCA2-proficient cells is represented in red.

The PARP inhibitor AZD2281 strongly inhibits BRCA2 -deficient cell growthRecent experiments support the idea that inhibiting PARP-1 activity, and thus SSB repair, may induce DSBs that are specifically toxic to cells with defective HR repair, such as BRCA2-deficient cells (Bryant et al., 2005; Farmer et al., 2005). To test the utility of PARP inhibitors for treating BRCA2-associated breast cancer, we investigated selective growth inhibition of a novel PARP inhibitor, AZD2281, in our panel of BRCA2-proficient and BRCA2-deficient cell lines (Figure 4, Table 1). To compare the activity of AZD2281 with various classes of cytotoxic agents, we tested a set of 10 drugs, including compounds directly inducing DNA-strand lesions that result in DSBs (mitomycin C [MMC], methylmethane sulphonate [MMS], temozolomide), antimetabolites (5-fluorouracil [5-FU], hydroxyurea [HU]), spindle poisons (docetaxel, nocodazole), the topoisomerase II inhibitor doxorubicin and the HDAC inhibitor valproic acid. Analogous to γ-irradiation and cisplatin, the DNA crosslinker MMC and the alkylating agents MMS and temozolomide resulted in significantly lower IC50 values in KB2P lines as compared to KP lines (Figure 4, Table 1). BRCA2 deficiency did not, on the other hand, significantly potentiate the action of the antimetabolites, the spindle poisons, doxorubicin and valproic acid. Importantly, the largest difference in drug sensitivity between BRCA2-deficient KB2P cells and BRCA2-proficient KP cells was observed for the PARP inhibitor AZD2281. Data from at least 3 independent experiments showed an average IC50 of 91nM for the KB2P lines compared to 8135nM for the KP lines, which is a highly significant (p=2.7·10-6) difference of ~90 t

KP-3.33 KP-6.3 KP-7.7 KB2P-1.21 KB2P-3.4

10-1

100

101

102

103

104

105

106

107

0

10

20

30

40

50

60

70

80

90

100

110

Gro

wth

(%)

[AZD2281] (nM)

10-1

100

101

102

103

104

105

106

107

0

10

20

30

40

50

60

70

80

90

100

110

Gro

wth

(%)

[Cisplatin] (nM)10

-110

010

110

20

10

20

30

40

50

60

70

80

90

100

110

Gro

wth

(%)

Dose (Gy)

10-1

100

101

102

103

104

105

106

107

0

10

20

30

40

50

60

70

80

90

100

110

Gro

wth

(%)

[Temozolomide] (nM)

10-1

100

101

102

103

104

105

106

107

0

10

20

30

40

50

60

70

80

90

100

110

Gro

wth

(%)

[MMS] (nM)

10-1

100

101

102

103

104

105

106

107

0

10

20

30

40

50

60

70

80

90

100

110

Gro

wth

(%)

[MMC] (nM)


2

39

Agent KP3.33 KP6.3 KP7.7 KB2P3.4 KB2P1.21 Ratio Significance

AZD2281 (nM) 9453 (1002) 5705 (918) 10428 (559) 57 (19) 124 (35) 89.7* 2.7·10-6

Temozolomide (µM) 1347 (241) 1093 (193) N.D.# 12.3 (2.85) 41 (4.75) 45.7* 1.3·10-7

MMC (nM) 303 (53) 427 (24) 165 (8.7) 25 (1.5) 20 (1.8) 13.3* 1.3·10-4

Cisplatin (nM) 2124 (382) 1043 (177) 969 (159) 117 (12) 108 (14) 12.2* 6.1·10-4

Irradiation (Gy) 8.4 (0.64) 5.8 (0.18) 3.9 (0.61) 1.6 (0.14) 1.4 (0.27) 4.1* 0.003MMS (µM) 759 (7.7) 1256 (103) 633 (8.5) 196 (13) 343 (54) 3.3* 3.5·10-4

Doxorubicin (nM) 34.7 (3.2) 13.3 (1.8) 5.4 (0.90) 3.3 (0.63) 7.4 (.53) 3 0.03Docetaxel (nM) 1.53 (0.37) 1.36 (0.10) 0.27 (0.037) 0.23 (0.015) 0.63 (0.13) 2.6 0.03Valproic acid (mM) 2.3 (0.17) 2.3 (0.17) 1.6 (0.051) 1.7 (0.40) 1.4 (0.13) 1.3 0.05Nocodazol (nM) 55.3 (9.5) 62.0 (6.7) 54.2 (8.9) 49.8 (5.1) 40.9 (5.9) 1.3 0.095FU (µM) 2.3 (0.11) 2.4 (0.067) 2.4 (0.20) 1.9 (0.35) 1.9 (0.15) 1.2 0.02HU (µM) 51 (13) 67 (9.9) 29 (3.6) 44 (7.7) 43 (9.5) 1.1 0.58

Table 1: Differential IC50 Values of 12 agents on Brca2 proficient vs.Brca2 deficient cellsBRCA2 Proficient BRCA2 Deficient

NOTE: Mean IC50 values of at least 3 independent experiments were determined for 11 drugs and γ-irradiation. Values between brackets represent s.e.m. of the independent IC50 determinations. Average IC50 values determined for the KP lines were compared to average IC50 values of the KB2P lines and displayed as their ratio. Statistical significance was determined using a t-test. *Significance with p<0.01. #For temozolomide, no accurate IC50 values could be obtained for KP-7.7 due to deviation of actual datapoints from a sigmoid curve.

PARP inhibition synergizes with cisplatin in growth inhibition of BRCA2-deficient mammary tumor cellsSince both platinum drugs and the PARP inhibitor AZD2281 give rise to DSBs, combination therapy with platinum and AZD2281 may lead to a reduced effective dose of both single agents. This can be favorable with regard to toxic side-effects of platinum drugs. To study possible drug synergy or additivity, growth inhibition induced by combinations of 16 different concentrations of AZD2281 and 9 different concentrations of cisplatin was determined for both KB2P cell lines and a KP control cell line (Figure 5A). Subsequently, using the growth inhibition curves of both single agents, combination index values as explained in (Chou, 2006) were calculated using the formula:

Thus, log10 CI values <-0.15 indicate synergy at any given combination of drug concentration, values >0.15 indicates antagonism, and values between -0.15 and 0.15 represent additive drug interaction (Chou, 2006). Whereas most cisplatin and AZD2281 combinations only exerted additive growth inhibitory effects on the KP-6.3 cell line, synergistic growth inhibition was observed for both BRCA2-deficient cell lines (Figure 5B).

)()2281( )(50),2281(

)(50)(

)2281(50),2281(

)2281(50)2281(

CisplatinmAZDm CisplatinICCisplatinAZDsurvival

CisplatinICCisplatinionConcentrat

AZDICCisplatinAZDsurvival

AZDICAZDionConcentratCI

Chapter 2

2

40

Discussion

Tumor derived cell lines are likely to recapitulate several cell-intrinsic properties of tumor cells in vivo (Lacroix and Leclercq, 2004) and have been used extensively as models for human cancer. For studying human hereditary breast cancer associated with BRCA2 loss-of-function, researchers have thus far relied upon the CAPAN-1 line, which carries a 6174delT mutation in one BRCA2 allele accompanied by loss of the wild-type allele (Goggins et al., 1996). This cell line originates from a pancreatic tumor and may therefore be less qualified as a model system for human BRCA2-mutated breast cancer. Growth arrest, probably caused by rapid accumulation of unrepaired DNA-damage, makes it very difficult to culture cells with dysfunctional BRCA2 (Patel et al., 1998). Consequently, no established BRCA2-deficient mammary tumor cell lines have been reported until now. Since supraphysiological oxygen levels can increase DNA damage (Halliwell and Aruoma, 1991), we reasoned that cells with dysfunctional BRCA2 should be cultured at low oxygen conditions, comparable to the levels present in situ. Although this strategy resulted in the successful establishment of BRCA2-deficient cell lines from two independent primary mammary tumors, cultures derived from 10 additional tumors displayed depletion of BRCA2-deficient cells, suggesting strong selection against BRCA2 dysfunction during in vitro culture. The fact that all mammary tumors and tumor cell lines derived from K14Cre;Brca2F11/F11;p53F2-10/F2-10 female mice are p53 deficient shows that inactivation of p53-mediated cell-cycle checkpoints is not sufficient to permit in vitro growth of BRCA2-deficient mammary tumor cells. Apparently, other factors present in the tumor stroma are

Figure 5. Cisplatin and AZD2281 show additivity in KP lines and synergism in KB2P lines. A. Two-dimensional plots, showing growth inhibitory effects exerted by combinations of 15 different AZD2281 concentrations with 9 different cisplatin concentrations. The color scale indicates growth ratios of treated cells compared to mock-treated control cells. B. For all drug combinations tested, log10 values of the combination indices are shown. All data points resulting in <20% or >80% growth are arbitrarily set to 0, since predictions of single-agent concentrations for such effects are intrinsically inaccurate.

-0.3 -0.25 -0.2 -0.15 -0.1 -0.05 0 0.05 0.1 0.15 0.2 0.25 0.3

0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1

Less survival More survival

Synergistic Additive Antagonistic

Log2 Relative [cisplatin]

Log2

Rel

ativ

e [A

ZD22

81]

Surviving fraction ofKB2P-1.21

0 -3.4 -2.4 -1.4 -0.4 0.6 1.6 2.6 3.6

6.2 5.2 4.2 3.2 2.2 1.2 0.2-0.8-1.8-2.8-3.8-4.8-5.8-6.8-7.8 0


Log2

Rel

ativ

e [A

ZD22

81]

Surviving fraction ofKB2P-3.4

0 -4.4 -3.4 -2.4 -1.4 -0.4 0.6 1.6 2.6

4.8 3.8 2.8 1.8 0.8-0.2-1.2-2.2-3.2-4.2-5.2-6.2-7.2-8.2-9.2 0


Log2

Rel

ativ

e [A

ZD22

81]

Surviving fraction ofKP-6.3

0 -3.0 -2.0 -1.0 0.0 1.0 2.0 3.0 4.0

4.5 3.5 2.5 1.5 0.5-0.5-1.5-2.5-3.5-4.5-5.5-6.5-7.5-8.5-9.5 0

-0.01 -0.030.02 0.05 -0.01

-0.04 -0.06-0.04 -0.11-0.04 -0.05-0.13 -0.10

-0.04-0.06-0.03-0.01-0.01


Log2

Rel

ativ

e [A

ZD22

81]

Combination index values of KP-6.3

-3.0 -2.0 -1.0 0.0 1.0 2.0 3.0 4.0

4.5 3.5 2.5 1.5 0.5-0.5-1.5-2.5-3.5-4.5-5.5-6.5-7.5-8.5-9.5

0.04-0.02 -0.02 -0.06 -0.03 -0.010.00 -0.06 -0.12 -0.14 -0.13-0.10 -0.20 -0.17 -0.25 -0.25-0.29 -0.25 -0.32 -0.34 -0.30-0.17 -0.20 -0.29 -0.34 -0.28-0.16 -0.17 -0.37 -0.33 -0.28 -0.14

-0.30 -0.25 -0.22 -0.09-0.19 -0.20 -0.11-0.12 -0.15 -0.10-0.14 -0.20 -0.10-0.09 -0.16 -0.07

-0.08 -0.06


Log2

Rel

ativ

e [A

ZD22

81]

Combination index values of KB2P-3.4

-4.4 -3.4 -2.4 -1.4 -0.4 0.6 1.6 2.6

4.8 3.8 2.8 1.8 0.8-0.2-1.2-2.2-3.2-4.2-5.2-6.2-7.2-8.2-9.2

0.00 -0.12-0.12 -0.09 -0.22-0.14 -0.22 -0.26-0.16 -0.18 -0.31 -0.25

-0.12 -0.21 -0.22-0.19 -0.19-0.25 -0.18-0.14 -0.13

-0.12 -0.05-0.07 -0.05


Log2

Rel

ativ

e [A

ZD22

81]

Combination index values of KB2P-1.21

-3.4 -2.4 -1.4 -0.4 0.6 1.6 2.6 3.6

6.2 5.2 4.2 3.2 2.2 1.2 0.2-0.8-1.8-2.8-3.8-4.8-5.8-6.8-7.8

A

B


2

41

required for unhindered proliferation in the absence of functional BRCA2. Endogenous or culture-induced mutations in the successfully established BRCA2-deficient lines may underlie the evasion of stromal dependency. Identification of such mutations might be of therapeutic relevance. Detailed functional characterization of our newly established BRCA2-deficient mammary tumor cell lines showed that both KB2P cell lines are defective in IR-induced RAD51 foci formation. Together with the observed early embryonic lethality of homozygous Brca2D11/D11 mouse mutants (Jonkers et al., 2001), these data indicate that Cre-mediated switching of Brca2F11 results in a non-functional allele. In line with this, both BRCA2-deficient KB2P cell lines showed increased genomic instability, characterized by large numbers of clonal structural aberrations, compared to BRCA2-proficient KP cell lines. The high degree of genomic instability of the BRCA2-deficient KB2P cell lines is also reflected by the fact that many aberrations were not clonal, giving rise to de novo genetic heterogeneity within the clonal KB2P cell lines. This continuing genetic heterogeneity may, in combination with strong selective pressure for adaptation to in vitro growth conditions, also be the cause of the discordance between the CGH profiles of KB2P-3 clonal cell lines and the corresponding primary tumor. Interestingly, whereas tri- and quadriradial chromosome structures have been described to be a direct effect of BRCA2 dysfunction (Patel et al., 1998), these structures were not observed in any of the metaphase spreads prepared from our KB2P cell lines (data not shown). Although it is known that DNA damaging agents show selective cytotoxicity against non-tumor cells with engineered Brca2 mutations, relatively few data are available about the effect of such agents on BRCA2-deficient mammary tumor cells. These tumor cells are either intrinsically less sensitive to the proliferative impediment that is induced by BRCA2 loss-of-function in non-tumor cells, or have somehow overcome this inhibition, perhaps by acquiring additional mutations. For this reason it is important to assess the efficacy of known cytotoxic agents in the context of steadily proliferating BRCA2-deficient cells. We have assessed, for the first time, the selective toxicity of γ-irradiation and 11 anticancer drugs on proliferating BRCA2-deficient breast cancer cells. Our in vitro cytotoxicity studies with BRCA2-proficient KP cell lines vs. BRCA2-deficient KB2P lines clearly showed selective sensitivity of KB2P cells to cytotoxic agents directly inducing DNA strand lesions (IR, Cisplatin, MMC, MMS, Temozolomide) but not to agents that do not, or only indirectly, induce DNA damage (doxorubicin, 5FU, HU, docetaxel, nocodazol, valproic acid). Temozolomide displayed an exquisite 46-fold higher sensitivity towards BRCA2-deficient cells. This strong selectivity may be explained by the fact that temozolomide indirectly induces DSBs as a result of futile mismatch repair of O6-methylguanine lesions (Drabløs et al., 2004). Our results highlight, for the first time, the potential efficacy of temozolomide against BRCA-mutated breast cancer, and warrant further investigation. Still, the strongest selective sensitivity of KB2P cells was observed with the clinical PARP inhibitor AZD2281. One explanation for the unrivaled sensitivity of BRCA2-defective cells towards AZD2281 is that suppression of BER by PARP inhibition may result in the conversion of SSBs to DSBs during DNA replication, thus activating BRCA2 dependent recombination pathways (Arnaudeau et al., 2001). The two independently isolated BRCA2-deficient cell lines show very similar responses to all agents tested, as do the three independent BRCA2-proficient lines. Nevertheless, definitive proof of BRCA2 directly being responsible for the differential effects between these groups of cell lines

Chapter 2

2

42

should come from reconstitution experiments that should rule out that other mutations are causal to the observed sensitization spectrum. The initial reports on the selective sensitivity of BRCA2-deficient cells to PARP inhibition were challenged by other studies, which claimed that known PARP inhibitors were not or only minimally selective to BRCA2 mutant CAPAN-1 tumor cells and BRCA1 mutant tumor cells (Gallmeier and Kern, 2005; De Soto et al., 2006). Although CAPAN-1 cells were subsequently shown to be highly sensitive to the PARP inhibitor used in one of the original studies (McCabe et al., 2005), these experiments did not rule out the possibility that cell type related differences might compromise the utility of PARP inhibitors for treating BRCA-associated breast cancer. This concern is alleviated by the potent growth inhibition induced by the clinical PARP inhibitor AZD2281 in our BRCA2-deficient mammary cancer cell lines. Whether the strong growth inhibition induced by AZD2281 also applies to BRCA1-deficient tumor cells remains yet to be determined. Most known PARP inhibitors inhibit PARP-1 as well as PARP-2 activity (Bryant et al., 2005) and, in contrast to PARP-1 single knockouts, PARP-1/PARP-2 double knockout mice are embryonic lethal (Ménissier de Murcia et al., 2003). Indeed, PARP-1 and PARP-2 have both overlapping and non-redundant functions in the maintenance of genomic stability (Huber et al., 2004). Nevertheless, both the large differential effect between BRCA2-deficient and –proficient cells and the absence of apparent toxic effects in mice treated with AZD2281 (data not shown) indicate that partial inhibition of PARP-1 and PARP-2 by AZD2281 does not cause notable toxicity in wild type cells. In summary, we have generated the first set of BRCA2-deficient mammary tumor cell lines, which may prove useful for mechanistic studies and for preclinical evaluation of novel anti-cancer drugs. In vitro cytotoxicity studies with these cell lines showed clear selective sensitivity of BRCA2-deficient cells to drugs that induce DNA strand lesions or compounds that target the BER pathway. Moreover, potent synergy between the clinical PARP inhibitor AZD2281 and cisplatin was observed. Taken together, our results provide strong evidence for the use of selective PARP inhibitors alone, or in combination with platinum drugs for the treatment of BRCA-associated cancers and BRCA-like tumors with defective HR repair.

Acknowledgments

We wish to thank Sheba Agarwal and Roland Kanaar for the RAD51 antibody; and Liesbeth van Deemter for expert help with generating the KP-3.33 and KP-6.3 and KP-7.7 cell lines. We thank Karin de Visser, Gilles Doumont, Marieke Vollebergh, Jelle Wesseling, Piet Borst and Hein te Riele for helpful comments on the manuscript. This work was supported by the Netherlands Organization for Scientific Research (Vidi grant 917.036.347), the Dutch Cancer Society (grants NKI 2002–2635 and NKI 2007–3772) and Susan G. Komen for the Cure (grant BCTR 0403230).

ReferencesArnaudeau, C., Lundin, C., and Helleday, T. (2001). DNA double-strand breaks associated with replication forks are predominantly repaired by homologous recombination involving an exchange mechanism in mammalian cells. J. Mol. Biol. 307, 1235–1245.

Bartz, S.R., Zhang, Z., Burchard, J., Imakura, M., Martin, M., Palmieri, A., Needham, R., Guo, J., Gordon, M., Chung,


2

43

N., et al. (2006). Small interfering RNA screens reveal enhanced cisplatin cytotoxicity in tumor cells having both BRCA network and TP53 disruptions. Mol. Cell. Biol. 26, 9377–9386.

Bryant, H.E., Schultz, N., Thomas, H.D., Parker, K.M., Flower, D., Lopez, E., Kyle, S., Meuth, M., Curtin, N.J., and Helleday, T. (2005). Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADP-ribose) polymerase. Nature 434, 913–917.

Chou, T.-C. (2006). Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol. Rev. 58, 621–681.

Chung, Y.-J., Jonkers, J., Kitson, H., Fiegler, H., Humphray, S., Scott, C., Hunt, S., Yu, Y., Nishijima, I., Velds, A., et al. (2004). A whole-genome mouse BAC microarray with 1-Mb resolution for analysis of DNA copy number changes by array comparative genomic hybridization. Genome Res. 14, 188–196.

Collins, N., McManus, R., Wooster, R., Mangion, J., Seal, S., Lakhani, S.R., Ormiston, W., Daly, P.A., Ford, D., and Easton, D.F. (1995). Consistent loss of the wild type allele in breast cancers from a family linked to the BRCA2 gene on chromosome 13q12-13. Oncogene 10, 1673–1675.

Daniels, M.J., Wang, Y., Lee, M., and Venkitaraman, A.R. (2004). Abnormal cytokinesis in cells deficient in the breast cancer susceptibility protein BRCA2. Science 306, 876–879.

Davies, A.A., Masson, J.Y., McIlwraith, M.J., Stasiak, A.Z., Stasiak, A., Venkitaraman, A.R., and West, S.C. (2001). Role of BRCA2 in control of the RAD51 recombination and DNA repair protein. Mol. Cell 7, 273–282.

Donawho, C.K., Luo, Y., Luo, Y., Penning, T.D., Bauch, J.L., Bouska, J.J., Bontcheva-Diaz, V.D., Cox, B.F., DeWeese, T.L., Dillehay, L.E., et al. (2007). ABT-888, an orally active poly(ADP-ribose) polymerase inhibitor that potentiates DNA-damaging agents in preclinical tumor models. Clin. Cancer Res. 13, 2728–2737.

Donoho, G., Brenneman, M.A., Cui, T.X., Donoviel, D., Vogel, H., Goodwin, E.H., Chen, D.J., and Hasty, P. (2003). Deletion of Brca2 exon 27 causes hypersensitivity to DNA crosslinks, chromosomal instability, and reduced life span in mice. Genes Chromosomes Cancer 36, 317–331.

Drabløs, F., Feyzi, E., Aas, P.A., Vaagbø, C.B., Kavli, B., Bratlie, M.S., Peña-Diaz, J., Otterlei, M., Slupphaug, G., and Krokan, H.E. (2004). Alkylation damage in DNA and RNA--repair mechanisms and medical significance. DNA Repair (Amst.) 3, 1389–1407.

El-Khamisy, S.F., Masutani, M., Suzuki, H., and Caldecott, K.W. (2003). A requirement for PARP-1 for the assembly or stability of XRCC1 nuclear foci at sites of oxidative DNA damage. Nucleic Acids Res. 31, 5526–5533.


Farmer, H., McCabe, N., Lord, C.J., Tutt, A.N., Johnson, D.A., Richardson, T.B., Santarosa, M., Dillon, K.J., Hickson, I., Knights, C., et al. (2005). Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917–921.

Fogh, J., Fogh, J.M., and Orfeo, T. (1977). One hundred and twenty-seven cultured human tumor cell lines producing tumors in nude mice. J. Natl. Cancer Inst. 59, 221–226.

Ford, D., Easton, D.F., Stratton, M., Narod, S., Goldgar, D., Devilee, P., Bishop, D.T., Weber, B., Lenoir, G., Chang-Claude, J., et al. (1998). Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. The Breast Cancer Linkage Consortium. Am. J. Hum. Genet. 62, 676–689.

Gallmeier, E., and Kern, S.E. (2005). Absence of specific cell killing of the BRCA2-deficient human cancer cell line CAPAN1 by poly(ADP-ribose) polymerase inhibition. Cancer Biol. Ther. 4, 703–706.

Chapter 2

2

44

Goggins, M., Schutte, M., Lu, J., Moskaluk, C.A., Weinstein, C.L., Petersen, G.M., Yeo, C.J., Jackson, C.E., Lynch, H.T., Hruban, R.H., et al. (1996). Germline BRCA2 gene mutations in patients with apparently sporadic pancreatic carcinomas. Cancer Res. 56, 5360–5364.

Halliwell, B., and Aruoma, O.I. (1991). DNA damage by oxygen-derived species. Its mechanism and measurement in mammalian systems. FEBS Lett. 281, 9–19.

Helleday, T., Bryant, H.E., and Schultz, N. (2005). Poly(ADP-ribose) polymerase (PARP-1) in homologous recombination and as a target for cancer therapy. Cell Cycle 4, 1176–1178.

Huber, A., Bai, P., de Murcia, J.M., and de Murcia, G. (2004). PARP-1, PARP-2 and ATM in the DNA damage response: functional synergy in mouse development. DNA Repair (Amst.) 3, 1103–1108.

Jonkers, J., Meuwissen, R., van der Gulden, H., Peterse, H., van der Valk, M., and Berns, A. (2001). Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat. Genet. 29, 418–425.

Kelland, L. (2007). The resurgence of platinum-based cancer chemotherapy. Nat. Rev. Cancer 7, 573–584.

Lacroix, M., and Leclercq, G. (2004). Relevance of breast cancer cell lines as models for breast tumours: an update. Breast Cancer Res. Treat. 83, 249–289.


Loonstra, A., Vooijs, M., Beverloo, H.B., Allak, B.A., van Drunen, E., Kanaar, R., Berns, A., and Jonkers, J. (2001). Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. Proc. Natl. Acad. Sci. U.S.A. 98, 9209–9214.

McCabe, N., Lord, C.J., Tutt, A.N.J., Martin, N.M.B., Smith, G.C.M., and Ashworth, A. (2005). BRCA2-deficient CAPAN-1 cells are extremely sensitive to the inhibition of Poly (ADP-Ribose) polymerase: an issue of potency. Cancer Biol. Ther. 4, 934–936.

Menear, K.A., Adcock, C., Boulter, R., Cockcroft, X., Copsey, L., Cranston, A., Dillon, K.J., Drzewiecki, J., Garman, S., Gomez, S., et al. (2008). 4-[3-(4-cyclopropanecarbonylpiperazine-1-carbonyl)-4-fluorobenzyl]-2H-phthalazin-1-one: a novel bioavailable inhibitor of poly(ADP-ribose) polymerase-1. J. Med. Chem. 51, 6581–6591.

Ménissier de Murcia, J., Ricoul, M., Tartier, L., Niedergang, C., Huber, A., Dantzer, F., Schreiber, V., Amé, J.-C., Dierich, A., LeMeur, M., et al. (2003). Functional interaction between PARP-1 and PARP-2 in chromosome stability and embryonic development in mouse. Embo J. 22, 2255–2263.


Moynahan, M.E., Pierce, A.J., and Jasin, M. (2001). BRCA2 is required for homology-directed repair of chromosomal breaks. Mol. Cell 7, 263–272.

Patel, K.J., Yu, V.P., Lee, H., Corcoran, A., Thistlethwaite, F.C., Evans, M.J., Colledge, W.H., Friedman, L.S., Ponder, B.A., and Venkitaraman, A.R. (1998). Involvement of Brca2 in DNA repair. Mol. Cell 1, 347–357.

Paull, T.T., Rogakou, E.P., Yamazaki, V., Kirchgessner, C.U., Gellert, M., and Bonner, W.M. (2000). A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr. Biol. 10, 886–895.

Rajagopalan, H., and Lengauer, C. (2004). Aneuploidy and cancer. Nature 432, 338–341.

Sharan, S.K., Morimatsu, M., Albrecht, U., Lim, D.S., Regel, E., Dinh, C., Sands, A., Eichele, G., Hasty, P., and Bradley,


2

45

A. (1997). Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature 386, 804–810.

Shivji, M.K.K., Davies, O.R., Savill, J.M., Bates, D.L., Pellegrini, L., and Venkitaraman, A.R. (2006). A region of human BRCA2 containing multiple BRC repeats promotes RAD51-mediated strand exchange. Nucleic Acids Res. 34, 4000–4011.

Silver, D.P., Richardson, A.L., Eklund, A.C., Wang, Z.C., Szallasi, Z., Li, Q., Juul, N., Leong, C.-O., Calogrias, D., Buraimoh, A., et al. (2010). Efficacy of neoadjuvant Cisplatin in triple-negative breast cancer. J. Clin. Oncol. 28, 1145–1153.

Smith, S.A., Easton, D.F., Evans, D.G., and Ponder, B.A. (1992). Allele losses in the region 17q12-21 in familial breast and ovarian cancer involve the wild-type chromosome. Nat. Genet. 2, 128–131.

De Soto, J.A., Wang, X., Tominaga, Y., Wang, R.-H., Cao, L., Qiao, W., Li, C., Xu, X., Skoumbourdis, A.P., Prindiville, S.A., et al. (2006). The inhibition and treatment of breast cancer with poly (ADP-ribose) polymerase (PARP-1) inhibitors. Int. J. Biol. Sci. 2, 179–185.

Tebbs, R.S., Flannery, M.L., Meneses, J.J., Hartmann, A., Tucker, J.D., Thompson, L.H., Cleaver, J.E., and Pedersen, R.A. (1999). Requirement for the Xrcc1 DNA base excision repair gene during early mouse development. Dev. Biol. 208, 513–529.


Tutt, A., Bertwistle, D., Valentine, J., Gabriel, A., Swift, S., Ross, G., Griffin, C., Thacker, J., and Ashworth, A. (2001). Mutation in Brca2 stimulates error-prone homology-directed repair of DNA double-strand breaks occurring between repeated sequences. Embo J. 20, 4704–4716.

Tutt, A., Gabriel, A., Bertwistle, D., Connor, F., Paterson, H., Peacock, J., Ross, G., and Ashworth, A. (1999). Absence of Brca2 causes genome instability by chromosome breakage and loss associated with centrosome amplification. Curr. Biol. 9, 1107–1110.

Tutt, A.N.J., van Oostrom, C.T.M., Ross, G.M., van Steeg, H., and Ashworth, A. (2002). Disruption of Brca2 increases the spontaneous mutation rate in vivo: synergism with ionizing radiation. EMBO Rep. 3, 255–260.Wang, Z.Q., Auer, B., Stingl, L., Berghammer, H., Haidacher, D., Schweiger, M., and Wagner, E.F. (1995). Mice lacking ADPRT and poly(ADP-ribosyl)ation develop normally but are susceptible to skin disease. Genes Dev. 9, 509–520.

Xia, F., Taghian, D.G., DeFrank, J.S., Zeng, Z.C., Willers, H., Iliakis, G., and Powell, S.N. (2001). Deficiency of human BRCA2 leads to impaired homologous recombination but maintains normal nonhomologous end joining. Proc. Natl. Acad. Sci. U.S.A. 98, 8644–8649.

Yang, Y.-G., Cortes, U., Patnaik, S., Jasin, M., and Wang, Z.-Q. (2004). Ablation of PARP-1 does not interfere with the repair of DNA double-strand breaks, but compromises the reactivation of stalled replication forks. Oncogene 23, 3872–3882.

Yuan, S.S., Lee, S.Y., Chen, G., Song, M., Tomlinson, G.E., and Lee, E.Y. (1999). BRCA2 is required for ionizing radiation-induced assembly of Rad51 complex in vivo. Cancer Res. 59, 3547–3551.

Chapter 2

2

46

Supplemental Information

Figure S1. H&E slides of parental tumors. Hematoxylin and eosin stained sections of the tumors from which cell lines are derived.All tumors are classified as solid adenocarcinomas resembling human infiltrating ductal carcinoma not otherwise specified (IDC-nos) grade III, although the expansive growth and partial spindle cell morphology may suggest a more metaplastic phenotype. Scale bars are 200mm.

Figure S2. Clonal cell lines are epithelial. Cells seeded on coverslips and harvested 24 hours later were stained for cytokeratin 8 (green, A) or E-cadherin (green, B), and DNA (blue) as described (Derksen et al., 2006). Subsequently, pictures were taken using a Leica TCS TNT microscope (Leica Microsystems, Wetzlar, Germany).

KB2P-3

KP-6 KP-7KP-3

KB2P-1

KP-3.33 KP-6.3 KP-7.7 KB2P-1.21 KB2P-3.4

KP-3.33 KP-6.3 KP-7.7 KB2P-1.21 KB2P-3.4

A

B


2

47

Cell line Ploidy Karyotype

KP-3.33 4n -X[8], -1[4], -9[3], -10[8], -12[7], -13[3], -14[4], -15[3], -18[8], -19[3], der(4)t(4;19)[7], der(9)t(9;17)[2], del(X)[6], der(11)dup(11)[5], +sat[4][cp9]

KP-6.3 2n +19[8], der(16)t(16;3)[8], der(11)dup(11)[3][cp9]

KP-7.7 4n -X*2[7], -1[8], -2[7], -4[7], -5[3], -7[8], +8[5], -9[8], +11[6], -12[7], -13[6], -14[8], +15[2], -16[8], -17[3], +19*2[6][cp8]

KB2P-1.21 3n -X[4], -2[3], -10[5], -11[4], -13[5], -15[3], -16[3], -18[4], +del(19)[2], der(X);t(x;3;18)[2], der(X);t(X;15)[2], der(1);t(1;11)[4], der(6)t(6;X)[2], der(11)t(11;6)[5], der(15)t(15;X)[3], der(18)t(18;11)[2], der(18)t(18;3)[2], del(5)[2], del(12)[5], del(12)*2[2], del(19)[2], der(19)dup(19)[2], +sat[42][cp6]

KB2P-3.4 3n -1[4], -8*2[3], -9[4], -10[5], -10*2[3], -11[4], -13[3], -14[3], -17[4], +del(18)[4], der(X)t(X;11)[3], der(4)t(4;5)[2], der(4)t(4;14)[2], der(4)t(4;14)[2], der(5)t(5;1)[2], der(5)t(5;17)[3], der(7)t(7;4;8/16;4;19)[2], der(12)t(12;19;6/18)[2], der(13)t(13;12)[4], der(14)t(14;12)[2], der(14)t(14;18)[2], der(16)t(16;5)[2], del(X)[4], del(2)[2], del(3)[2], del(4)[2], del(6)[2], del(7)[5], del(8)[2], del(12)[3], del(13)[3], del(18)[4], del(18)*2[2], der(10)dup(10)[2], +sat[37][cp6]

Supplementary table 1: Cell-line karyotypes as determined by SKY-analysis

NOTE: A minimum of 6 cells per cell-line are analyzed by spectral karyotyping analysis. The composite karyotype of all clonal variations is described while using the assigned ploidies as a starting point.

Chapter 3 BRCA1-deficient mammary tumor cells are dependent on EZH2 expression and sensitive to Polycomb Repressive Complex 2-inhibitor 3-deazaneplanocin A

Julian Puppe1,2, Rinske Drost3, Xiaoling Liu3,8, Simon Joosse5, Bastiaan Evers3, Paulien Cornelissen-Steijger1, Petra Nederlof4, Qiang Yu6, Jos Jonkers3, Maarten van Lohuizen1 and Alexandra Pietersen1,7

Breast Cancer Research 2009 (11):R63

1 Molecular Genetics and Cancer Genomics Centre, Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX, Amsterdam, The Netherlands

2 Institute of Physiological Chemistry, The Medical Faculty Carl-Gustav Carus, Fetscherstraß 74, 01307 Dresden, Germany

3 Division of Molecular Biology, Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX, Amsterdam, The Netherlands

4 Department of Pathology, Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX, Amsterdam,The Netherlands

5 Department of Experimental Therapy, Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX, Amsterdam,The Netherlands

6 Molecular Pharmacology, Genome Institute of Singapore, 60 Biopolis Street, 138672 Singapore

7 National Cancer Centre Singapore/Duke-NUS GMS, 11 Hospital Drive, 169610 Singapore

8 Current address: Biomedical Analysis Center, Tsinghua University, Beijing 100084, PR China

Chapter 3

3

50

IntroductionTreatment of breast cancer is becoming more individualized with the recognition of tumor subgroups that respond differently to available therapies. BRCA1-deficient tumors are usually of the basal subtype and associated with poor survival rates, highlighting the need for more effective therapy.

MethodsWe investigated a mouse model that closely mimics breast cancer arising in BRCA1-mutation carriers to better understand the molecular mechanism of tumor progression and tested whether targeting of the Polycomb-group protein EZH2 would be a putative therapy for BRCA1-deficient tumors.

ResultsGene expression analysis demonstrated that EZH2 is overexpressed in BRCA1-deficient mouse mammary tumors. By immunohistochemistry we show that an increase in EZH2 protein levels is also evident in tumors from BRCA1-mutation carriers. EZH2 is responsible for repression of genes driving differentiation and could thus be involved in the undifferentiated phenotype of these tumors. Importantly, we show that BRCA1-deficient cancer cells are selectively dependent on their elevated EZH2 levels. In addition, a chemical inhibitor of EZH2, DZNep, is about 20-fold more effective in killing BRCA1-deficient cells compared to BRCA1-proficient mammary tumor cells.

ConclusionsWe demonstrate by specific knock-down experiments that Ezh2 overexpression is functionally relevant in BRCA1-deficient breast cancer cells. The effectiveness of a small molecule inhibitor indicates that EZH2 is a druggable target. The overexpression of EZH2 in all basal-like breast cancers warrants further investigation of the potential for targeting the genetic make-up of this particular breast cancer type.

Introduction

Breast cancer is a heterogeneous disease. Studies by Perou and others have demonstrated that at least five different subtypes can be identified based on molecular profiling (Perou et al., 2000; Sorlie et al., 2003). These different subtypes might arise from transformation of different cell types in the breast and/or from mutations in different genes. It has become clear that breast cancer subtypes correspond with marked differences in therapy response and overall survival, indicating that each subgroup should be treated differently (Linn and Jonkers, 2007). To a certain extent this is already common practice, as ErbB2-overexpressing tumors are treated with Herceptin and ER-positive tumors with tamoxifen or aromatase inhibitors (Ziogas et al., 2008). However, for other groups, such as the basal-type tumors that lack expression of ErbB2, ER and PR, rationally designed treatments are currently lacking. These tumors are generally characterised by a poor differentiation grade, and it is speculated that they may arise from an undifferentiated breast epithelial cell, or at least have acquired stem cell-like properties during transformation (Honeth et al., 2008). Currently, standard treatment of these tumors is chemotherapy. Although

BRCA1-deficient mammary tumor cells are dependent on EZH2 expression

3

51

there is an initial effect of chemotherapy agents such as anthracyclins, basal-like tumors nevertheless exhibit the worst overall survival rate of all breast cancer subtypes. This highlights the need for more effective therapies. In the current study, we investigated the potential of a molecular-based therapy for a subgroup of basal-like breast tumors: those arising in women with an inherited mutation in BRCA1. These tumors are characterized by the loss of the second BRCA1 allele, concomitant loss of TP53 function and an undifferentiated, basal-like phenotype (Chappuis et al., 2000; Greenblatt et al., 2001; Turner and Reis-Filho, 2006; Holstege et al., 2009). Consistent with their basal-like characteristics, BRCA1-deficient breast tumors exhibit aggressive behavior and are associated with poor survival. At the cellular level, an important consequence of loss of BRCA1 function is impaired DNA double-strand break (DSB) repair (Moynahan et al., 1999). Because unresolved DSBs will activate p53, resulting in either cell cycle arrest or apoptosis, there is a strong selection pressure on loss of p53 function in BRCA1-associated breast tumorigenesis. In addition, recent evidence indicates that loss of BRCA1 inhibits differentiation into ER-positive luminal cells, which might contribute to the undifferentiated phenotype (Liu et al., 2008). We developed a mouse model mimicking human BRCA1-deficient breast cancer to gain insight into the molecular progression of BRCA1-deficient tumors and to test putative therapies (Liu et al., 2007b). In this model, the Brca1 and p53 genes are deleted by tissue-specific expression of Cre recombinase driven by the Keratin 14 promoter, which is active in basal cells of the mammary gland, including the stem cells (Jonkers et al., 2001). The ensuing mammary tumors show a solid growth pattern with pushing margins, are highly proliferative, poorly differentiated and similar to human basal-like breast cancers (ER-, PR- and HER2-negative). Importantly, our mouse model allows us to compare BRCA1-deficient mammary tumors (arising in K14cre;Brca1F/F;p53F/F mice) with BRCA1-proficient control tumors (arising in K14cre;Brca1w.t/w.t;p53F/F mice). After comparing gene expression patterns of BRCA1-deficient mouse mammary tumors with BRCA1-proficient control tumors, we noted that Ezh2 expression was particularly high in BRCA1-deficient tumors. EZH2 is a member of the family of Polycomb group proteins, which are epigenetic repressors that prevent the expression of cell cycle inhibitors and genes required for differentiation (Sparmann and van Lohuizen, 2006; Pietersen and van Lohuizen, 2008). We and others had already observed that EZH2 overexpression is linked to aggressive tumours with a high proliferation rate and a poor prognosis (Bracken et al., 2003; Kleer et al., 2003; Raaphorst et al., 2003; Bachmann et al., 2006; Pietersen et al., 2008). In the study presented here, we set out to determine whether increased EZH2 expression also characterizes human BRCA1-deficient breast cancer, and whether BRCA1-deficient tumor cells are dependent on high EZH2 levels for their survival. This would indicate that EZH2 constitutes a therapeutic target for BRCA1-deficient breast cancer. EZH2 is the catalytic subunit of Polycomb Repressive Complex 2 (PRC2), which also contains SUZ12 and EED, and initiates gene silencing by trimethylating lysine 27 in histone H3 (H3-K27me3) (Cao et al., 2002). Yu and colleagues recently demonstrated that a small molecule inhibitor, 3-deanzaneplanocin A (DZNep), effectively reduced the protein levels of PRC2 components EZH2, SUZ12 and EED and inhibits the associated H3K27 trimethylation activity (Tan et al., 2007). H3-K27me3 depletion resulted in reactivation of PRC2-silenced genes and apoptotic cell death in several cancer cell lines. The availability of a small molecule inhibitor like DZNep allowed us to test whether pharmacological

Chapter 3

3

52

targeting of EZH2 function provides a selective approach to kill BRCA1-deficient breast tumor cells.

Materials and Methods

Derivation and maintenance of mouse tumor cell linesTumor cell lines were generated from individual tumors arising in female mice with a K14cre;Brca1F/F;p53F/F (KB1P) or K14cre;Brca1w.t/w.t;p53F/F (KP) genotype as described previously (Silver et al., 2007). Established cell lines were cultured at 37°C with 5% CO2 in DMEM-F12 medium (Gibco, Carlsbad, CA) supplemented with 10% fetal calf serum, 50U/ml penicillin, 50µg/ml streptomycin (Gibco, Carlbad, CA), 5µg/ml insulin (Sigma, St. Louis, MO), 5ng/ml EGF (Invitrogen, Carlbad, CA) and 5ng/ml cholera toxin (Gentaur, Brussels, Belgium).

BRCA1 reconstitution in BRCA1-deficient tumor cellsOne million KB1P3.12 cells were electroporated (3mF, 0.8kV) with the bacterial artificial chromosome (BAC) clone RP11-812O5 containing the complete human BRCA1 gene and regulatory sequences. The RP11-812O5 BAC was obtained from the Children’s Hospital and Research Center at Oakland CA, USA (CHRCO; http://bacpac.chori.org/home.htm). The vector backbone was modified by insertion of the pgk/EM7 Neo/KanR-positive selection cassette pCEI1 (Prosser et al., 2008) into the sacBII gene by bacterial homologous recombination in E. coli SW102 (Warming et al., 2005). After selection with 300mg/ml Geneticin (Gibco-BRL) for two weeks, clones were picked and checked for presence of the BAC by PCR for exon 11 of human BRCA1 (Chandler et al., 2001).

Tumorsphere formation assay Stem Cell Medium (SCM) containing defined growth factors as described by (Liu et al., 2007a; Zucchi et al., 2007) was freshly prepared each time and DZNep (5 mm) or DMSO (no-drug control) was added. Cells were trypsinized, which was inactivated with 10% serum and subsequently washed with PBS to get remove the serum and resuspended in SCM. Cells were filtered to obtain single cells and 40,000 cells, counted with a Casy counter (Schaerfe Systems, Reutlingen, Germany), were plated out in ultra-low binding plates with a flat bottom (Corning, NY, USA). Sphere formation was checked every day and cell culture images were obtained after 72 hours using a Zeiss Axiovert 25 microscope with 10x objective on a Sony Cybershot.

Classification of human breast tumor samplesHuman breast tumor tissue samples were obtained from the Pathology archive of the Netherlands Cancer Institute. BRCA1-mutation status was determined by routine DNA diagnostics. The basal-like and luminal status was determined using expression data to classify the tumors according to the intrinsic gene set as described (Hu et al., 2006).

ImmunohistochemistryParaffin embedded tumor samples were sectioned (4 µm) and deparaffinized by treating twice with xylene for 10 min each and subsequently hydrated in 100%, 80% and 70% ethanol. Antigen retrieval was performed by boiling samples in 10mM sodium citrate for 1 min at 900W and 15 min at 250W in the microwave followed by 20 min gradual cooling at


3

53

room temperature. Slides were blocked in 5% normal goat serum in phosphate-buffered saline. Mouse tissue was additionally permeabilized with 0.25% Triton prior to blocking. The samples were incubated over night with a mouse monoclonal antibody against EZH2/Ezh2 (1:100, BD Biosciences). Immunodetection was performed by DAB oxidation using the Powervision system (Immunologics). Samples were dehydrated in 70%, 80% and 100% ethanol. Once immunostained, slides were digitally scanned with a Scanscope (Aperio Technologies, Vista, CA) and the amount of EZH2-expressing epithelial cell nuclei were counted in a blinded manner by two observers (S. Joosse and J. Puppe) independently. For statistical analysis the Wilcoxon test was used to compare the percentage of EZH2 positive nuclei between two samples and p < 0.05 was considered statistically significant.

Immunoblot analysisCells were scraped from subconfluent plates and lysed in RIPA buffer (150 mM NaCl, 10 mM Tris-HCl pH 7.5, 1% Triton X100, 1% DOC, 0.1% SDS, 1 mM EDTA) Equal amount of protein (10 µg) was loaded and separated by electrophoresis on NuPAGE Novex 4-12% SDS-polyacrylamide gels (Invitrogen) and transferred to nitrocellulose membranes. The blot was blocked with TBST (0.1% Tween 20) containing 5% bovine serum albumine (Sigma) and incubated with primary antibodies for 2 hours at room temperature. After washing with TBST, the membrane was incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody and the signal was detected with enhanced chemiluminescence substrate (GE Healthcare, Amersham). Following antibodies were used: mouse monoclonal against EZH2 (1:20, provided by K. Helin), b-Tubulin (1:10000, Sigma), anti-mouse IgG-HRP (1:10000, Biosource).

Quantitative real-time PCRTotal RNA was extracted using Trizol Reagent (Invitrogen) and 1 µg per sample was treated with DNase. Reverse transcription was performed using the SuperScript™ First-Strand Synthesis System for RT-PCR (Invitrogen, according to manufacturer’s protocol). The generated cDNA was analyzed using SYBR Green (Taqman universal PCR master mix, Applied Biosystems), performed on an ABI Prism 7000 SDS (Applied Biosystems). Product accumulation was evaluated using the comparative CT method (DDCT), with Hprt levels as internal control for normalization. The following primers were used (all for mouse transcripts): Hprt FW, 5'-CTG GTG AAA AGG ACC TCT CG-3'; Hprt RV, 5'-TGA AGT ACT CAT TAT AGT CAA GGG CA-3'; Ezh2 FW, 5'-AAA GAC CCT GAA TGC AGT CGC-3'; Ezh2 RV, 5'-TGA TCC AGA ACT TCA TCC CCC-3'.

Microarray analysisExpression values (Log2 Ratio) of Ezh2 in 21 KB1P and 32 KP mammary tumors were obtained from oligonucleotide microarrays representing 18,173 genes. Methods for RNA extraction, RNA amplification, microarray hybridization, and data processing are described by Liu et al. (Liu et al., 2007b). For comparison of EZH2 gene expression (Log10 Ratio) signatures between mouse and human breast tumors, we used the expression profiles of 96 human breast tumors: 18 ER-negative BRCA1 tumors, 34 tumors with a good prognosis signature and 44 tumors with a poor prognosis signature categorized by the human 70-genes signature dataset (van de Vijver et al., 2002).

Growth inhibition assays

Chapter 3

3

54

DZNep (3-deanzaneplanocin A) was provided by YU Qiang (Genome Institute of Singapore) and TSA (Trichostatin A) was obtained from Sigma. Both compounds were solved in DMSO and stored at -20°C. Before the growth inhibition assays, growth curves were made of all cell lines to determine the amount of cells which ensure exponential growth during a 5 day culture period. For cell viability analysis, subconfluent dishes were trypsinized and filtered to obtain single cells. Cells were counted with a Casy counter (Schaerfe Systems, Reutlingen, Germany) and appropriate amounts of cells were typically plated out in 96-well plates on day 0. Drugs were added in twofold serial dilutions on day 1 in triplicate. DMSO was used as no-drug control. Both drugs were left on the cells for 120h. On day 5 cell viability was measured using the Cell Titer Blue assay (Promega, Madison, WI). Cell Titer Blue reagent was added directly to the cells (10µl/well) and incubated for 2h at 37°C. Fluorescence at 560ex/590em nm was measured using a Tecan infinite m200 plate reader (Tecan, Salzburg, Austria). After correction for medium only and no-drug controls, data points were fitted to a sigmoidal dose-response curve with variable slope using GraphPad Prism Version 5.00 (GraphPad Software, San Diego, CA, USA): Y=100/(1+10^((LogIC50-X)*HillSlope))). At least three independent experiments were used to determine the IC50 values for each drug/cell line combination.

RNA interference and DZNep-drug treatmentThe SMARTpool siRNA targeting Ezh2 and the non targeting control were purchased from Dharmacon. Prior to all knock-down experiments optimal transfection conditions were determined for all cell lines. Cells were plated on day 0 and either transfected with 2 µM siRNA using DharmaFECT transfection reagent according to manufacturer’s protocol (Dharmacon) or supplied with 5 µM DZNep on day 1. For protein and RNA analysis cells were harvested 48, 72 and 96 h after transfection. The effect on cell growth was quantified using a Cell Titer Blue cell viability assay as described above. Cells were plated on day 0 in a density to allow exponential growth during the whole experiment and either transfected with siRNA or treated with 5 µM DZNep on day 1. Fluorescence was recorded 24, 48, 72 and 96 h after transfection. Cell culture images were obtained using a Zeiss Axiovert 25 microscope with 10x objective on a Sony Cybershot. In all cases, data is presented from at least three independent experiments.

Results

Ezh2 expression is elevated in BRCA1-deficient mouse mammary tumorsTo define the molecular changes associated with BRCA1-deficient breast cancer, we previously compared BRCA1-deficient (KB1P) mammary tumors derived from our conditional K14cre;Brca1F/F;p53F/F mouse model for hereditary breast cancer with BRCA1-proficient mammary tumors (KP) derived from K14cre;Brca1w.t/w.t;p53F/F mice. Gene expression microarray analysis showed that KB1P tumors expressed markers of basal-like breast cancer, for example p63 and keratin 5, compared to the KP tumors (Liu et al., 2007b; Sarrió et al., 2008). Strikingly, the polycomb repressor EZH2 is also higher expressed in BRCA1-deficient tumors than in BRCA1-proficient control tumors (Figure 1A). Whereas there is heterogeneity in the BRCA1-proficient group, virtually all BRCA1-deficient tumors display increased Ezh2 expression, suggesting that in the absence of BRCA1 increased levels of EZH2 may be required. To determine whether the increase in mRNA levels translates to higher EZH2 protein expression, we analyzed tissue sections from both KB1P


3

55

and KP tumors by immunohistochemistry (Figure 1 B). We indeed found that BRCA1-deficient mouse mammary tumors have higher EZH2 protein levels than control tumors, as also indicated by the higher percentage of tumor cells with EZH2 expression above background (77% in KB1P tumors versus 11.5% in KP tumors; Wilcoxon p<0.029; Figure 1C).

Figure 1. Ezh2 expression is elevated in BRCA1-deficient primary mouse mammary tumors. A. mRNA levels of Ezh2 in BRCA1-deficient (KB1P) and BRCA1-proficient (KP) mammary tumors analyzed by microarray analysis. The mean (±S.E.M.) log2 ratio of Ezh2 expression in 21 KP tumors is -0.036 (±0.067) and 0.497 (±0.054) in 32 KB1P tumors. The Ezh2 expression is significantly higher in KB1P tumors compared to KP tumors (*, Wilcoxon exact test). B. EZH2 protein levels in two independent primary KB1P and in two independent primary KP tumors detected by immunohistochemistry (scale bar represents 100µm), representative of a total of 4 tumors analysed for each genotype. C. Quantification of EZH2 immunohistochemistry shown in B (*, Wilcoxon exact test).

EZH2 is overexpressed in BRCA1-deficient human breast tumorsNext, we determined whether EZH2 is also overexpressed in human BRCA1-deficient breast cancer. Recently, we and others showed that EZH2 levels are high in breast tumors with a poor prognosis (Bachmann et al., 2006; Collett et al., 2006; Pietersen et al., 2008). Tumors from BRCA1-mutation carriers belong to this group of aggressive breast cancer, and accordingly EZH2 mRNA levels are also high in human BRCA1-deficient tumors (Figure 2A). Consistent with our previous observation that EZH2 mRNA and protein levels

A

B C

Chapter 3

3

56

correlate relatively well (Pietersen et al., 2008), we observed increased EZH2 protein levels in human BRCA1-deficient tumor sections compared to other breast tumors (Figure 2B). To allow direct comparison, we simultaneously performed immunohistochemistry for EZH2 on sections from luminal A, basal-like and BRCA1-mutated breast tumors. Like previously reported (Bachmann et al., 2006; Collett et al., 2006; Pietersen et al., 2008), we found EZH2 levels to be higher in basal-like tumors compared to luminal A type tumors (Figure 2B). By the same detection criteria, EZH2 levels in the BRCA1-deficient tumors were at least as high as in the sporadic basal-like tumors (no significant difference, Wilcoxon p<0,164) and significantly increased compared to luminal A type tumors (Wilcoxon p< 0,002, Figure 2C).

Figure 2. EZH2 is overexpressed in BRCA1-deficient human breast tumors. A. The mean (±S.E.M.) log10 ratio of EZH2 expression in human breast cancer samples (van ’t Veer et al., 2002) is -0.15 (±0.041) (>5 yr survival, good prognosis), 0.028 (±0.046) (<5 yr survival, poor prognosis) and 0.177 (±0.047) (BRCA1-deficient). EZH2 expression is significantly different between the three groups (*, Kruskall-Wallis test). B. Immunohistochemistry for EZH2 in human breast tumor tissues (scale bar represents 100µm). Two examples are shown of individual tumors for each subtype, representative of a total of 6 tumors analysed per subtype. C. Quantification of EZH2 immunohistostchemistry shown in B (*, Wilcoxon exact test).

A B

C

BRCA1-deficient cells are dependent on EZH2To determine whether the increased EZH2 levels are functionally relevant in the BRCA1-deficient tumor cells, we made use of cell lines that were derived from KB1P and KP mouse mammary tumors (Silver et al., 2007). In total, we used a panel of three BRCA1-deficient and three BRCA1-proficient cell lines, all derived from individual primary tumors. Even though DZNep is a selective inhibitor of EZH2 function, some effects on other epigenetic marks, such as H4K20 methylation, have been reported (Tan et al., 2007). To ascertain


3

57

whether observed effects with DZNep are due to its inhibition of EZH2 specifically, we included small interfering RNAs (siRNAs) targeting Ezh2 in our experiments. Quantitative PCR demonstrated efficient knockdown of Ezh2 mRNA levels in both BRCA1-proficient and BRCA1-deficient cells (Figure 3A). DZNep does not affect Ezh2 mRNA levels, as reported previously (Tan et al., 2007). However, treatment with either Ezh2 specific siRNAs or DZNep resulted in significant reduction of EZH2 protein levels in both KB1P and KP cells (Figure 3B). Forty-eight hours after treatment there was visible toxicity in KB1P cells when EZH2 levels were reduced by either DZNep or siRNAs targeting Ezh2, but not in KB1P cells treated with non targeting control siRNAs (Figure 3C). In contrast, there was no apparent effect of reduced EZH2 levels, either by Ezh2 -knockdown or DZNep treatment, in BRCA1-proficient tumor cells. A more quantitative assessment of the effect of the treatments by a growth inhibition assay revealed that there is some adverse affect of DZNep in the KP cells. However, this effect of DZNep is unrelated to EZH2, as knockdown of Ezh2 does not inhibit the growth of these cells (Figure 3D, blue lines). Possibly, this is due to the effect of DZNep on H4K20 or other methylation events. In contrast, KB1P cells are severely affected by reduced EZH2 levels, as demonstrated by a strong growth inhibition of KB1P cells treated with siRNAs targeting Ezh2 (Figure 3D, red lines). In BRCA1-deficient cells, treatment with DZNep inhibited growth even more effectively than knock-down of Ezh2, which could be due to a more effective depletion of EZH2 by DZNep than that achieved by siRNAs, or due to possible effects of DZNep on other epigenetic marks. Nevertheless, DZNep shows remarkable selectivity in inhibiting BRCA1-deficient tumor cells compared to BRCA1-proficient tumor cells (Figure 3C and D).

BRCA1-deficiency sensitizes cells to EZH2-inhibitor DZNep but not to TSATo better quantify the difference in sensitivity to DZNep between KB1P and KP cells, we performed a dose response curve (Figure 4A). Strikingly, the average IC50 for BRCA1-deficient cells is 163 nM, whereas an almost 19-fold higher dose is required for 50% growth inhibition in BRCA1-proficient cells (average IC50 of 2944 nM, p<0.0001, t-test; Table 1). To exclude the possibility that KB1P cells are in general more sensitive to epigenetic inhibitors we tested the effect of the histone deacetylase-inhibitor Trichostatin A (TSA) in the same growth inhibition assay (Figure 4B). TSA affected KB1P and KP cell lines to a similar extend (average IC50 of 26 nM vs 29 nM) showing no significant difference (p=0.5; t-test, Table 1). When the cell lines were grown under non-adherent conditions, DZNep also inhibited sphere-formation, suggesting that there is no subpopulation of BRCA1-deficient cells that is resistant to DZNep treatment (Figure S1). However, in vivo experiments should demonstrate whether targeting EZH2 inhibits all tumor-initiating potential.

Chapter 3

3

58

Figure 3. EZH2 is required for survival of BRCA1-deficient but not BRCA1-proficient tumors cells. A. Ezh2 mRNA expression measured by qRT-PCR in BRCA1-deficient cells (in red, KB1P) and in BRCA1-proficient cells (in blue, KP) after treatment with siRNAs against Ezh2 or 5µM DZNep (shown as fold induction relative to Hprt). B. EZH2 levels analysed by Western blot after KB1P and KP cells were treated with siRNAs targeting Ezh2 or non-targeting siRNAs (siNTC) and 5 µM DZNep or vehicle (DMSO) for the indicated period. C. Phase contrast images of BRCA1-deficient and -proficient cells treated for 48 hours with control (ctrl) siRNAs, siRNAs against Ezh2 or 5 µM DZNep (original magnification 10x). D. Growth curves of KB1P (depicted in red) and KP cell lines (depicted in blue) treated with control (ctrl) siRNAs, siRNAs against Ezh2 or 5 µM DZNep. Data measured by Cell Titer Blue and represented as the mean±S.E.M. (three independent experiments). The depicted cell lines are representative for all three KB1P and KP cell lines.

Figure 4. Chemical EZH2-inhibitor DZNep selectively kills BRCA1-deficient tumor cells. A. Representative growth inhibition curves for BRCA1-deficient cell lines (KB1P, in blue) and BRCA1-proficient cell lines (KP, in red) treated with DZNep. A serial dilution of DZNep was added to the cells and cell viability was measured 5 days later (each data point represents the mean±S.E.M. of three independent experiments). B. Representative growth inhibition curves for BRCA1-deficient cell lines (KB1P, in blue) and BRCA1-proficient cell lines (KP, in red) treated with TSA. A serial dilution of TSA was added to the cells and cell viability was measured 5 days later (mean±S.E.M.).

A B

C D

A B


3

59

Reconstitution of BRCA1 partially restores resistance to DZNepSince loss of BRCA1 function results in genomic instability, we wanted to establish whether the dependence on EZH2 is a direct consequence of Brca1 loss, or whether this is a secondary effect caused by mutations accumulated during the tumorigenic process. To test this, we re-introduced a BAC clone encompassing the complete human BRCA1 gene into a BRCA1-deficient cell line (KB1P-3.12) and derived several clones that were shown to re-express BRCA1 (Figure 5A). These cells became less sensitive to cisplatin treatment indicating that the introduced BRCA1 is functional (data not shown). Of note, we did not observe a decrease in EZH2 levels in the reconstituted cell lines, indicating that BRCA1 does not directly influence Ezh2 expression (Figure 5B). However, treatment with DZNep reduces EZH2 levels to a similar extent in all cell lines (Figure 5D, Figure 3B and data not shown). Interestingly, when the reconstituted cell lines were treated with DZNep, we observed a substantial rescue from DZNep-induced cell death (Figure 5C). The IC50 values for DZNep in the BRCA1-reconstituted cells lines were more similar to the IC50 values of the KP cells, than those of KB1P cells (average IC50 of 1391 nM, Table 2). This shows that sensitivity of BRCA1-deficient cells to DZNep is mainly due to a loss of BRCA1 function, and not due to secondary mutations. This also indicates that there is a synthetic lethal effect; the effect of targeting one gene (e.g. EZH2) becomes deleterious specifically in the absence of another gene (e.g. BRCA1) (Fong et al., 2009). Even though the reconstituted cells become over 8-times more resistant to DZNep, the rescue is not complete. This could be due to differences in mouse and human BRCA1 or to technical issues with achieving the correct amount of BRCA1 expression. Alternatively, additional mutations could play a minor role in the sensitivity to DZNep. In summary, we have demonstrated that DZNep selectively inhibits BRCA1-deficient- but not BRCA1-proficient mammary tumor cells, and that this effect is mainly due to the fact that BRCA1-deficient cells are dependent on EZH2, whereas BRCA1-proficient cells are not.

Table 1. IC50 Values of DZNep and TSA on BRCA1-proficient vs. BRCA1-deficient mammary tumor cells

Cell line nM DZNep (S.E.M) nM TSA (S.E.M)

BRCA1-proficient

KP-3.33 3202 (284) 27 (1.2)

KP-6.3 3467 (277) 35 (1.5)

KP-7.7 2163 (63) 25 (3.8)

BRCA1-deficient

KB1P-3.12 154 (14) 26 (2.4)

KB1P-30.3 163 (13) 17 (0.6)

KB1P-40.1 171 (9) 36 (3.4)

Ratio (KP/KB1P) 18.1* 1.1

Significance <0.0001 0.5

Note: Values between brackets represent s.e.m. of at least three independent experiments. Ratio: Average IC50 values of DNZep and TSA for the KP lines were compared to average IC50 values of the KB1P lines. *Significance: p<0.01 (t-test)

Chapter 3

3

60

Figure 5. Restoration of BRCA1 partially rescues from sensitivity to DZNep. A. Detection of the human BRCA1 allele by PCR amplification of exon 11 in the reconstituted subclones KB1PR-3.12 E3 and F4. The human breast cancer cell line T47D was used as a positive control. B. EZH2 protein levels of (untreated) KB1P, KB1PR and KP cell lines were analysed by Western blotting. Corresponding Ezh2 mRNA levels of KB1P, KB1PR and KP cell lines were measured by qRT-PCR (shown as fold induction relative to Hprt). C. Representative growth inhibition curves for BRCA1-deficient cell lines (KB1P, in blue), BRCA1-proficient cell lines (KP, in red) and two clones of a BRCA1-reconstituted cell line (KB1PR E3 and F4, in purple) treated with DZNep. A serial dilution of DZNep was added to the cells and cell viability was measured 5 days later (mean±S.E.M.). D. EZH2 protein levels of hBRCA1-reconstituted KB1P cells 48 hours after treatment with DZNep or siRNAs targeting EZH2.

Table 2. IC50 Values of DZNep on BRCA1-deficient vs. BRCA1-reconstituted mammary tumor cells

Cell line nM DZNep (S.E.M.)

BRCA1-proficient

KP-6.3 3523 (463)

BRCA1-reconstituted

KB1PR-3.12 E3 1954 (744)

KB1PR-3.12 F4 829 (331)

BRCA1-deficient

KB1P-3.12 135 (13)

KB1P40.1 187 (33)

Ratio (BRCA1-reconst. vs. deficient) 8.7*

Significance 0.003

Note: Values between brackets represent s.e.m. of at least three independent experiments. Ratio: Average IC50 values of DNZep for the KB1PR lines were compared to average IC50 values of the KB1P lines. *Significance: p<0.01 (t-test)

A

B

C

D


3

61

Discussion

Breast tumors in BRCA1-mutation carriers arise early in life and exhibit an aggressive, basal-like phenotype associated with poor overall survival. More insight into the molecular make-up of this breast cancer subtype will contribute to the development of more effective therapies. In this study, we demonstrate that EZH2 expression is high in breast tumors from BRCA1-mutation carriers, similar to what we observe in our mouse model for BRCA1-deficient breast cancer. Moreover, the knockdown experiments show that BRCA1-deficient mammary tumor cells are dependent on EZH2 for their survival. Interestingly, even though EZH2 levels were reduced to a similar level in the BRCA1-proficient control cells as well, these cells seem much less affected by EZH2 loss. This indicates that targeting EZH2 is synthetic lethal in combination with BRCA1-deficiency. Conceivably, the dependence on high EZH2 levels derives from a selective advantage during the in vivo tumorigenesis process that occurs only in BRCA1-deficient and not BRCA1-proficient cells. The observation that restoration of BRCA1 does not reduce EZH2 levels suggests that the increased expression is caused by more permanent changes. However, such mutations or epigenetic alterations do not necessarily have to target Ezh2 directly, but could occur in upstream regulators of EZH2 as well. Note that selection for Ezh2 overexpression may occur in other breast tumors, as evident from some of the primary BRCA1-proficient mouse tumors in figure 1a. The central question of this study was whether overexpression of EZH2 is required for the survival of breast tumor cells or whether this is a byproduct of the tumorigenic process, and our data suggest that whereas BRCA1-deficient cells remain dependent on their EZH2 expression, loss of EZH2 is much better tolerated in cells with intact BRCA1. Now that we have established the functional importance of EZH2 expression in BRCA1-deficient cells, it would be interesting to understand why these tumors are selectively dependent on EZH2, and whether this dependence is specific to loss of BRCA1 function, or more related to the basal-like characteristics of these tumors. There could be several, not mutually exclusive, reasons for selection of Ezh2 overexpression during tumorigenesis. With regards to a specific role of BRCA1-deficiency, there could be an effect of EZH2 on DNA repair. It has been reported that EZH2 overexpression represses genes of the Rad51 family (Zeidler et al., 2005), which may attenuate DNA damage signalling in BRCA1-deficient cells. This would suggest that EZH2 overexpression could play a similar role in BRCA2-deficient tumors that are subject to the same impairment in homology-directed DSB repair as BRCA1-deficient tumors. However, we did not observe increased EZH2 expression in breast tumors from BRCA2-mutation carriers (data not shown), suggesting that the main oncogenic role of EZH2 is not linked to DNA repair. Another possible explanation for the selective overexpression of EZH2 in BRCA1-deficient breast tumors could involve a role of EZH2 in the cell of origin. Specifically, the absence of BRCA1 has been associated with characteristics of stem cells and loss of BRCA1 is incompatible with luminal differentiation (Liu et al., 2008). EZH2 is required for the maintenance of embryonic and adult stem cells, is expressed in a relatively small number of cells in the mammary gland, and is only overexpressed in breast tumors with an undifferentiated phenotype (O’Carroll et al., 2001; Raaphorst et al., 2003; Pietersen et al., 2008). In addition, a large subset of genes silenced by EZH2 includes transcription factors that orchestrate lineage-specific differentiation (Bracken et al., 2006; Lee et al., 2006). Therefore, it could

Chapter 3

3

62

be envisaged that overexpression of EZH2 is required to maintain the undifferentiated state of the transformed cell. Reducing EZH2 levels by DZNep or siRNAs might result in the expression of genes that induce differentiation, a fate potentially incompatible with absence of BRCA1. However, overexpression of EZH2 does not seem to cause hyperrepression of typical PcG-target genes (Bracken et al., 2007; Pietersen et al., 2008), suggesting that it has consequences distinct from silencing its normal target genes. Several groups have indeed found evidence for genes marked by PcG proteins specifically in tumor cells (Ohm et al., 2007; Tan et al., 2007). It remains to be established, however, whether silencing of these genes is responsible for the selective advantage of EZH2 overexpression in BRCA1-deficient tumor cells, and whether these genes include more classical tumor-suppressors or specific differentiation factors. The model for a specific function of EZH2 in more undifferentiated, basal-like cells is consistent with the observation that our KB1P tumors are indeed more basal than the KP control tumors (Liu et al., 2007b). This raises the question whether not only BRCA1-deficient breast tumors but also sporadic basal-like tumors would be dependent on EZH2 overexpression. Our observation that restoration of BRCA1 function negates the sensitivity of tumor cells to DZNep would argue against this. However, even though BRCA1 mutations in sporadic cancer are rare, there are indications that a significant proportion of sporadic breast tumors share traits with BRCA1-deficient tumors, a feature termed BRCAness (Turner et al., 2004). Alterations in genes functioning in the same biochemical pathways as BRCA1 could effectively result in loss of BRCA1 function (Turner and Reis-Filho, 2006). Sporadic basal-like tumors that exhibit this feature may be specifically sensitive to EZH2 inhibition. Recently, Gonzalez et al (Gonzalez et al., 2009) showed that knockdown of EZH2 reduced the proliferation of two ER-negative human breast cancer cell lines. Intriguingly, this effect seemed partly due to an upregulation of BRCA1 protein levels. This is in disagreement with our data which show that cells without BRCA1 are particularly sensitive to EZH2 reduction, suggesting that repression of Brca1 is not the main oncogenic function of EZH2. Moreover, breast tumors in BRCA1-mutation carriers show invariably loss of the other BRCA1 allele, indicating that selection for loss of BRCA1 expression is not achieved by high levels of EZH2. However, the observation that these two basal-like breast cancer cell lines are also sensitive to EZH2 inhibition, and the repeated observation that EZH2 overexpression characterizes basal-like breast tumors, warrants the further investigation of EZH2 as a druggable target. Unfortunately, our preliminary in vivo studies with DZNep revealed substantial toxicity in mice (data not shown). We are currently investigating whether this is due to a dependence of certain normal cell types on EZH2 expression, or whether this is due to chemical properties of DZNep. The former would complicate EZH2 inhibition as therapeutic strategy in breast cancer, whereas the latter may be resolved by using other EZH2 inhibitors or DZNep-analogs, which are currently being developed. In addition, even though DZNep inhibits sphere-formation of BRCA1-deficient tumor cells and considering the role of EZH2 in stem cells and cancer (Ben-Porath et al., 2008), in vivo studies will be required to determine whether targeting of EZH2 by itself or in combination with other treatments can result in complete eradication of the tumor.


3

63

Conclusions

The preclinical studies and clinical trials with combinations of platinum drugs and PARP inhibitors against BRCA1-mutated breast cancers constitute one example of how insight in the genetic make-up of a tumor subtype can provide a targeted and possibly more effective treatment (Rottenberg et al., 2008; Fong et al., 2009). Our data show that BRCA1-deficient tumor cells are selectively dependent on EZH2 expression, and suggest that pharmacological disruption of EZH2 could provide another individualized approach for the treatment of BRCA1-mutated breast cancers, and possibly also for sporadic basal-like breast tumors.

Authors’ contributions

AP initiated the study, conceived the design together with MvL and JJ, and wrote the manuscript together with JP. JP participated in the design and performed most of the experiments and data analysis. RD performed the experiments with the reconstituted cell lines she created, XL provided the panel of cell lines and micro-array data, BE advised on the set-up and analysis of the IC50 studies, PC performed Western Blots and qPCRs, PN provided human tumor samples and SA participated in the immunohistochemical analysis of those samples. QY provided the DZNep, MvL and JJ gave expert advice throughout the study and all authors read and approved the final manuscript.

Acknowledgements

The authors acknowledge Anke Sparmann and Mathijs Voorhoeve for critical reading of the manuscript and Joep Vissers for helpful discussions. We thank Haydn Prosser for providing the pgk/EM7 Neo/KanR-positive selection cassette (pCEI1). The E. coli SW102 strain was a gift from Neal Copeland and Nancy Jenkins. We thank Peter Bouwman and Hanneke van der Gulden for providing the modified RP11-812O5 BAC. Funding of the authors was as follows: JP (Roland-Ernst Foundation scholarship), RD, XL, BE and JJ (Dutch Cancer Society, NKI 2007-3772), SA (Dutch Cancer Society, NKI 2007-3749), PC, AP and MvL (Dutch Cancer Society, NKI 2007-3803 and Centre for Biomedical Genetics), PN (NKI/AvL) and QY (A*STAR). None of the funding bodies had any say in the study design; in the collection, analysis, and interpretation of data; in the writing of the manuscript; or in the decision to submit the manuscript for publication.

References

Bachmann, I.M., Halvorsen, O.J., Collett, K., Stefansson, I.M., Straume, O., Haukaas, S.A., Salvesen, H.B., Otte, A.P., and Akslen, L.A. (2006). EZH2 expression is associated with high proliferation rate and aggressive tumor subgroups in cutaneous melanoma and cancers of the endometrium, prostate, and breast. J. Clin. Oncol. 24, 268–273.

Ben-Porath, I., Thomson, M.W., Carey, V.J., Ge, R., Bell, G.W., Regev, A., and Weinberg, R.A. (2008). An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat. Genet. 40, 499–507.

Bracken, A.P., Dietrich, N., Pasini, D., Hansen, K.H., and Helin, K. (2006). Genome-wide mapping of Polycomb

Chapter 3

3

64

target genes unravels their roles in cell fate transitions. Genes Dev. 20, 1123–1136.

Bracken, A.P., Kleine-Kohlbrecher, D., Dietrich, N., Pasini, D., Gargiulo, G., Beekman, C., Theilgaard-Mönch, K., Minucci, S., Porse, B.T., Marine, J.-C., et al. (2007). The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells. Genes Dev. 21, 525–530.

Bracken, A.P., Pasini, D., Capra, M., Prosperini, E., Colli, E., and Helin, K. (2003). EZH2 is downstream of the pRB-E2F pathway, essential for proliferation and amplified in cancer. Embo J. 22, 5323–5335.

Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., Jones, R.S., and Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 298, 1039–1043.

Chandler, J., Hohenstein, P., Swing, D.A., Tessarollo, L., and Sharan, S.K. (2001). Human BRCA1 gene rescues the embryonic lethality of Brca1 mutant mice. Genesis 29, 72–77.

Chappuis, P.O., Nethercot, V., and Foulkes, W.D. (2000). Clinico-pathological characteristics of BRCA1- and BRCA2-related breast cancer. Semin Surg Oncol 18, 287–295.

Collett, K., Eide, G.E., Arnes, J., Stefansson, I.M., Eide, J., Braaten, A., Aas, T., Otte, A.P., and Akslen, L.A. (2006). Expression of enhancer of zeste homologue 2 is significantly associated with increased tumor cell proliferation and is a marker of aggressive breast cancer. Clin. Cancer Res. 12, 1168–1174.


Gonzalez, M.E., Li, X., Toy, K., DuPrie, M., Ventura, A.C., Banerjee, M., Ljungman, M., Merajver, S.D., and Kleer, C.G. (2009). Downregulation of EZH2 decreases growth of estrogen receptor-negative invasive breast carcinoma and requires BRCA1. Oncogene 28, 843–853.



Honeth, G., Bendahl, P.-O., Ringnér, M., Saal, L.H., Gruvberger-Saal, S.K., Lövgren, K., Grabau, D., Fernö, M., Borg, A., and Hegardt, C. (2008). The CD44+/CD24- phenotype is enriched in basal-like breast tumors. Breast Cancer Res. 10, R53.

Hu, Z., Fan, C., Oh, D.S., Marron, J.S., He, X., Qaqish, B.F., Livasy, C., Carey, L.A., Reynolds, E., Dressler, L., et al. (2006). The molecular portraits of breast tumors are conserved across microarray platforms. BMC Genomics 7, 96.

Jonkers, J., Meuwissen, R., van der Gulden, H., Peterse, H., van der Valk, M., and Berns, A. (2001). Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat. Genet. 29, 418–425.

Kleer, C.G., Cao, Q., Varambally, S., Shen, R., Ota, I., Tomlins, S.A., Ghosh, D., Sewalt, R.G.A.B., Otte, A.P., Hayes, D.F., et al. (2003). EZH2 is a marker of aggressive breast cancer and promotes neoplastic transformation of breast epithelial cells. Proc. Natl. Acad. Sci. U.S.A. 100, 11606–11611.

Lee, T.I., Jenner, R.G., Boyer, L.A., Guenther, M.G., Levine, S.S., Kumar, R.M., Chevalier, B., Johnstone, S.E., Cole, M.F., Isono, K., et al. (2006). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301–313.

Linn, S.C., and Jonkers, J. (2007). Treating the genetic make-up of breast cancer: a new fashion? Expert Rev


3

65

Anticancer Ther 7, 1065–1067.

Liu, J.C., Deng, T., Lehal, R.S., Kim, J., and Zacksenhaus, E. (2007a). Identification of tumorsphere- and tumor-initiating cells in HER2/Neu-induced mammary tumors. Cancer Res. 67, 8671–8681.

Liu, S., Ginestier, C., Charafe-Jauffret, E., Foco, H., Kleer, C.G., Merajver, S.D., Dontu, G., and Wicha, M.S. (2008). BRCA1 regulates human mammary stem/progenitor cell fate. Proc. Natl. Acad. Sci. U.S.A. 105, 1680–1685.

Liu, X., Holstege, H., van der Gulden, H., Treur-Mulder, M., Zevenhoven, J., Velds, A., Kerkhoven, R.M., van Vliet, M.H., Wessels, L.F.A., Peterse, J.L., et al. (2007b). Somatic loss of BRCA1 and p53 in mice induces mammary tumors with features of human BRCA1-mutated basal-like breast cancer. Proc. Natl. Acad. Sci. U.S.A. 104, 12111–12116.


O’Carroll, D., Erhardt, S., Pagani, M., Barton, S.C., Surani, M.A., and Jenuwein, T. (2001). The polycomb-group gene Ezh2 is required for early mouse development. Mol. Cell. Biol. 21, 4330–4336.

Ohm, J.E., McGarvey, K.M., Yu, X., Cheng, L., Schuebel, K.E., Cope, L., Mohammad, H.P., Chen, W., Daniel, V.C., Yu, W., et al. (2007). A stem cell-like chromatin pattern may predispose tumor suppressor genes to DNA hypermethylation and heritable silencing. Nat. Genet. 39, 237–242.

Perou, C.M., Sørlie, T., Eisen, M.B., van de Rijn, M., Jeffrey, S.S., Rees, C.A., Pollack, J.R., Ross, D.T., Johnsen, H., Akslen, L.A., et al. (2000). Molecular portraits of human breast tumours. Nature 406, 747–752.

Pietersen, A.M., Horlings, H.M., Hauptmann, M., Langerød, A., Ajouaou, A., Cornelissen-Steijger, P., Wessels, L.F., Jonkers, J., van de Vijver, M.J., and van Lohuizen, M. (2008). EZH2 and BMI1 inversely correlate with prognosis and TP53 mutation in breast cancer. Breast Cancer Res. 10, R109.

Pietersen, A.M., and van Lohuizen, M. (2008). Stem cell regulation by polycomb repressors: postponing commitment. Curr. Opin. Cell Biol. 20, 201–207.

Prosser, H.M., Rzadzinska, A.K., Steel, K.P., and Bradley, A. (2008). Mosaic complementation demonstrates a regulatory role for myosin VIIa in actin dynamics of stereocilia. Mol. Cell. Biol. 28, 1702–1712.

Raaphorst, F.M., Meijer, C.J.L.M., Fieret, E., Blokzijl, T., Mommers, E., Buerger, H., Packeisen, J., Sewalt, R.A.B., Otte, A.P., and van Diest, P.J. (2003). Poorly differentiated breast carcinoma is associated with increased expression of the human polycomb group EZH2 gene. Neoplasia 5, 481–488.

Rottenberg, S., Jaspers, J.E., Kersbergen, A., van der Burg, E., Nygren, A.O.H., Zander, S.A.L., Derksen, P.W.B., de Bruin, M., Zevenhoven, J., Lau, A., et al. (2008). High sensitivity of BRCA1-deficient mammary tumors to the PARP inhibitor AZD2281 alone and in combination with platinum drugs. Proc. Natl. Acad. Sci. U.S.A. 105, 17079–17084.

Sarrió, D., Rodriguez-Pinilla, S.M., Hardisson, D., Cano, A., Moreno-Bueno, G., and Palacios, J. (2008). Epithelial-mesenchymal transition in breast cancer relates to the basal-like phenotype. Cancer Res. 68, 989–997.

Silver, D.P., Dimitrov, S.D., Feunteun, J., Gelman, R., Drapkin, R., Lu, S.D., Shestakova, E., Velmurugan, S., Denunzio, N., Dragomir, S., et al. (2007). Further evidence for BRCA1 communication with the inactive X chromosome. Cell 128, 991–1002.

Sorlie, T., Tibshirani, R., Parker, J., Hastie, T., Marron, J.S., Nobel, A., Deng, S., Johnsen, H., Pesich, R., Geisler, S., et al. (2003). Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acad Sci U S A 100, 8418–8423.

Sparmann, A., and van Lohuizen, M. (2006). Polycomb silencers control cell fate, development and cancer. Nat. Rev. Cancer 6, 846–856.

Chapter 3

3

66

Tan, J., Yang, X., Zhuang, L., Jiang, X., Chen, W., Lee, P.L., Karuturi, R.K.M., Tan, P.B.O., Liu, E.T., and Yu, Q. (2007). Pharmacologic disruption of Polycomb-repressive complex 2-mediated gene repression selectively induces apoptosis in cancer cells. Genes Dev. 21, 1050–1063.

Turner, N., Tutt, A., and Ashworth, A. (2004). Hallmarks of “BRCAness” in sporadic cancers. Nat. Rev. Cancer 4, 814–819.

Turner, N.C., and Reis-Filho, J.S. (2006). Basal-like breast cancer and the BRCA1 phenotype. Oncogene 25, 5846–5853.

van ’t Veer, L.J., Dai, H., van de Vijver, M.J., He, Y.D., Hart, A.A.M., Mao, M., Peterse, H.L., van der Kooy, K., Marton, M.J., Witteveen, A.T., et al. (2002). Gene expression profiling predicts clinical outcome of breast cancer. Nature 415, 530–536.

van de Vijver, M.J., He, Y.D., van’t Veer, L.J., Dai, H., Hart, A.A.M., Voskuil, D.W., Schreiber, G.J., Peterse, J.L., Roberts, C., Marton, M.J., et al. (2002). A gene-expression signature as a predictor of survival in breast cancer. N. Engl. J. Med. 347, 1999–2009.

Warming, S., Costantino, N., Court, D.L., Jenkins, N.A., and Copeland, N.G. (2005). Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res. 33, e36.

Zeidler, M., Varambally, S., Cao, Q., Chinnaiyan, A.M., Ferguson, D.O., Merajver, S.D., and Kleer, C.G. (2005). The Polycomb group protein EZH2 impairs DNA repair in breast epithelial cells. Neoplasia 7, 1011–1019.

Ziogas, D., Ignatiadou, E., Roukos, D., and Lykoudis, E. (2008). HER2 and trastuzumab: impact of a new standard agent on local control and surgery for breast cancer. Ann. Surg. Oncol. 15, 3614–3615; author reply 3616.

Zucchi, I., Sanzone, S., Astigiano, S., Pelucchi, P., Scotti, M., Valsecchi, V., Barbieri, O., Bertoli, G., Albertini, A., Reinbold, R.A., et al. (2007). The properties of a mammary gland cancer stem cell. Proc. Natl. Acad. Sci. U.S.A. 104, 10476–10481.


3

67

KB1P-3.12 D

ZNep

(5 µ

M)

DM

SO

KB1P-40.1 KB1P-30.3

KP-6.3 KP-7.7 KP-3.33

KP-3.33 KP-6.3 KP-7.7

Figure S1. DZNep prevents sphere-formation in three independent BRCA1-deficient cell lines. Phase contrast images are shown of KB1P-3.12, 30.3 and 40.1 cells three days after plating in serum-free medium with defined growth factors on ultra-low binding plates in the presence of 5 mM DZNep or DMSO.


Chapter 4 Loss of p53 partially rescues embryonic development of Palb2 knockout mice but does not foster haploinsufficiency of Palb2 in tumour suppression

Peter Bouwman1,5, Rinske Drost1,5, Christiaan Klijn1,3, Mark Pieterse1, Hanneke van der Gulden1, Ji-Ying Song2, Karoly Szuhai4 and Jos Jonkers1

Journal of Pathology 2011 (224):10-21

1 Division of Molecular Biology, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands

2 Division of Experimental Animal Pathology, The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands

3 Delft University of Technology, Delft Bioinformatics Lab, Mekelweg 4, 2628 CD Delft, The Netherlands

4 Department of Molecular Cell Biology, Leiden University Medical Center, Einthovenweg 20, 2333 ZC Leiden, The Netherlands

5These authors contributed equally to this work

Chapter 4

4

70

PALB2 interacts with BRCA1 and BRCA2 in supercomplexes involved in DNA repair via homologous recombination. Heterozygous germline mutations in PALB2 confer a moderate risk of breast cancer while biallelic PALB2 mutations are linked to a severe form of Fanconi anaemia characterized by early childhood solid tumours and severe chromosomal instability. In contrast to BRCA1- or BRCA2-associated cancers, breast tumours in heterozygous PALB2 mutation carriers do not show loss of the wild type allele, suggesting PALB2 might be haploinsufficient for tumour suppression. To study the role of PALB2 in development and tumourigenesis, we have generated Palb2GT mouse mutants using a gene trap approach. Whereas Palb2GT/GT homozygous mutant embryos died at mid-gestation due to massive apoptosis, Palb2GT/+ heterozygous mice were viable and did not show any obvious abnormalities. Deletion of p53 alleviated the phenotype of Palb2GT/GT embryos, but did not rescue embryonic lethality. In addition, loss of p53 did not significantly collaborate with Palb2 heterozygosity in tumourigenesis in heterozygous or homozygous p53 knockout mice. Tumours arising in Palb2GT/+;p53+/– or Palb2GT/+;p53–/– compound mutant mice retained the wild type Palb2 allele and did not display increased genomic instability.

Introduction

PALB2 (‘Partner And Localizer of BRCA2’) was first identified as nuclear interactor of BRCA2. By promoting the nuclear localization and stability of BRCA2, PALB2 is required for proper homologous recombination (HR) and repair of double-strand DNA breaks (Xia et al., 2006). While the C-terminus of PALB2 binds to BRCA2, the N-terminal region was shown to bind to BRCA1, indicating that PALB2 may function as a direct physical link between both BRCA proteins (Sy et al., 2009; Zhang et al., 2009a, 2009b). Both interactions appear to be required for homology-directed DNA repair. Biallelic PALB2 mutations cause Fanconi anaemia (FA), a chromosomal instability disorder with clinical features like bone marrow dysfunction, growth retardation, congenital malformations and an elevated cancer risk (D’Andrea, 2010). Individuals with Fanconi anaemia caused by PALB2 mutations display a rare and severe variant of the disorder, Fanconi anaemia subtype N (FA-N), characterized by early onset of cancer (Reid et al., 2007; Xia et al., 2007). All individuals with FA-N developed tumours in early childhood and died before the age of four (Reid et al., 2007). FA-N is clinically similar to Fanconi anaemia subtype D1 (FA-D1), which is caused by biallelic BRCA2 mutations, and characterized by childhood cancers like Wilms’ tumour and medulloblastoma (Howlett et al., 2002; Alter et al., 2007). Since PALB2 was shown to interact with BRCA2 and to function in the DNA damage response (DDR) (Xia et al., 2006), Rahman and co-workers investigated whether PALB2 mutations also confer susceptibility to breast cancer. Monoallelic PALB2 mutations were identified in breast cancer patients from breast cancer families that were negative for mutations in either BRCA1 or BRCA2. Mutations in PALB2 conferred a 2.3-fold elevated breast cancer risk (Rahman et al., 2007), highlighting PALB2 as a novel breast cancer susceptibility gene. Heterozygous PALB2 germline mutations confer a moderate increased risk of cancer, similar to CHEK2, ATM and BRIP1 mutations (Walsh and King, 2007). Truncating mutations of PALB2 have also been linked to hereditary pancreatic cancer (Jones et al., 2009). Intriguingly, in the PALB2-associated breast tumours that have been studied in more detail, no loss of the wild type allele was found (Erkko et al., 2007; Tischkowitz et

Genetic interaction between Palb2 and p53 in mouse mutants

4

71

al., 2007). These data suggest that PALB2 may function as a haploinsufficient tumour suppressor. Although heterogenic loss of wild-type BRCA1 or BRCA2 alleles has been observed in BRCA-associated breast cancers (King et al., 2007), there was little evidence for haploinsufficiency of BRCA1 or BRCA2 in mammary tumour suppression in mice. Recently however, Brca2 heterozygosity was shown to promote KrasG12D driven pancreatic cancer development in mice (Skoulidis et al., 2010), suggesting context dependency of gene dosage effects. To study the function of PALB2 in development and tumourigenesis, we have generated Palb2 knockout mice using a gene trap approach. We show that homozygous null mutants die during embryonic development due to increased apoptosis. The Palb2 knockout phenotype was alleviated on a p53 deficient background but there was no rescue from apoptosis and in utero lethality. Since Palb2 heterozygous mice showed no spontaneous tumour phenotype they were crossed with p53 knockout mice to analyze possible haploinsufficiency of PALB2 in tumourigenesis. However, Palb2 heterozygosity did not significantly affect onset or genomic instability of tumours in p53 homozygous or heterozygous knockout mice.

Materials and Methods

Generation of Palb2GT mutant miceMouse embryonic stem (ES) cells containing a gene trap in the Palb2 locus (clone CG0691) were obtained from the Sanger Institute Gene Trap Resource. ES cells were cultured in 1xGMEM medium (Invitrogen) supplemented with sodium pyruvate (100mM), non-essential amino acids, 10% fetal calf serum (FCS; Invitrogen), leukaemia inhibitory factor (LIF; 103 u/ml; Millipore) and 0.1mM β-mercaptoethanol (Merck). ES cells were checked for integration of the gene trap in the Palb2 locus by RT-PCR, subcloned and injected into C57Bl/6 blastocysts. Chimeric mice were obtained and subsequently bred with FVB females to achieve germline transmission. All animal experiments were approved by the local ethical review committee.

Mouse breedingPalb2GT+/– mice (129/FVB) were crossed to Actb-Flpe+/– mice (C57BL/6) (Rodriguez et al., 2000) to check whether the phenotype of homozygous Palb2GT mice was reversible. Actb-Flpe+/–;Palb2GT/GTrev mice were bred with Palb2GT/+ mice to generate Palb2GTrev/GTrev or Palb2GT/GTrev mice. All other studies were performed on a mixed 129/FVB genetic background. Palb2GT/+ mice were crossed to p53+/– mice (Jonkers et al., 2001) to see whether the phenotype of Palb2GT homozygotes would be alleviated by a p53 deficient background. Palb2GT/+; p53+/– mice were intercrossed to analyze the phenotype of p53 deficient Palb2GT/GT mice. Palb2GT/+ mice were bred with Brca2+/– mice (Jonkers et al., 2001) to generate Palb2GT/+;Brca2+/– mice. Weight and overall appearance of these compound heterozygous mice was compared to littermate controls. Palb2GT/+; Brca2+/– animals were monitored for tumour development over a period of more than 17 months. Littermate Palb2GT/+; p53+/– and Palb2GT/+; p53-/– mice were used for the tumour watch to eliminate possible effects of genetic background.

Isolation of mouse embryos Timed matings were performed between Palb2GT/+ male and female mice. The impregnated females were sacrificed at various time points after conception and uteri were isolated

Chapter 4

4

72

in ice-cold PBS. The embryos were isolated by removing the muscular wall of the uterus, Reichert’s membrane and visceral yolk sac. Embryos were fixed overnight in 4% paraformaldehyde at 4°C and stored in 70% ethanol. For histological analysis embryos were further dehydrated and embedded in paraffin. 4mm thick sections were cut and stained with haematoxylin and eosin or used for immunohistochemistry.

ImmunohistochemistryFixed sections were rehydrated and stained with primary antibodies. Endogenous peroxidases were blocked with 3% H2O2 and stained with biotin-conjugated secondary antibodies, followed by incubation with StreptABComplex (Dakocytomation). Substrate was developed with DAB (Dakocytomation). TUNEL staining was performed according to the manufacturer’s instructions (ApopTag peroxidase in situ apoptosis detection kit, Chemicon). The following primary antibodies were used: rat anti-ki67 (1:50; Dakocytomation), mouse anti-PCNA (1:40; Alexis) and rabbit anti-caspase-3 (1:200; Cell Signaling). The following (biotinylated) secondary antibodies were used: rabbit-anti-rat (1:400; Dakocytomation), goat-anti-mouse (1:600;Dakocytomation) and goat-anti-rabbit (1:800; Dakocytomation).

GenotypingFor DNA isolation for routine genotyping, mouse tail samples or yolk sacs were lysed in DirectPCR lysis reagent (Viagen) supplemented with 100mg/ml proteinase K (Sigma Aldrich). In order to locate the exact integration of the gene trap insertion, overlapping PCR amplicons compatible with a gene trap-specific primer were designed in intron 1 of Palb2. The product of Palb2 intron 1 primer 5’–atggaagagctttccggga–3’ in combination with the gene trap primer 5’-tgctatacgaagttatcgatgcg-3’ was sequenced to determine the integration site. Subsequently, the following genotyping primers were designed: Palb2-intron1-fwd (5’–ccagcagaaaagaaggacc–3’; primer 1), Palb2-intron1-rev (5'–gttcccttagcagaagtgc–3'; primer 2) and pGT0lxr-En2-intron1-rev (5'–gagcaccagaggacatcc–3'; primer 3). Primers 1 and 2 detect the wild type Palb2 allele (361 bp product) and primers 1 and 3 detect the trapped Palb2GT allele (530 bp product).

Southern blot analysisGenomic DNA was isolated from tissue by proteinase K lysis and organic extraction with phenol-chloroform. Southern blot analysis was performed using 10mg genomic DNA, digested with the appropriate restriction enzymes to determine the status of Palb2. Southern blotting and hybridization were performed as described previously (Jonkers et al., 2001). The Palb2 intron 1 probe was generated and radioactively labelled by PCR amplification of a 257 bp fragment using primers Palb2-int1-fwd (5’–agcacttttgtgggactccagc–3’) and Palb2-int1-rev (5’–tggcagcatcctggaggaac–3’).

RNA analysisRNA from ES cells and mouse tissues was isolated using Trizol (Invitrogen). RNA from PFA fixed embryos was isolated using the High Pure RNA Paraffin Kit (Roche). cDNA was synthesized using random hexamer primers and cloned AMV reverse transcriptase (Invitrogen). RT-PCR on Palb2 and the Palb2GT allele was performed using the following primers: Palb2-exon1-fwd (5’–atggaagagctttccggga–3’; primer 1), Palb2-exon4-rev (5’–ctccagtctcctcatccag–3’; primer 2), Palb2-exon5-fwd (5’–ccaagcaacacctctacct–3’; primer


4

73

3) and Palb2-exon7-rev (5’–ctctgcagtgggagaaagt–3’; primer 4). Primer 1 and 2 produce a product of 268 bp; primer 5 and 7 produce a product of 309 bp. To control for input material, expression of the housekeeping gene Hprt was determined using primers Hprt-fwd (5’–ctggtgaaaaggacctctcg–3’) and Hprt-rev (5’–tgaagtactcattatagtcaag-3’). These primers produce a product of 109 bp.

Analysis of thymic lymphomasMaterials and methods used to analyze thymic lymphomas are described in the Supplemental information.

Results

No obvious abnormalities in heterozygous Palb2GT miceTo study the in vivo functions of Palb2, we used a mouse ES cell line from the Sanger Institute Gene Trap Resource carrying a gene trap insertion in intron 1 of Palb2 (Figure 1A). Insertion of the gene trap at this position is predicted to result in a fusion of exon 1 and βgeo, thereby disrupting transcription of Palb2. This was confirmed by RT-PCR (Figure 1D). To obtain Palb2GT mice, we subcloned the Palb2GT ES cell line and generated chimeric mice by blastocyst injection. Upon germline transmission of the Palb2GT allele, we tested the viability of homozygous Palb2GT mutants by intercrossing heterozygous mice and genotyping their offspring. Heterozygous Palb2GT mice were viable and born at the expected Mendelian ratio (Table 1A). Based on appearance and breeding capacity, these mice were indistinguishable from their wild type littermates. Cohorts of Palb2GT heterozygous mice and wild type littermates have now been monitored for more than 17 months for spontaneous tumour development (Supplemental information, Supplementary Figure 2). So far, we did not find any tumour or other abnormalities which could be linked to Palb2GT heterozygosity.

Palb2GT/GT embryos die at mid-gestationThe intercrosses between heterozygous Palb2GT/+ animals did not yield any homozygous Palb2GT/GT offspring (Table 1A), indicating in utero lethality due to loss of PALB2 expression. To rule out embryonic lethality due to mutations linked to the Palb2GT allele, we made use of the possibility to remove the FRT-flanked βgeo cassette of the gene trap by Flp recombinase (Figure 1A). This post-insertional modification of the trapped locus should restore Palb2 expression. We crossed Palb2GT/+ animals with the Actb-Flpe deleter strain (Rodriguez et al., 2000) to generate Actb-Flpe+/–;Palb2GTrev/+ mice. These mice were subsequently crossed to Palb2GT/+ mice to obtain Actb-Flpe+/–;Palb2GTrev/GTrev and Palb2GT/GTrev mice (Table 1B). Actb-Flpe+/–;Palb2GTrev/GTrev and Palb2GT/GTrev mice were viable, showing that the embryonic lethal phenotype of Palb2GT/GT mice was indeed caused by PALB2 deficiency. PALB2 is known to be essential for BRCA2 stability and function and Brca2 knockout mice die at mid-gestation (Ludwig et al., 1997; Sharan et al., 1997; Suzuki et al., 1997; Bennett et al., 2000; Jonkers et al., 2001). To analyze the in utero phenotype of Palb2GT/GT mutants, we examined embryos from Palb2GT/+ intercrosses at several time points between gestation day 7.5 (E7.5) and E12.5 (Figure 2A-B and Table 1A). Between E7.5 and E9.5, Palb2GT/GT embryos were developmentally retarded but still present at the expected Mendelian frequency. However at E12.5, Palb2GT/GT embryos were no longer present, indicating that Palb2GT/GT embryos died between E9.5 and E12.5 (Table 1A).

Chapter 4

4

74

Increased apoptosis in Palb2GT/GT embryosThe retarded growth and development of the Palb2GT/GT embryos suggests defects in proliferation and/or increased apoptosis. We therefore analyzed expression of the proliferation markers ki67 and PCNA in E7.5–E9.5 embryos from Palb2GT/+ intercrosses by immunohistochemistry. Because of the developmental retardation of mutant embryos, E8.5 Palb2GT/GT embryos were compared to both E7.5 and E8.5 Palb2GT/+ and Palb2+/+ embryos. Expression of ki67 and PCNA was similar in E8.5 Palb2GT/GT embryos and E7.5 control littermates, indicating active cycling of most cells (Figure 2C, Supplemental information, Supplementary Figure 1A and data not shown). TUNEL and cleaved caspase-3 staining was used to check for DNA damage or apoptosis in the embryos. Palb2GT/GT embryos were strongly positive for both markers, and most of the positive cells contained pyknotic nuclei, indicating that PALB2 deficiency led to increased apoptosis in developing embryos (Figure 2D, Supplemental information, Supplementary Figure 1B and data not shown).

No genetic interaction between Palb2 and Brca2 in development and tumourigenesisPALB2 has been described to promote nuclear localization and stability of BRCA2 (Xia et al., 2006). It was suggested that the impact of PALB2 mutations on tumourigenesis is mainly due to impairment of BRCA2 activity. We therefore sought to investigate possible genetic interaction between Palb2 and Brca2 by monitoring spontaneous tumour formation in

Figure 1. Characterization of the Palb2 gene trap allele. A. Schematic representation of the gene trap insertion in intron 1 of the Palb2 gene. F, En2, SA, pA and B indicate the FRT sites, the engrailed 2 sequence and its splice acceptor, the polyadenylation site of the gene trap vector and the BamHI restriction sites. Recombination of the FRT sites takes place upon activity of Flp recombinase. Palb2+, Palb2 wild type allele; Palb2GT, Palb2 gene trap allele; Palb2GTrev, Palb2 gene trap reverted allele. B. PCR genotyping of Palb2+/+, Palb2GT/+ and Palb2GT/GT mice. C. PCR genotyping of Actb-Flpe;Palb2GTrev/+ mice. Left panel: Palb2GT genotyping PCR; right panel: lacZ genotyping PCR. Lanes in left panel are comparable to lanes in right panel. D. RT-PCR of E10.5 Palb2+/+;p53–/–, Palb2GT/+;p53–/– and Palb2GT/GT;p53–/– embryos with two different primer sets. In the left panel primers in Palb2 exons 1 and 4 were used, generating a product of 268 bp. In the middle panel primers in Palb2 exons 5 and 7 were used, resulting in a product of 309 bp. In the left panel Hprt primers were used, generating a product of 109 bp.

A

B DC


4

75

Palb2GT/+;Brca2+/– mice, which were generated by crossing Palb2GT/+ mice to Brca2+/– mice (Jonkers et al., 2001), Palb2GT/+;Brca2+/– mice were viable, fertile and did not show any predisposition to spontaneous tumours or other abnormalities compared to wild type littermates or to Palb2GT/+ or Brca2+/– mice (Supplemental information, Supplementary Figure 2, Supplementary Table 1).

Partial developmental rescue of Palb2GT/GT;p53–/– miceHomozygous Brca1 and Brca2 knockout mutants survive longer and progress further in development when bred onto a p53–/– or p21–/– background (Hakem et al., 1997; Ludwig et al., 1997). To investigate whether embryonic lethality of Palb2GT/GT mutant embryos could also be alleviated by loss of p53, Palb2GT/+ mice were crossed with p53+/– mice (Jonkers et al., 2001) to produce Palb2GT/+;p53+/– mice, which were subsequently intercrossed. Genotyping of the resulting offspring showed that no Palb2GT/GT;p53–/– mice were born, indicating that p53 deficiency did not rescue embryonic lethality of Palb2GT/GT mice (Table 1C). To study whether p53 deficiency would partially rescue in utero development of Palb2 knockout mice, we isolated E8.5–E11.5 embryos from Palb2GT/+;p53+/– intercrosses. Analysis of E10.5 embryos showed that Palb2 mutants indeed developed further in the absence of p53 (Figure 3A). Palb2GT/GT;p53–/– embryos were larger, had completely turned and clearly further developed than Palb2GT/GT;p53+/– littermate controls. Of note, also Palb2GT/GT;p53+/– embryos appeared more advanced in their development than age-matched Palb2GT/

GT;p53+/+ mutants (Figure 3A). Nevertheless, similar to Brca1 and Brca2 null embryos on a p53-deficient background, the embryonic lethality of Palb2GT/GT;p53–/– embryos was only delayed, and p53 loss did not prevent apoptosis (Figure 3B). At E11.5, no living p53–/–

;Palb2GT/GT embryos could be detected (Table 1C).

Table 1A. Genotype distribution of Palb2 GT/+ x Palb2 GT/+ offspring

Genotype All +/+ GT/+ GT/GT

E8.5 125 29 (31.3) 69 (62.5) 27 (31.3)

E9.5 23 5 (5.8) 11 (11.5) 7 (5.8)

E10.5 27 6 (6.8) 19 (13.5) 2 (6.8)

E12.5 12 5 (3) 7 (6) 0 (3)

Postnatal 31 9 (7.8) 22 (15.5) 0 (7.8)

B. Genotype distribution of Actb-Flpe;Palb2 GTrev/+ x Palb2 GT/+ offspring

Genotype All GTrev/GT GTrev/GTrev

Postnatal 21 4 (2.6) 4 (2.6)

C. Genotype distribution of Palb2 GT/+;p53 +/– x Palb2 GT/+;p53 +/– offspring

Genotype All GT/GT;+/+ GT/GT;+/- GT/GT;-/-

E8.5 9 1 (0.5) 0 (1.2) 1 (0.5)

E9.5 11 0 (0.7) 1 (1.4) 1 (0.7)

E10.5 11 0 (0.7) 2 (1.4) 2 (0.7)

E11.5 17 0 (1) 1 resorbed (2.2) 1 resorbed (1)

Postnatal 71 0 (4.3) 0 (9.2) 0 (4.3)

For each genotype the expected numbers of mice/embryos are indicated between brackets.

Chapter 4

4

76

Figure 2. Developmental phenotype of Palb2 knockout embryos. A-B. Analysis of Palb2 knockout embryos. Representative pictures of Palb2GT/+ and Palb2GT/GT embryos at E8.5 (A) or E9.5 (B). All pictures were taken at the same magnification. Scale bar represents 1mm. C-D. Cellular proliferation and apoptosis in Palb2 knockout embryos. Ki67 (C) and TUNEL (D) staining of E7.5 Palb2GT/+, E7.5 Palb2+/+ and E8.5 Palb2GT/GT embryos. All pictures were taken at a magnification of 40x.

A

B

C

D


4

77

Palb2 heterozygosity does not affect tumourigenesis in p53-deficient miceIn the small number of PALB2 associated breast tumours that have been analyzed so far, no loss of the wild type PALB2 allele could be detected (Erkko et al., 2007; Tischkowitz et al., 2007), raising the possibility that PALB2 functions as a haploinsufficient tumour suppressor. Since heterozygous Palb2GT mutants did not spontaneously develop any tumours, we decided to investigate the impact of Palb2 heterozygosity on tumourigenesis in p53+/– and p53–/– mice. We established cohorts of Palb2GT/+;p53–/–, Palb2+/+;p53–/–, Palb2GT/+;p53+/– and Palb2+/+;p53+/– mice, which were monitored for spontaneous tumour development. Similar to what was previously reported for homozygous p53Δ2–10 knockout mice (Jonkers et al., 2001), the median tumour latency of Palb2+/+;p53–/– mice was 84 days (Figure 4A). Palb2GT/+;p53–/– mice developed tumours with a comparable median latency of 80 days, and there was no significant difference between both cohorts (Log-rank p=0.9747). There was also no difference in tumour latency between Palb2GT/+;p53+/– and Palb2+/+;p53+/– mice (Figure 4C). Whereas we did not observe a difference in tumour spectrum between Palb2GT/+;p53–/– and Palb2+/+;p53–/–, mice (Figure 4B), we observed a higher frequency and earlier onset of thymic lymphomas in Palb2GT/+;p53+/– compound heterozygous mice compared to Palb2+/+;p53+/– mice (Figure 4C). However, the observed difference was not statistically significant (Log-rank p=0.735).

Palb2 heterozygosity does not affect genomic instability of p53–/– lymphomasAlthough we did not observe effects of Palb2 heterozygosity on latency or spectrum of tumours in p53 mutant mice, we observed reduced Palb2 mRNA expression in Palb2 heterozygous lymphomas compared to Palb2 wildtype control tumours (Figure 4D and Supplemental information, Supplementary Figure 3A). Importantly, this reduction in Palb2 expression was not caused by LOH of Palb2 because all tumours had retained the Palb2 wildtype allele (Supplemental information, Supplementary Figure 3B-D). To determine possible effects of Palb2 dosage reduction on genomic instability, we compared DNA ploidy and genomic aberrations in Palb2GT/+ versus Palb2+/+ lymphomas. Flow cytometry with anti-CD4 and anti-CD8 antibodies confirmed that both Palb2GT/+;p53–/– and Palb2GT/+;p53–/– tumours were of T-cell origin (Supplemental information, Supplementary Figure 3). Tumours expressed both CD4 and CD8 (double-positive), indicating that they consisted mainly of immature T-cells. This is in accordance with what has previously been described for thymic lymphomas in p53 deficient mice (Donehower et al., 1995). To assess tumour ploidy as well as chromosomal aberrations such as translocations and pericentric inversions, we used Combined Binary Ratio Labelling – Fluoresence In Situ Hybridization (COBRA-FISH) for multi-colour karyotyping (Szuhai and Tanke, 2006). COBRA-FISH on metaphase preparations of early-passage thymic lymphoma cells revealed that Palb2GT/+;p53–/– thymic lymphomas were euploid and displayed only few chromosomal rearrangements (Figure 5A). To investigate whether Palb2 heterozygosity leads to increased genomic instability, we measured DNA copy number aberrations (CNAs) in Palb2 heterozygous and wildtype lymphomas by high-resolution array comparative genomic hybridization (aCGH). KC_SMART analysis (Klijn et al., 2008) of aCGH profiles from 15 Palb2GT/+;p53–/– and 11 Palb2+/+;p53–/– lymphomas indicated no significant differences in CNA frequencies between both tumour groups (Figure 5B). To determine whether Palb2 heterozygosity affects general genomic instability, we used a segmentation algorithm (Venkatraman and Olshen, 2007) on each aCGH profile and counted the resulting segments. There was no

Chapter 4

4

78

Figure 3. Partial developmental rescue of Palb2GT/GT;p53–/– embryos. A. Representative pictures of E10.5 Palb2+/+;p53+/+, Palb2GT/GT;p53+/+, Palb2GT/GT;p53+/– and Palb2GT/GT;p53–/– embryos. The arrow indicates the allantois of the Palb2GT/GT;p53+/+ embryo. All pictures were taken at a similar magnification. Scale bar represents 1mm. B. Cleaved caspase-3 (CC3) staining representing apoptosis in E10.5 Palb2GT/+;p53+/-, Palb2GT/+;p53-/-, Palb2GT/GT;p53+/– and Palb2GT/GT;p53–/– embryos. All pictures were taken at a magnification of 10x.

A

B


4

79

difference between Palb2GT/+;p53–/– and Palb2+/+;p53–/– lymphomas based on total segment count (Figure 5C) or on frequency of segments that report homozygous deletions (Figure 5D). PALB2 has recently been linked to suppression of sister chromatid exchange (SCE) (Sy et al., 2009), raising the possibility that haploinsufficiency of PALB2 in SCE suppression might contribute to tumour development in heterozygous PALB2 mutation carriers. To test this possibility, we measured SCE frequencies in activated splenocytes from heterozygous Palb2GT/+ mice and wild type control mice. Analysis of at least 20 metaphases of three individual Palb2GT/+ mice did not show any difference in the frequency of SCEs compared to Palb2+/+ controls (Supplemental information, Supplementary Table 2).

Figure 4. Tumour development in Palb2GT/+;p53–/– and Palb2GT/+;p53+/– mice. A. Tumour free survival curves of Palb2GT/+;p53–/– mice (n=28, orange curve) and Palb2+/+;p53–/– mice (n=37, blue curve). Median latency of tumour development in Palb2GT/+;p53–/– and Palb2+/+;p53–/– mice is 84 and 80 days, respectively. Statistical analysis was performed by a log-rank test (p=0.97). B. Tumour spectrum in Palb2GT/+;p53–/– and Palb2+/+;p53–/– mice. C. Tumour free survival curves of Palb2GT/+;p53+/– mice (n=50, orange curve) and Palb2+/+;p53+/– mice (n=48, blue curve). Thymic lymphomas are depicted with open circles. Statistical analysis was performed by a log-rank test (p=0.74). D. Palb2 mRNA expression in Palb2+/+;p53–/–, Palb2GT/+;p53–/– and Palb2GT/+;p53+/– thymic lymphomas. qRT-PCR of Palb2 exons 1-4 in a Palb2+/+ thymus, a Palb2GT/+ thymus, 11 Palb2+/+;p53–/–, 10 Palb2GT/+;p53–/– and 7 Palb2GT/+;p53+/– thymic lymphomas. Values were corrected for Hprt expression and normalized to expression of Palb2 in normal thymus. All samples were measured in duplo.

A

B

C

D

Chapter 4

4

80

Discussion

In this study, we have used a gene trap mouse model to investigate the biological functions of PALB2 in vivo. Insertion of the gene trap in the first intron of Palb2 resulted in abrogation of PALB2 expression and a functional null allele. As recently described by Rantakari et al. (Rantakari et al., 2010) and similar to Brca1 and Brca2 knockout mice, Palb2GT/

GT mutants showed a severe developmental delay and died between post implantation and mid-gestation. This phenotype could be completely rescued by reverting the gene

Figure 5. No increased genomic instability in Palb2GT/+;p53–/– tumours. A. COBRA FISH analysis of Palb2GT/+;p53–/– thymic lymphoma cells from 2 different tumours. B. KC-SMART analysis of aCGH data derived from Palb2GT/+;p53–/– and Palb2+/+;p53–/– tumours. Shown are kernel smoothed estimate (KSE) curves representing recurrent DNA copy number aberrations in Palb2GT/+;p53–/– lymphomas (red) and Palb2+/+;p53–/– tumours (green). C. Quantification of genomic instability by counting the number of copy number segments per tumour. D. Histograms of numbers of homozygous deletions per tumour, for either the Palb2GT/+;p53–/– or the Palb2+/+;p53–/– lymphomas.

A

B

C D


4

81

trap mutation, demonstrating that lethality was not due to co-segregating mutations in the ES clone used to generate the mice. Palb2GT/GT embryos showed a significantly reduced growth although most cells still expressed proliferation markers. Compared to age- or stage-matched controls the abundance of apoptotic cells was increased. Since most of these TUNEL and cleaved caspase-3 positive cells contained pyknotic nuclei we conclude that Palb2GT/GT embryos died of apoptosis-related growth impairment. Whereas most Brca1 and Brca2 mutants are thought to die because of hypoproliferation, increased apoptosis has been noticed in some Brca1 hypomorphic mouse mutants (Hohenstein et al., 2001; Xu et al., 2001). In contrast to Fanconi anaemia patients with biallelic PALB2 mutations, the Palb2GT/

GT mutants were embryonic lethal, thus precluding the analysis of a possible Fanconi anaemia-like phenotype in this strain. This apparent discrepancy between mouse and human PALB2 mutants might suggest partial PALB2 activity in the few patients analyzed thus far (Reid et al., 2007; Xia et al., 2007). Mutant PALB2 protein might be expressed at very low levels or lack the N-terminal epitope, so that it escapes detection by western blot analysis. Similar to this scenario, mice and patients with Brca2 hypomorphic mutations were viable whereas Brca2 null mutants died during embryonic development.

Genetic interaction between PALB2 and p53 in developmentIn human BRCA1/2-associated breast tumours TP53 is more frequently mutated than in sporadic cases, suggesting selective pressure for loss of p53 in the absence of BRCA1 or BRCA2 (Greenblatt et al., 2001; Holstege et al., 2009). In support of this view, p53 deficiency alleviates the phenotype of Brca1 and Brca2 knockout mice (Hakem et al., 1997; Ludwig et al., 1997). In both cases, double mutants develop further and embryonic lethality is delayed for 1-2 days. Also Palb2GT/GT mice developed further on a p53-deficient background, but were not rescued from apoptosis-related embryonic lethality. This appears to be a general feature of HR deficient mouse mutants as it was also observed for Rad51 knockout mice (Lim and Hasty, 1996). Increased p21 mRNA expression without concomitant p53 mRNA induction in homozygous Palb2GT mutant embryos led Rantakari et al. to suggest that PALB2 deficiency induces a p53-independent proliferation arrest (Rantakari et al., 2010). This would argue against selection for loss of TP53 in PALB2-associated tumours. However, we show that p53 ablation does alleviate the embryonic phenotype of Palb2 knockout mice, suggesting as similar requirement for TP53 mutation in BRCA1/2- and PALB2-associated tumours. Whether loss of p53 partially rescues Palb2GT/GT embryos through delayed or reduced apoptosis requires a more careful analysis of compound mutants at various stages of development. On a p53-deficient background Palb2-null embryos are able to form mesoderm derived structures such as heart muscle, arguing against an absolute requirement for Palb2 in mesoderm differentiation as reported by Rantakari et al (Rantakari et al., 2010). The development of conditional Palb2 mouse mutants will be helpful to more directly address this issue.

No evidence for haploinsufficiency of Palb2 in tumour suppression in mouseAs is the case for Brca1 and Brca2 knockout mice, monoallelic loss of Palb2 did not seem to result in tumour predisposition by itself. In addition, heterozygosity of Palb2 did not significantly accelerate tumourigenesis in p53-deficient mice. A possible explanation might be the rapid tumour development because of p53 deficiency alone, especially in

Chapter 4

4

82

p53–/– mice. Like p53–/– mice, Palb2GT/+;p53–/– mice developed mainly hemangiosarcomas and CD4+;CD8+ thymic lymphomas. These Palb2 heterozygous lymphomas were euploid and did not contain more translocations or copy number changes than Palb2 wild type tumours. Increases in chromosomal abnormalities have been observed in compound mutants for p53 and other components of the DDR pathway, including Brca1 (Bachelier et al., 2003), Brca2 (Cheung et al., 2002) and 53bp1 (Ward et al., 2005; Morales et al., 2006). This may be explained because BRCA1/2 associated breast tumours are characterized by LOH, whereas there appeared to be no selection for the loss of the wild type PALB2 allele in the Palb2 heterozygous lymphomas. This would be in agreement with previously published data on a small number of PALB2-associated human breast tumours (Erkko et al., 2007; Tischkowitz et al., 2007). The gene trap insertion reduced expression of Palb2 mRNA in heterozygous Palb2GT/+ mice as well as in Palb2GT/+;p53–/– and Palb2GT/+;p53+/– lymphomas. However, this reduction in Palb2 mRNA dosage did not accelerate tumour development in Palb2GT/+;p53–/– and Palb2GT/+;p53+/– mice, arguing against haploinsufficient tumour suppression by PALB2. Haploinsufficiency of PALB2 as a tumour suppressor might have important consequences for tumour treatment strategies in PALB2 mutation carriers. Possibly tumours in heterozygous mutation carriers are sensitive to DNA damaging treatments. However, without loss of the wild type allele it seems likely that such tumours will be relatively insensitive. Because of the low number of breast cancer patients diagnosed with a PALB2 mutation, we believe that mouse models for PALB2-associated mammary tumourigenesis will be important to address this issue. Given the lack of tumour predisposition in heterozygous Palb2 mutant mice, transplantation models (Marangoni et al., 2007) of human PALB2 mutant breast tumours in mice might be instrumental. The feasibility of such an approach has recently been demonstrated for a human BRCA2 mutant breast tumour xenograft model that maintained the characteristics of the origininal tumour including chemotherapy responses (de Plater et al., 2010). In summary, we have used a gene trap approach to investigate the functions of PALB2 in vivo. While loss of PALB2 leads to apoptosis and embryonic lethality, we found no evidence for PALB2 haploinsufficiency in suppressing tumourigenesis in p53+/– or p53–

/– mice. Further analysis of tumours in conditional mouse models and human-in-mouse models of PALB2 deficiency is expected to give more insight to the role of PALB2 mutations in FA and PALB2 associated cancer.

Acknowledgment

We thank Jeroen Korving for assistance with embryo histology; Metamia Ciampricotti for assistance with FACS analysis; John Zevenhoven, Manon Verwijs and Anneke Oostra for technical advice; Gavin Bendle, Paul van den Berk, Heinz Jacobs and Peter Krijger for providing reagents; and Hein te Riele and Sietske Bakker for critically reading the manuscript. Members of the NKI animal facility, mouse pathology and digital microscopy departments are gratefully acknowledged for their assistance. This work was supported by grants from the Dutch Cancer Society (NKI 2007-3772 to J. Jonkers, S. Rottenberg and J.H.M. Schellens and NKI 2008-4116 to J. Jonkers and P. Bouwman).


4

83

Author contribution statement

PB, RD, and JJ designed research; PB, RD, MP, HvdG, JYS, and KS performed research; PB, RD, CK, JYS, KS, and JJ analyzed data; PB, RD, and JJ wrote the paper.

References

Alter, B.P., Rosenberg, P.S., and Brody, L.C. (2007). Clinical and molecular features associated with biallelic mutations in FANCD1/BRCA2. J.Med.Genet. 44, 1–9.

Bachelier, R., Xu, X., Wang, X., Li, W., Naramura, M., Gu, H., and Deng, C.X. (2003). Normal lymphocyte development and thymic lymphoma formation in Brca1 exon-11-deficient mice. Oncogene 22, 528–537.

Bennett, L.M., McAllister, K.A., Blackshear, P.E., Malphurs, J., Goulding, G., Collins, N.K., Ward, T., Bunch, D.O., Eddy, E.M., Davis, B.J., et al. (2000). BRCA2-null embryonic survival is prolonged on the BALB/c genetic background. Mol.Carcinog. 28, 174–183.

Cheung, A.M., Hande, M.P., Jalali, F., Tsao, M.S., Skinnider, B., Hirao, A., McPherson, J.P., Karaskova, J., Suzuki, A., Wakeham, A., et al. (2002). Loss of Brca2 and p53 synergistically promotes genomic instability and deregulation of T-cell apoptosis. Cancer Res. 62, 6194–6204.

D’Andrea, A.D. (2010). Susceptibility pathways in Fanconi’s anemia and breast cancer. N.Engl.J.Med. 362, 1909–1919.

Donehower, L.A., Harvey, M., Vogel, H., McArthur, M.J., Montgomery, C.A., Park, S.H., Thompson, T., Ford, R.J., and Bradley, A. (1995). Effects of genetic background on tumorigenesis in p53-deficient mice. Mol.Carcinog. 14, 16–22.

Erkko, H., Xia, B., Nikkila, J., Schleutker, J., Syrjakoski, K., Mannermaa, A., Kallioniemi, A., Pylkas, K., Karppinen, S.M., Rapakko, K., et al. (2007). A recurrent mutation in PALB2 in Finnish cancer families. Nature 446, 316–319.


Hakem, R., de la Pompa, J.L., Elia, A., Potter, J., and Mak, T.W. (1997). Partial rescue of Brca1 (5-6) early embryonic lethality by p53 or p21 null mutation. Nat.Genet. 16, 298–302.



Howlett, N.G., Taniguchi, T., Olson, S., Cox, B., Waisfisz, Q., De Die-Smulders, C., Persky, N., Grompe, M., Joenje, H., Pals, G., et al. (2002). Biallelic inactivation of BRCA2 in Fanconi anemia. Science 297, 606–609.

Jones, S., Hruban, R.H., Kamiyama, M., Borges, M., Zhang, X., Parsons, D.W., Lin, J.C., Palmisano, E., Brune, K., Jaffee, E.M., et al. (2009). Exomic sequencing identifies PALB2 as a pancreatic cancer susceptibility gene. Science 324, 217.

Jonkers, J., Meuwissen, R., van der Gulden, H., Peterse, H., van der Valk, M., and Berns, A. (2001). Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat Genet 29, 418–425.

Chapter 4

4

84

King, T.A., Li, W., Brogi, E., Yee, C.J., Gemignani, M.L., Olvera, N., Levine, D.A., Norton, L., Robson, M.E., Offit, K., et al. (2007). Heterogenic loss of the wild-type BRCA allele in human breast tumorigenesis. Ann Surg Oncol 14, 2510–2518.

Klijn, C., Holstege, H., de Ridder, J., Liu, X., Reinders, M., Jonkers, J., and Wessels, L. (2008). Identification of cancer genes using a statistical framework for multiexperiment analysis of nondiscretized array CGH data. Nucleic Acids Res. 36, e13.

Lim, D.S., and Hasty, P. (1996). A mutation in mouse rad51 results in an early embryonic lethal that is suppressed by a mutation in p53. Mol.Cell Biol. 16, 7133–7143.

Ludwig, T., Chapman, D.L., Papaioannou, V.E., and Efstratiadis, A. (1997). Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes Dev. 11, 1226–1241.

Marangoni, E., Vincent-Salomon, A., Auger, N., Degeorges, A., Assayag, F., de Cremoux, P., de Plater, L., Guyader, C., De Pinieux, G., Judde, J.G., et al. (2007). A new model of patient tumor-derived breast cancer xenografts for preclinical assays. Clin Cancer Res 13, 3989–3998.

Morales, J.C., Franco, S., Murphy, M.M., Bassing, C.H., Mills, K.D., Adams, M.M., Walsh, N.C., Manis, J.P., Rassidakis, G.Z., Alt, F.W., et al. (2006). 53BP1 and p53 synergize to suppress genomic instability and lymphomagenesis. Proc.Natl.Acad.Sci.U.S.A 103, 3310–3315.

de Plater, L., Lauge, A., Guyader, C., Poupon, M.F., Assayag, F., de Cremoux, P., Vincent-Salomon, A., Stoppa-Lyonnet, D., Sigal-Zafrani, B., Fontaine, J.J., et al. (2010). Establishment and characterisation of a new breast cancer xenograft obtained from a woman carrying a germline BRCA2 mutation. Br J Cancer 103, 1192–1200.

Rahman, N., Seal, S., Thompson, D., Kelly, P., Renwick, A., Elliott, A., Reid, S., Spanova, K., Barfoot, R., Chagtai, T., et al. (2007). PALB2, which encodes a BRCA2-interacting protein, is a breast cancer susceptibility gene. Nat Genet 39, 165–167.

Rantakari, P., Nikkila, J., Jokela, H., Ola, R., Pylkas, K., Lagerbohm, H., Sainio, K., Poutanen, M., and Winqvist, R. (2010). Inactivation of Palb2 gene leads to mesoderm differentiation defect and early embryonic lethality in mice. Hum.Mol.Genet. ddq207.

Reid, S., Schindler, D., Hanenberg, H., Barker, K., Hanks, S., Kalb, R., Neveling, K., Kelly, P., Seal, S., Freund, M., et al. (2007). Biallelic mutations in PALB2 cause Fanconi anemia subtype FA-N and predispose to childhood cancer. Nat Genet 39, 162–164.

Rodriguez, C.I., Buchholz, F., Galloway, J., Sequerra, R., Kasper, J., Ayala, R., Stewart, A.F., and Dymecki, S.M. (2000). High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nat Genet 25, 139–140.

Sharan, S.K., Morimatsu, M., Albrecht, U., Lim, D.S., Regel, E., Dinh, C., Sands, A., Eichele, G., Hasty, P., and Bradley, A. (1997). Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature 386, 804–810.

Skoulidis, F., Cassidy, L.D., Pisupati, V., Jonasson, J.G., Bjarnason, H., Eyfjord, J.E., Karreth, F.A., Lim, M., Barber, L.M., Clatworthy, S.A., et al. (2010). Germline Brca2 Heterozygosity Promotes Kras(G12D) -Driven Carcinogenesis in a Murine Model of Familial Pancreatic Cancer. Cancer Cell 18, 499–509.

Suzuki, A., de la Pompa, J.L., Hakem, R., Elia, A., Yoshida, R., Mo, R., Nishina, H., Chuang, T., Wakeham, A., Itie, A., et al. (1997). Brca2 is required for embryonic cellular proliferation in the mouse. Genes Dev. 11, 1242–1252.

Sy, S.M., Huen, M.S., and Chen, J. (2009). MRG15 is a novel PALB2-interacting factor involved in homologous recombination. J Biol Chem 284, 21127–21131.


4

85

Szuhai, K., and Tanke, H.J. (2006). COBRA: combined binary ratio labeling of nucleic-acid probes for multi-color fluorescence in situ hybridization karyotyping. Nat.Protoc. 1, 264–275.

Tischkowitz, M., Xia, B., Sabbaghian, N., Reis-Filho, J.S., Hamel, N., Li, G., van Beers, E.H., Li, L., Khalil, T., Quenneville, L.A., et al. (2007). Analysis of PALB2/FANCN-associated breast cancer families. Proc Natl Acad Sci U S A 104, 6788–6793.

Venkatraman, E.S., and Olshen, A.B. (2007). A faster circular binary segmentation algorithm for the analysis of array CGH data. Bioinformatics 23, 657–663.

Walsh, T., and King, M.C. (2007). Ten genes for inherited breast cancer. Cancer Cell 11, 103–105.

Ward, I.M., Difilippantonio, S., Minn, K., Mueller, M.D., Molina, J.R., Yu, X., Frisk, C.S., Ried, T., Nussenzweig, A., and Chen, J. (2005). 53BP1 cooperates with p53 and functions as a haploinsufficient tumor suppressor in mice. Mol.Cell Biol. 25, 10079–10086.

Xia, B., Dorsman, J.C., Ameziane, N., de Vries, Y., Rooimans, M.A., Sheng, Q., Pals, G., Errami, A., Gluckman, E., Llera, J., et al. (2007). Fanconi anemia is associated with a defect in the BRCA2 partner PALB2. Nat Genet 39, 159–161.

Xia, B., Sheng, Q., Nakanishi, K., Ohashi, A., Wu, J., Christ, N., Liu, X., Jasin, M., Couch, F.J., and Livingston, D.M. (2006). Control of BRCA2 cellular and clinical functions by a nuclear partner, PALB2. Mol Cell 22, 719–729.

Xu, X., Qiao, W., Linke, S.P., Cao, L., Li, W.M., Furth, P.A., Harris, C.C., and Deng, C.X. (2001). Genetic interactions between tumor suppressors Brca1 and p53 in apoptosis, cell cycle and tumorigenesis. Nat.Genet. 28, 266–271.

Zhang, F., Fan, Q., Ren, K., and Andreassen, P.R. (2009a). PALB2 functionally connects the breast cancer susceptibility proteins BRCA1 and BRCA2. Mol Cancer Res 7, 1110–1118.

Zhang, F., Ma, J., Wu, J., Ye, L., Cai, H., Xia, B., and Yu, X. (2009b). PALB2 links BRCA1 and BRCA2 in the DNA-damage response. Curr Biol 19, 524–529.

Chapter 4

4

86


Supplementary Table 1. Genotype distribution of offspring from Palb2GT/+ x Brca2+/- crosses

Genotype Expected Observed

All - 68

Palb2+/+;Brca2+/+ 17 18

Palb2GT/+;Brca2+/+ 17 17

Palb2+/+;Brca2+/- 17 20

Palb2GT/+;Brca2+/- 17 13

Supplemental figures and tables

Per

cent

age

surv

ival

0

20

40

60

80

100

0 100 200 300 400 500

Latency (days)

Palb2GT/+;Brca2+/- (n =12)

Palb2 +/+;Brca2+/- (n =23)

Palb2GT/+;Brca2+/+ (n =17)

Palb2 +/+;Brca2+/+ (n =18)

Supplementary Figure 1. Survival of offspring from Palb2GT/+ x Brca2+/– intercrosses. Survival curves are shown for the following cohorts of mice: Palb2GT/+;Brca2+/– (n=12, purple curve), Palb2+/+;Brca2+/– (n=23, orange curve), Palb2GT/+;Brca2+/+ (n=17, blue curve), Palb2+/+;Brca2+/+ (n=18, green curve).


4

87

Supplementary Figure 2. Cellular proliferation and apoptosis in Palb2 knockout embryos. A. Ki67 staining of E7.5 Palb2GT/+, E7.5 Palb2+/+ and E8.5 Palb2GT/GT embryos. B. TUNEL staining of E7.5 Palb2GT/+, E7.5 Palb2+/+ and E8.5 Palb2GT/GT embryos. Pictures were taken at a 10 or 20 times magnification.

10x

20x

Palb2GT/+ E7.5 Palb2+/+ E7.5 Palb2GT/GT E8.5

10x

20x

Palb2GT/+ E7.5 Palb2+/+ E7.5 Palb2GT/GT E8.5

A

B

Chapter 4

4

88

Supplementary Figure 3. DNA and RNA analysis of Palb2GT/+;p53–/– and Palb2+/+;p53–/– lymphomas. A. qRT-PCR of Palb2 exons 1-4 in lymphomas from 11 Palb2+/+;p53–/–, 10 Palb2GT/+;p53–/–, and 7 Palb2GT/+;p53+/– mice. Values were corrected for Hprt expression and normalized to Palb2 expression levels in normal Palb2+/+ thymus. All samples were measured in duplo. B-D. Retention of Palb2 wild-type allele in Palb2+/+;p53–/– and Palb2GT/+;p53–/– lymphomas. Southern blot analysis of Palb2GT/+;p53+/– lymphomas (B) and Palb2+/+;p53–/– tumors (C). The upper band represents the Palb2+ allele; the lower band the Palb2GT allele. D. PCR genotyping of Palb2 in a panel of 15 Palb2GT/+;p53–/– lymphomas and 16 Palb2+/+;p53–/– tumors. The upper band represents the Palb2GT allele; the lower band the Palb2+ allele.

A

Palb2+

C

D

Palb2+

Palb2GT

Palb2+/+;p53-/- tumors Palb2GT/+;p53-/- tumors

Palb2+/+;p53-/- tumors Palb2GT/+;p53-/- tumors

Palb2GT

Palb2+

B

Palb2GT

Palb2+/+ controls Palb2GT/+;p53+/- tumors

Rel

ativ

e P

alb2

exp

ress

ion

(%)

Palb2+/+;p53-/- Palb2GT/+;p53-/- Palb2GT/+;p53+/-

0

50

100

150

200

250

A

B

C

D

Rel

ativ

e P

alb2

exp

ress

ion

(%)

Palb2+/+;p53-/- Palb2GT/+;p53-/- Palb2GT/+;p53+/-

0

50

100

150

200

250


4

89

Supplementary Figure 4. Characterization of Palb2GT/+;p53–/– lymphomas. A. Microphotographs of representative lymphoma sections stained with H&E at two different magnifications. Scale bar in left picture represents 200 µm and scale bar in right picture represents 20 µm. B. Flow cytometric analysis of Palb2GT/+;p53–/– lymphoma cells for CD4/CD8 and CD19/B220 surface markers. Percentages of cells in each quadrant are indicated.

Supplementary Table 2. Sister chromatid exchanges (SCEs) in Palb2GT/+ and Palb2+/+ splenocytes

Sample Genotype Chromosomes SCEs/chromosome SCEs/metaphase

1 Palb2GT/+ 1099 0.16 6.5

2 Palb2GT/+ 784 0.11 4.5

3 Palb2GT/+ 1234 0.14 5.8

4 Palb2+/+ 1064 0.16 6.5

5 Palb2+/+ 1979 0.11 4.4

6 Palb2+/+ 1183 0.15 5.9

CD4

CD8

CD19

B220

200 m 20 m

A

B

Chapter 4

4

90

Supplementary Methods

Establishment and culture of thymic lymphomasTumor cohorts were monitored at least three times a week. Mice were sacrificed when moribund and thymic lymphomas were harvested. Single cell suspensions of lymphoma cells were immediately taken into culture at several dilutions in 24-well format. Non-adherent lymphoma cells were grown in DMEM medium (Gibco; Invitrogen) supplemented with 10% FCS (Invitrogen), 5x10–5 M β-mercaptoethanol (Merck), 10% interleukin-7 conditioned medium (a kind gift from Dr. Heinz Jacobs) and antibiotics. Alternatively, single cell suspensions of lymphoma cells were first frozen down at -80°C in a mixture of 60% serum free DMEM medium, 30% FCS and 10% DMSO (Merck). At a later time, cryopreserved lymphoma cells were taken into culture following the same procedure as described earlier.

Flow cytometryCells were harvested, washed with PBS, spun down for 2 min at 1200 rpm and resuspended in PBS supplemented with 1% BSA (Sigma). Samples of 5 x 105 cells were incubated for 20 min at 4 °C in the dark with a 1:200 dilution of directly conjugated monoclonal antibodies in PBS+BSA. The following antibodies were used: FITC-conjugated anti-CD4 (clone GK.1.5), PE-conjugated anti-CD8 (clone 53-6.7), FITC-conjugated anti-CD19 (clone MB19-1), PE-conjugated anti-B220 (CD45R, clone RAS3-6B2) and APC-conjugated anti-CD45 (clone 30-F11) (eBioscience). Subsequently, cells were washed twice with PBS+BSA and 7-AAD (eBioscience) was added (1:10) to exclude dead cells. Data acquisition and analysis were performed on a FACSCalibur (Becton Dickinson) using FlowJo software (Tree Star, Inc.).

Array comparative genome hybridization (aCGH)Genomic DNA of tumor and spleen samples was extracted by proteinase K lysis and organic extraction with phenol-chloroform. aCGH analysis of thymic lymphomas was carried out by Roche Nimblegen Systems Inc. (http://www.nimblegen.com). Methods of DNA labeling, array construction and hybridization, as well as methods for array normalization and data analysis have been described previously (Selzer et al., 2005). In brief, tumor and reference (spleen) samples were fragmented by sonification and random-prime labeled with Cy3 and Cy5 dyes. Labeled material was co-hybridized to microarrays consisting of 385.000 oligonucleotide probes throughout the mouse genome (median probe spacing: 5.8kb). Arrays were scanned at 532nm (Cy3) and 635nm (Cy5) using a microarray scanner and data were extracted using NimbleScan software. After normalization and log2-ratio calculation, copy number gains and losses were identified using the segMNT algorithm included in Nimblescan software.

KC-SMART analysis of aCGH dataKC-SMART analysis (Klijn et al., 2008) was performed using the R implementation available through the Bioconductor software package (www.bioconductor.org), using the comparative module. The comparative module uses single tumor smoothed profiles calculated by kernel regression to compare two classes via the SAM algorithm (Tusher et al., 2001). We used standard parameters for the comparative analysis with 1000 permutations.


4

91

Quantification of homozygous deletions from aCGH dataUsing normalized log2 data obtained from the Nimblegen software we segmented each sample DNAcopy R package. The DNAcopy package is an implementation of the Circular Binary Segmentation algorithm (Venkatraman and Olshen, 2007). Prior to segmentation we applied single outlier smoothing as implemented in the DNAcopy package. We used standard parameters for the segmentation. We counted the total number of individual segments per tumor to score genomic instability. We regarded a segment as a homozygous deletion when the segment log2 value was < -0.5. To control for noise-induced small segments we required each segment to contain at least 10 probes.

Combined Binary Ratio labeling (COBRA) FISHMetaphase spreads were prepared according to standard protocols. COBRA FISH analysis was done as described by Szuhai and Tanke (Szuhai and Tanke, 2006). Mouse whole chromosome libraries were kindly provided by Dr. Michael Speicher (Graz, Austria). The 21 whole chromosome libraries were amplified by degenerate-oligonucleotide priming polymerase chain reaction (DOPPCR) and chemically labeled by the Universal Linkage System (ULS; Kreatech Diagnostics). The mouse chromosome DNA samples were labeled using DEAC, Cy3 and Cy5 as ratio-fluorochromes. The odd-numbered chromosomes and the Y-chromosome were additionally binary labeled with rhodamine green. After hybridization and posthybridization washes, slides were counterstained with DAPI immersed in antifading solution (Citifluor; Agar). Digital fluorescence imaging was performed using a Leica DM-RXA epifluorescence microscope (Leica). Image analysis was done using the COBRA FISH software (Tanke et al., 1999).

Sister Chromatid Exchange (SCE) analysisFor the analysis of SCEs, splenocytes were isolated from Palb2GT/+ and Palb2+/+ siblings and from Blmm3/m3 mice (Luo et al., 2000) at 1-2 months of age. 2-4 x 106 cells/ml were plated in DMEM containing 10% FCS, 10% IL7 conditioned medium and 2.0 µg/ml ConA (Sigma). After 18h, the cells were incubated either with 5 ng/ml MMC in the presence of 10 μM bromodeoxyuridine (BrdU) or with 10 μM BrdU alone. After another 22 hr in culture, colcemid was added to a final concentration of 100 ng/ml for 3 hr before harvest and preparation of chromosome spreads. Cells were treated with 75 mM KCL for 15 min at 37 °C and fixed with 3:1 dried methanol:acetic acid. Slides were air dried, incubated with Hoechst 33258, exposed to ultraviolet light, stained with 3% Giemsa and embedded in Pertex (Surgipath). For each individual culture at least 20 metaphases were evaluated.

Supplemental references

Luo, G., Santoro, I.M., McDaniel, L.D., Nishijima, I., Mills, M., Youssoufian, H., Vogel, H., Schultz, R.A., and Bradley, A. (2000). Cancer predisposition caused by elevated mitotic recombination in Bloom mice. Nat.Genet. 26, 424–429.

Selzer, R.R., Richmond, T.A., Pofahl, N.J., Green, R.D., Eis, P.S., Nair, P., Brothman, A.R., and Stallings, R.L. (2005). Analysis of chromosome breakpoints in neuroblastoma at sub-kilobase resolution using fine-tiling oligonucleotide array CGH. Genes Chromosomes.Cancer 44, 305–319.

Tanke, H.J., Wiegant, J., van Gijlswijk, R.P., Bezrookove, V., Pattenier, H., Heetebrij, R.J., Talman, E.G., Raap, A.K., and Vrolijk, J. (1999). New strategy for multi-colour fluorescence in situ hybridisation: COBRA: COmbined Binary RAtio labelling. Eur.J.Hum.Genet. 7, 2–11.

Chapter 4

4

92

Tusher, V.G., Tibshirani, R., and Chu, G. (2001). Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. U.S.A. 98, 5116–5121.


4

93

Chapter 5 BRCA1 RING function is essential for tumor suppression but dispensable for therapy resistance

Rinske Drost1, Peter Bouwman1, Sven Rottenberg1, Ute Boon1, Eva Schut1, Sjoerd Klarenbeek1, Christiaan Klijn1, Ingrid van der Heijden1, Hanneke van der Gulden1, Ellen Wientjens1, Mark Pieterse1, Aurelie Catteau2, Pete Green2, Ellen Solomon2, Joanna R. Morris2,3 and Jos Jonkers1

Cancer Cell 2011 (20):797-809

1 Division of Molecular Biology and Cancer Systems Biology Centre, the Netherlands Cancer Institute, Amsterdam, 1066 CX, the Netherlands

2 Department of Medical and Molecular Genetics, King’s College London, Guy’s Medical School Campus, London, SE1 9RT, United Kingdom

3 Present address: School of Cancer Sciences, College of Medical & Dental Sciences, University of Birmingham, Edgbaston, Birmingham, B15 2TT, United Kingdom

Chapter 5

5

96

SummaryHereditary breast cancers are frequently caused by germline BRCA1 mutations. The BRCA1C61G mutation in the BRCA1 RING domain is a common pathogenic missense variant, which reduces BRCA1/BARD1 heterodimerization and abrogates its ubiquitin ligase activity. To investigate the role of BRCA1 RING function in tumor suppression and therapy response, we introduced the Brca1C61G mutation in a conditional mouse model for BRCA1-associated breast cancer. In contrast to BRCA1-deficient mammary carcinomas, tumors carrying the Brca1C61G mutation responded poorly to platinum drugs and PARP inhibition and rapidly developed resistance whilst retaining the Brca1C61G mutation. These findings point to hypomorphic activity of the BRCA1-C61G protein that, while unable to prevent tumor development, affects response to therapy.

SignificanceWhile BRCA1-related cancers respond well to therapies targeting homologous recombination deficiency (HRD), resistance is a serious clinical problem. Although reversion of BRCA1 germline mutations has been observed in resistant tumors, it is unclear which functions of BRCA1 are required for therapy resistance. Here we show that residual activity of mutant BRCA1 proteins with a dysfunctional RING domain triggers acquired resistance to PARP inhibitors and platinum drugs. Genomic instability is viewed as a potential HRD biomarker. However, we show that while mammary tumors with different Brca1 mutations have identical genomic profiles, they respond differently to HRD-targeting therapeutics. It may therefore be useful to stratify patients according to the underlying BRCA1 mutation and functional biomarkers such as loss of RAD51 foci formation.

Introduction

Hereditary breast and ovarian cancer cases can often be attributed to germline mutations in the BRCA1 gene, which confer lifetime risks of up to 90% for developing breast cancer and 40-50% for ovarian cancer (Rahman and Stratton, 1998). The BRCA1 protein has been implicated in maintenance of genome integrity via processes as DNA replication and repair, transcriptional regulation and chromatin remodelling (Huen et al., 2010). Especially its role in error-free repair of DNA double-strand breaks (DSBs) by homologous recombination (HR) is thought to be important for its tumor suppression activity (Moynahan et al., 1999). In the absence of BRCA1, HR is impaired and DSBs have to be repaired by more error-prone mechanisms, like non-homologous end joining, which may lead to the increased genomic instability that characterizes BRCA1-mutated tumors (Moynahan et al., 2001). HR deficiency (HRD) may also underlie the hypersensitivity of BRCA1-deficient cells to DSB-inducing agents (Bhattacharyya et al., 2000). Although BRCA1-mutated ovarian cancers are often sensitive to platinum-based chemotherapy, they may eventually develop resistance via secondary mutations in the BRCA1 gene that lead to restoration of function (Swisher et al., 2008). This finding suggests the existence of a causal link between BRCA1 status and response to DSB-inducing agents. BRCA1-deficient cells are also hypersensitive to inhibition of poly(ADP-ribose) polymerase (PARP) (Bryant et al., 2005; Farmer et al., 2005), an enzyme involved in DNA single-strand break (SSB) repair. In the absence of PARP

BRCA1 RING function is dispensable for therapy resistance

5

97

activity, accumulating SSBs lead to DSBs because of replication fork stalling. Whereas these DSBs are rapidly repaired by HR in normal cells, they can only be repaired by error-prone mechanisms in BRCA1-deficient cells, resulting in gross chromosomal rearrangements and cell death. Indeed, recent clinical trials have demonstrated anti-tumor activity of the PARP inhibitor olaparib in BRCA1-associated cancer with only few side-effects (Fong et al., 2009, 2010; Tutt et al., 2010). BRCA1 is a large nuclear protein that contains an N-terminal RING domain required for heterodimerization of BRCA1 with BARD1. The BRCA1/BARD1 heterodimer has E3 ubiquitin ligase activity with the class of UbcH5 E2 ubiquitin conjugating enzymes (Mallery et al., 2002; Xia et al., 2003). BRCA1/BARD1-dependent ubiquitin conjugates occur at sites of double-strand DNA breaks suggesting that the BRCA1/BARD1 heterodimer is important for DNA repair and thereby for the tumor suppressive function of BRCA1 (Morris and Solomon, 2004). Heterodimerization of BRCA1 and BARD1 is also important for their stability in vivo (Hashizume et al., 2001; Joukov et al., 2001) and their nuclear localization (Fabbro et al., 2002). The BRCA1/BARD1 heterodimer appears to be important for the tumor suppressor activity of BRCA1, since mammary-specific inactivation of either BRCA1 or BARD1 in mice induces mammary tumors with similar kinetics and histological features (Shakya et al., 2008). Several germline mutations within the RING finger domain of BRCA1 have been linked to development of breast and ovarian cancers (Castilla et al., 1994; Friedman et al., 1994). The C61G mutation in the BRCA1 RING domain is one of the most frequently reported missense variants (BIC database; http://research.nhgri.nih.gov/bic/) and reduces the binding between BRCA1 and BARD1. This mutation also disrupts the interaction of BRCA1 with E2 ubiquitin conjugating enzymes and thereby abrogates the E3 ubiquitin ligase activity of the BRCA1/BARD1 heterodimer (Hashizume et al., 2001; Ruffner et al., 2001; Mallery et al., 2002). In this study we set out to investigate the importance of the RING domain for the various in vivo functions of BRCA1 and its potential importance in therapy response.

Results

Embryonic lethality of Brca1C61G mutant miceTo analyze the physiological role of the BRCA1 RING domain in mammalian cells, we generated Brca1C61G knock-in mice carrying a substitution of a conserved RING cysteine (Cys; TGT) into a glycine (Gly; GGT) at amino acid position 61 (Figure 1). This enabled us to exactly reproduce the human BRCA1C61G mutation in the mouse Brca1 gene. To determine the effects of Brca1C61G expression on normal mouse development, we investigated whether homozygous Brca1C61G mice were viable. Intercrossing of heterozygous Brca1C61G mice did not yield Brca1C61G homozygous pups (Table S1), indicating that the Brca1C61G mutation leads to embryonic lethality due to loss of BRCA1 RING function. To study at which stage of development homozygous Brca1C61G mice die, embryos were harvested at several time points after gestation and genotyped. Although homozygous Brca1C61G embryos were still recovered at Mendelian ratios at embryonic day (E) 10.5 (Table S1), they were already severely delayed in development at E9.5 compared to Brca1C61G/+

and Brca1+/+ embryos (Figure 1E). From E12.5 on, Brca1C61G/C61G embryos could no longer be detected (Table S1). In line with this, BRCA1-deficient mouse embryonic stem (ES) cells expressing human BRCA1-C61G showed a proliferation defect, which was independent

Chapter 5

5

98

of p53 status and not caused by reduced expression levels of BRCA1-C61G protein (Figure S1).

Figure 1. Embryonic lethality of the Brca1C61G mutant mice. A. Schematic overview of the Brca1wt and Brca1C61G allele before and after Cre-mediated excision of the neomycin (neo) selection marker. The Brca1C61G mutation is indicated with an asterisk. EcoN1 restriction sites are depicted. tk: thymidine kinase negative selection cassette; Cre: Cre recombinase; p: Brca1 intron 4 probe. B. Mouse Brca1+ and Brca1C61G DNA and protein sequence. Location of mutation and corresponding change of amino acid residue are indicated. C. Southern blot analysis of Brca1C61G/+ (1) and Brca1+/+ (2) genomic DNA. D. Melting curve genotyping of Brca1+/+ (blue), Brca1C61G/+ (red) and Brca1C61G/

C61G (green) mice. E. Embryonic lethality of Brca1C61G/C61G mice. Pictures of Brca1+/+, Brca1C61G/+ and Brca1C61G/C61G mice at embryonic day 9.5 (E9.5; see also Table S1 and Figure S1).

Mammary tumor development in K14cre;Brca1F/C61G;p53F/F miceTo study the role of BRCA1 RING function in tumor suppression, we introduced the Brca1C61G allele into the K14cre;Brca1F/F;p53F/F (KB1P) mouse mammary tumor model, in which Cre recombinase-mediated deletion of Brca1F and p53F alleles is induced in several epithelial tissues including skin and mammary gland epithelium (Liu et al., 2007). Brca1C61G mice were crossed with KB1P mice to generate cohorts of K14cre;Brca1F/C61G;p53F/F

(KB1C61GP) mice and KB1P control littermates, which were monitored for spontaneous tumor formation. While KB1P mice showed a median tumor-free survival of 236 days, KB1C61GP mice developed tumors with a significantly shorter median latency of 197 days (Figure 2A; Log-rank test p=0.0003). However, when we scored for mammary tumors only,

A

B

C

E

D


5

99

no significant difference in tumor-free survival was observed (Figure 2B; Log-rank test p=0.5657). When only skin tumors were taken into account, median tumor-free survival of KB1C61GP animals was again significantly reduced compared to KB1P mice (Figure S2; Log-rank test p=0.0117), showing that the difference in median tumor-free survival between KB1C61GP and KB1P mice is mainly due to skin tumors rather than mammary tumors. While the frequency of mammary tumors was comparable for KB1C61GP and KB1P mice (63% vs. 59%, respectively, the incidence of skin tumors was markedly lower in KB1C61GP mice than in KB1P mice (47% vs. 75%; Figure 2C). Consequently, KB1P mice more often carried both mammary and skin tumors (37%) than KB1C61GP mice (13%).

Figure 2. Spontaneous tumor development in KB1C61GP and KB1P mice. A. Tumor-free survival of KB1C61GP mice (K14cre;Brca1F/C61G;p53F/F; green curve; T50=197 days, n=61 mice) and KB1P mice (K14cre;Brca1F/F;p53F/F; blue curve; T50=236 days, n=37 mice). T50: median tumor-free survival; n: number of mice. B. Mammary tumor-free survival KB1C61GP (blue; T50=196 days, n=30 mice) and KB1P mice (green; T50=225 days, n=8 mice). C. Distribution of different tumor types in KB1C61GP and KB1P mice. Purple: only one or multiple mammary tumor(s); yellow: only one or multiple skin tumor(s); orange: both mammary and skin tumor(s); blue: another kind of tumor (see also Figure S2).

Characterization of K14cre;Brca1F/C61G;p53F/F mammary tumorsOn the basis of their histomorphological characteristics, the majority of mammary tumors that developed in both KB1P (89%) and KB1C61GP animals (87%) were classified as poorly differentiated solid carcinomas (Figure S3). In both groups only a small percentage of tumors were classified as carcinosarcomas, characterized by the presence of spindle-shaped cells (KB1C61GP: 2%; KB1P: 7%; Figure S3). Other tumors that developed in KB1C61GP and KB1P mice were grouped as lumen-forming carcinomas with varying degrees of glandular differentiation (Figure S3). Similar to human BRCA1-associated breast cancer (Lakhani et al., 2002), most KB1C61GP and KB1P mammary tumors stained (partly) positive for cytokeratin 8 and negative for vimentin, ER and PR (Figure 3A and Table S2).

A

C

B

Chapter 5

5

100

Human BRCA1-associated breast tumors are known to display a high degree of genomic instability (Tirkkonen et al., 1997) and also mouse KB1P tumors have a considerably higher number of genomic alterations than tumors from K14cre;p53F/F (KP)

Figure 3. Molecular characterization of KB1C61GP mouse mammary carcinomas. A. Immunohistochemical staining of sections from a KB1C61GP solid mouse mammary carcinoma for cytokeratin 8 (CK8), vimentin (Vim), estrogen receptor (ER) and progesterone receptor (PR). All pictures were taken at the same magnification. B. Comparative KC-Smart profiles of 20 KB1C61GP (blue) and 18 KB1P (green) mouse mammary carcinomas. Chromosome numbers are represented on the x-axis, KC score (measure of recurrence and strength of copy number change over a group of tumors) is depicted on the y-axis. C. Level of genomic instability in KB1C61GP mouse mammary carcinomas. The graph displays the number of discrete copy number aberrations identified by segmentation of aCGH profiles from Brca1-proficient K14cre;p53F/F (KP) tumors (red boxplot), KB1C61GP tumors (blue boxplot) and KB1P tumors (green boxplot). Standard deviation is depicted as a line connected to the box. The size of the box represents the variation between tumors within a group and the line within the box depicts the average level of genomic instability. D. BRCA1 protein expression in KB1C61GP mouse mammary carcinomas. Lane 1-5: KB1C61GP tumors; lane 6-8: KB1P littermate control tumors; lane 9: KP tumor. PolII protein expression was used as loading control (see also Figure S3 and Table S2).

A

B

C D


5

101

mice (Liu et al., 2007; Holstege et al., 2010). To investigate the level of genomic instability in KB1C61GP tumors, we measured DNA copy number aberrations (CNAs) in mammary tumors from KB1C61GP (n=20), littermate KB1P (n=18) and KP mice (n=19) using array comparative genomic hybridization (aCGH). When applying the comparative module of the R package KCsmart (Klijn et al., 2008; de Ronde et al., 2010), we did not find any differences between recurrent CNAs of KB1C61GP and KB1P tumors (Figure 3B). We also counted the number of segments per individual tumor as a measure of genomic instability and aggregated the results of individual tumors per genotype (Figure 3C). In line with our previous findings, KB1P tumors were found to be more genomically unstable than KP tumors (Wilcoxon rank-sum test p=0.04632). KB1C61GP tumors also had a significantly higher level of genomic instability than KP tumors (Wilcoxon rank-sum test p=0.008207), and no significant differences could be detected between KB1C61GP and KB1P tumors (Wilcoxon rank-sum test p=0.4383). Thus, the histological features and aCGH profiles of KB1C61GP mammary tumors are indistinguishable from those of KB1P control tumors. Whereas some studies have suggested that the BRCA1C61G mutation leads to reduced BRCA1 stability due to disruption of the BRCA1-BARD1 interaction (Hashizume et al., 2001; Joukov et al., 2001), others have found that the mutation has only a slight impact on BRCA1 stability (Brzovic et al., 2001; Nelson and Holt, 2010). To test the effect of the Brca1C61G mutation on protein stability, several KB1C61GP and control tumors were analyzed for BRCA1 protein expression by Western blot (Figure 3D). KB1C61GP and control KP tumors expressed BRCA1 protein at similar levels, indicating no significant instability of the murine BRCA1-C61G protein.

Response of K14cre;Brca1F/C61G;p53F/F mammary tumors to the PARP inhibitor olaparibMammary tumors arising in the KB1P mouse model can be transplanted orthotopically into female wild-type mice without losing their histomorphological features, molecular characteristics and drug sensitivity profile (Rottenberg et al., 2007, 2010). We used this transplantation system to study the response of KB1C61GP mammary tumors to the clinical PARP inhibitor olaparib (AZD2281). Several independent KB1C61GP, KB1P or KP tumors were transplanted into the fourth mammary gland of syngeneic recipient females and tumor-bearing mice were either treated with olaparib or left untreated (Figure 4A). In all cases, untreated animals had to be sacrificed within 12 days because of a large tumor (Figure 4B, left panel; Figure S4). No significant differences in overall survival (OS) after transplantation could be observed between KP, KB1C61GP and KB1P tumors (KP vs. KB1C61GP: Log-rank test p=0.1953; KB1C61GP vs. KB1P: Log-rank test p=0.1210). Whereas mice carrying KP tumors did not respond to olaparib treatment (Figure 4B-C, red curves; Figure S4), the median survival of mice carrying KB1P tumors increased from 12 to 60 days following treatment with olaparib and their tumors disappeared during treatment (Figure 4B-C, green curves; Figure S4). However, as reported before (Rottenberg et al., 2008), KB1P tumors could not be eradicated with this 28-day dosing schedule and all tumors grew back after the end of treatment. Interestingly, mice transplanted with KB1C61GP tumors had an average OS of 23 days after start of treatment (Figure 4B, right panel), which was significantly better than KP tumors, but significantly worse than KB1P tumors (KP vs. KB1C61GP: Log-rank test p=0.0002, KB1C61GP vs. KB1P: Log-rank test p=0.006). In contrast to KB1P tumors, KB1C61GP tumors never shrank in response to olaparib treatment, but continued to grow after a short period of tumor stasis (Figure 4C). These data indicate that, whereas KB1C61GP and KB1P tumors have similar characteristics, their responses to

Chapter 5

5

102

olaparib differ substantially.

Response of K14cre;Brca1F/C61G;p53F/F mammary tumors to cisplatinWe also investigated the response of KB1C61GP tumors to the maximum tolerable dose (MTD) of cisplatin, to which KB1P tumors never develop complete resistance (Rottenberg et al., 2007). We again transplanted several individual KB1C61GP, KB1P and KP mammary tumors and treated tumor-bearing mice with cisplatin (Table S3 and Figure 5A). Because

Figure 4. Olaparib response of KB1C61GP mammary tumors. A. Schematic representation of olaparib treatment schedule. Tx: orthotopic transplantation of fragments from spontaneous mouse mammary tumors; T0: start of treatment at a tumor volume of 200mm3 (100%). Mice received a daily dose of 50mg/kg olaparib intraperitoneally for 28 consecutive days. B. Overall survival (OS) curves of mice transplanted with KB1C61GP (blue), KB1P (green) and KP (red) tumors. The left graph depicts untreated animals; the right graph shows mice treated with olaparib. T50: median OS, n: number of mice. KP without treatment: T50=11 days, n=4 mice, KP with olaparib treatment: T50=10 days, n=5 mice; KB1C61GP without treatment: T50=7 days, n=5 mice, KB1C61GP with olaparib treatment: T50=23 days, n=10 mice; KB1P without treatment: T50=12 days, n=4 mice, KB1P with olaparib treatment: T50=60 days, n=7 mice. C. Comparison of relative mammary tumor volumes during 28-day treatment with olaparib. Tumor volumes are relative to the tumor volume at start of treatment (day 0, 100%=±200mm3). Error bars indicate SEM (see also Figure S4).

A

B

C


5

103

cisplatin can have toxic side-effects after multiple rounds of treatment, we studied both OS and tumor-free survival (TFS). Although the median OS of mice transplanted with KP tumors was prolonged from 11 to 48 days following cisplatin treatment (Figure 5B), they quickly developed resistance (Figure S5A). Consequently, 38% of the mice transplanted with KP tumors had to be sacrificed because of resistance (Figure 5C). As described before (Rottenberg et al., 2007), KB1P tumors respond well to platinum therapy, showing an increase in median OS from 12 days to 196 days following cisplatin treatment (Figure 5B). KB1P tumors never developed resistance and ultimately all animals had to be sacrificed because of toxicity (Figure 5C and S5A). Remarkably, mice transplanted with KB1C61GP tumors showed a significantly worse OS after cisplatin therapy than mice transplanted with KB1P tumors (Figure 5B and S5B; KB1C61GP: T50=70 days; KB1P: T50=196 days; Log-rank test p=<0.0001). This difference in survival was even more pronounced when only animals that had to be sacrificed because of a large tumor were scored (Figure S5C; Log-rank test p=<0.0001). Moreover, KB1C61GP tumors readily developed cisplatin resistance and 50% of the mice had to be sacrificed because of therapy-refractory tumors (Figure 5C and S5D; Table S3). In fact, no significant difference in OS after cisplatin therapy was observed between mice transplanted with KB1C61GP and KP tumors, respectively (Figure 5B; Log-rank test p=0.5823). Thus, the response of KB1C61GP tumors to cisplatin treatment is more similar to KP tumors than to KB1P tumors.

Acquired cisplatin resistance in K14cre;Brca1F/C61G;p53F/F mammary tumorsTo investigate whether resistance of KB1C61GP tumors to cisplatin was stable, we re-transplanted both platinum-sensitive and -resistant tumors derived from four different KB1C61GP donor tumors. There was no significant difference in tumor outgrowth after re-transplantation between cisplatin-sensitive and -resistant tumors (Figure 5D, left upper panel; Log-rank test p=0.2102). When tumors reached a volume of 200mm3, mice were treated with the MTD of cisplatin. Mice transplanted with platinum-resistant tumors responded significantly worse to cisplatin treatment than animals transplanted with platinum-sensitive tumors (Figure 5D, right upper panel; Log-rank test p=0.0003), indicating that cisplatin resistance of KB1C61GP tumors is a stably acquired trait. To probe whether platinum resistance in KB1C61GP tumors could be due to a platinum-specific mechanism such as increased nucleotide excision repair (NER) or to restoration of HR, we investigated cross-resistance of cisplatin-resistant KB1C61GP tumors to olaparib. Mice engrafted with cisplatin-sensitive and -resistant KB1C61GP tumors were treated with 50mg/kg olaparib for 28 successive days. Mice carrying platinum-sensitive KB1C61GP tumors showed a good response to olaparib, which was comparable to the response to cisplatin (Figure 5D, right upper panel and left lower panel; cisplatin T50=29 days vs. olapari T50=32 days). Compared to mice transplanted with platinum-sensitive tumors, mice with platinum-resistant tumors responded significantly worse to olaparib treatment, showing a median OS of only 10 days (Figure 5D, left lower panel; Log-rank test p=0.0002). Thus, platinum-resistant KB1C61GP tumors display cross-resistance to olaparib. We next investigated cross-resistance of cisplatin-resistant KB1C61GP tumors to the bifunctional alkylator nimustine. Bifunctional alkylators may be more lethal to HR-deficient cells than platinum agents since they are more efficient in inducing DNA interstrand crosslinks (ICLs), which can only be resolved by HR-mediated DNA repair (Deans and West, 2011). Treatment of mice carrying cisplatin-sensitive KB1C61GP tumors with a single dose of 48mg/kg nimustine resulted in a median OS of 28 days, which is

Chapter 5

5

104

Figure 5. Cisplatin response of KB1C61GP mammary tumors. A. Schematic representation of cisplatin treatment schedule. Tx: orthotopic transplantation of fragments from spontaneous mouse mammary tumors. T0: start of treatment at a tumor volume of approximately 200mm3, corresponding to a relative tumor volume (RTV) of 100%. T13: if the RTV on day 13 was ≥50%, mice received an additional treatment that was repeated every two weeks until their tumor shrank to a RTV of ≤50%. If the RTV at T13 was ≤50%, retreatment was postponed until the tumors grew back to their starting volume. B. OS curves of mice transplanted with KB1C61GP (blue), KB1P (green) and KP (red) tumors after cisplatin treatment. KP: T50=48 days, n=21 mice; KB1C61GP: T50=70 days, n=32 mice; KB1P: T50=196 days, n=20 mice. C. Causes of death of tumor-bearing mice after treatment with cisplatin. The stacked bars depict the percentage of mice that are still alive (orange) or sacrificed because of cisplatin-associated toxicity (grey) or cisplatin-resistant tumors (blue). D. Effects of cisplatin, olaparib or nimustine on OS of mice transplanted with cisplatin-sensitive (blue) and cisplatin-resistant (red) KB1C61GP tumors. Top-left panel: OS of untreated mice (cisplatin-sensitive: T50=8 days, n=4 mice; cisplatin-resistant: T50=10 days, n=6 mice). Top-right panel: OS after treatment with a single dose of 6mg/kg cisplatin (cisplatin-sensitive: T50=29 days, n=8 mice; cisplatin-resistant: T50=17 days, n=8 mice). Bottom-left panel: OS after daily treatment with 50mg/kg olaparib for 28 consecutive days (cisplatin-sensitive: T50=32 days, n=10 mice; cisplatin-resistant: T50=10 days, n=8 mice). Bottom-right panel: OS after treatment with a single dose of 48mg/kg nimustine (cisplatin-sensitive: T50=28 days, n=7 mice; cisplatin-resistant: T50=24 days, n=7 mice; see also Table S3 and Figure S5).

A

B C

D


5

105

comparable to the median OS after treatment with cisplatin (T50=29 days) or olaparib (T50=32 days; Figure 5D). Interestingly, a similar median OS was observed following nimustine treatment of mice carrying cisplatin-resistant KB1C61GP tumors (T50=24 days) and there was no significant difference in OS benefit from nimustine treatment between animals carrying platinum-resistant or –sensitive tumors (Figure 5D, right lower panel; Log-rank test p=0.7458). Thus, while cisplatin-resistant KB1C61GP tumors show cross-resistance to PARP inhibition, no cross-resistance to bifunctional alkylators such as nimustine was observed.

No genetic reversion of the Brca1C61G mutation in therapy-resistant tumorsThe cross-resistance of cisplatin-resistant KB1C61GP tumors to olaparib suggests that the mechanism of platinum resistance involves adaptation of HR-mediated DNA repair. Since secondary mutations in BRCA1/2 can lead to resistance to platinum agents and olaparib in BRCA1/2-deficient cell lines and ovarian tumors (Sakai et al., 2008, 2009; Swisher et al., 2008), we investigated whether acquired resistance of KB1C61GP tumors was due to genetic reversion of the Brca1C61G mutation. Sanger sequencing and Southern blot analysis showed that all cisplatin-resistant KB1C61GP tumors retained the Brca1C61G mutation (Figure 6A-B, Table S3 and data not shown). The wild-type band on the Southern blot in Figure 6B is probably derived from wild-type stromal cells from the recipient animal, since PCR genotyping confirmed complete absence of the Brca1F allele (data not shown). To exclude other secondary mutations in Brca1, we sequenced the first 8 exons of mouse Brca1 in all cisplatin-resistant tumors. Besides the Brca1C61G mutation, no other mutations could be detected in the cisplatin-resistant tumors (data not shown). In conclusion, we have found no evidence for genetic reversion of the Brca1C61G mutation as a mechanism for platinum resistance in KB1C61GP mouse mammary tumors. Next, we evaluated potential changes in Brca1-C61G mRNA and protein levels in cisplatin-resistant KB1C61GP tumors. To avoid unwanted detection of Brca1Δ5-13 mRNA expression, we used primers located in the deleted part of the Brca1 gene. The level of Brca1C61G mRNA expression in untreated KB1C61GP tumors was comparable to the level of Brca1 expression in BRCA1-proficient KP tumors (Figure 6C and S6A). This corresponds with normal levels of BRCA1 protein in spontaneous KB1C61GP tumors (Figure 3D) and in BRCA1-deficient mouse ES cells reconstituted with human BRCA1-C61G (Figure S1B). On average, cisplatin-resistant KB1C61GP tumors did not show a significantly higher level of Brca1C61G mRNA expression than untreated KB1C61GP tumors (Figure 6C and S6B). However, we observed substantial heterogeneity between individual tumors, and some cisplatin-resistant tumors showed higher BRCA1 mRNA and protein expression than their untreated counterparts (Figure 6C-D and S6A-B). We did not find evidence for a direct correlation between high BRCA1 expression levels and poor therapy response. Thus, the relevance of increased BRCA1-C61G expression for the development of platinum resistance remains unclear. It was recently shown that BRCA1-deficient breast cancers show de-repression of satellite DNA transcription, which may contribute to tumorigenesis through induction of genomic instability (Zhu et al., 2011). Presumably, repression of satellite DNA transcription may also serve as a mechanism of therapy resistance in BRCA1-deficient cancers. We could, however, not observe significant differences in satellite repeat expression between BRCA1-proficient KP tumors, BRCA1-deficient KB1P tumors and KB1C61GP tumors (Figure S6C). In addition, satellite repeat expression between cisplatin-sensitive and –resistant

Chapter 5

5

106

tumors was not significantly different (Figure S6C).

Figure 6. No genetic reversion in cisplatin-resistant KB1C61GP mammary tumors. A. Sanger sequencing of DNA from KB1C61GP tumors shows that the c.181T>G mutation in the Brca1C61G allele is retained in cisplatin-resistant tumors. B. Southern blot analysis of DNA from normal spleen (S) and KB1C61GP tumors. D: spontaneous donor tumors; U: untreated transplanted tumors; R: cisplatin-resistant transplanted tumors. T1, T2, T3, T4 represent individual spontaneous KB1C61GP donor tumors. Transplanted tumors were grouped according to the KB1C61GP donor tumor from which they originated. C. Brca1 qRT-PCR of untreated and cisplatin-resistant transplanted KB1C61GP tumors. Brca1 mRNA expression was normalized to mRNA expression of a housekeeping gene (HPRT). Brca1 mRNA expression in a KP mammary tumor was set at 100%. Error bars indicate SD. n: number of tumors. D. Western blot analysis of untreated (U) and cisplatin-resistant (R) KB1C61GP tumors. PolII protein expression was used as loading control (see also Figure S6).

Hypomorphic activity of BRCA1-C61GThe poor initial response to olaparib and normal BRCA1 protein expression in KB1C61GP tumors prompted us to compare their intrinsic DNA repair capacity to BRCA1-proficient KP tumors and BRCA1-deficient KB1P tumors. Several KB1C61GP, KP and KB1P tumors were transplanted and treated with cisplatin or olaparib when they reached a volume of approximately 200 mm3 (Rottenberg et al., 2007). Mice were sacrificed 24 hours after they received a single dose of cisplatin or two hours after receiving the last of seven daily doses of olaparib. Subsequently, the level of apoptosis, proliferation and DSBs were evaluated by immunohistochemistry for cleaved caspase 3, ki67 and pH2AX, respectively. No difference in the level of apoptosis and proliferation could be observed between KB1C61GP, KP and KB1P tumors, regardless of treatment (data not shown). Also the level of DSBs did not differ significantly between untreated KB1C61GP, KP and KB1P tumors (Figure 7A-B). As expected, the number of DSBs increased considerably after treatment with cisplatin for all tumor groups (Figure 7A-B). In line with the hypersensitivity of BRCA1-deficient KB1P tumors to olaparib (Rottenberg et al., 2008), the number of pH2AX-positive cells was significantly

A

B

C D


5

107

higher in olaparib-treated KB1P tumors than in KP tumors (Figure 7A-B, unpaired t test p=0.0002). Remarkably, the level of DSBs after olaparib treatment was significantly lower in KBC61GP tumors than in KB1P tumors (unpaired t test p=0.0020), suggesting that the DNA damage response is (partially) intact in KB1C61GP tumor cells. However, BRCA1-C61G expression alone may not be sufficient to mediate this response, since BRCA1-deficient ES cells expressing BRCA1-C61G do not show functional HR activity and are still sensitive to cisplatin and olaparib (Figure S7A-D).

Figure 7. Hypomorphic activity of BRCA1-C61G in vivo. A. Immunohistochemistry of pH2AX foci in KB1C61GP, KB1P and KP mammary tumors without treatment or after treatment with olaparib or cisplatin. Mice were sacrificed 2 hours after the last of 7 daily doses of olaparib (50mg/kg i.p.) or 24 hours after a single dose of cisplatin (6mg/kg i.v.). All pictures were taken at the same magnification. B. Quantification of pH2AX foci in KB1C61GP (grey), KB1P (orange) and KP (blue) tumors without treatment or after treatment with olaparib or cisplatin. Error bars indicate SD. n: number of tumors. C. Immunofluorescence of RAD51 foci in KB1C61GP, KB1P and KP tumor cell suspensions with or without gamma irradiation (10Gy). Cells with more than 10 RAD51 foci (red) are indicated with red arrowheads. Nuclei were visualized with DAPI (blue). All pictures were taken at a 63x magnification. D. Quantification of RAD51 foci in KB1C61GP (grey; n=7), KB1P (orange; n=9) and KP (blue; n=5) tumors after gamma irradiation. Percentages of cells with more than 10 RAD51 foci were normalized to tumor cells derived from a KP tumor. Error bars indicate SEM (see also Figure S7).

A

B

C

D

To evaluate whether the decreased amount of damage-induced DSBs in KB1C61GP tumors could be due to an altered DNA damage response in vivo, we assessed the formation of irradiation-induced RAD51 foci (RAD51 IRIFs) in short-term tumor cell cultures derived from the different tumor genotypes. As expected, RAD51 IRIFs were observed in HR-proficient KP tumor cells but not in HR-deficient KB1P tumor cells (Figure 7C, upper and lower panel; Figure S7E; Figure 7D; unpaired t test p=<0.0001). While we have no evidence for residual HR activity of BRCA1-C61G in vitro (Figure S7A-D), we did observe RAD51 IRIFs in short-term cultures derived from KB1C61GP tumors (Figure

Chapter 5

5

108

7C, middle panel; Figure S7E). The number of cells with RAD51 foci after irradiation was significantly higher in KB1C61GP cells compared to KB1P cells (Figure 7D; unpaired t test p=0.0012). Compared to KP tumor cells, KB1C61GP cells appeared to have a somewhat lower amount of RAD51-positive cells after irradiation, but this difference did not reach statistical significance (Figure 7D; unpaired t test p=0.0712).

Discussion

We have studied the importance of BRCA1 RING function in development, tumor suppression and therapy response using a mouse model carrying the Brca1C61G missense mutation, which impairs BRCA1/BARD1 heterodimerization and ubiquitin ligase activity. Similar to Brca1-null mutant mice, homozygous Brca1C61G mutants displayed embryonic lethality and heterozygous Brca1C61G mutant mice with tissue-specific loss of p53 and the second Brca1 allele developed mammary carcinomas resembling Brca1-null tumors. These findings indicate a pronounced loss of function of the mutant BRCA1-C61G protein. However, in contrast to Brca1-null mammary tumors from KB1P mice, Brca1C61G expressing tumors from KB1C61GP mice readily became resistant to cisplatin without undergoing genetic reversion of the C61G mutation. The acquired resistance of Brca1C61G tumors to platinum drugs and PARP inhibitors appears to be caused by residual activity of the mutant BRCA1-C61G protein resulting in an altered DNA damage response, as these tumors show reduced levels of pH2AX-positive DNA damage foci after olaparib treatment and formation of DNA damage-induced RAD51 foci.

The role of BRCA1 RING activity in mouse development and tumor suppressionTo study the role of BRCA1 in normal development and tumor suppression, a range of conventional Brca1 knockout mouse models has been generated carrying mutations in different parts of the gene (Evers and Jonkers, 2006; Drost and Jonkers, 2009). Most homozygous Brca1 mouse mutants show embryonic lethality at mid-gestation, while known Brca1 hypomorphic mutants display a less severe, and in case of the Brca1Δexon11 mutation even partly viable, embryonic phenotype (Hohenstein et al., 2001; Xu et al., 2001). In terms of their developmental phenotype, homozygous Brca1C61G mutant mice resemble Brca1-null mutants rather than Brca1 hypomorphic mutants that still express a partly functional BRCA1 protein. In line with this, Chang et al. showed that BAC transgenic mice expressing the Brca1C61G variant failed to rescue the embryonic lethality of Brca1 knockout mice (Chang et al., 2009). Together, these data show that BRCA1 RING activity is essential for embryonic survival. BRCA1 RING activity is also essential for tumor suppression, since KB1C61GP mice developed undifferentiated, ER-negative mammary carcinomas that closely resembled Brca1-null mammary tumors and human BRCA1-mutated breast tumors.

The role of BRCA1 RING activity in therapy response and resistanceAlthough human BRCA1-deficient tumors are very sensitive to DSB-forming agents, they eventually become resistant. Secondary mutations in the BRCA1 gene appear to be one mechanism for ovarian carcinomas to develop platinum resistance (Swisher et al., 2008), suggesting that restoration of BRCA1 expression is required for resistance to platinum-based chemotherapy. In line with this, Brca1-null mouse mammary tumors with a large intragenic deletion of Brca1 exons 5-13 fail to develop resistance and remain hypersensitive


5

109

to cisplatin or carboplatin even after multiple rounds of treatment (Rottenberg et al., 2007). We found that Brca1C61G expressing mammary tumors from KB1C61GP mice respond much worse to treatment with olaparib or cisplatin than Brca1-null tumors from KB1P mice. KB1C61GP tumors also developed cisplatin resistance, which was never observed in KB1P tumors. Surprisingly, we have found no evidence for genetic reversion of Brca1 by secondary mutations in cisplatin-resistant KB1C61GP tumors. The absence of secondary mutations in Brca1 indicates that KB1C61GP tumors may readily acquire resistance to DNA damaging agents due to residual activity of the mutant BRCA1-C61G protein. This residual activity of BRCA1-C61G might relate to another function of BRCA1 besides HR-mediated DNA repair, such as its reported role in gene silencing in constitutive heterochromatin (Zhu et al., 2011). However, we obtained no evidence for restoration of heterochromatin-mediated silencing in therapy-resistant KB1C61GP tumors. It is also possible that more subtle alterations, such as increased expression of BRCA1-C61G or adaptations in the DNA damage response network might suffice to trigger resistance to HRD targeted therapy in KB1C61GP tumors. In line with this, we found that cisplatin-resistant KB1C61GP tumors were cross-resistant to the clinical PARP inhibitor olaparib, which induces DSBs through inhibition of SSB repair. This finding excludes platinum-specific resistance mechanisms such as increased NER activity (Martin et al., 2008) or reduced expression of the copper transporter CTR1 (Ishida et al., 2010) and advocates for adaptation at the level of HR-mediated DNA repair. Nevertheless, cisplatin-resistant KB1C61GP tumors were still sensitive to the bifunctional alkylator nimustine. This might be due to the fact that nimustine causes more ICLs and may therefore be more lethal to cells with decreased HR capacity than cisplatin (Deans and West, 2011). Consistent with a role in ICL repair, BRCA1 has been shown to associate with FANCD2 (Taniguchi et al., 2002), one of the central proteins in the Fanconi Anemia pathway, and siRNA depletion of BRCA1 results in loss of damage-induced FANCD2 foci (Vandenberg et al., 2003).

Hypomorphic activity of BRCA1-C61GWe have obtained evidence that residual activity of the mutant BRCA1-C61G protein in the DNA damage response underlies the resistance of KB1C61GP tumors to olaparib and cisplatin. Compared to BRCA1-deficient tumors, KB1C61GP tumors showed more DNA damage-induced RAD51 foci and fewer pH2AX positive cells, suggesting that the DNA repair process in KB1C61GP tumors is (partially) intact. However, basic HR levels of both human (Ransburgh et al., 2010) and mouse C61G mutant cells (Figure S7A-B) in vitro are very low. This apparent discrepancy between in vitro HR reporter activity and in vivo response of BRCA1-C61G mutant mammary tumors to DNA damage could be the result of differences between in vivo and in vitro assays or of differences in cell type. Alternatively, additional (epi)genetic alterations might contribute to the altered DNA damage response of BRCA1-C61G mutant tumors. The mouse model we have used to investigate the in vivo functions of the BRCA1 RING domain carries the Brca1C61G missense mutation, which mutates the first cysteine residue in the last C-X2-C pair of Zn2+ binding ligands within the BRCA1 RING domain (Brzovic et al., 2001). The C61G mutation in the BRCA1 RING domain is one of the most frequently reported missense variants (BIC database; http://research.nhgri.nih.gov/bic/) and linked to the development of breast and ovarian cancer (Castilla et al., 1994; Friedman et al., 1994). This mutation reduces the binding between BRCA1 and BARD1,

Chapter 5

5

110

and inhibits E2 conjugating enzyme interaction and thereby the E3 ubiquitin ligase activity of the heterodimer (Hashizume et al., 2001; Ruffner et al., 2001; Mallery et al., 2002). It is interesting to compare our results to data obtained with the synthetic Brca1I26A mutation (Reid et al., 2008; Shakya et al., 2011), which is suggested to produce a protein that lacks the E3 ubiquitin ligase activity but retains the ability to heterodimerize with BARD1 (Brzovic et al., 2003; Christensen et al., 2007). Cells expressing BRCA1-I26A are able to repair DSBs by HR at the same level as wild-type cells (Reid et al., 2008), while BRCA-C61G mutant cells have a very low HR activity (Figure S7A-B) (Ransburgh et al., 2010). While mammary tumor development is observed in KB1C61GP mice expressing BRCA1-C61G, BRCA1-I26A is able to prevent tumor formation to the same degree as wild-type BRCA1 (Shakya et al., 2011). This suggests that not the enzymatic activity but rather another function of the RING domain (e.g. BRCA1/BARD1 heterodimerization) is essential for the tumor suppressive activity of BRCA1.

Clinical implicationsWe believe that the work presented in this paper may have important diagnostic and therapeutic implications. We show that secondary mutations in the Brca1 gene are not always required to develop resistance to platinum drugs or PARP inhibitors, as residual activity of BRCA1 mutant proteins with a dysfunctional RING domain may be sufficient for tumor cells to withstand treatment with DNA damaging agents. Nevertheless, our data indicate that platinum- and olaparib-resistant tumors in BRCA1C61G mutation carriers may still respond to treatment with bifunctional alkylators, like nimustine. This may not only hold true for the BRCA1C61G mutation but also for other pathogenic missense mutations in the BRCA1 RING domain. The fact that Brca1Δ11/Δ11;p53-/- mouse mammary tumors, which only express the BRCA1-Δ11 isoform, can acquire resistance to cisplatin (Shafee et al., 2008) suggests that certain pathogenic missense or splicing mutations outside the BRCA1 RING domain might also produce BRCA1 species with residual activity resulting in an altered DNA damage response. Since it will be difficult to obtain treatment response and survival data for sufficiently large numbers of patients carrying specific BRCA1 founder mutations, it will be useful to evaluate the impact of defined Brca1 mutations on treatment response and resistance in genetically engineered mouse models for BRCA1-associated breast and ovarian cancer. It will also be interesting to evaluate the response of mouse mammary tumors carrying Bard1 mutations to treatment with DSB-forming agents. Shakya et al. have shown that BARD1-deficient mouse mammary tumors are virtually indistinguishable from BRCA1-deficient tumors (Shakya et al., 2008). However, it is unknown whether BARD1-deficient tumors have a similar response to DNA damaging agents as BRCA1-deficient tumors. Currently, it is thought that genomic profiling of tumors may serve as potential diagnostic tool to stratify patients for HRD targeted therapies (Asakawa et al., 2010; Graeser et al., 2010; Vollebergh et al., 2010; Lips et al., 2011). However, here we show that while mouse mammary tumors with different Brca1 mutations have identical genomic profiles, they show marked differences in their capacity to form DNA damage-induced RAD51 foci and in their responses to HRD targeted therapy. It may therefore be useful to stratify patients for HRD targeted therapies not only by genomic profiling of tumors but also according to functional assays, like RAD51 foci formation assays, and the precise nature of the underlying BRCA1 mutation.


5

111

Experimental procedures

Generation of the Brca1C61G mutant miceMouse ES cells were targeted with a construct in which Brca1 exon 5 was modified by site-directed mutagenesis to encode the C61G mutation (Figure 1). The neomycin selection cassette was removed from correctly targeted cells by Cre-excision. The resulting ES cells were injected into C57BL/6J blastocysts to produce chimeric males, which were mated with C57BL/6J females to generate Brca1C61G/+ mice. Brca1C61G/+ mice were bred with K14cre;Brca1F/F;p53F/F (KB1P) animals (Liu et al., 2007) to generate K14cre;Brca1C61G/F;p53F/F

(KB1C61GP) mice. Full details on the generation of the Brca1C61G allele are provided in the Supplemental Experimental Procedures.

Orthotopic transplantations and drug interventionsAll experiments involving animals comply with local and international regulations and ethical guidelines, and have been authorized by our local animal experimental committee at the Netherlands Cancer Insititute (DEC-NKI). Small fragments of mammary tumors from K14cre;p53F/F (KP), KB1P or KB1C61GP mice were transplanted orthotopically in FVB:129/Ola F1 hybrid female mice as described previously (Rottenberg et al., 2007). When the tumor volume exceeded 200 mm3, mice were treated with the MTD of cisplatin, olaparib and nimustine (Rottenberg et al., 2007, 2010; Evers et al., 2010). To study resistance, animals received additional doses of cisplatin when tumors grew back to 200 mm3. Animals were sacrificed when the tumor volume exceeded 1500 mm3 or when they became ill from drug toxicity.

RAD51 foci formation assayCells from cryopreserved tumors were grown on glass coverslips for 36-48 hours, γ-irradiated with 10 Gy and fixed 6 hours later in 2% paraformaldehyde. RAD51 immuofluorescence was performed as described previously (Bouwman et al., 2010). To quantify RAD51 foci in single tumor cells, 150-200 cells per condition were counted blindly. Cells were scored RAD51-positive if they had more than ten RAD51-positive dots per nucleus.

Accession numbers

Array CGH data generated in this study have been deposited at the National Center for Biotechnology Information Gene Expression Omnibus database (www.ncbi.nlm.nih.gov/geo) under accession number GSE30710.

Acknowledgments

We thank the personnel of the animal facilities of the Netherlands Cancer Institute (NKI) and King’s College London for excellent animal husbandry; the NKI microarray facility for expert help with the aCGH studies; the NKI animal pathology department for their expertise on immunohistochemical stainings; M. O’Connor (Astrazeneca) for providing us with olaparib; D.P. Silver (Dana-Farber Cancer Institute, Boston, USA) for the human BRCA1 cDNA expression construct; L. van der Weyden (Wellcome Trust Sanger Institute, Hinxton, UK) for the pFlpe expression construct; M. Jasin (Memorial Sloan-Kettering Cancer Center, New York, USA) and T. Ludwig (Colombia University, New York, USA) for the I-SceI

Chapter 5

5

112

expression plasmid and the DR-GFP reporter plasmid; R. Kanaar (Erasmus MC, Rotterdam, NL) for the RAD51 antibody; and R.I. Drapkin (Dana-Farber Cancer Institute, Boston, USA) for the mouse Brca1 antibody. This work was supported by grants from the Dutch Cancer Society (NKI 2007-3772 to JJ, SR and J. Schellens; NKI 2008-4116 to JJ and PB), the Cancer Systems Biology Center funded by the Netherlands Organization for Scientific Research (NWO) and Breast Cancer Campaign (SF06 to JM).

References

Asakawa, H., Koizumi, H., Koike, A., Takahashi, M., Wu, W., Iwase, H., Fukuda, M., and Ohta, T. (2010). Prediction of breast cancer sensitivity to neoadjuvant chemotherapy based on status of DNA damage repair proteins. Breast Cancer Res. 12, R17.

Bhattacharyya, A., Ear, U.S., Koller, B.H., Weichselbaum, R.R., and Bishop, D.K. (2000). The breast cancer susceptibility gene BRCA1 is required for subnuclear assembly of Rad51 and survival following treatment with the DNA cross-linking agent cisplatin. J Biol Chem 275, 23899–23903.

Bouwman, P., Aly, A., Escandell, J.M., Pieterse, M., Bartkova, J., van der Gulden, H., Hiddingh, S., Thanasoula, M., Kulkarni, A., Yang, Q., et al. (2010). 53BP1 loss rescues BRCA1 deficiency and is associated with triple-negative and BRCA-mutated breast cancers. Nat Struct Mol Biol 17, 688–695.


Brzovic, P.S., Keeffe, J.R., Nishikawa, H., Miyamoto, K., Fox, D., Fukuda, M., Ohta, T., and Klevit, R. (2003). Binding and recognition in the assembly of an active BRCA1/BARD1 ubiquitin-ligase complex. Proc Natl Acad Sci U S A 100, 5646–5651.

Brzovic, P.S., Meza, J.E., King, M.C., and Klevit, R.E. (2001). BRCA1 RING domain cancer-predisposing mutations. Structural consequences and effects on protein-protein interactions. J Biol Chem 276, 41399–41406.

Castilla, L.H., Couch, F.J., Erdos, M.R., Hoskins, K.F., Calzone, K., Garber, J.E., Boyd, J., Lubin, M.B., Deshano, M.L., Brody, L.C., et al. (1994). Mutations in the BRCA1 gene in families with early-onset breast and ovarian cancer. Nat Genet 8, 387–391.

Chang, S., Biswas, K., Martin, B.K., Stauffer, S., and Sharan, S.K. (2009). Expression of human BRCA1 variants in mouse ES cells allows functional analysis of BRCA1 mutations. J Clin Invest 119, 3160–3171.

Christensen, D.E., Brzovic, P.S., and Klevit, R.E. (2007). E2-BRCA1 RING interactions dictate synthesis of mono- or specific polyubiquitin chain linkages. Nat Struct Mol Biol 14, 941–948.

Deans, A.J., and West, S.C. (2011). DNA interstrand crosslink repair and cancer. Nat.Rev.Cancer 11, 467–480.

Drost, R.M., and Jonkers, J. (2009). Preclinical mouse models for BRCA1-associated breast cancer. Br J Cancer 101, 1651–1657.


Evers, B., Schut, E., van der Burg, E., Braumuller, T.M., Egan, D.A., Holstege, H., Edser, P., Adams, D.J., Wade-Martins, R., Bouwman, P., et al. (2010). A high-throughput pharmaceutical screen identifies compounds with specific toxicity against BRCA2-deficient tumors. Clin Cancer Res 16, 99–108.


5

113

Fabbro, M., Rodriguez, J.A., Baer, R., and Henderson, B.R. (2002). BARD1 induces BRCA1 intranuclear foci formation by increasing RING-dependent BRCA1 nuclear import and inhibiting BRCA1 nuclear export. J Biol Chem 277, 21315–21324.



Fong, P.C., Yap, T.A., Boss, D.S., Carden, C.P., Mergui-Roelvink, M., Gourley, C., De Greve, J., Lubinski, J., Shanley, S., Messiou, C., et al. (2010). Poly(ADP)-ribose polymerase inhibition: frequent durable responses in BRCA carrier ovarian cancer correlating with platinum-free interval. J Clin Oncol 28, 2512–2519.

Friedman, L.S., Ostermeyer, E.A., Szabo, C.I., Dowd, P., Lynch, E.D., Rowell, S.E., and King, M.C. (1994). Confirmation of BRCA1 by analysis of germline mutations linked to breast and ovarian cancer in ten families. Nat Genet 8, 399–404.

Graeser, M., McCarthy, A., Lord, C.J., Savage, K., Hills, M., Salter, J., Orr, N., Parton, M., Smith, I.E., Reis-Filho, J.S., et al. (2010). A marker of homologous recombination predicts pathologic complete response to neoadjuvant chemotherapy in primary breast cancer. Clin.Cancer Res. 16, 6159–6168.



Holstege, H., van Beers, E., Velds, A., Liu, X., Joosse, S.A., Klarenbeek, S., Schut, E., Kerkhoven, R., Klijn, C.N., Wessels, L.F., et al. (2010). Cross-species comparison of aCGH data from mouse and human B. BMC Cancer 10, 455.

Huen, M.S., Sy, S.M., and Chen, J. (2010). BRCA1 and its toolbox for the maintenance of genome integrity. Nat Rev Mol Cell Biol 11, 138–148.

Ishida, S., McCormick, F., Smith-McCune, K., and Hanahan, D. (2010). Enhancing tumor-specific uptake of the anticancer drug cisplatin with a copper chelator. Cancer Cell 17, 574–583.

Joukov, V., Chen, J., Fox, E.A., Green, J.B., and Livingston, D.M. (2001). Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development. Proc Natl Acad Sci U S A 98, 12078–12083.

Klijn, C., Holstege, H., de Ridder, J., Liu, X., Reinders, M., Jonkers, J., and Wessels, L. (2008). Identification of cancer genes using a statistical framework for multiexperiment analysis of nondiscretized array CGH data. Nucleic Acids Res 36, e13.

Lakhani, S.R., Van De Vijver, M.J., Jacquemier, J., Anderson, T.J., Osin, P.P., McGuffog, L., and Easton, D.F. (2002). The pathology of familial breast cancer: predictive value of immunohistochemical markers estrogen receptor, progesterone receptor, HER-2, and p53 in patients with mutations in BRCA1 and BRCA2. J Clin Oncol 20, 2310–2318.

Lips, E.H., Mulder, L., Hannemann, J., Laddach, N., Vrancken Peeters, M.T., Van De Vijver, M.J., Wesseling, J., Nederlof, P.M., and Rodenhuis, S. (2011). Indicators of homologous recombination deficiency in breast cancer

Chapter 5

5

114

and association with response to neoadjuvant chemotherapy. Ann.Oncol. 22, 870–876.


Mallery, D.L., Vandenberg, C.J., and Hiom, K. (2002). Activation of the E3 ligase function of the BRCA1/BARD1 complex by polyubiquitin chains. Embo J 21, 6755–6762.

Martin, L.P., Hamilton, T.C., and Schilder, R.J. (2008). Platinum resistance: the role of DNA repair pathways. Clin.Cancer Res. 14, 1291–1295.

Morris, J.R., and Solomon, E. (2004). BRCA1 : BARD1 induces the formation of conjugated ubiquitin structures, dependent on K6 of ubiquitin, in cells during DNA replication and repair. Hum Mol Genet 13, 807–817.


Moynahan, M.E., Cui, T.Y., and Jasin, M. (2001). Homology-directed dna repair, mitomycin-c resistance, and chromosome stability is restored with correction of a Brca1 mutation. Cancer Res 61, 4842–4850.

Nelson, A.C., and Holt, J.T. (2010). Impact of RING and BRCT domain mutations on BRCA1 protein stability, localization and recruitment to DNA damage. Radiat Res 174, 1–13.

Rahman, N., and Stratton, M.R. (1998). The genetics of breast cancer susceptibility. Annu Rev Genet 32, 95–121.

Ransburgh, D.J., Chiba, N., Ishioka, C., Toland, A.E., and Parvin, J.D. (2010). Identification of breast tumor mutations in BRCA1 that abolish its function in homologous DNA recombination. Cancer Res 70, 988–995.

Reid, L.J., Shakya, R., Modi, A.P., Lokshin, M., Cheng, J.T., Jasin, M., Baer, R., and Ludwig, T. (2008). E3 ligase activity of BRCA1 is not essential for mammalian cell viability or homology-directed repair of double-strand DNA breaks. Proc Natl Acad Sci U S A 105, 20876–20881.

de Ronde, J.J., Klijn, C., Velds, A., Holstege, H., Reinders, M.J., Jonkers, J., and Wessels, L.F. (2010). KC-SMARTR: An R package for detection of statistically significant aberrations in multi-experiment aCGH data. BMC Res Notes 3, 298.

Rottenberg, S., Jaspers, J.E., Kersbergen, A., van der Burg, E., Nygren, A.O., Zander, S.A., Derksen, P.W., de Bruin, M., Zevenhoven, J., Lau, A., et al. (2008). High sensitivity of BRCA1-deficient mammary tumors to the PARP inhibitor AZD2281 alone and in combination with platinum drugs. Proc Natl Acad Sci U S A 105, 17079–17084.

Rottenberg, S., Nygren, A.O., Pajic, M., van Leeuwen, F.W., van der Heijden, I., van de Wetering, K., Liu, X., de Visser, K.E., Gilhuijs, K.G., van Tellingen, O., et al. (2007). Selective induction of chemotherapy resistance of mammary tumors in a conditional mouse model for hereditary breast cancer. Proc Natl Acad Sci U S A 104, 12117–12122.

Rottenberg, S., Pajic, M., and Jonkers, J. (2010). Studying drug resistance using genetically engineered mouse models for breast cancer. Methods Mol Biol 596, 33–45.

Ruffner, H., Joazeiro, C.A., Hemmati, D., Hunter, T., and Verma, I.M. (2001). Cancer-predisposing mutations within the RING domain of BRCA1: loss of ubiquitin protein ligase activity and protection from radiation hypersensitivity. Proc Natl Acad Sci U S A 98, 5134–5139.

Sakai, W., Swisher, E.M., Jacquemont, C., Chandramohan, K.V., Couch, F.J., Langdon, S.P., Wurz, K., Higgins, J., Villegas, E., and Taniguchi, T. (2009). Functional restoration of BRCA2 protein by secondary BRCA2 mutations in BRCA2-mutated ovarian carcinoma. Cancer Res 69, 6381–6386.


5

115

Sakai, W., Swisher, E.M., Karlan, B.Y., Agarwal, M.K., Higgins, J., Friedman, C., Villegas, E., Jacquemont, C., Farrugia, D.J., Couch, F.J., et al. (2008). Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers. Nature 451, 1116–1120.


Shakya, R., Reid, L.J., Reczek, C.R., Cole, F., Egli, D., Lin, C.-S., deRooij, D.G., Hirsch, S., Ravi, K., Hicks, J.B., et al. (2011). BRCA1 tumor suppression depends on BRCT phosphoprotein binding, but not its E3 ligase activity. Science 334, 525–528.

Shakya, R., Szabolcs, M., McCarthy, E., Ospina, E., Basso, K., Nandula, S., Murty, V., Baer, R., and Ludwig, T. (2008). The basal-like mammary carcinomas induced by Brca1 or Bard1 inactivation implicate the BRCA1/BARD1 heterodimer in tumor suppression. Proc Natl Acad Sci U S A 105, 7040–7045.


Taniguchi, T., Garcia-Higuera, I., Andreassen, P.R., Gregory, R.C., Grompe, M., and D’Andrea, A.D. (2002). S-phase-specific interaction of the Fanconi anemia protein, FANCD2, with BRCA1 and RAD51. Blood 100, 2414–2420.


Tutt, A., Robson, M., Garber, J.E., Domchek, S.M., Audeh, M.W., Weitzel, J.N., Friedlander, M., Arun, B., Loman, N., Schmutzler, R.K., et al. (2010). Oral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: a proof-of-concept trial. Lancet 376, 235–244.

Vandenberg, C.J., Gergely, F., Ong, C.Y., Pace, P., Mallery, D.L., Hiom, K., and Patel, K.J. (2003). BRCA1-independent ubiquitination of FANCD2. Mol.Cell 12, 247–254.

Vollebergh, M.A., Lips, E.H., Nederlof, P.M., Wessels, L.F., Schmidt, M.K., van Beers, E.H., Cornelissen, S., Holtkamp, M., Froklage, F.E., de Vries, E.G., et al. (2010). An aCGH classifier derived from BRCA1-mutated breast cancer and benefit of high-dose platinum-based chemotherapy in HER2-negative breast cancer patients. Ann Oncol.

Xia, Y., Pao, G.M., Chen, H.W., Verma, I.M., and Hunter, T. (2003). Enhancement of BRCA1 E3 ubiquitin ligase activity through direct interaction with the BARD1 protein. J Biol Chem 278, 5255–5263.

Xu, X., Qiao, W., Linke, S.P., Cao, L., Li, W.M., Furth, P.A., Harris, C.C., and Deng, C.X. (2001). Genetic interactions between tumor suppressors Brca1 and p53 in apoptosis, cell cycle and tumorigenesis. Nat.Genet. 28, 266–271.

Zhu, Q., Pao, G.M., Huynh, A.M., Suh, H., Tonnu, N., Nederlof, P.M., Gage, F.H., and Verma, I.M. (2011). BRCA1 tumour suppression occurs via heterochromatin-mediated silencing. Nature 477, 179–184.

Chapter 5

5

116

Table S1. Genotype distribution of Brca1 C61G/+ x Brca1 C61G/+ offspring

Genotype All +/+ C61G/+ C61G/C61G n.d.

E9.5 18 6 (4.5) 9 (9) 3 (4.5) 0

E10.5 17 3 (4.25) 9 (8.5) 4 (4.25) 1*

E12.5 8 2 (2) 4 (4) 0 (2) 2*

E13.5 18 5(4.5) 10 (9) 0 (4.5) 3*

Postnatal 69 24 (17.25) 45 (34.5) 0 (17.25) 0

* = resorptionThe expected number of mice according to Mendelian ratio is depicted between brackets. Resorbed embryos are depicted with *. Embryos of which the genotype could not be determined are displayed in the nd column.

Figure S1. Characterization of BRCA1-C61G mutant mouse embryonic stem cells. A. Proliferation of Brca1-deficient mouse embryonic stem (ES) cells reconstituted with human wild type BRCA1, BRCA1-C61G or empty vector. Average of triplicate experiment ±SD is shown. B. BRCA1 protein expression levels in Brca1-deficient mouse ES cells reconstituted with human wild type BRCA1, BRCA1-C61G or empty vector. Upper band is non specific for BRCA1. PolII protein expression was used as loading control.

Supplemental InformationSupplemental figures and tables

A

B


5

117

Figure S2. Spontaneous tumor development in KB1C61GP and KB1P mice. Skin tumor-free survival of KB1C61GP (blue; T50=200 days, n=21 mice) and KB1P mice (green; T50=246 days, n=14 mice). KB1C61GP vs. KB1P Log-rank test p=0.0117. T50: median OS, n: the number of mice.

Figure S3. Molecular characterization of KB1C61GP mouse mammary carcinomas. A. Distribution of different types of mammary tumors in KB1C61GP and KB1P mice. Purple: solid carcinoma; orange: carcinosarcoma; yellow: lumen-forming carcinoma. B. Representative sections (H&E staining) of a solid mammary carcinoma, carcinosarcoma and lumen-forming carcinoma from KB1C61GP mice.

Table S2. Immunohistochemical characterization of KB1C61GP and KB1P mammary tumors

Cytokeratin 8 Vimentin ER PR

+ +/- - + +/- - + - + -

KB1C61GP 31 44 24 5 12 83 9 91 0 100

KB1P 36 46 18 8 21 71 0 100 0 100

KB1C61GP (n=45) and KB1P (n=28) mammary tumors were scored positive (+), negative (-) or partly positive (+/-) for cytokeratin 8 (CK8) and vimentin (Vim). CK8+/- = expression in mammary tubules and small tumor lobules, not in larger lobules. Vim+/- = some expression in non-solid parts of the tumor. Tumors were scored positive (+) for estrogen receptor (ER) or progesterone receptor (PR) when more than 10% of cells showed staining. Represented is the percentage of tumors.

A

B

Chapter 5

5

118

Figure S4. Olaparib response of KP, KB1P and KB1C61GP mammary tumors. Different colours represent individual spontaneous donor tumors. Panels on the left depict relative tumor volumes without treatment, panels on the right depict relative tumor volumes after olaparib treatment.

Table S3. Overview transplanted KB1C61GP mammary tumors

Donor tumor

# of tumors T1 T2 T3 T4

Transplanted 11 12 12 10

Outgrowth 6/11 12/12 10/12 10/10

No treatment 1/6 2/12 1/10 1/10

Cisplatin treatment 5/6 10/12 9/10 9/10

Cisplatin-resistant 3/5 3/10 7/9 3/9

Genetic reversion 0/3 0/3 0/7 0/3

T1 = spontaneous KB1C61GP donor tumor 1, T2 = spontaneous KB1C61GP donor tumor 2, T3 = spontaneous KB1C61GP donor tumor 3 and T4 = spontaneous KB1C61GP donor tumor 4.


5

119

A

B

Chapter 5

5

120

Figure S5. Cisplatin response of KP, KB1P and KB1C61GP mammary tumors. A. Response to cisplatin treatment of individual mice transplanted with different KB1C61GP, KB1P and KP mammary tumors. Different colours represent individual spontaneous donor tumors. Panels on the left depict relative tumor volumes without treatment, panels on the right depict relative tumor volumes after cisplatin treatment. B. OS of mice transplanted with KB1C61GP mammary tumors after cisplatin treatment (grouped per donor tumor). The red line represents OS of mice transplanted with different KB1C61GP donor tumors without treatment (T50=7 days, n=5 mice), the blue line represents OS of mice transplanted with KB1C61GP donor tumor 1 (T1) after treatment with cisplatin (T50=67 days, n=4 mice), the green line represents OS of mice transplanted with KB1C61GP donor tumor 2 (T2) after treatment with cisplatin (T50=79 days, n=10 mice), the orange line represents OS of mice transplanted with KB1C61GP donor tumor 3 (T3) after treatment with cisplatin (T50=68 days, n=9 mice) and the black line represents OS of mice transplanted with KB1C61GP donor tumor 4 (T4) after treatment with cisplatin (T50=67 days, n=8 mice). T1 treated vs. KB1C61GP untreated Log-rank test p=0.0046, T2 treated vs. KB1C61GP untreated Log-rank test p=<0.0001, T3 treated vs. KB1C61GP untreated Log-rank test p=<0.0001, T4 treated vs. KB1C61GP untreated Log-rank test p=0.0001. T50: median OS, n: the number of mice. C. Tumor-free survival of mice transplanted with KB1C61GP (blue; T50=72 days, n=32 mice), KB1P (green; T50=undefined, n=20 mice) or KP mammary tumors (red; T50=undefined, n=21 mice) after cisplatin treatment. KP vs. KB1C61GP Log-rank test p=0.8429, KB1C61GP vs. KB1P Log-rank test p=<0.0001. D. Causes of death of mice transplanted with KB1C61GP mammary tumors after cisplatin treatment (grouped per donor tumor). Mice that had to be sacrificed because of cisplatin-resistant tumors are depicted in purple, mice that had to be sacrificed because of cisplatin-toxicity are depicted in red and mice that are still alive are depicted in yellow. Percentages are indicated within the stacked bars.

C

D


5

121

Figure S6. Brca1 and satellite repeat expression in platinum-sensitive and -resistant KB1C61GP mammary tumors. A. Mouse Brca1 expression in individual donor, untreated and platinum-resistant KB1C61GP tumors. T1, T2, T3, T4 represent individual KB1C61GP donor tumors. Brca1 mRNA expression was normalized to mRNA expression of a housekeeping gene (mouse HPRT). Brca1 mRNA expression in a KP mammary tumor was set at 100%. Average of duplicate experiment ±SD is shown. B. Mouse Brca1 expression in platinum-sensitive and –resistant KB1C61GP tumors. Average of multiple tumors ±SEM is shown. C. Major and minor satellite repeat expression in KP, KB1P, platinum-sensitive and –resistant KB1C61GP tumors. Satellite repeat mRNA expression was normalized to mRNA expression of a housekeeping gene (18S RNA). Satellite repeat mRNA expression in a KP mammary tumor was set at 100%. Average of multiple tumors ±SEM is shown.

A

B

C

Chapter 5

5

122

A

B

C

D


5

123

Figure S7. Hypomorphic activity of BRCA1-C61G in vivo, but not in vitro. A. Representative FACS inmages of HR reporter assay in Brca1-deficient mouse embryonic stem (ES) cells reconstituted with wild type human BRCA1, BRCA1-C61G or empty vector with p53 knockdown. B. HR activity in mouse ES cells reconstituted with wild type human BRCA1, BRCA1-C61G or empty vector with p53 knockdown (+p53kd; right panel) or without p53 knockdown (-p53kd; left panel). Represented are the FACS percentages of cells that are able to perform HR repair (GFP-positive cells) relative to the total number of cells transfected with the HR reporter (MCherry-positive cells). Average of triplicate experiment ±SD is shown. C. Cisplatin IC50 values (in μM) of mouse ES cells reconstituted with wild type human BRCA1, BRCA1-C61G or empty vector with p53kd (right panel) or without p53kd (left panel). Average of triplicate experiment ±SD is shown. D. Olaparib IC50 values (in nM) of mouse ES cells reconstituted with wild type human BRCA1, BRCA1-C61G or empty vector with p53kd (right panel) or without p53kd (left panel). Average of duplicate experiment ±SD is shown. E. Immunofluorescence of RAD51 foci in KB1C61GP, KB1P and KP tumor cell suspensions with or without gamma irradiation (10Gy). Cells with more than 10 RAD51 foci are indicated with red arrowheads. Nuclei were visualized with DAPI (blue). All pictures were taken at a 63x magnification. The red inlay represents the part of the picture that was used for Figure 7C.

E

Chapter 5

5

124

Supplemental Experimental Procedures

Generation of the Brca1C61G alleleA mouse genomic library was screened with a mouse Brca1 exon 5 genomic probe made by PCR amplification. Overlapping genomic clones containing exons 3 to 5 were cloned with a PGKneo resistance expression cassette in reverse orientation into the targeting vector, linearized with NotI and electroporated into ES cells (GenOway). Homologous recombinants were identified by PCR using primers ex5fwd and ex5rev, yielding a product with an expected size of 931 bp. The primer sequences were as follows: Ex5fwd, 5’-CATAGCAGTAAGTCATATGCAGG-3’; Ex5rev, 5’-CTCCATCTGAAAGACTGAGT-3’. Subsequently, the product was digested with EcoNI to give products of 290 and 640 bp in the recombinant situation, while the wild-type product remained 931 bp. Positive clones were genotyped by southern blotting of EcoNI or Drd1 digested DNA and hybridized with probes generated using primers listed below. To check the 3’ arm, a probe (probe 3) was generated using the following primers: Ex6F-PR: 5’-TCTGATTCAGGAGCCTACAG-3’, Ex6R-PR: 5’-AACCAGACCAGTCTCATACAA-3’. After digestion of genomic DNA with EcoNI, southern blotting with this probe resulted in a 2.15 kb band for the recombined allele and a 4.45 kb product in the wild-type situation. To check the 5’ arm, a probe (probe 1) was generated using the following primers: NeoDrd1-8284 fwd 5’-AACAAGATGGATTGCAGCCAGGTTCTCCG-3’, NeoDrd1-8575-Rev 5’-CAGGAGCAAGGTGAGATGACAGGAGATCCT-3’. After digestion of genomic DNA with Drd1, southern blotting with this probe resulted in a product of 7.4 and 4.2 kb. To check for single integration, a probe (probe 2) was generated using the following primers: Neo-8575-Fwd 5’-AGGATCTCCTGTCATCTCACCTTGCTCCTG-3’, Neo-9067-Rev 5’-AAGAACTCGTCAAGAAGGCGATAGAAGGCG-3’. After digestion of genomic DNA with Drd1, southern blotting with this probe resulted in a product of 4.26 kb. The Neomycin cassette was removed by Cre-excision, leaving a single loxP site. Short-extension time PCR was used to assay for the presence of the remaining loxP at a 1:1 ratio with the wild-type band using primers 7610-Fwd-Neo 5’-ATTCCCTACCCTGTCATGTGC-3’, 9510-Rev-Neo 5’-TCGAATGGCTCATGGACAAGCGG-3’ (expected size wild-type: 159 bp) and using the mouse Brca1 exon 5 PCR described above. Chimeric mice were produced by microinjection of targeted ES cells into 3.5 day C57BL/6J blastocysts that were transferred to CD1 pseudopregnant foster mothers. Chimeric males were mated with C57BL/6J females and germline transmission of the mutant allele was verified by PCR analysis of tail DNA from F1 offspring with agouti coat colour (GenOway). F2 offspring from heterozygous intercrosses were genotyped by PCR. Heterozygous males were back-crossed on C57BL/6J females and 129Sv females for 10 generations.

Embryo isolationsTimed matings were performed between Brca1C61G heterozygous male and female mice. The impregnated females were sacrificed at various time points after conception and uteri were isolated in ice-cold PBS. The embryos were isolated by removing the muscular wall of the uterus, Reichert’s membrane and visceral yolk sac. The visceral yolk sac was used for genotyping.

Animals, generation of mammary tumors and orthotopic transplantation into wild-type miceThe generation of K14cre;Brca1F/F;p53F/F (KB1P) mice has been described previously (Jonkers


5

125

et al., 2001; Liu et al., 2007). Brca1C61G/+ mice were bred with KB1P animals to generate K14cre;Brca1C61G/F;p53F/F (KB1C61GP) and littermate control mice. These animals were checked biweekly from the age of 4 months onward for onset of tumor growth and overall appearance. After tumor onset, mammary tumor size was determined regularly by caliper measurements. Tumors were harvested at a maximal size of 1000 mm3 (formula tumor volume: 0.5 x length x width2). FVB:129/Ola F1 hybrid females were used for orthotopic transplantations of mammary tumors. Small tumor fragments (1-2mm in diameter) were transplanted orthotopically in the fourth mammary fat pad of adult F1 hybrid female mice as described (Rottenberg et al., 2007).

DrugsCisplatin (1 mg/ml in saline-mannitol) originated from Mayne Pharma. Olaparib was kindly provided by Astrazeneca. Olaparib was used by diluting 50 mg/ml stocks in DMSO with 10% 2-hydroxyl-propyl-β-cyclodextrine/PBS such that the final volume administered by intraperitoneal injection was 10 μl/g of body weight. Nimustine hydrochloride (1 g; Sigma) was dissolved in 6.5 ml DMSO and immediately before injection 25-fold diluted in physiologic salt solution.

Treatment of mammary tumor-bearing animalsMaximum tolerable dose (MTD) levels of cisplatin, olaparib and nimustine were determined in earlier studies (Rottenberg et al., 2007, 2008; Evers et al., 2010). 6 mg/kg of cisplatin was administered by intravenous injection in the tail vein. 50 mg/kg of olaparib was administered daily for 28 consecutive days by intraperitoneal injection. 30 mg/kg of nimustine was administered by intraperitoneal injection. Treatment at MTD levels was initiated when the tumor volume, calculated as 0.5 x length x width2, exceeded 200 mm3. To determine whether tumors would acquire resistance to cisplatin, animals received multiple doses of cisplatin. An animal was retreated two weeks after the initial treatment if the tumor volume was larger than 50%. If the tumor volume two weeks after the initial treatment was smaller than 50%, an animal was not retreated until the tumor volume reached 100%. Animals were sacrificed when the tumor volume exceeded 1500 mm3 or because of severe weight loss due to toxicity of the drug.

DNA isolation, southern blot analysis and genotypingFor routine genotyping tail DNA samples or yolk sacs were lysed in DirectPCR lysis reagent (Viagen) supplemented with 100mg/ml proteinase K (Sigma Aldrich). The Brca1F allele was detected by PCR amplification of the loxP site in intron 3 with primers P1 and P2, yielding products of 545 bp and 390 bp for the floxed and wild-type alleles, respectively. Detection of the Brca1del allele with primers P1 and P3 yielded a 594-bp fragment. The primer sequences were as follows: P1, 5'-TAT CAC CAC TGA ATC TCT ACC G-3'; P2, 5'-GAC CTC AAA CTC TGA GAT CCA C-3' and P3, 5'-TCC ATA GCA TCT CCT TCT AAA C-3'. For all PCR reactions, thermocycling conditions consisted of 30 cycles of 30 sec at 94°C, 30 sec at 58°C, and 50 sec at 72°C. Reactions contained approximately 200 ng of template DNA, 0.5 mM primers, 100 mM dNTPs, 2.5 units of Taq DNA polymerase, 2.5 mM MgCl2, and 10 x PCR buffer in a total volume of 20 μl. The Brca1C61G allele was detected in multiple ways: by PCR amplification of the region across the single remaining loxP site (Figure 1A; primers SET 1), by PCR amplification of the region around the mutation itself in exon 5 (Figure 1A; primers SET 2) or by probe-based melting curve analysis. PCR amplification of

Chapter 5

5

126

the remaining loxP site uses primers P4 and P5 yields products of 209 bp and 159 bp for the mutant and wild-type allele, respectively. The Brca1C61G mutation itself was detected by PCR amplification with primers P6 and P7, yielding a product of 931 bp. Subsequently, this product was purified and digested with the EcoN1 enzyme. While the wild-type allele remains uncut, digestion of the mutant allele results in a product of 96 bp and a product of 475 bp. The primer sequences were as follows: P4, 5’-ATT CCC TAC CCT GTC ATG TGC-3’; P5, 5’-TCG AAT GGC TCA TGG ACA AGC GG-3’; P6, 5-‘CAT AGC AGT AAG TCA TAT GCA GG-3’ and P7, 5’-CTCCATCTGAAAGACTGAGT-3’. For melting curve analysis, we used the LightCycler 480 instrument of Roche Applied Science. We designed the following probes and primers for melt curve genotyping: Anchor HybProbe, 5’-LC640-CCC TTT CTT CTG GTT AAG AAG TTT CAG CA--PH; Sensor HybProbe, 5’-TTC TTA CAC AAA GGA CCT TGT GAA G--FL; Primer forward, 5’-CCT TTT CCT GCC ATG TT-3’; Primer reverse, 5’-TGT TGC CTT TTG AGT GTT C-3’. Probe-based melting curve genotyping results in different melting peaks for the Brca1+ or the Brca1C61G allele. Heterozygous alleles show two distinct peaks representing both the Brca1+ and the Brca1C61G allele. For southern blot analysis we made use of the introduction of an EcoN1 restriction site by the Brca1C61G mutation. Southern blot analysis was performed using 10 mg genomic DNA, digested with EcoN1 to determine the status of Brca1. Genomic DNA was isolated from tissue by proteinase K lysis and organic extraction with phenol-chloroform. Blotting and hybridization were performed as described previously (Jonkers et al., 2001). Probes were radioactively labeled by PCR. Primers for amplification of the 310-nt Brca1 intron 4 probe were: forward primer, 5'-GAT AGT GCA ACT CTT AAA GC -3'; and reverse primer, 5'-ACA CGA CTA ACT CAT AAC TG -3'. Hybridization of EcoN1 digested DNA to the Brca1 intron 4 probe resulted in 4.5kb and 2.5kb bands for the Brca1+ and Brca1C61G allele, respectively.

Array comparative genome hybridization and data analysisGenomic DNA of tumor and spleen samples was extracted by proteinase K lysis and organic extraction with phenol-chloroform. Tumor and spleen samples were labeled with Nimblegen dual-color DNA labeling kit and hybridized to Nimblegen 12-plex 135K full genome mouse custom NKI array. Background correction and normalization was performed in the NimbleScan program. Probe annotation and corrected log2 ratios were imported into the R programming language from the NimbleScan output. Probes mapping to Y and mitochondrial chromosomes were discarded. CGH data was segmented using the DNAcopy (Venkatraman and Olshen, 2007)software package (available in the R-programming language package BioConductor). We used standard parameter settings and the standard-deviation based segmentation undo function. To determine whether there is a global difference in genomic instability we counted all segments per tumor per genotype. To discount outlier or noise based segments we counted only those segments that spanned more than 10 probes on the array. We used the Wilcoxon rank sum test between tumor groups to find a significantly different number of segments per tumor. To find genomic loci of significant difference between the groups of tumors we applied the comparative module of the R package KCsmart (as available in BioConductor; (Klijn et al., 2008; de Ronde et al., 2010). All comparisons were performed using standard parameters (sigma = 1 Mb, 1000 permutations, p < 0.05). In short: a smoothed profile for each individual tumor was computed. The SAM algorithm as implemented in the multitest R-package was used to calculate significantly different copy number changes for discrete


5

127

sample points along the mouse genome.

SequencingSequencing was done using Big Dye Terminator v3.1 cycle sequencing kit (Applied Biosystems). Sequencing was performed on both genomic DNA and cDNA of tumors and spleens. The following primers were used for sequencing the Brca1C61G mutation on genomic DNA: F1 (fwd-intES), 5’-CAT AGC AGT AAG TCA TAT GCA GG-3’; R1 (Rev-int5), 5’-CTC CAT CTG AAA GAC TGA GT-3’; F2 (Fwd-INT-4-1), 5’-CAT TCG TGG CTG TTG CC-3’; R2 (Rev-Int5-N2), 5’-CAG CAG ATG TCT CAT AAA AAC TTC C-3’. The following primers were used for sequencing the first 8 exons of mouse Brca1 on genomic DNA: F3 (mBrca1 exon 1 fwd), 5’-AAA GCC CTT TAA TGT AGT TTA ATT GC-3’; R3 (mBrca1 exon 1 rev), 5’-TCA TTT GCA TGA ACA GTA ACC AC-3’; F4 (mBrca1 exon 2 fwd), 5’-CCT CTT TAG CCA AAA CCA AGT G-3’; R4 (mBrca1 exon 2 rev), 5’-GCT GTG CAG TGA AGA ACA CG-3’; F5 (mBrca1 exon 3 fwd), 5’-GCT GTT GCC TTT TGA GTG TTC-3’; R5 (mBrca1 exon 3 rev5’-AT), T AAT TTC TAC CTT TTC CTG CC-3’; F6 (mBrca1 exon 4 fwd), 5’-CGG AAA GCT ACA ATC CAT GTG-3’; R6 (mBrca1 exon 4 rev), 5’-AAT GCG CTC AGG TTT CCA C-3’; F7 (mBrca1 exon 5 fwd), 5’-GAC GCC ACC ACC ACT AGG-3’; R7 (mBrca1 exon 5 rev), 5’-GCC ACT AAA TGT ACA ATC ACC ATC-3’; F8 (mBrca1 exon 6 fwd), 5’-CAT TTT ATG TTG CTG GCC TTC-3’; R8 (mBrca1 exon 6 rev), 5’-CTC CAT GCA ACA CAT ACA CAT C-3’; F9 (mBrca1 exon 7 fwd), 5’-TTT TGG GTT GTT TGT TTT GG-3’; R9 (mBrca1 exon 7 rev), 5’-TGA TCT AAA TCT AGG CTC CTC AAT AC-3’; F10 (mBrca1 exon 8 fwd), 5’-TGA TCT TGC ACA TTT GAC TGA G-3’; R10 (mBrca1 exon 8 rev), 5’-TGA TGG GAA TAA TGG AAC GG-3’. All forward primers had a 5’-AGC TAA GCG CGA GAA GGC-3’ universal sequencing tag. All reverse primers had a 5’-GCT TTA CCG CTC AAC CGT T-3’ universal sequencing tag. The following primers were used for sequencing the first 10 exons of mouse Brca1 on cDNA: F11 (mBrca1 exon 1 fwd), 5’-CTT GGG GCT TCT CCG TCC TC-3’; R11 (mBrca1 exon 6 rev), 5’-CGC TCA CAA GAA TTA TTT CTC-3’; F12 (mBrca1 exon 5 fwd), 5’-GAA GAG CTG CTG AGA ATA ATG-3’; R12 (mBrca1 exon 9 rev), 5’-CTT CAT CTC CAG CTT CTT G-3’; F13 (mBrca1 exon 7 fwd), 5’-GAA TCG TGA GAT CAG TGA A-3’; R13 (mBrca1 exon 11 rev), 5’-CAG TTG CAT GAT TCT CAG TAG G-3’.

RNA isolation and RT-PCR analysisTotal RNA from ES cells and mouse tissues was isolated using Trizol (Invitrogen). The integrity of RNA was verified by denaturing gel electrophoresis. Before cDNA synthesis, RNA samples were treated with RQ1 RNase-free DNase (Promega) to degrade both double- and single stranded DNA and with RNasin (promega) to inhibit activity of RNases. Subsequently, cDNA was synthesized using random hexamer primers and cloned AMV reverse transcriptase (Invitrogen). RT-PCR for mouse Brca1 and housekeeping gene (HPRT) was performed using the following primers: Mouse Brca1 ex10 forward, 5’-GAG ATG AAG GCA AGC TGC-3’; Mouse Brca1 ex11 reverse, 5’-CAG TTG CAT GAT TCT CAG TAG G-3’; Mouse HPRT forward, 5’-CTG GTG AAA AGG ACC TCT CG-3’; Mouse HPRT reverse, 5’-TGA AGT ACT CAT TAT AGT CAA GGG CA-3’. RT-PCR for minor/major satellite repeats and housekeeping gene (18S RNA) was performed with primers described by Zhu and colleagues (Zhu et al., 2011). LightCycler 480 SYBR Green I Master (Roche Applied Science) was used for amplification and detection of cDNA target. RT-PCR was carried out on the LightCycler 480 instrument of Roche Applied Science.

Chapter 5

5

128

Generation of RMCE donor vectors containing human BRCA1C61G mutationHuman BRCA1 cDNA from a pcDNA3B-Mycx3-BRCA1 expression construct was subcloned into a vector for recombination mediated cassette exchange (RMCE) (Seibler et al., 2005) under control of the EF1α promoter. The BRCA1C61G mutation was introduced by site-directed mutagenesis using the QuickChange Lightning protocol (Stratagene) and verified by sequencing the complete human BRCA1 cDNA region.

Generation of human BRCA1 transgenic ES cellsThe wild type Rosa26 allele of R26CreERT2 Brca1SCo/Δ ES cells (Bouwman et al., 2010) was provided with Frt and F3 sites for Flp RMCE as described (Seibler et al., 2005). RMCE of human BRCA1 cDNA containing exchange vectors was performed by cotransfection with a Flpe expression construct (pFlpe) (Buchholz et al., 1998) using Lipofectamine 2000 (Invitrogen) and selected using 200 μg/ml G418. Correct RMCE was confirmed by PCR using a common Rosa26 specific primer (5’-ACCTTTCTGGGAGTTCTCTG-3’) in combination with primers specific for the RMCE allele before (5’-GCGGTACTTCATGGTCATC-3’) and after recombination (5’-CGTCCTGCAGTTCATTCA-3’) and expression of human BRCA1 was analyzed by western blotting using a polyclonal human BRCA1 specific antibody (9010; Cell Signalling). G418 resistant cells were subcloned and provided with a Pim1 targeted I-SceI based DR-GFP reporter construct for homologous recombination (Moynahan et al., 1999; Bouwman et al., 2010). For experiments on a p53-deficient background cells were infected with a lentiviral p53 shRNA (5'-AGAGTATTTCACCCTCAAGAT-3') (Bouwman et al., 2010) before targeting with the DR-GFP reporter. Knockdown was confirmed by western blot analysis. Correctly targeted clones were identified by PCR over the 5’ homology arm of the targeting construct using Pim1 specific primers (5’- ATCAACTCCCTGGCCCACCT-3’ and 5’-GGCCTGGCTCACCATCAAAG-3’).

Drug sensitivity and HR reporter assaysMouse Brca1 expression was switched off by overnight incubation with 0.5 μM 4-OHT. One week after switching cells were seeded in triplicate at 1000 cells/well in 96-well plates for drug sensitivity assays as described previously (Bouwman et al., 2010). HR reporter assays were performed by Lipofectamine 2000 (Invitrogen) transfections of I-SceI-mCherry plasmid which was generated by providing the cBas I-SceI expression plasmid with CMV-mCherry (Clontech). 48 hours after transfection mCherry/GFP double positive cells were monitored by flow cytometry on a FACS CyAn ADP (Beckman Coulter) and analyzed using Summit software.

AntibodiesThe following primary antibodies were used for immunohistochemistry: rat anti-cytokeratin 8 (University of Iowa Troma-1; 1:600), rabbit anti-vimentin (Abcam ab45939; 1:1500), rabbit anti-progesterone receptor (Neomarkers RM-9102-SO; 1:300), rabbit anti-estrogen receptor alpha (Santa Cruz SC-542; 1:1750), rabbit anti-cleaved caspase-3 (Cell Signaling Asp175 9661L; 1:100), rabbit anti-ki67 (Monosan PSX1028; 1:1000) and rabbit anti-phospho-histone H2A.X (Cell Signaling 2577; 1:50). The following secondary antibodies were used for immunohistochemistry: biotin-conjugated anti-rat (Santa Cruz SC-2041; 1:100), biotin-conjugated anti-rabbit (Dako E0432; 1:1000) and HRP-conjugated anti-rabbit Envision (Dako K4009). The following primary antibodies were used for western


5

129

blot analysis: goat anti-PolII (Santa Cruz C-18; 1:200), rabbit anti-mouse Brca1 (1:500), rabbit anti-human BRCA1 (9010; Cell Signalling; 1:1000) and mouse anti-p53 (IMX25; Monosan; 1:1000). The following secondary antibodies were used for western blot analysis: HRP-conjugated rabbit anti-goat (Dako) and HRP-conjugated goat anti-rabbit (Dako). Rabbit anti-RAD51 (1:10000) was used as a primary antibody for immunofluorescence studies. Goat-anti-rabbit Alexa fluor 568 (Invitrogen; 1:400) was used as secondary antibody for immunofluorescence studies.

Histology and immunohistochemistryTissues were isolated and fixed in formaldehyde for 48 hours. Tissues were rehydrated, cut into 4 μm sections and stained with hematoxylin and eosin. For immunohistochemical staining for phospho-histone H2A.X, progesterone receptor, ki67, cleaved caspase-3 and cytokeratin 8, antigen retrieval was performed with citra solution (Biogenex HK086-5K). For immunohistochemical staining for estrogen receptor alpha, antigen retrieval was performed with citraconic anhydride 0.05% (Fluka 27429). For immunohistochemical staining for vimentin, antigen retrieval was performed with Tris/EDTA pH 9.0. Subsequently, endogenous peroxidases were blocked with 3% H2O2. Before slides were incubated with vimentin or ki67 primary antibodies, slides were pre-incubated with 1% milk/PBS. Before slides were incubated with primary antibodies for phospho-histone H2A.X, cleaved caspase-3 or progesterone receptor, slides were pre-incubated with PBS/4% BSA/5% NGS. Next, slides were incubated with HRP-conjugated Envision (Dako) or stained with biotin-conjugated secondary antibodies and incubated with HRP-conjugated streptavidin-biotin complex (Dako). Following detection with 3,3-diaminobenzidine-tetrahydrochloride (DAB; Sigma A-6926), slides were counterstained with heamatoxylin and dehydrated. Tumors were only scored positive for ER or PR, when more than 10% of tumor cells stained positive. To quantify γH2AX foci in tumor sections, at least 500 tumor cells per section were counted using a 20x magnification lens. Cells were scored γH2AX-positive if they had more than one γH2AX dot per nucleus.

ImmunoblottingTumor protein lysates were made by using a microhomogenizer and RIPA lysis buffer (50mM Tris pH 8.0, 150mM NaCl, 0.1% SDS, 0.1% deoxycholate, 1% NP40) complemented with 2x Complete protease inhibitor cocktail (Roche) and Pefabloc (Roche; 1mg/ml). Following homogenizing on ice, tumor lysates were kept on ice for 30 minutes. After a short spin, protein concentrations were determined with the BCA assay (Pierce). Samples were prepared for gel electrophoresis by adding 4x NuPage LDS sample buffer (Invitrogen) and incubated for 5 minutes at 100˚C to denature proteins. Samples were fractionated on 3-8% NuPage Tris-Acetate precast gels (Invitrogen) in the presence of 10x NuPage reducing agent and transferred onto Immobilon-PVDF membranes (Millipore) in transfer buffer (0.4M Glycine, 50mM Tris, 0.01% SDS) overnight at 100mA at 4˚C. Membranes were blocked for 1 hour at room temperature in 5% milk (Campina) in TBST (25mM Tris pH 7.5, 125mM NaCl, 0.1% Tween). Subsequently, membranes were incubated with primary antibodies in 1% milk/TBST for 1 hour at room temperature (POLII) or for 4 hours at 4˚C (mBRCA1). After three washes with 1% milk/TBST, membranes were incubated with secondary antibodies in 1% milk/TBST for 1 hour at room temperature. Membranes were washed three times with 1% milk/TBST and once with TBS (25mM Tris pH 7.5, 125mM NaCl). For detection of proteins, the ECL plus western blotting detection system (Amersham) was used.

Chapter 5

5

130

RAD51 foci formation assayCryo-preserved tumors were cut into small pieces with sterile scalpels (Swann Morton) in PBS (Invitrogen) supplemented with 0.5mM EDTA (Lonza). Subsequently, tumor pieces were digested with 0.1% trysin (Invitrogen) and 3mg/ml collagenase A (Roche) for 30 minutes at 37˚C. Tumor cell suspensions were passed through a 40uM cell strainer (BD Biosciences). After cell counting, appropriate amount of tumor cells were plated on glass coverslips (Omnilabo) and grown for 36-48 hours at 37˚C in low oxygen (3%) condition. Cells were treated with 10 Gy gamma irradiation to induce DNA repair foci at DNA DSBs. After irradiation, cells were incubated for 6 hours at 37˚C, washed with PBS++ (containing 1mM CaCl2 and 0.5mM MgCl2) and fixed using 2% paraformaldehyde (PFA; Merck) in PBS++ for 20 minutes at room temperature. Fixed cells were washed three times with PBS++ and stored overnight at 4˚C. The next day cells were incubated in 0.2% Triton X-100 (Sigma) in PBS++ for permeabilization and washed three times in staining buffer (PBS++ containing 0.5% BSA (Sigma), 0.15% glycin (Fluka) and 0.1% Triton X-100 (Sigma) for 5 minutes at a rocking plate. To block aspecific interactions, cells were incubated for 30 minutes in staining buffer at room temperature. Subsequently, cells were incubated with the primary antibody against RAD51 (1:10000 in staining buffer) for 2 hours at room temperature. After three washes in staining buffer, cells were incubated with the secondary antibody for 1 hour at room temperature. After three additional washes in staining buffer, cells were stained with DAPI (Invitrogen; 0.5μg/ml in staining buffer) for 5 minutes at room temperature. Cells were washed once in staining buffer and then coverslips were mounted in Vectashield H1000 (Vector Laboratories). Pictures were taken by using an AxioObserver Z1 inverted microscope (Zeiss) equipped with a cooled ORCA AG black and white CCD camera (Hamamatsu) and AxioVision 4.7.2 software (Zeiss). To quantify RAD51 foci in single tumor cells, 150-200 cells per condition were counted blindly using a 63x magnification lens. Cells were scored RAD51-positive if they had more than ten RAD51-positive dots per nucleus.

Supplemental referencesBuchholz, F., Angrand, P.O., and Stewart, A.F. (1998). Improved properties of FLP recombinase evolved by cycling mutagenesis. Nat. Biotechnol. 16, 657–662.

Jonkers, J., Meuwissen, R., van der Gulden, H., Peterse, H., van der Valk, M., and Berns, A. (2001). Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat Genet 29, 418–425.

Seibler, J., Küter-Luks, B., Kern, H., Streu, S., Plum, L., Mauer, J., Kühn, R., Brüning, J.C., and Schwenk, F. (2005). Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67.

Venkatraman, E.S., and Olshen, A.B. (2007). A faster circular binary segmentation algorithm for the analysis of array CGH data. Bioinformatics 23, 657–663.


5

131

Chapter 6 BRCA1185delAG tumors may acquire therapy resistance through expression of a RING-less BRCA1 protein via internal translation reinitiation

Rinske Drost1, Ute Boon1, Eva Schut1, Ellen Wientjens1, Mark Pieterse1, Dafni Chondronasiou1, Christiaan Klijn1, Sjoerd Klarenbeek1, Hanneke van der Gulden1, Ingrid van der Heijden1, Sven Rottenberg1, Peter Bouwman1 and Jos Jonkers1

Manuscript in preparation

1 Division of Molecular Pathology and Cancer Systems Biology Centre, the Netherlands Cancer Institute, Amsterdam, 1066 CX, the Netherlands

Chapter 6

6

134

Women with heterozygous germline mutations in BRCA1 have a strongly increased lifetime risk of developing breast and/or ovarian cancer. Particularly the role of BRCA1 in repair of DNA double-strand breaks through homologous recombination appears to be critical for maintenance of genomic stability and tumor suppression. Through their defect in HR, BRCA1-deficient cells are highly sensitive to treatment with DSB-inducing agents. It was recently shown, however, that not all biochemical functions of BRCA1 are equally important for its role in tumor suppression and therapy response. In the current study we have investigated the effects of the two most common BRCA1 founder mutations, BRCA1185delAG and BRCA15382insC, on tumor development, therapy response and resistance in genetically engineered mouse models. While mice carrying the Brca1185delAG and Brca15382insC mutation develop mouse mammary tumors with the same latency and characteristics, Brca1185delAG tumors respond significantly worse to DSB-inducing therapy than Brca15382insC tumors. The poor response of Brca1185delAG tumors is probably caused by expression of a RING-less BRCA1 protein, which may be produced via internal translation reinitiation. This mutant BRCA1 protein is also expressed in human BRCA1185delAG mutant breast cancer cells and has residual activity in DNA damage signaling. Together our results indicate that expression of the RING-deficient BRCA1 protein may promote therapy resistance of BRCA1185delAG tumors in mice and human patients.

Introduction

Breast cancer is one of the most common malignancies in women, accounting for almost one in three diagnosed cancers, and it is the second leading cause of cancer death among women in Western countries (DeSantis et al., 2011). 5-10% of all breast cancer cases have a hereditary component and 30-80% of all hereditary cases are attributable to mutations in BRCA1 or BRCA2. Germline mutations in the BRCA1 gene predispose to hereditary breast and ovarian cancer (HBOC) with 80-90% lifetime risk for developing breast cancer and 40-50% for ovarian cancer (Rahman and Stratton, 1998). Germline BRCA1 mutations are scattered throughout the 81 kb-long gene that encompasses 22 coding exons (Smith et al., 1996). Of the known BRCA1 mutations, the majority is predicted to result in premature termination of protein translation thereby making them targets for nonsense-mediated mRNA decay (NMD), an evolutionarily conserved mechanism that prevents synthesis of potentially harmful protein products (Conti and Izaurralde, 2005; Lejeune and Maquat, 2005). These mutations consist of small deletions (70%) and insertions (10%) that generate frameshifts, single base substitutions that produce termination codons (10%) and splice site errors (5%) (Rahman and Stratton, 1998). In most populations a large number of different BRCA1 mutations can be found; however, in certain ethnic populations only a few mutations, so-called founder mutations, account for almost all breast and/or ovarian cancer families attributable to BRCA1. For example, two founder mutations in BRCA1 (185delAG and 5382insC) account for the vast majority of BRCA1 mutations in the Ashkenazi Jewish population (Rahman and Stratton, 1998; Phelan et al., 2002). The BRCA1185delAG mutation is carried by 1% of the Jewish Ashkenazim population, while the BRCA15382insC mutation is present in 0.15% of Ashkenazi Jews (Struewing et al., 1995; Roa et al., 1996). The prevalence of these mutations in unselected ovarian cancer patients of Ashkenazi origin was found to be close to 30% and may even reach over 50% in patients with a family history of breast and/or ovarian cancer

Therapy resistance of BRCA1185delAG tumors is mediated by RING-less BRCA1

6

135

(Moslehi et al., 2000; Frank et al., 2002; Levy-Lahad and Friedman, 2007). Especially the role of BRCA1 in homologous recombination (HR)-mediated repair of DNA double-strand breaks (DSBs) appears to be important in maintenance of genomic stability and tumor suppression (Moynahan et al., 1999; Huen et al., 2010). Impaired HR also renders BRCA1-deficient cells extremely sensitive to DSB-inducing agents, like platinum drugs (Bhattacharyya et al., 2000). In line with this, patients with BRCA1-mutated ovarian cancer had a better prognosis after platinum-based chemotherapy than non-mutation carriers (Boyd et al., 2000; Ben David et al., 2002; Foulkes, 2006; Chetrit et al., 2008). More recently, it was also shown that BRCA1 mutation carriers were highly sensitive to neo-adjuvant cisplatin chemotherapy and that the degree of response to cisplatin exceeded that of non-mutation carriers with triple-negative breast cancer (Byrski et al., 2010). Moreover, patients harboring breast tumors with a BRCA1-like genomic profile had a significantly greater benefit from high-dose platinum-based chemotherapy versus conventional chemotherapy than patients with non-BRCA1-like tumors (Vollebergh et al., 2010). Also chemical inhibitors of poly (ADP-ribose) polymerase (PARP), an enzyme involved in DNA single-strand break (SSB) repair, are effective against BRCA-deficient tumors in preclinical models (Bryant et al., 2005; Farmer et al., 2005; Rottenberg et al., 2008) and in patients carrying BRCA mutations (Fong et al., 2009, 2010; Audeh et al., 2010; Tutt et al., 2010; Gelmon et al., 2011). PARP inhibition results in an increased number of DSBs due to replication fork collapse at SSBs. PARP inhibition is therefore selectively toxic in cells that lack HR-mediated DSB repair, such as BRCA1/2-deficient tumor cells. The BRCA1 gene encodes for a protein of 1.863 amino acids (aa) that contains a highly conserved amino-terminal RING domain and tandem BRCT repeats at its carboxyl terminus (Huen et al., 2010). The RING domain of BRCA1 is required for stable interaction with BARD1 and the BRCA1/BARD1 heterodimer has E3 ubiquitin ligase activity with the class of UbcH5 E2 ubiquitin conjugating enzymes (Mallery et al., 2002; Xia et al., 2003). The observation that BRCA1/BARD1-dependent ubiquitin conjugates occur at DSBs suggests that the BRCA1/BARD1 heterodimer is important for DNA repair and thereby for the tumor suppressive function of BRCA1 (Morris and Solomon, 2004). BRCA1 has been reported to interact with numerous proteins involved in repair, cell cycle checkpoint, transcription and chromatin remodeling through its BRCT domains (Scully et al., 1997a, 1997c; Anderson et al., 1998; Yarden and Brody, 1999; Bochar et al., 2000). Recently studies showed that not all biochemical activities of BRCA1 are equally important for its role in tumor suppression and therapy response (Patel et al., 2011). Using genetically engineered mouse models, Shakya and coworkers showed that loss of the BRCA1 E3 ligase activity does not lead to tumor formation, while loss of BRCT phosphoprotein binding does (Shakya et al., 2011). We showed that BRCA1 RING function is essential for tumor suppression, but that its loss does not lead to hypersensitivity to homologous recombination deficiency (HRD)-targeted therapy (Drost et al., 2011). Mouse mammary tumors that express a mutant BRCA1-C61G protein, which lacks a functional RING domain, respond much worse to DSB-inducing therapy than Brca1 null tumors. In addition, tumors carrying the Brca1C61G mutation rapidly develop therapy resistance whilst retaining the Brca1 mutation (Drost et al., 2011). These data suggest that the mutant BRCA1-C61G protein has some residual activity in the DNA damage response. This may not only hold true for the BRCA1C61G missense mutation, but also for other BRCA1 mutations and could indicate the existence of differences in therapy response and resistance between different BRCA1 mutation carriers.

Chapter 6

6

136

In the present study we have investigated the effects of the two most common BRCA1 nonsense mutations, namely BRCA1185delAG and BRCA15382insC, on tumor development, therapy response and resistance in genetically engineered mouse models.

Results

Generation of Brca1185stop and Brca15382stop allelesIn order to mimic the human BRCA1185delAG and BRCA15382insC mutations in mice we used short synthetic single-stranded oligodeoxyribonucleotides to introduce mutations into the genome of mouse embryonic stem cells (mESCs). It has been shown previously that this technique requires (transient) suppression of DNA mismatch repair (MMR) by knockdown of MLH1 or knockout of MSH2 or MSH3 (Dekker et al., 2003, 2006, 2011; Aarts et al., 2006). In order to mimic the BRCA1185delAG mutation as closely as possible we introduced the Brca1185stop mutation in MLH1-knockdown mESCs by substitution of three nucleotides (TCC to AAG), thereby creating an early STOP codon at aa 24 (Figure 1A). We used MSH3-knockout mESCs to insert 4 nucleotides (AGGA) to generate the Brca15382stop mutation, which results in premature protein truncation at aa 1713 and closely resembles the human BRCA15382insC mutation (Figure 1B). Brca1185stop and Brca15382stop mutant mESCs were injected into 3.5 day C57BL/6J blastocysts to generate chimeric mice. Chimeric mice were mated with C57BL/6J females and germline transmission of the mutant alleles was verified by melting curve genotyping, PCR and sequencing (Figure 1C-D and data not shown).

Embryonic lethality of homozygous Brca1185stop and Brca15382stop miceTo determine the effect of the Brca1185stop and Brca15382stop mutation on normal mouse development, we intercrossed heterozygous Brca1185stop or Brca15382stop to produce homozygous offspring. No homozygous pups were born (Table S1), indicating that homozygous Brca1185stop or Brca15382stop mutations lead to embryonic lethality. To study at which stage of embryonic development homozygous Brca1185stop and Brca15382stop mice die, embryos were harvested and genotyped at several time points after gestation. Although (resorbed) homozygous Brca1185stop and Brca15382stop embryos could still be recovered at embryonic day (E) 12.5-13.5 (Table S1), they were already severely delayed in development at E9.5 compared to wild type and heterozygous embryos (Figure 1E-F).

Mammary tumor development in K14cre;Brca1F/185stop;p53F/F and K14cre;Brca1F/5382stop;p53F/F miceTo investigate the influence of Brca1185stop and Brca15382stop mutations on tumor development, we introduced both alleles independently in the K14cre;Brca1F/F;p53F/F (KB1P) mouse model, in which epithelium-specific deletion of Brca1F and p53F alleles predisposes to mammary and skin tumor formation (Liu et al., 2007). The resulting mice carry one Brca1185stop or Brca15382stop allele throughout their body and loose the remaining Brca1 wild type allele in specific tissues including mammary gland (Figure 2A). We crossed heterozygous Brca1185stop and Brca15382stop mice with KB1P animals to generate cohorts of K14cre;Brca1F/185stop;p53F/F

(KB1(185stop)P) mice, K14cre;Brca1F/5382stop;p53F/F (KB1(5382stop)P) mice and KB1P littermate controls (Figure 2A). All cohorts were monitored for spontaneous tumor formation, but no significant differences in tumor-free survival (TFS) could be observed between KB1(185stop)P, KB1(5382stop)P and KB1P control mice (Figure 2B; KB1(185stop)P T50 = 186


6

137

CAG AAA ATC TTA GTG TCC CAT CTG GTA Q K I L V S H L S (11aa) STOPQ K I L E STOP

CAG AAA ATC TTA GAG TGA AGG ATC TGG

BRCA1185stop

DNAproteinHuman

Mouse DNAprotein

BRCA15382stop

CCA AAG CGA GCA AGA GAA TCC CCA GGAP K R A R E S P G (71aa) STOPP R R S R E S G P (12aa) STOP

CCA AGG CGA TCC AGA GAA TCA GGA CCG

Human

Mouse

DNAprotein

DNAprotein

wt

homhet

Temperature (C)-(d/d

T) F

luor

esce

nce

-(d/d

T) F

luor

esce

nce

Temperature (C)

wt

homhet

Brca1185stop Brca15382stop

1 mm

Brca1+/+

1 mm

Brca1185stop/+

1 mm

Brca1185stop/185stop

1 mm 1 mm 1 mm

Brca1+/+ Brca15382stop/+ Brca15382stop/5382stop

Figure 1. Characterization of Brca1 mutant alleles. A. Protein and DNA sequences of human BRCA1185delAG and mouse Brca1185stop mutation. Mutation is indicated in red. The number of amino acids (aa) until the STOP codon is indicated between brackets. B. Protein and DNA sequences of human BRCA15382insC and mouse Brca15382stop mutation. C. Melting curve genotyping of Brca1185stop mutant mice. wt= Brca1+/+, het= Brca1185stop/+ and hom= Brca1185stop/185stop. D. Melting curve genotyping of Brca15382stop mutant mice. wt= Brca1+/+, het= Brca15382stop/+ and hom= Brca15382stop/5382stop. E. Embryonic lethality of homozygous Brca1185stop mice. Pictures of Brca1+/+, Brca1185stop/+

and Brca1185stop/185stop embryos at embryonic day 9.5 (E9.5). Scale bar represents 1 mm. F. Embryonic lethality of homozygous Brca15382stop mice. Pictures of Brca1+/+, Brca15382stop/+ and Brca15382stop/5382stop embryos at E9.5.

A

B

C D

E

F

Chapter 6

6

138

days, KB1(5382stop)P T50 = 200 days, KB1P T50 = 196 days; KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=0.4510). For all cohorts the median TFS was around 200 days, which is similar to what has been described previously for KB1P mice (Liu et al., 2007) and for mice carrying the Brca1C61G mutation (Drost et al., 2011). In addition, no differences in TFS could be detected between cohorts when only mammary tumors (Figure 2C; KB1(185stop)P T50 = 184 days, KB1(5382stop)P T50 = 206 days, KB1P T50 = 197 days; KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=0.0415) or only skin tumors (Figure S1A; KB1(185stop)P T50 = 177 days, KB1(5382stop)P T50 = 191 days, KB1P T50 = 193 days; KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=0.5456) were taken into account. Mammary and skin TFS was comparable between KB1P mice derived from the 185delAG cohort and from the 5382insC cohort (Figure S1B-C; Mammary TFS: 185delAG cohort vs. 5382insC cohort Log-rank test p=0.2025, skin TFS: 185delAG cohort vs. 5382insC cohort Log-rank test p=0.1096). Furthermore, the spectrum and incidence of tumors that developed were similar between KB1(185stop)P, KB1(5382stop)P and KB1P mice (Figure S1D).

Characterization of K14cre;Brca1F/185stop;p53F/F and K14cre;Brca1F/5382stop;p53F/F

mammary tumorsOn the basis of their histomorphological characteristics, the majority of mammary tumors that developed in KB1(185stop)P (84%), KB1(5382stop)P (79%) and KB1P mice (85%) were classified as poorly differentiated solid carcinomas (Figure 2D and S2A-B). In line with this observation, most KB1(185stop)P and KB1(5382stop)P mammary tumors stained (partly) positive for the epithelial marker cytokeratin 8 (KB1(185stop)P: 91%, KB1(5382stop)P: 100%) and negative for the mesenchymal marker vimentin (KB1(185stop)P: 78%, KB1(5383stop)P: 67%; Figure S2C-D, Table S2). In all cohorts only a small fraction of mammary tumors (8%) was classified as carcinosarcoma, characterized by the presence of spindle-shaped cells (Figure 2D and S2A-B). Other mammary tumors that developed in KB1(185stop)P, KB1(5382stop)P and KB1P mice were grouped as lumen-forming carcinomas with varying degrees of glandular differentiation (KB1(185stop)P: 8%, KB1(5382stop)P: 13%, KB1P: 7%; Figure 2D and S2A-B). Similar to the majority of human BRCA1-mutated breast cancer (Lakhani et al., 2002), most KB1(185stop)P and KB1(5382stop)P mammary tumors stained negative for the estrogen receptor (ER; KB1(185stop)P: 87%, KB1(5382stop)P: 86%) and progesterone receptor (PR; KB1(185stop)P: 78%, KB1(5382stop)P: 90%; Figure S2C-D, Table S2). A high level of genomic instability is one of the hallmarks of human BRCA1-associated breast cancer (Tirkkonen et al., 1997) and also BRCA1-deficient mouse mammary tumors display a considerably higher amount of genetic aberrations than BRCA1-proficient tumors (Liu et al., 2007; Holstege et al., 2010; Drost et al., 2011). To investigate the level of genomic instability in KB1(185stop)P and KB1(5382stop)P tumors, we measured DNA copy number aberrations (CNAs) in mammary tumors from KB1(185stop)P (n=20), KB1(5382stop)P (n=20) and littermate control KB1P mice (n=22) using array comparative genomic hybridization (aCGH). When applying the comparative module of the R package KCsmart (Klijn et al., 2008; de Ronde et al., 2010), we did not detect any differences between recurrent CNAs of KB1(185stop)P and KB1P tumors (Figure 3A). We also could not find any differences in recurrent CNAs between KB1(5382stop)P and KB1P tumors (Figure 3B). On the basis of these results, we conclude that the histological and genetic features of KB1(185stop)P and KB1(5382stop)P mammary tumors are indistinguishable from KB1P control tumors and from each other.


6

139

Solid carcinoma

Lumen-formingcarcinoma

Carcinosarcoma

79

813

KB1(5382stop)P

84

88

KB1(185stop)P

85

8 7KB1P

KB1P

XXBrca15382stop/+Brca1185stop/+

KB1(185stop)P KB1(5382stop)P

Brca1185stop/Δ

p53Δ/ΔBrca15382stop/Δ

p53Δ/ΔBrca15382stop/F

p53F/FBrca1185stop/F

p53F/F

Brca1Δ/Δ

p53Δ/ΔBrca1F/F

p53F/F

Figure 2. Development of mammary tumors in mice carrying Brca1185stop and Brca15382stop mutation. A. Schematic representation of the generation of K14cre;Brca1185stop/flox;p53flox/flox (KB1(185stop)P) and K14cre;Brca15382stop/

flox;p53flox/flox (KB1(5382stop)P) mouse models. Indicated are the genotypes after Cre-mediated recombination in the mammary gland and in the rest of the mouse. B. Tumor-free survival curves (TFS) of KB1(185stop)P (green curve; n=53, T50=186 days), KB1(5382stop)P (blue curve; n=60, T50=200 days) and K14cre;Brca1flox/flox;p53flox/flox (KB1P; red curve; n=128, T50=196 days) mice. KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=0.4510. T50: median survival, n: the number of mice. C. Mammary tumor-free survival curves (TFS) curves of KB1(185stop)P (green curve; n=29, T50=184 days), KB1(5382stop)P (blue curve; n=31, T50=206 days) and KB1P (red curve; n=68, T50=197 days). KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=0.0415. D. Distribution of mammary tumor types in KB1(185stop)P and KB1(5382stop)P and KB1P mice. Solid carcinomas as depicted in purple, carcinosarcomas are depicted in orange and lumen-forming carcinomas are depicted in yellow.

A

B C

D

Chapter 6

6

140

Figure 3. Genomic instability of KB1(185stop)P and KB1(5382stop)P mouse mammary tumors. A. Comparative KC SMART profiles of KB1(185stop)P (green curve) and KB1P (red curve) mouse mammary tumors. B. Comparative KC SMART profiles of KB1(5382stop)P (blue curve) and KB1P (red curve) tumors.

K14cre;Brca1F/185stop;p53F/F mammary tumors respond poorly to the PARP inhibitor olaparibTo study the response of KB1(185stop)P and KB1(5382stop)P tumors to the PARP inhibitor olaparib (AZD2281), we transplanted several independent KB1(185stop)P, KB1(5382stop)P, BRCA1-deficient KB1P and BRCA1-proficient K14cre;p53F/F (KP) tumors into the fourth mammary gland of syngeneic female recipient mice. This orthotopic transplantation model ensures that transplanted mouse mammary tumors retain the histomorphological features, molecular characteristics and drug sensitivity profile of their spontaneous counterparts (Rottenberg et al., 2007, 2010). When tumors reached a volume of 200 mm3, tumor-bearing mice were treated with 50mg/kg olaparib for 28 consecutive days or left untreated (Figure 4A). We did not observe significant differences in overall survival (OS) between mice that did not receive any treatment, regardless of the genotype of the transplanted tumor (Figure 4B). All mice had to be sacrificed within 25 days because of a large tumor (Figure 4A and S3). While mice carrying KP tumors did not respond to olaparib treatment at all (Figure 4C-D; black curves; T50= 10 days), the median OS of mice carrying KB1P tumors increased from 12 to 60 days following olaparib treatment and their tumors disappeared completely during the course of treatment (Figure 4C-D; red curves). However, as has been reported previously (Rottenberg et al., 2008; Drost et al., 2011), KB1P tumors could not be fully eradicated with this 28-day olaparib dosing schedule and tumors reappeared after the end of the treatment period. The median OS of KB1(5382stop)P tumors increased from 8 to 52 days after olaparib treatment (Figure 4B-C; blue curves), which was significantly better than the median OS of KP tumors (KB1(5382stop)P vs. KP Log-rank test p=<0.0001). No significant difference in OS could be observed between KB1(5382stop)P and KB1P tumors after treatment with olaparib (KB1(5382stop)P vs. KB1P Log-rank test p=0.0905). However, in contrast to KB1P tumors, KB1(5382stop)P tumors never completely disappeared during olaparib treatment, but rather entered a phase of tumor stasis (Figure 4D; blue curve).

A

B


6

141

Tx

spontaneoustumor

T0 tumor vol. ±200mm3

Olaparib (50mg/kg, 28xq.d)

OlaparibNo treatment

0

200

400

600

800

1000

0 5 10 15 20 25 30

Time (days)

Rel

ativ

e tu

mor

vol

ume

(%)

KB1(185stop)PKB1(5382stop)PKB1PKP

Interestingly, KB1(185stop)P tumors had a median OS of 26 days after start of olaparib treatment (Figure 4C; green curve), which was significantly better than BRCA1-proficient KP tumors (KB1(185stop)P vs. KP Log-rank test p=0.0017), but significantly worse than BRCA1-deficient KB1P tumors (KB1(185stop)P vs. KB1P Log-rank test p=<0.0001). While KB1(185stop)P tumors kept growing during the course of olaparib treatment, their growth speed was reduced compared to KP tumors (Figure 4D; green curve). Moreover, the olaparib response of KB1(185stop)P tumors was markedly worse than the response of KB1(5382stop)P tumors (Figure 4C-D and S3; KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=0.0012). The response of KB1(185stop)P tumors to olaparib treatment closely

Figure 4. KB1(185stop)P mouse mammary tumors respond poorly to the PARP inhibitor olaparib. A. Schematic representation of olaparib treatment schedule. Tx: orthotopic transplantation of fragments from spontaneous mouse mammary tumors; T0: start of treatment at a tumor volume of 200mm3 (100%). Mice received a daily dose of 50mg/kg olaparib intraperitoneally for 28 consecutive days. B. Overall survival (OS) curves of mice transplanted with KB1(185stop)P (green), KB1(5382stop)P (blue), KB1P (red) and K14cre;p53flox/flox

(KP; black) tumors without treatment. T50: median OS, n: number of mice. KB1(185stop)P: T50=15 days, n=4 mice; KB1(5382stop)P: T50=8 days, n=6 mice; KB1P: T50=12 days, n=4 mice; KP: T50=11 days, n=4 mice. C. Overall survival (OS) curves of mice transplanted with KB1(185stop)P (green), KB1(5382stop)P (blue), KB1P (red) and KP (black) tumors after olaparib treatment. KB1(185stop)P: T50=26 days, n=12 mice; KB1(5382stop)P: T50=52 days, n=10 mice; KB1P: T50=60 days, n=7 mice; KP: T50=10 days, n=5 mice. KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=0.0012, KB1(185stop)P vs. KB1P Log-rank test p=<0.0001, KB1(185stop)P vs. KP Log-rank test p=0.0017, KB1(5382stop)P vs. KB1P Log-rank test p=0.0905 (not significant), KB1(5382stop)P vs. KP Log-rank test p=<0.0001, KB1P vs. KP Log-rank test p=0.0003. D. Comparison of relative mammary tumor volumes during 28-day treatment with olaparib. Tumor volumes are relative to the tumor volume at start of treatment (day 0, 100%=±200mm3).

A

B C

D

Chapter 6

6

142

resembles the response of K14cre;Brca1F/C61G;p53F/F (KB1C61GP) mouse mammary tumors to olaparib (Drost et al., 2011).

K14cre;Brca1F/185stop;p53F/F mammary tumors respond poorly to cisplatinWhile BRCA1-deficient KB1P mouse mammary tumors are highly sensitive to platinum-based chemotherapy, KB1C61GP tumors showed a poor response to cisplatin and rapidly developed resistance (Drost et al., 2011). We transplanted several KB1(185stop)P, KB1(5382stop)P, KB1P and BRCA1-proficient KP mammary tumors to study potential differences in cisplatin response (Table S3). We started treatment with 6mg/kg cisplatin when the tumor reached a volume of 200 mm3 and retreated every two weeks when the tumor volume was still over 50% of the starting volume. If the tumor size after two weeks was smaller than 50%, treatment was postponed until the tumor reached 100% of the starting volume (Figure 5A). As some animals had to be sacrificed because of the toxic side effects of multiple cisplatin doses, we measured OS as well as TFS. The median OS of mice transplanted with KB1(5382stop)P tumors was prolonged from 8 to 159 days after cisplatin treatment (Figure 5B-C; blue curves), which is in line with the response of BRCA1-deficient KB1P tumors (Figure 5B-C; red curves, KB1(5382stop)P vs. KB1P Log-rank test p=0.9696 (ns)). Almost all mice transplanted with KB1(5382stop)P tumors had to be sacrificed because of cisplatin toxicity instead of therapy resistance (Figure 5D). The median OS of mice transplanted with KB1(185stop)P mammary tumors was prolonged from 15 to 55 days after treatment with cisplatin (Figure 5B-C; green curves), which is more comparable to the response of BRCA1-proficient tumors to cisplatin (Figure 5B-C; black curves, KB1(185stop)P vs. KP Log-rank test p=0.2550 (ns)). After this initial response to cisplatin, KB1(185stop)P tumors rapidly acquired resistance and 62% of the mice need to be sacrificed because of therapy-resistant tumors (Figure 5D). Remarkably, the response of KB1(185stop)P tumors to cisplatin was significantly worse than the response of KB1(5382stop)P tumors (Figure 5C; KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=<0.0001; Figure S4). The difference in response to cisplatin was even more pronounced when we compared the TFS of mice transplanted with KB1(185stop)P and KB1(5382stop)P tumors (Figure S4F).

BRCA1-ΔRING expression in mouse and human BRCA1185delAG tumor cellsSince KB1(185stop)P mouse mammary tumors have a poor response to olaparib and cisplatin compared to KB1(5382stop)P and BRCA1-deficient KB1P tumors, we studied BRCA1 protein expression in KB1(185stop)P tumors. Human BRCA1185delAG and BRCA15382insC nonsense mutations have been reported to lead to the production of highly instable truncated BRCA1 proteins of 38 and 1829 aa, respectively (Friedman et al., 1995). As described previously (Drost et al., 2011), we could not detect any BRCA1 protein in BRCA1-deficient KB1P tumors (Figure 6A; middle panel), while we did observe BRCA1 expression in a BRCA1-proficient KP tumor (Figure 6A; right panel). Remarkably, BRCA1 protein could also be detected in KB1(185stop)P tumors (Figure 6A; left panel). However, the BRCA1 protein product present in KB1(185stop)P tumors appeared to be slightly smaller in size than wild type BRCA1 (Figure 6A; right panel). This finding seems to be in contradiction with the human situation, where presence of the BRCA1185delAG mutation was reported to result in a truncated protein of only 38 aa (Friedman et al., 1995). To ensure that our observation was not an artifact of our genetically engineered KB1(185stop)P mouse model, we checked BRCA1 protein expression in several human


6

143

Cisplatin

spontaneoustumor

T0 tumor vol. ±200mm3

Tx T13 RTV >50% retreat

T13 RTV <50% no treatment

retreat every 2 wksuntil RTV <50%

retreat if RTV >100%

Untreated

38

6238

94 100

62

100%

80%

60%

40%

20%

0%

KB1(185

stop)P

KB1(538

2stop

)PKB1PKP

Alive

Toxicity

Resistance

Figure 5. KB1(185stop)P mouse mammary tumors respond poorly to cisplatin. A. Schematic representation of cisplatin treatment schedule. Tx: orthotopic transplantation of fragments from spontaneous mouse mammary tumors. T0: start of treatment at a tumor volume of approximately 200mm3, corresponding to a relative tumor volume (RTV) of 100%. T13: if the RTV on day 13 was ≥50%, mice received an additional treatment that was repeated every two weeks until their tumor shrank to a RTV of ≤50%. If the RTV at T13 was ≤50%, retreatment was postponed until the tumors grew back to their starting volume. B. Overall survival (OS) curves of mice transplanted with KB1(185stop)P (green), KB1(5382stop)P (blue), KB1P (red) and KP (black) tumors without treatment. T50: median OS, n: number of mice. KB1(185stop)P: T50=15 days, n=4 mice; KB1(5382stop)P: T50=8 days, n=6 mice; KB1P: T50=12 days, n=4 mice; KP: T50=11 days, n=4 mice. C. Overall survival (OS) curves of mice transplanted with KB1(185stop)P (green), KB1(5382stop)P (blue), KB1P (red) and KP (black) tumors after olaparib treatment. KB1(185stop)P: T50=55 days, n=35 mice; KB1(5382stop)P: T50=159 days, n=47 mice; KB1P: T50=188 days, n=18 mice; KP: T50=48 days, n=21 mice. KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=<0.0001, KB1(185stop)P vs. KB1P Log-rank test p=<0.0001, KB1(185stop)P vs. KP Log-rank test p=0.2550 (not significant (ns)), KB1(5382stop)P vs. KB1P Log-rank test p=0.9696 (ns), KB1(5382stop)P vs. KP Log-rank test p=<0.0001, KB1P vs. KP Log-rank test p=<0.0001. D. Causes of death of tumor-bearing mice after treatment with cisplatin. The stacked bars depict the percentage of mice that are still alive (orange) or sacrificed because of cisplatin-associated toxicity (grey) or cisplatin-resistant tumors (blue).

breast cancer cell lines, including the SUM1315MO2 line which contains the BRCA1185delAG mutation (Figure 6B). Previously, it has been reported that two independent bands with a slight difference in size can be observed after BRCA1 immunoblotting, presumably as a consequence of BRCA1 phosphorylation (Scully et al., 1997b). While we could detect this BRCA1 doublet in the BRCA1-proficient human breast cancer cell line T47D, BRCA1 expression was significantly reduced in HCC1937 tumor cells, which harbor the BRCA15382insC

A

B C

D

Chapter 6

6

144

mutation (Figure 6B). Remarkably, although BRCA1185delAG mutant SUM1315MO2 cells also displayed reduced expression of the BRCA1 doublet, we could detect a slightly smaller form of BRCA1 (Figure 6B; left panel). This smaller BRCA1 product in BRCA1185delAG mutant SUM1315MO2 cells could not be detected with a different BRCA1 antibody that binds the extreme N-terminus of BRCA1 (aa 1-304; Figure 6B; right panel). Together these findings show that the BRCA1185delAG mutation can lead to production of a mutant BRCA1-ΔRING protein, which is probably devoid of its N-terminal RING domain.

KB1(185stop)P KB1P

mBRCA1

POLII

KP*

ΔAG+

Tumor cell lines

-

POLII

hBRCA1

hBRCA1 AB MS110 (aa 1-304)

hBRCA1-p

ΔAG+

Tumor cell lines

-

hBRCA1-p

hBRCA1-ΔRING

POLII

hBRCA1

hBRCA1 AB #9010 (aa 305-325)

Brca1+

wild typeUntreated

KB1(185stop)Ptumor

ResistantKB1(185stop)P

tumor

Figure 6. BRCA1-ΔRING expression in mouse and human BRCA1185delAG tumor cells. A. BRCA1 protein expression in KB1(185stop)P (left panel) and KB1P (middle panel) mouse mammary tumors. BRCA1 expression in a BRCA1-proficient KP tumor was used as positive control (right panel). The asterisk (*) in the right panel indicates another KB1(185stop)P mouse mammary tumor. Expression of POLII was used as loading control. B. BRCA1 protein expression in human breast cancer cell lines. ‘+’: BRCA1-proficient breast cancer cell line T47D, ‘-’: BRCA15382insC mutant breast cancer cell line HCC1937, ‘ΔAG’: BRCA1185delAG mutant breast cancer cell line SUM1315MO2. The upper band represents phosphorylated hBRCA1 (hBRCA1-p), the middle band represents hBRCA1 and the lower band represents RING-less hBRCA1 (hBRCA1-ΔRING). For the left panel the #9010 rabbit polyclonal hBRCA1 antibody (epitope: aa 305-325) was used, for the right panel the MS110 mouse monoclonal hBRCA1 antibody (epitope: aa 1-304) was used. Expression of POLII was used as loading control. C. No evidence for genetic reversion of Brca1 in platinum-resistant KB1(185stop)P mouse mammary tumors. Sequencing plots of KB1(185stop)P tumor DNA showing that 3nt substitution (TCC>AAG) is retained in cisplatin-resistant tumors.

A

B

C


6

145

BRCA1-ΔRING expression in platinum-resistant mouse BRCA1185stop tumorsWe previously found that platinum resistance of Brca1C61G tumors was mediated by expression of the BRCA1-C61G protein, which lacks ubiquitin ligase activity and interaction with BARD1 due to a missense mutation in the BRCA1 RING domain (Drost et al., 2011). We therefore asked whether expression of the mutant BRCA1-ΔRING protein could also play a role in development of platinum resistance in KB1(185stop)P mouse mammary tumors. We first checked whether the Brca1185stop mutation was still present in platinum-resistant KB1(185stop)P tumors, since it is known that BRCA1/2-deficient cell lines and ovarian tumors can become resistant to platinum compounds and olaparib through genetic reversion of the BRCA1/2 mutation (Sakai et al., 2008, 2009; Swisher et al., 2008; Norquist et al., 2011). Previously, we did not find any evidence for secondary Brca1 mutations in therapy-resistant KB1C61GP tumors (Drost et al., 2011). In line with this, Sanger sequencing and melting curve genotyping revealed that all cisplatin-resistant KB1(185stop)P tumors had retained the Brca1185stop mutation (Figure 6C and data not shown). Based on these results, we conclude that the observed platinum resistance in KB1(185stop)P mammary tumors is not caused by genetic reversion of the Brca1185stop mutation. We also investigated whether cisplatin resistance of KB1(185stop)P mammary tumors might be associated with increased expression levels of BRCA1-ΔRING protein. Although we found significantly increased Brca1 mRNA levels in most platinum-resistant KB1(185stop)P tumors compared to untreated tumors, we did not find a concomitant increase in BRCA1-ΔRING protein levels (Figure S5). This finding implies that upregulation of steady state levels of BRCA1-ΔRING protein is not strictly required for KB1(185stop)P tumors to become resistant to platinum therapy.

DNA damage response in mouse and human BRCA1185delAG tumor cellsThe absence of secondary Brca1 mutations and stable BRCA1-ΔRING protein level in platinum-resistant KB1(185stop)P tumors suggest that the BRCA1-ΔRING protein has some residual activity in the cellular response to DNA DSBs. To investigate this we compared the ability to form RAD51 irradiation-induced foci (IRIFs) in short-term tumor cell cultures derived from KB1(185stop)P, KB1P and BRCA1-proficient KP tumors. Before irradiation, we observed almost no RAD51 foci for all tumor genotypes (Figure 7A). As shown previously (Drost et al., 2011), we could readily detect RAD51 IRIFs in short-term cultures of HR-proficient KP tumor cells, but not in HR-deficient KB1P tumor cells (Figure 7A; upper and lower panel; Figure 7B; KP vs. KB1P unpaired t test p=0.0002). We could observe significantly more RAD51 IRIFs in KB1(185stop)P tumor cells compared to KB1P tumor cells (Figure 7B; KB1(185stop)P vs. KB1P unpaired t test p=0.0355). In addition, human SUM1315MO2 breast cancer cells, carrying the BRCA1185delAG mutation, were also capable of forming RAD51 IRIFs (Figure 7C and S6; upper panel). Thus, both mouse and human BRCA1185delAG tumor cells have some activity in response to DNA damage, which could be the result of expression of BRCA1-ΔRING.

BRCA1185delAG tumor cells are dependent on BRCA1-ΔRING for proliferation and DNA damage signalingTo test whether this mutant BRCA1-ΔRING protein is functionally important for BRCA1185delAG tumor cells, we performed BRCA1 knockdown experiments. Expression of BRCA1-ΔRING in BRCA1185delAG mutant SUM1315MO2 cells could be significantly reduced by transduction with lentiviruses encoding two independent short hairpin RNAs (shRNAs) against human

Chapter 6

6

146

BRCA1 (#5 and #8; Figure 8A). After BRCA1 knockdown, proliferation of BRCA1185delAG cells was significantly inhibited compared to cells transduced with a non-targeting (NT) shRNA (Figure 8B; SUM NT vs. SUM #5 unpaired t test p=<0.0001, SUM NT vs. SUM #8 unpaired t test p=<0.0001; Figure 8C). In addition, we assessed formation of RAD51 IRIFs after BRCA1 knockdown in BRCA1185delAG mutant SUM1315MO2 cells to discover whether BRCA1-ΔRING still has a function in the DNA damage response. Interestingly, the number of BRCA1185delAG mutant cells with RAD51 IRIFs was significantly lower after BRCA1 knockdown than in cells with normal expression of BRCA1-ΔRING (Figure 8D; SUM NT vs. SUM #5 unpaired t test p=0.0303, SUM NT vs. SUM #8 unpaired t test p=0.0116; Figure S6). These data show that BRCA1185delAG cells are dependent on expression of the BRCA1-ΔRING protein, possibly through its function in repair of DNA DSBs.

-γ irradiation +γ irradiation

KB

1PK

PK

B1(

185s

top)

P

p=0.0355

p=0.0002

-γ irradiation +γ irradiation

SU

M13

15M

O2

Figure 7. DNA damage response in mouse and human BRCA1185delAG tumor cells. A. Immunofluorescence of RAD51 foci in KB1(185stop)P, KB1P and KP tumor cell suspensions with or without gamma irradiation (10Gy). Cells with more than 10 RAD51 foci (red) are indicated with red arrowheads. Red square: single cell zoom-in. Nuclei were visualized with DAPI (blue). All pictures were taken at a 63x magnification. B. Quantification of RAD51 IRIFs in KB1(185stop)P (green; n=5), KB1P (red; n=10) and KP (black; n=7) tumors. Percentages of cells with more than 10 RAD51 foci were normalized to tumor cells derived from a KP tumor. KB1(185stop)P vs. KB1P unpaired t test p=0.0355; KB1(185stop)P vs. KP unpaired t test p=0.5975 (ns); KB1P vs. KP unpaired t test p=0.0002. Error bars indicate SEM. C. Immunofluorescence of RAD51 foci in human SUM1315MO2 breast cancer cells with or without gamma irradiation (10Gy). Cells with more than 10 RAD51 foci (red) are indicated with red arrowheads. Red square: single cell zoom-in. Nuclei were visualized with DAPI (blue). All pictures were taken at a 63x magnification.

A

C

B


6

147

Discussion

We have used genetically engineered mouse models mimicking the two most common BRCA1 founder mutations in humans, respectively BRCA1185delAG and BRCA15382insC, to study the effects of these mutations on tumor development, therapy response and resistance. While mice carrying the Brca1185stop or Brca15382stop mutation develop similar types of mammary carcinomas, Brca1185stop tumors respond significantly worse to HRD-targeted therapy than Brca15382stop tumors and rapidly develop therapy resistance. It has been shown previously that secondary mutations in BRCA1 can mediate resistance to platinum-based chemotherapy in BRCA1185delAG ovarian carcinomas (Swisher et al., 2008; Norquist et al., 2011). However, we could not detect genetic reversion of the Brca1185stop mutation in any of the platinum-resistant Brca1185stop mouse mammary tumors. Instead, we found that mouse and human BRCA1185delAG tumor cells produce a BRCA1-ΔRING protein, which could be involved in development of platinum resistance through its role in the DNA damage response. A similar observation has been made before in platinum-resistant mouse mammary tumors carrying the Brca1C61G missense mutation (Drost et al., 2011).

Potential role of BRCA1-ΔRING in therapy response and resistanceWhile the BRCA1185delAG nonsense mutation is described to lead to the formation of a

SUM NT

SUM #5 SUM #8

Medium

p=<0.0001

p=<0.0001

p=0.0303

p=0.0116

- #5 #8NT

SUM

hBRCA1-ΔRING

POLII

shRNAhBRCA1

Figure 8. BRCA1185delAG tumor cells are dependent on BRCA1-ΔRING for proliferation and DNA damage signaling. A. Protein expression levels after human BRCA1 knockdown in BRCA1185delAG mutant SUM1315MO2 tumor cells. ‘-’: SUM1315MO2 without lentiviral transduction, ‘NT’: SUM1315MO2 cells after lentiviral transduction with a non-targeting (NT) shRNA, ‘#5': SUM1315MO2 cells after lentiviral transduction with shRNA #5 against hBRCA1, ‘#8’: SUM1315MO2 cells after lentiviral transduction with shRNA #8 against hBRCA1. Expression of POLII was used as loading control. B. Relative metabolic activity of BRCA1185delAG mutant SUM1315MO2 tumor cells after hBRCA1 knockdown. Medium: no cells, negative control. Metabolic activity was normalized to SUM1315MO2 cells transduced with a NT shRNA. SUM NT vs. SUM #5 unpaired t test p=<0.0001, SUM NT vs. SUM #8 unpaired t test p=<0.0001. Error bars indicate SD. C. Colony formation of BRCA1185delAG mutant SUM1315MO2 tumor cells after hBRCA1 knockdown. D. Quantification of RAD51 IRIFs in BRCA1185delAG mutant SUM1315MO2 cells after hBRCA1 knockdown. SUM: SUM1315MO2 without lentiviral transduction. SUM NT vs. SUM #5 unpaired t test p=0.0303, SUM NT vs. SUM #8 unpaired t test p=0.0116. Error bars indicate SD.

A

C D

B

Chapter 6

6

148

truncated, highly instable protein of only 38 aa, we observed production of nearly full-length BRCA1 protein in Brca1185stop mouse mammary tumors. This is not merely an artifact of our genetically engineered mouse model, since we could also detect mutant BRCA1 protein in a human breast cancer cell line carrying the BRCA1185delAG mutation. It is likely that this mutant BRCA1 protein lacks a functional RING domain, because this protein product is slightly smaller than wild type BRCA1 and could not be detected with an antibody binding to the extreme N-terminus of human BRCA1. We speculate that, similar to Brca1C61G tumors, Brca1185stop tumors may not require secondary Brca1 mutations because residual activity of the BRCA1-ΔRING protein expressed by Brca1185stop tumors might already be sufficient to withstand stress induced by DNA-damaging compounds. The finding that Brca1185stop mouse mammary tumor cells are capable of forming RAD51 IRIFs, indicative of DNA DSB repair, shows that this RING-less BRCA1 protein is at least partially functional. Thus, while insufficient for embryonic survival and tumor suppression, the residual activity of the BRCA1-ΔRING protein can contribute to rapid development of therapy resistance of Brca1185stop tumors. Expression of a RING-less BRCA1 protein might also confer therapy resistance in human BRCA1185delAG mutation carriers, since BRCA1-ΔRING expression could be detected in human BRCA1185delAG breast cancer cells. shRNA-mediated depletion of BRCA1 in these tumor cells resulted in reduced proliferation and RAD51 IRIF formation, demonstrating the functional significance of the BRCA1-ΔRING protein. Why are secondary BRCA1 mutations then still observed in therapy-resistant BRCA1185delAG ovarian carcinomas? One possibility is that these secondary BRCA1 mutations are already present in rare cells of primary carcinomas due to genomic instability and subsequently selected under pressure of chemotherapy. This has already been described for chronic myeloid leukemia, where BCR-ABL mutations that confer imatinib resistance are already present in a minority of tumor cells before exposure to imatinib (Roche-Lestienne et al., 2002). In addition, the level of BRCA1-ΔRING protein in untreated BRCA1185delAG ovarian carcinomas is unknown. There could be considerable intertumoral heterogeneity in both the presence (and abundance) of pre-existing secondary BRCA1 mutations and the expression level of BRCA1-ΔRING protein. Genetic reversion may thus drive therapy resistance in tumors with pre-existing secondary BRCA1 mutations and no or weak expression of the BRCA1-ΔRING protein.

Production of BRCA1-ΔRING protein via internal translation reinitiationThe existence of RING-less BRCA1 protein in mouse and human BRCA1185delAG tumor cells may be the result of internal translation reinitiation at a downstream start codon (Buisson et al., 2006). This translation initiation at position 128 could also explain why the BRCA1185delAG mRNA is not degraded by nonsense-mediated decay (NMD) (Perrin-Vidoz et al., 2002; Buisson et al., 2006). The mutant BRCA1-ΔRING protein produced in our genetically engineered Brca1185stop mouse model appears to be somewhat larger than its human counterpart, possibly due to usage of a more upstream alternative start codon present in the mouse Brca1 coding sequence. BRCA1 alternative translation reinitiation at a downstream start codon may not only occur in BRCA1185delAG tumor cells, but also in cells with other mutations in the extreme N-terminus of BRCA1. Our preclinical data indicate that residual activity of the BRCA1-ΔRING protein may have serious consequences for clinical responses of HBOC patients to DNA damaging therapy and might even affect the median survival time of patients


6

149

harboring different BRCA1 mutations.

Effects of different BRCA1 founder mutations on therapy response and resistanceSeveral studies have reported a significant better survival of BRCA1/2 mutation carriers compared to non-carriers with invasive ovarian cancer (Ben David et al., 2002; Chetrit et al., 2008), presumably due to the extreme sensitivity of BRCA1/2 mutant tumors to cisplatin-based chemotherapy. Nevertheless, heterogeneity in therapy response is observed for different BRCA1/2 mutation carriers. For example, ovarian cancer patients carrying the BRCA1185delAG mutation appeared to have a worse median survival compared to BRCA15382insC patients, although this difference in survival did not reach statistical significance due to the low number of patients with a BRCA15382insC mutation (Ben David et al., 2002). This trend could hint towards differences in sensitivity to DSB-inducing agents between BRCA1185delAG and BRCA15382insC mutant ovarian tumors, similar to the differences in survival we observed between Brca1185stop and Brca15382stop mouse mammary carcinomas after olaparib or cisplatin treatment. PARP inhibitors like olaparib have shown to be effective against BRCA1/2-deficient tumor cells in preclinical studies (Bryant et al., 2005; Farmer et al., 2005; Rottenberg et al., 2008) and in phase I/II clinical trials (Fong et al., 2009, 2010; Audeh et al., 2010; Tutt et al., 2010; Gelmon et al., 2011). Also in this case, heterogeneous responses were observed for BRCA1 mutation carriers, suggesting that different BRCA1 mutations might have a different impact on BRCA1 protein function and subsequent HR-mediated DNA repair. Together our data indicate that therapy responses of women with BRCA1-mutated breast (or ovarian) cancer will not only differ from those of non-mutation carriers, but will also vary between carriers of different BRCA1 mutations. It would be clinically valuable if we could predict therapy responses of different BRCA1 mutation carriers, since this could prevent ineffective treatment and lead to earlier use of alternative therapeutic agents. While it will be important to evaluate the clinical relevance of our findings, such trials will require large numbers of patients carrying specific BRCA1 founder mutations and therefore remain a challenge for the future.

Experimental Procedures

Generation of the Brca1185stop and Brca15382stop mutant miceNon-chemically modified deoxyribonucleotides were obtained from Sigma-Genosys Ltd. The following oligonucleotide sequences were used to introduce the Brca1185stop and Brca15382stop mutation in mouse embryonic stem cells (mESCs): Brca1185stop, 5’-ATG CAG AAA ATC TTA GAG TAG GCG ATC TGG TAA GTC AAC A-3’; Brca15382stop, 5’-CAA GGC GAT CCA GAG AAT CAG GAC CGG GAA AAG GTA AAG TC-3’. Procedures for introducing oligonucleotides in mESCs, selection for G418-resistant colonies and identification and purification of modified cells have been described previously (Dekker et al., 2003, 2006, 2011; Aarts et al., 2006). The following primers were used to identify Brca1185stop mutant mESCs by PCR: 185stop fwd1, 5’-CAA GTC CAG TGT GGG ATG-3’; 185stop rev1, 5’-CCT GGT GCA GTA GCT TAA AC-3’; 185stop fwd2, 5’-CAC TAG GGT GGA AAC TGG T-3’; 185stop wild type rev, 5’-TGA CTT ACC AGA TCG CCT -3’; 185stop mutant rev, 5’-GAC TTA CCA GAT CGG AC -3’; 185stop rev2, 5’-TTC AAG TTG GAG GCT AAT C-3’; 185stop wild type fwd, 5’-ATG CAG AAA ATC TTA GAG TAG G -3’; 185stop mutant fwd, 5’-ATG CAG AAA ATC TTA GAG TGT C -3’. The following primers were used to identify Brca15382stop mutant mESCs by PCR: 5382stop fwd1, 5’-CCT

Chapter 6

6

150

TTT GTG TTT CCT GCA CC-3’; 5382stop rev1, 5’-GGT TTT ATT CCA GCA GC-3’; 5382stop fwd2, 5’-CTT GGA CCT CAG AGA TGG G-3’; 5382stop wild type rev, 5’-ATC CAG AGA ATC CCG GG-3’; 5382stop mutant rev, 5’-GCG ATC CAG AGA ATC AGG A-3’; 5382stop rev2, 5’-CCT CAT GGG TTC TCA CAG C-3’; 5382stop wild type fwd, 5’-ATC CCG GGA AAG GTA AAG-3’; 5382stop mutant fwd, 5’-AGG ACC GGG AAA AGG TAA AG-3’.

Cell cultureHuman breast cancer cell lines SUM1315MO2, HCC1937 and T47D were grown in RPMI culture medium (Gibco Invitrogen) supplemented with 10% foetal bovine serum (Sigma) and 1% Pen Strep (5000U/ml penicillin, 5000μg/ml streptomycin; Gibco Invitrogen).

Embryo isolationsTimed matings were performed between Brca1185stop or Brca15382stop heterozygous male and female mice. The impregnated females were sacrificed at various time points after conception and uteri were isolated in ice-cold PBS. The embryos were isolated by removing the muscular wall of the uterus, Reichert’s membrane and visceral yolk sac. The visceral yolk sac was used for genotyping.

Animals, generation of mammary tumors and orthotopic transplantation into wild type miceAll experiments involving animals comply with local and international regulations and ethical guidelines, and have been authorized by our local animal experimental committee at the Netherlands Cancer Insititute (DEC-NKI). The generation of K14cre;Brca1F/F;p53F/F (KB1P) mice has been described previously (Jonkers et al., 2001; Liu et al., 2007). Brca1185stop/+ and Brca15382stop/+ mice were bred with KB1P animals to generate K14cre;Brca1185stop/F;p53F/F

(KB1(185stop)P), K14cre;Brca15382stop/F;p53F/F (KB1(5382stop)P) and littermate control mice. These animals were checked weekly from the age of 4 months onward for onset of tumor growth and overall appearance. After tumor onset, mammary tumor size was determined biweekly by caliper measurements. Tumors were harvested at a maximal size of 1000 mm3 (formula tumor volume: 0.5 x length x width2). FVB/n:129/Ola F1 hybrid females were used for orthotopic transplantations of mammary tumors. Small tumor fragments (1-2mm in diameter) were transplanted orthotopically in the fourth mammary fat pad of adult F1 hybrid female mice as described (Rottenberg et al., 2007).

DrugsCisplatin (1 mg/ml in saline-mannitol) originated from Mayne Pharma. Olaparib was kindly provided by Astrazeneca. Olaparib was used by diluting 50 mg/ml stocks in DMSO with 10% 2-hydroxyl-propyl-β-cyclodextrine/PBS such that the final volume administered by intraperitoneal injection was 10 μl/g of body weight.

Treatment of mammary tumor-bearing animalsMaximum tolerable dose (MTD) levels of cisplatin and olaparib were determined in earlier studies (Rottenberg et al., 2007, 2008). 6 mg/kg of cisplatin was administered by intravenous injection in the tail vein. 50 mg/kg of olaparib was administered daily for 28 consecutive days by intraperitoneal injection. Treatment at MTD levels was initiated when the tumor volume, calculated as 0.5 x length x width2, exceeded 200 mm3. To determine whether tumors would acquire resistance to cisplatin, animals received multiple doses


6

151

of cisplatin. An animal was retreated two weeks after the initial treatment if the tumor volume was larger than 50%. If the tumor volume two weeks after the initial treatment was smaller than 50%, an animal was not retreated until the tumor volume reached 100%. Animals were sacrificed when the tumor volume exceeded 1500 mm3 or because of severe weight loss due to toxicity of the drug

DNA isolation, southern blot analysis and genotypingFor routine genotyping tail DNA samples or yolk sacs were lysed in DirectPCR lysis reagent (Viagen) supplemented with 100mg/ml proteinase K (Sigma Aldrich). The Brca1F allele was detected by PCR amplification of the loxP site in intron 3 with primers P1 and P2, yielding products of 545 bp and 390 bp for the floxed and wild type alleles, respectively. Detection of the Brca1del allele with primers P1 and P3 yielded a 594-bp fragment. The primer sequences were as follows: P1, 5'-TAT CAC CAC TGA ATC TCT ACC G-3'; P2, 5'-GAC CTC AAA CTC TGA GAT CCA C-3' and P3, 5'-TCC ATA GCA TCT CCT TCT AAA C-3'. For all PCR reactions, thermocycling conditions consisted of 30 cycles of 30 sec at 94°C, 30 sec at 58°C, and 50 sec at 72°C. Reactions contained approximately 200 ng of template DNA, 0.5 mM primers, 100 mM dNTPs, 2.5 units of Taq DNA polymerase, 2.5 mM MgCl2, and 10 x PCR buffer in a total volume of 20 μl. The Brca1185stop and Brca15382stop alleles were detected by probe-based melting curve analysis. For high-resolution melting curve analysis, we used the LightCycler 480 instrument of Roche Applied Science. We used the following probes and primers for detecting the Brca1185stop mutation: Anchor HybProbe, 5’-AAG ATT TTC TGC ATA GCA TGA AGG ACA TTT TGT AC--PH; Sensor HybProbe, 5’-CTG TTG ACT TAC CAG ATC GGA CAC TC--FL; Primer forward, 5’- CTC ATT TGC ATG AAC AGT AAC CAC-3’; Primer reverse, 5’-TTA TCT GCC GTC CAA ATT CAA G-3’. We used the following probes and primers for detecting the Brca15382stop mutation: Anchor HybProbe, 5’-ATC GCC TTG GAC CTT GGT GAT TTC TTC C--PH; Sensor HybProbe, 5’-CTT TTC CCG GTC CTG ATT CTC TG--FL; Primer forward, 5’-TTA GGC TGG GGT TCT GTC-3’; Primer reverse, 5’-TTG AAG TCA AAG GAG ATG TTG T-3’. After 10 min pre-incubation at 95˚C, thermocycling conditions for high-resolution melting curve analysis consisted of 45 cycles of 10 sec at 95°C, 10 sec at 60°C, and 10 sec at 72°C. Afterwards, a melting curve was produced by 1 min incubation at 95˚C and 2 min incubation at 40˚C. Reactions contained approximately 200 ng of template DNA, 5pmol forward primer, 20pmol reverse primer, 3pmol sensor probe, 3pmol anchor probe, and 2 x LightCycler 480 Probes Master (Roche Applied Science) in a total volume of 20 μl.

Array comparative genome hybridization and data analysisGenomic DNA of tumor and spleen samples was extracted by proteinase K lysis and organic extraction with phenol-chloroform. Tumor and spleen samples were labeled with Nimblegen dual-color DNA labeling kit and hybridized to Nimblegen 12-plex 135K full genome mouse custom NKI array. Background correction and normalization was performed in the NimbleScan program. Probe annotation and corrected log2 ratios were imported into the R programming language from the NimbleScan output. Probes mapping to Y and mitochondrial chromosomes were discarded. To find genomic loci of significant difference between the groups of tumors we applied the comparative module of the R package KCsmart (as available in BioConductor; (Klijn et al., 2008; de Ronde et al., 2010). All comparisons were performed using standard parameters (sigma = 1 Mb, 1000 permutations, p < 0.05). In short: a smoothed profile for each individual tumor was computed. The SAM algorithm as implemented in the multitest R-package was used to

Chapter 6

6

152

calculate significantly different copy number changes for discrete sample points along the mouse genome.

Sanger sequencingSequencing was done using Big Dye Terminator v3.1 cycle sequencing kit (Applied Biosystems). Sequencing was performed on both genomic DNA and cDNA of tumors and spleens. The following primers were used for sequencing the Brca1185stop mutation on DNA: 185stop fwd1, 5’-CAA GTC CAG TGT GGG ATG-3’; 185stop fwd2, 5’-CAC TAG GGT GGA AAC TGG T-3’; 185stop rev1, 5’-CCT GGT GCA GTA GCT TAA AC-3’; 185stop rev2, 5’-TTC AAG TTG GAG GCT AAT C-3’. The following primers were used for sequencing the Brca15382stop

mutation on DNA: 5382stop fwd1, 5’-CCT TTT GTG TTT CCT GCA CC-3’; 5382stop fwd2, 5’-CTT GGA CCT CAG AGA TGG G-3’; 5382stop rev1, 5’-GGT TTT ATT CCA GCA GC-3’; 5382stop rev2, 5’-CCT CAT GGG TTC TCA CAG C-3’. The following primers were used for sequencing the Brca1185stop mutation on cDNA: mBrca1 ex1 fwd, 5’-CTT GGG GCT TCT CCG TCC TC-3’; mBrca1 ex2 fwd, 5’-ACT GGA ACT GGA AGA AAT GG-3’; mBrca1 ex4/5 rev, 5’-TGT AGG CTC CTT TTG GTT AT-3’; mBrca1 ex5 rev, 5’-CTT GTG CTT CCC TGT AGG-3’. The following primers were used for sequencing the Brca1185stop mutation on cDNA: mBrca1 ex12 fwd, 5’-CCA AAC ATG TCA GGA GCA-3’; mBrca1 ex14 fwd, 5’-TTC AAC AGG GCA GTC TTG-3’; mBrca1 ex18 fwd, 5’-GGT CCG GTC TAT CCA AGA-3’; mBrca1 ex20 rev, 5’-GGC TCA CAA CAA TAG ACC TG-3’; mBrca1 ex24 rev, 5’-TTC TGT ACC AGG TAG GCA TC-3’.

RNA isolation and RT-PCR analysisTotal RNA from ES cells and mouse tissues was isolated using Trizol (Invitrogen). The integrity of RNA was verified by denaturing gel electrophoresis. Before cDNA synthesis, RNA samples were treated with RQ1 RNase-free DNase (Promega) to degrade both double- and single stranded DNA and with RNasin (promega) to inhibit activity of RNases. Subsequently, cDNA was synthesized using random hexamer primers and cloned AMV reverse transcriptase (Invitrogen). RT-PCR for mouse Brca1 and housekeeping gene (HPRT) was performed using the following primers: mBrca1 ex10 fwd, 5’-GAG ATG AAG GCA AGC TGC-3’; mBrca1 ex11 rev, 5’-CAG TTG CAT GAT TCT CAG TAG G-3’; mHPRT fwd, 5’-CTG GTG AAA AGG ACC TCT CG-3’; mHPRT rev, 5’-TGA AGT ACT CAT TAT AGT CAA GGG CA-3’. LightCycler 480 SYBR Green I Master (Roche Applied Science) was used for amplification and detection of cDNA target. RT-PCR was carried out on the LightCycler 480 instrument of Roche Applied Science.

AntibodiesThe following primary antibodies were used for immunohistochemistry: rat anti-cytokeratin 8 (University of Iowa Troma-1; 1:600), rabbit anti-vimentin (Abcam ab45939; 1:1500), rabbit anti-progesterone receptor (Neomarkers RM-9102-SO; 1:300) and rabbit anti-estrogen receptor alpha (Santa Cruz Biotechnology SC-542; 1:1750). The following secondary antibodies were used for immunohistochemistry: biotin-conjugated anti-rat (Santa Cruz Biotechnology SC-2041; 1:100), biotin-conjugated anti-rabbit (Dako E0432; 1:1000) and HRP-conjugated anti-rabbit Envision (Dako K4009). The following primary antibodies were used for western blot analysis: mouse anti-BRCA1 (MS110; Abcam ab16780; 1:250), rabbit anti-BRCA1 (Cell Signaling Technology 9010; 1:1000), rabbit anti-mouse Brca1 (1:500) and goat anti-POLII (Santa Cruz Biotechnology C-18; 1:200). The


6

153

following secondary antibodies were used for western blot analysis: HRP-conjugated rabbit anti-goat (Dako; 1:1000), HRP-conjugated rabbit anti-mouse (Dako; 1:2500) and HRP-conjugated goat anti-rabbit (Dako; 1:2000). Rabbit anti-RAD51 (1:10000) was used as a primary antibody for immunofluorescence studies. Goat anti-rabbit Alexa fluor 568 (Invitrogen; 1:400) was used as secondary antibody for immunofluorescence studies.

Histology and immunohistochemistryTissues were isolated and fixed in formaldehyde for 48 hours. Tissues were rehydrated, cut into 4 μm sections and stained with hematoxylin and eosin. For immunohistochemical staining for progesterone receptor and cytokeratin 8, antigen retrieval was performed with citra solution (Biogenex HK086-5K). For immunohistochemical staining for estrogen receptor alpha, antigen retrieval was performed with citraconic anhydride 0.05% (Fluka 27429). For immunohistochemical staining for vimentin, antigen retrieval was performed with Tris/EDTA pH 9.0. Subsequently, endogenous peroxidases were blocked with 3% H2O2. Before slides were incubated with vimentin primary antibody, slides were pre-incubated with 1% milk/PBS. Before slides were incubated with primary antibody for progesterone receptor, slides were pre-incubated with PBS/4% BSA/5% NGS. Next, slides were incubated with HRP-conjugated Envision (Dako) or stained with biotin-conjugated secondary antibodies and incubated with HRP-conjugated streptavidin-biotin complex (Dako). Following detection with 3,3-diaminobenzidine-tetrahydrochloride (DAB; Sigma A-6926), slides were counterstained with heamatoxylin and dehydrated. Tumors were only scored positive for ER or PR, when more than 10% of tumor cells stained positive.

ImmunoblottingTumor protein lysates were made by using a microhomogenizer and RIPA lysis buffer (50mM Tris pH 8.0, 150mM NaCl, 0.1% SDS, 0.1% deoxycholate, 1% NP40) complemented with 2x Complete protease inhibitor cocktail (Roche) and Pefabloc (Roche; 1mg/ml). Following homogenizing on ice, tumor lysates were kept on ice for 30 minutes. After a short spin, protein concentrations were determined with the BCA assay (Pierce). Samples were prepared for gel electrophoresis by adding 4x NuPage LDS sample buffer (Invitrogen) and incubated for 5 minutes at 100˚C to denature proteins. Samples were fractionated on 3-8% NuPage Tris-Acetate precast gels (Invitrogen) in the presence of 10x NuPage reducing agent and transferred onto Immobilon-PVDF membranes (Millipore) in transfer buffer (0.4M Glycine, 50mM Tris, 0.01% SDS) overnight at 100mA at 4˚C. Membranes were blocked for 1 hour at room temperature in 5% milk (Campina) in TBST (25mM Tris pH 7.5, 125mM NaCl, 0.1% Tween). Subsequently, membranes were incubated with primary antibodies in 1% milk/TBST for 1 hour at room temperature (POLII) or for 4 hours at 4˚C (BRCA1). After three washes with 1% milk/TBST, membranes were incubated with secondary antibodies in 1% milk/TBST for 1 hour at room temperature. Membranes were washed three times with 1% milk/TBST and once with TBS (25mM Tris pH 7.5, 125mM NaCl). For detection of proteins, the ECL plus western blotting detection system (Amersham) was used.

hBRCA1 knockdown experimentsSUM1315MO2 cells were transduced with pLKO-puro shRNA viruses obtained from TRC library clones (Thermo Scientific Open Biosystems). We used shRNAs targeting human BRCA1 (TRCN0000039833 (#5), 5’-CCCTAAGTTTACTTCTCTAAA-3’; TRCN0000010305 (#8), 5’-AGAATCCTAGAGATACTGAA-3’) and a nontargeting shRNA (SHC202,

Chapter 6

6

154

5’-CAACAAGATGAAGAGCACCAA-‘3). After selection with 1.8 μg/ml puromycin, 1000 cells per 6-well were seeded for clonal growth. The experiment was performed in sextuplicate. After two weeks, cells were incubated for 4 hours with CellTiter-Blue (Promega). Fluorescence (590nm) and absorbance (570 and 600nm) were measured by using the Infinite M200 microplatereader (Tecan). At the same time samples were taken for RNA and protein analysis. The cells were fixed in 4% paraformaldehyde for 10 minutes and stained with 0.1% crystal violet for 30 minutes.

RAD51 foci formation assayCryo-preserved tumors were cut into small pieces with sterile scalpels (Swann Morton) in PBS (Invitrogen) supplemented with 0.5mM EDTA (Lonza). Subsequently, tumor pieces were digested with 0.1% trysin (Invitrogen) and 3mg/ml collagenase A (Roche) for 30 minutes at 37˚C. Tumor cell suspensions were passed through a 40uM cell strainer (BD Biosciences). After cell counting, appropriate amount of tumor cells were plated on glass coverslips (Omnilabo) and grown for 36-48 hours at 37˚C in low oxygen (3%) condition. Cells were irradiated with 10 Gy to induce repair foci at DNA DSBs. After irradiation, cells were incubated for 6 hours at 37˚C, washed with PBS++ (containing 1mM CaCl2 and 0.5mM MgCl2) and fixed using 2% paraformaldehyde (PFA; Merck) in PBS++ for 20 minutes at room temperature. Fixed cells were washed three times with PBS++ and stored overnight at 4˚C. The next day cells were incubated in 0.2% Triton X-100 (Sigma) in PBS++ for permeabilization and washed three times in staining buffer (PBS++ containing 0.5% BSA (Sigma), 0.15% glycin (Fluka) and 0.1% Triton X-100 (Sigma) for 5 minutes at a rocking plate. To block aspecific interactions, cells were incubated for 30 minutes in staining buffer at room temperature. Subsequently, cells were incubated with the primary antibody against RAD51 (1:10000 in staining buffer) for 2 hours at room temperature. After three washes in staining buffer, cells were incubated with the secondary antibody for 1 hour at room temperature. After three additional washes in staining buffer, cells were stained with DAPI (Invitrogen; 0.5μg/ml in staining buffer) for 5 minutes at room temperature. Cells were washed once in staining buffer and then coverslips were mounted in Vectashield H1000 (Vector Laboratories). Pictures were taken by using an AxioObserver Z1 inverted microscope (Zeiss) equipped with a cooled ORCA AG black and white CCD camera (Hamamatsu) and AxioVision 4.7.2 software (Zeiss). To quantify RAD51 foci in single tumor cells, 150-200 cells per condition were counted blindly using a 63x magnification lens. Cells were scored RAD51-positive if they had more than ten RAD51-positive dots per nucleus.

Acknowledgements

We thank the personnel of the animal facility of the Netherlands Cancer Institute (NKI) for excellent animal husbandry; the NKI microarray facility for expert help with the aCGH studies; the NKI animal pathology department for their expertise on immunohistochemical stainings; M. O’Connor (Astrazeneca) for providing us with olaparib; R. Kanaar (Erasmus MC, Rotterdam, NL) for the RAD51 antibody; R.I. Drapkin (Dana-Farber Cancer Institute, Boston, USA) for the mouse Brca1 antibody; M. Schutte for the SUM1315MO2 human breast cancer cell line and M. Aarts, M. Dekker and S. de Vries for their expert help with the oligonucleotide-mediated gene targeting. This work was supported by grants from the Dutch Cancer Society (NKI 2007-3772 to JJ, SR and J. Schellens; NKI 2008-4116 to JJ and PB; NKI 2012-5220 to SR and JJ) and the Cancer Systems Biology Center funded by the


6

155

Netherlands Organization for Scientific Research (NWO).

References

Aarts, M., Dekker, M., de Vries, S., van der Wal, A., and te Riele, H. (2006). Generation of a mouse mutant by oligonucleotide-mediated gene modification in ES cells. Nucleic Acids Res. 34, e147.

Anderson, S.F., Schlegel, B.P., Nakajima, T., Wolpin, E.S., and Parvin, J.D. (1998). BRCA1 protein is linked to the RNA polymerase II holoenzyme complex via RNA helicase A. Nat. Genet. 19, 254–256.

Audeh, M.W., Carmichael, J., Penson, R.T., Friedlander, M., Powell, B., Bell-McGuinn, K.M., Scott, C., Weitzel, J.N., Oaknin, A., Loman, N., et al. (2010). Oral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and recurrent ovarian cancer: a proof-of-concept trial. Lancet 376, 245–251.


Bhattacharyya, A., Ear, U.S., Koller, B.H., Weichselbaum, R.R., and Bishop, D.K. (2000). The breast cancer susceptibility gene BRCA1 is required for subnuclear assembly of Rad51 and survival following treatment with the DNA cross-linking agent cisplatin. J. Biol. Chem. 275, 23899–23903.

Bochar, D.A., Wang, L., Beniya, H., Kinev, A., Xue, Y., Lane, W.S., Wang, W., Kashanchi, F., and Shiekhattar, R. (2000). BRCA1 is associated with a human SWI/SNF-related complex: linking chromatin remodeling to breast cancer. Cell 102, 257–265.

Boyd, J., Sonoda, Y., Federici, M.G., Bogomolniy, F., Rhei, E., Maresco, D.L., Saigo, P.E., Almadrones, L.A., Barakat, R.R., Brown, C.L., et al. (2000). Clinicopathologic features of BRCA-linked and sporadic ovarian cancer. Jama 283, 2260–2265.


Buisson, M., Anczuków, O., Zetoune, A.B., Ware, M.D., and Mazoyer, S. (2006). The 185delAG mutation (c.68_69delAG) in the BRCA1 gene triggers translation reinitiation at a downstream AUG codon. Hum. Mutat. 27, 1024–1029.

Byrski, T., Gronwald, J., Huzarski, T., Grzybowska, E., Budryk, M., Stawicka, M., Mierzwa, T., Szwiec, M., Wisniowski, R., Siolek, M., et al. (2010). Pathologic complete response rates in young women with BRCA1-positive breast cancers after neoadjuvant chemotherapy. J. Clin. Oncol. 28, 375–379.

Chetrit, A., Hirsh-Yechezkel, G., Ben-David, Y., Lubin, F., Friedman, E., and Sadetzki, S. (2008). Effect of BRCA1/2 mutations on long-term survival of patients with invasive ovarian cancer: the national Israeli study of ovarian cancer. J. Clin. Oncol. 26, 20–25.

Conti, E., and Izaurralde, E. (2005). Nonsense-mediated mRNA decay: molecular insights and mechanistic variations across species. Curr. Opin. Cell Biol. 17, 316–325.

Dekker, M., Brouwers, C., Aarts, M., van der Torre, J., de Vries, S., van de Vrugt, H., and te Riele, H. (2006). Effective oligonucleotide-mediated gene disruption in ES cells lacking the mismatch repair protein MSH3. Gene Ther. 13, 686–694.

Dekker, M., Brouwers, C., and te Riele, H. (2003). Targeted gene modification in mismatch-repair-deficient embryonic stem cells by single-stranded DNA oligonucleotides. Nucleic Acids Res. 31, e27.

Chapter 6

6

156

Dekker, M., de Vries, S., Aarts, M., Dekker, R., Brouwers, C., Wiebenga, O., de Wind, N., Cantelli, E., Tonelli, R., and Te Riele, H. (2011). Transient suppression of MLH1 allows effective single-nucleotide substitution by single-stranded DNA oligonucleotides. Mutat. Res. 715, 52–60.

DeSantis, C., Siegel, R., Bandi, P., and Jemal, A. (2011). Breast cancer statistics, 2011. CA Cancer J Clin 61, 409–418.

Drost, R., Bouwman, P., Rottenberg, S., Boon, U., Schut, E., Klarenbeek, S., Klijn, C., van der Heijden, I., van der Gulden, H., Wientjens, E., et al. (2011). BRCA1 RING Function Is Essential for Tumor Suppression but Dispensable for Therapy Resistance. Cancer Cell 20, 797–809.



Fong, P.C., Yap, T.A., Boss, D.S., Carden, C.P., Mergui-Roelvink, M., Gourley, C., De Greve, J., Lubinski, J., Shanley, S., Messiou, C., et al. (2010). Poly(ADP)-ribose polymerase inhibition: frequent durable responses in BRCA carrier ovarian cancer correlating with platinum-free interval. J Clin Oncol 28, 2512–2519.

Foulkes, W.D. (2006). BRCA1 and BRCA2: chemosensitivity, treatment outcomes and prognosis. Fam. Cancer 5, 135–142.

Frank, T.S., Deffenbaugh, A.M., Reid, J.E., Hulick, M., Ward, B.E., Lingenfelter, B., Gumpper, K.L., Scholl, T., Tavtigian, S.V., Pruss, D.R., et al. (2002). Clinical characteristics of individuals with germline mutations in BRCA1 and BRCA2: analysis of 10,000 individuals. J. Clin. Oncol. 20, 1480–1490.

Friedman, L.S., Szabo, C.I., Ostermeyer, E.A., Dowd, P., Butler, L., Park, T., Lee, M.K., Goode, E.L., Rowell, S.E., and King, M.C. (1995). Novel inherited mutations and variable expressivity of BRCA1 alleles, including the founder mutation 185delAG in Ashkenazi Jewish families. Am. J. Hum. Genet. 57, 1284–1297.

Gelmon, K.A., Tischkowitz, M., Mackay, H., Swenerton, K., Robidoux, A., Tonkin, K., Hirte, H., Huntsman, D., Clemons, M., Gilks, B., et al. (2011). Olaparib in patients with recurrent high-grade serous or poorly differentiated ovarian carcinoma or triple-negative breast cancer: a phase 2, multicentre, open-label, non-randomised study. Lancet Oncol. 12, 852–861.

Holstege, H., Horlings, H.M., Velds, A., Langerod, A., Borresen-Dale, A.L., Van De Vijver, M.J., Nederlof, P.M., and Jonkers, J. (2010). BRCA1-mutated and basal-like breast cancers have similar aCGH profiles and a high incidence of protein truncating TP53 mutations. BMC Cancer 10, 654.

Huen, M.S.Y., Sy, S.M.H., and Chen, J. (2010). BRCA1 and its toolbox for the maintenance of genome integrity. Nat. Rev. Mol. Cell Biol. 11, 138Jonkers, J., Meuwissen, R., van der Gulden, H., Peterse, H., van der Valk, M., and Berns, A. (2001). Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat. Genet. 29, 418–425.

Klijn, C., Holstege, H., de Ridder, J., Liu, X., Reinders, M., Jonkers, J., and Wessels, L. (2008). Identification of cancer genes using a statistical framework for multiexperiment analysis of nondiscretized array CGH data. Nucleic Acids Res. 36, e13.

Lakhani, S.R., Van De Vijver, M.J., Jacquemier, J., Anderson, T.J., Osin, P.P., McGuffog, L., and Easton, D.F. (2002). The pathology of familial breast cancer: predictive value of immunohistochemical markers estrogen receptor, progesterone receptor, HER-2, and p53 in patients with mutations in BRCA1 and BRCA2. J Clin Oncol 20, 2310–2318.


6

157

Lejeune, F., and Maquat, L.E. (2005). Mechanistic links between nonsense-mediated mRNA decay and pre-mRNA splicing in mammalian cells. Curr. Opin. Cell Biol. 17, 309–315.

Levy-Lahad, E., and Friedman, E. (2007). Cancer risks among BRCA1 and BRCA2 mutation carriers. Br. J. Cancer 96, 11–15.

Liu, X., Holstege, H., van der Gulden, H., Treur-Mulder, M., Zevenhoven, J., Velds, A., Kerkhoven, R.M., van Vliet, M.H., Wessels, L.F.A., Peterse, J.L., et al. (2007). Somatic loss of BRCA1 and p53 in mice induces mammary tumors with features of human BRCA1-mutated basal-like breast cancer. Proc. Natl. Acad. Sci. U.S.A. 104, 12111–12116.

Moslehi, R., Chu, W., Karlan, B., Fishman, D., Risch, H., Fields, A., Smotkin, D., Ben-David, Y., Rosenblatt, J., Russo, D., et al. (2000). BRCA1 and BRCA2 mutation analysis of 208 Ashkenazi Jewish women with ovarian cancer. Am. J. Hum. Genet. 66, 1259–1272.


Norquist, B., Wurz, K.A., Pennil, C.C., Garcia, R., Gross, J., Sakai, W., Karlan, B.Y., Taniguchi, T., and Swisher, E.M. (2011). Secondary Somatic Mutations Restoring BRCA1/2 Predict Chemotherapy Resistance in Hereditary Ovarian Carcinomas. Journal of Clinical Oncology 29, 3008 –3015.

Patel, K.J., Crossan, G.P., and Hodskinson, M.R.G. (2011). “Ring-fencing” BRCA1 tumor suppressor activity. Cancer Cell 20, 693–695.

Perrin-Vidoz, L., Sinilnikova, O.M., Stoppa-Lyonnet, D., Lenoir, G.M., and Mazoyer, S. (2002). The nonsense-mediated mRNA decay pathway triggers degradation of most BRCA1 mRNAs bearing premature termination codons. Hum. Mol. Genet. 11, 2805–2814.

Phelan, C.M., Kwan, E., Jack, E., Li, S., Morgan, C., Aubé, J., Hanna, D., and Narod, S.A. (2002). A low frequency of non-founder BRCA1 mutations in Ashkenazi Jewish breast-ovarian cancer families. Hum. Mutat. 20, 352–357.

Rahman, N., and Stratton, M.R. (1998). The genetics of breast cancer susceptibility. Annu. Rev. Genet. 32, 95–121.

Roa, B.B., Boyd, A.A., Volcik, K., and Richards, C.S. (1996). Ashkenazi Jewish population frequencies for common mutations in BRCA1 and BRCA2. Nat. Genet. 14, 185–187.

Roche-Lestienne, C., Soenen-Cornu, V., Grardel-Duflos, N., Laï, J.-L., Philippe, N., Facon, T., Fenaux, P., and Preudhomme, C. (2002). Several types of mutations of the Abl gene can be found in chronic myeloid leukemia patients resistant to STI571, and they can pre-exist to the onset of treatment. Blood 100, 1014–1018.

de Ronde, J.J., Klijn, C., Velds, A., Holstege, H., Reinders, M.J., Jonkers, J., and Wessels, L.F. (2010). KC-SMARTR: An R package for detection of statistically significant aberrations in multi-experiment aCGH data. BMC Res Notes 3, 298.


Rottenberg, S., Nygren, A.O.H., Pajic, M., van Leeuwen, F.W.B., van der Heijden, I., van de Wetering, K., Liu, X., de Visser, K.E., Gilhuijs, K.G., van Tellingen, O., et al. (2007). Selective induction of chemotherapy resistance of mammary tumors in a conditional mouse model for hereditary breast cancer. Proc. Natl. Acad. Sci. U.S.A. 104, 12117–12122.

Rottenberg, S., Pajic, M., and Jonkers, J. (2010). Studying drug resistance using genetically engineered mouse models for breast cancer. Methods Mol Biol 596, 33–45.

Chapter 6

6

158



Scully, R., Anderson, S.F., Chao, D.M., Wei, W., Ye, L., Young, R.A., Livingston, D.M., and Parvin, J.D. (1997a). BRCA1 is a component of the RNA polymerase II holoenzyme. Proc. Natl. Acad. Sci. U.S.A. 94, 5605–5610.

Scully, R., Chen, J., Ochs, R.L., Keegan, K., Hoekstra, M., Feunteun, J., and Livingston, D.M. (1997b). Dynamic changes of BRCA1 subnuclear location and phosphorylation state are initiated by DNA damage. Cell 90, 425–435.

Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., Ashley, T., and Livingston, D.M. (1997c). Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 88, 265–275.


Smith, T.M., Lee, M.K., Szabo, C.I., Jerome, N., McEuen, M., Taylor, M., Hood, L., and King, M.C. (1996). Complete genomic sequence and analysis of 117 kb of human DNA containing the gene BRCA1. Genome Res. 6, 1029–1049.

Struewing, J.P., Abeliovich, D., Peretz, T., Avishai, N., Kaback, M.M., Collins, F.S., and Brody, L.C. (1995). The carrier frequency of the BRCA1 185delAG mutation is approximately 1 percent in Ashkenazi Jewish individuals. Nat. Genet. 11, 198–200.




Vollebergh, M.A., Lips, E.H., Nederlof, P.M., Wessels, L.F., Schmidt, M.K., van Beers, E.H., Cornelissen, S., Holtkamp, M., Froklage, F.E., de Vries, E.G., et al. (2010). An aCGH classifier derived from BRCA1-mutated breast cancer and benefit of high-dose platinum-based chemotherapy in HER2-negative breast cancer patients. Ann Oncol.

Yarden, R.I., and Brody, L.C. (1999). BRCA1 interacts with components of the histone deacetylase complex. Proc. Natl. Acad. Sci. U.S.A. 96, 4983–4988.


6

159

Table S1A. Genotype distribution of Brca1185stop/+ x Brca1185stop/+ offspring

Genotype All +/+ 185stop/+185stop/185stop

n.d.

E7.5 17 4 (4.25) 13 (8.5) 0 (4.25) 0

E8.5 34 9 (8.5) 17 (17) 5 (8.5) 3

E9.5 10 2 (2.5) 6 (5) 2 (2.5) 0

E10.5 20 4 (5) 10 (10) 6 (5) 0

E11.5 17 6 (4.25) 7 (8.5) 1 (4.25) 3*

E13.5 40 11 (10) 23 (20) 2* (10) 4*

Postnatal 40 10 (10) 30 (20) 0 (10) 0

Table S1B. Genotype distribution of Brca15382stop/+ x Brca15382stop/+ offspring

Genotype All +/+ 5382stop/+5382stop/5382stop

n.d.

E7.5 2 1 (0.5) 1 (1) 0 (0.5) 0

E8.5 31 7 (7.75) 17 (15.5) 7 (7.75) 0

E9.5 22 6 (5.5) 10 (11) 3 (5.5) 3

E12.5 23 4 (5.75) 13 (11.5) 1* (5.75) 5*

Postnatal 30 9 (7.5) 21 (15) 0 (7.5) 0

The expected number of mice according to Mendelian ratio is depicted between brackets. Resorbed embryos are depicted with *. Embryos of which the genotype could not be determined are displayed in the n.d. column.

Supplemental InformationSupplemental figures and tables

Chapter 6

6

160

p=0.2025 p=0.1096

Figure S1. Spontaneous tumor development in KB1(185stop)P and KB1(5382stop)P mice. A. Skin tumor-free survival of KB1(185stop)P (green; T50=177 days, n=12 mice) and KB1(5382stop)P mice (blue; T50=191 days, n=14 mice). KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=0.5456. T50: median survival, n: the number of mice. B. Mammary tumor-free survival of KB1P mice from the 185stop cohort (green; T50=198 days, n=29 mice) and KB1P

mice from the 5382stop cohort (blue; T50=194 days, n=39 mice). KB1P (185stop cohort) vs. KB1P (5382stop cohort) Log-rank test p=0.2025. C. Skin tumor-free survival of KB1P mice from the 185stop cohort (green; T50=186 days, n=23 mice) and KB1P mice from the 5382stop cohort (blue; T50=195 days, n=15 mice). KB1(5382stop)P vs. KB1P Log-rank test p=0.1096. D. Distribution in percentages of different tumor types in KB1(185stop)P, KB1(5382stop)P and KB1P mice. Purple: only one or multiple mammary tumor(s); orange: both mammary and skin tumor(s); yellow: only one or multiple skin tumor(s); blue: another kind of tumor.

A

B C

D


6

161

Figure S2. Molecular characterization of KB1(185stop)P and KB1(5382stop)P mouse mammary tumors. A. HE pictures of different types of KB1(185stop)P mammary tumors. Scale bar represents 100 μm. B. HE pictures of different types of KB1(5382stop)P mammary tumors. C. Immunohistochemical characterization of KB1(185stop)P solid mammary carcinoma. CK8= cytokeratin 8, Vim= vimentin, ER= estrogen receptor, PR= progesterone receptor. Scale bar represents 100 μm. D. Immunohistochemical characterization of KB1(5382stop)P solid mammary carcinoma.

A

B

C

D

Chapter 6

6

162

Table S2. Immunohistochemical characterization of KB1(185stop)P and KB1(5382stop)P mammary tumors

Cytokeratin 8 Vimentin ER PR

+ +/- - + +/- - + - + -

KB1(185stop)P 87 4 9 17 4 78 13 87 22 78

KB1(5382stop)P 100 0 0 10 24 67 14 86 10 90

KB1(185stop)P (n=23) and KB1(5382stop)P (n=21) mammary tumors were scored positive (+), negative (-) or partly positive (+/-) for cytokeratin 8 and vimentin. Cytokeratin 8+/- = expression in mammary tubules and small tumor lobules, not in larger lobules. Vimentin +/- = some expression in non-solid parts of the tumor. Tumors were scored positive (+) for estrogen receptor (ER) or progesterone receptor (PR) when more than 10% of cells showed staining. Represented is the percentage of tumors.

Figure S3. Olaparib response of KB1(185stop)P and KB1(5382stop)P mammary tumors. Different colors represent individual spontaneous donor tumors. Panels on the left depict relative tumor volumes without treatment, panels on the right depict relative tumor volumes after olaparib treatment.

KB1(185stop)P tumors: No treatment

0

200

400

600

800

1000

1200

0 10 20 30 40 50 60 70 80

Time (days)

Rel

ativ

e tu

mor

vo

lum

e (%

)


0

200

400

600

800

1000

1200

0 10 20 30 40 50 60 70 80

Time (days)

Rel

ativ

e tu

mor

vo

lum

e (%

)

T1 T1 T2 T2 T3 T3 T4 T4

KB1(185stop)P tumors: Olaparib

0

200

400

600

800

1000

1200

0 10 20 30 40 50 60 70 80

Time (days)

Rel

ativ

e tu

mor

vo

lum

e (%

)

KB1(5382stop)P tumors: Olaparib

0

200

400

600

800

1000

1200

0 10 20 30 40 50 60 70 80

Time (days)

Rel

ativ

e tu

mor

vo

lum

e (%

)

T1 T1 T2 T2 T3 T3 T4 T4


6

163

Table S3A. Overview transplanted KB1(185stop)P tumors

Donor tumor

# of tumors T1 T2 T3 T4 T5

Transplanted 9 10 10 10 10

Outgrowth 3/9 10/10 9/10 10/10 10/10

No treatment 1/3 1/10 1/9 1/10 1/10

Cisplatin treatment 2/3 9/10 8/9 9/10 9/10

Cisplatin-resistant 2/2 3/9 5/8 6/9 7/9

Genetic reversion 0/2 0/3 0/5 0/6 0/7

Table S3B. Overview transplanted KB1(5382stop)P tumors

Donor tumor

# of tumors T1 T2 T3 T4 T5 T6

Transplanted 10 10 10 10 10 10

Outgrowth 8/10 9/10 10/10 10/10 6/10 10/10

No treatment 1/8 1/9 1/10 1/10 1/6 1/10

Cisplatin treatment 7/8 8/9 9/10 9/10 5/6 9/10

Cisplatin-resistant 0/7 1/8 1/9 0/9 0/5 0/9

Genetic reversion 0/0 0/0 0/0 0/0 0/0 0/0

T1 = spontaneous donor tumor 1, T2 = spontaneous donor tumor 2, T3 = spontaneous donor tumor 3, T4 = spontaneous donor tumor 4, T5 = spontaneous donor tumor 5 and T6 = spontaneous donor tumor 6.

Chapter 6

6

164


0

200

400

600

800

1000

1200

0 20 40 60 80 100

Time (days)

Rel

ativ

e tu

mor

vo

lum

e (%

)


0

200

400

600

800

1000

1200

0 20 40 60 80 10

Time (days)

Rel

ativ

e tu

mor

vo

lum

e (%

) T1 T2

T1 T3 T2 T4

0

KB1(185stop)P tumors: Cisplatin

0

200

400

600

800

1000

1200

0 20 40 60 80 100

Time (days)

Rel

ativ

e tu

mor

vo

lum

e (%

)


0

200

400

600

800

1000

1200

0 20 40 60 80 10

Time (days)0

tum

or

volu

me

(%)

Rel

ativ

e


0

200

400

600

800

1000

1200

0 200 400 600 800

Time (days)

Rel

ativ

e tu

mor

vo

lum

e (%

)


0

200

400

600

800

1000

1200

0 200 400 600 800

Time (days)

Rel

ativ

e tu

mor

vo

lum

e (%

)

KB1(185stop)P tumors: Cisplatin KB1(5382stop)P tumors: Cisplatin

T1 T2 T3 T4

T3 T6 T5

T4

T1 T2 T3

T6 T5

T4

T1

T4 T3 T2

T5 T6

T4 T3 T2 T1

A


33

63 6778

67

38 3322

0

20

40

60

80

100

T1 T2 T3 T4

AliveToxicityResistance


13 11

86

88 89100 100 100

14

0

20

40

60

80

100

T1 T2 T3 T4 T5 T6


p=<0.0001

CB

D


6

165

Figure S4. Cisplatin response of KB1(185stop)P and KB1(5382stop)P mammary tumors. A. Response to cisplatin treatment of individual mice transplanted with different KB1(185stop)P and KB1(5382stop)P mammary tumors. Different colors represent individual spontaneous donor tumors. Panels on the left depict relative tumor volumes without treatment, panels on the right depict relative tumor volumes after cisplatin treatment. B. OS of mice transplanted with KB1(185stop)P mammary tumors after cisplatin treatment (grouped per donor tumor). The blue line represents OS of mice transplanted with donor tumor 1 (T1; T50= 62 days, n=9), the pink line represents OS of mice transplanted with donor tumor 2 (T2; T50=44 days, n=8), the yellow line represents OS of mice transplanted with donor tumor 3 (T3; T50=55 days, n=9) and the green line represents OS of mice transplanted with donor tumor 4 (T4; T50=54 days, n=9). T50: median OS, n: the number of mice. C. OS of mice transplanted with KB1(5382stop)P mammary tumors after cisplatin treatment (grouped per donor tumor). The blue line represents OS of mice transplanted with donor tumor 1 (T1; T50=248 days, n=6), the pink line represents OS of mice transplanted with donor tumor 2 (T2; T50=132 days, n=8), the yellow line represents OS of mice transplanted with donor tumor 3 (T3; T50=92 days, n=9), the green line represents OS of mice transplanted with donor tumor 4 (T4; T50=254 days, n=9), the purple line represents OS of mice transplanted with donor tumor 5 (T5; T50=121 days, n=5) and the brown line represents OS of mice transplanted with donor tumor 6 (T6; T50=154 days, n=9). D. Causes of death of mice transplanted with KB1(185stop)P mammary tumors after cisplatin treatment (grouped per donor tumor). Mice that had to be sacrificed because of cisplatin-resistant tumors are depicted in blue, mice that had to be sacrificed because of cisplatin-toxicity are depicted in grey and mice that are still alive are depicted in orange. Percentages are indicated within the stacked bars. E. Causes of death of mice transplanted with KB1(5382stop)P mammary tumors after cisplatin treatment (grouped per donor tumor). F. Tumor-free survival of mice transplanted with KB1(185stop)P (green; T50=56 days, n=35 mice) or KB1(5382stop)P mammary tumors (blue; T50=undefined, n=47 mice) after cisplatin treatment. KB1(185stop)P vs. KB1(5382stop)P Log-rank test p=<0.0001.


33

63 6778

67

38 3322

0

20

40

60

80

100

T1 T2 T3 T4



13 11

86

88 89100 100 100

14

0

20

40

60

80

100

T1 T2 T3 T4 T5 T6


p=<0.0001

E

F

Chapter 6

6

166

Figure S5. BRCA1-ΔRING expression in platinum-resistant mouse Brca1185stop tumor cells. A. Brca1 mRNA expression in KP (black), KB1P (red), untreated (green squares) and platinum-resistant KB1(185stop)P mouse mammary tumors (green triangles). The average Brca1 mRNA expression in several BRCA1-proficient KP tumors was used for normalization. KB1(185stop)P untreated vs. KB1(185stop)P resistant unpaired t test p=0.0032. Error bars indicate SEM. B. BRCA1 protein expression in untreated (U1-U4) and platinum-resistant KB1(185stop)P mouse mammary tumors (R1-R4). BRCA1 expression in a BRCA1-proficient KP tumor was used as positive control. Expression of POLII was used as loading control.

Figure S6. Formation of RAD51 IRIFs in BRCA1185delAG mutant SUM1315MO2 cells after BRCA1 knockdown. SUM: SUM1315MO2 cells without lentiviral transduction, SUM NT: SUM1315MO2 cells after lentiviral transduction with a non-targeting (NT) shRNA, SUM #5: SUM1315MO2 cells after lentiviral transduction with shRNA #5 against human BRCA1, SUM #8: SUM1315MO2 cells after lentiviral transduction with shRNA #8 against human BRCA1. The pictures on the right represent magnifications of the cells indicated with the red triangle.

A

B


6

167

Chapter 7 General discussion

Chapter 7

170

7

Breast cancer is the most frequently diagnosed cancer and leading cause of cancer death among women in the Western world, accounting for 23% of cancer cases and 14% of cancer deaths (Jemal et al., 2011). While breast cancer incidence rates increased in the past 25 years – at least in part due to intensified screening programs - breast cancer death rates have been decreasing due to early detection and improved treatment (reviewed in (Jemal et al., 2011)). Breast cancer is nowadays seen as a collection of diseases that affect the same organ, but have significantly different histopathological features, risk factors, clinical outcome and response to systemic therapy. Up to 10% of all breast cancer cases may be caused by inheritance of mutations in breast cancer susceptibility genes. Identification of those patients carrying such a mutation is important for proper genetic counseling, screening and prevention strategies. Currently, the therapeutic strategies for women with hereditary breast cancer are similar to those for sporadic breast cancer patients. Based on hormone receptor status, lymph node involvement and tumor size, recommendations are made on intervention strategies. These usually consist of surgery in combination with chemotherapy, hormone therapy or radiation. After treatment, the prognosis of a breast cancer patient with certain BRCA1/2 mutations is identical to that of a sporadic breast cancer patient (Rennert et al., 2007). However, the choice of chemotherapy may be particularly important in BRCA1/2 mutation carriers, since BRCA-deficient tumors may respond differently to chemotherapy due to the roles of BRCA1 and BRCA2 in homologous recombination-mediated DNA repair. In this general discussion, I describe our current knowledge of BRCA1-associated breast cancer, thereby highlighting how different functionalities of the BRCA1 protein can contribute to tumor suppression, therapy response and resistance. Additionally, I discuss the future perspectives for patients with BRCA1-related breast cancer, focusing on how improved mouse models and clinical trial design can contribute to improved treatment strategies.

1. Current knowledge1.1 BRCA1 in hereditary breast cancerAlmost half of the hereditary breast cancer cases can be explained by germline mutations in the BRCA1 and BRCA2 genes. The prevalence of pathogenic BRCA1/2 mutations in the general population is estimated to be 1:140 to 1:800 (Whittemore et al., 1997; Risch et al., 2006). In certain populations, BRCA1/2 founder mutations exist. For example in people from Ashkenazi Jew descent, the prevalence of three mutations (185delAG and 5382insC in BRCA1 (Figure 1) and 6174T in BRCA2) is 1:40 (Metcalfe et al., 2010). Approximately 90% of all BRCA1/2 mutations found in the Ashkenazi Jewish population represents one of these three founder mutations (Roa et al., 1996). Individuals with a BRCA1 or BRCA2 mutation have a 50-80% lifetime risk of developing breast cancer and 30-50% risk of developing ovarian cancer. Apart from breast and ovarian cancer, BRCA1/2 mutation carriers are also at risk for other cancers. Especially BRCA2 mutations are associated with an increased risk of pancreatic cancer and melanoma (reviewed in (Clark and Domchek, 2011)). Over 75% of breast tumors arising in women with a BRCA1 mutation have a triple-negative phenotype (Rakha et al., 2008; Reis-Filho and Tutt, 2008), meaning that these tumors do not express estrogen receptor (ER), progesterone receptor (PR) or human

General discussion

171

7

epidermal growth factor receptor type 2 (HER2). Patients with triple-negative breast cancer (TNBC) have a relatively poor outcome compared to other breast cancer subtypes and cannot be treated with endocrine therapy or therapies directed against HER2, like trastuzumab. Mutations in the TRP53 gene occur at higher frequencies in BRCA1-mutated breast and ovarian cancer than in sporadic cases (Crook et al., 1997; Holstege et al., 2009), suggesting that P53 inactivation is required for survival of BRCA1-deficient cells. Various kinds of BRCA1 mutations have been found throughout the BRCA1 coding sequence, but the majority of cancer-associated mutations are frameshift or nonsense mutations that lead to premature chain termination (Breast Cancer Information Core (BIC) Database; http://research.nhgri.nih.gov/bic/). Nonetheless, also a small number of BRCA1 missense mutations, including C61G (Figure 1), have been linked to breast and ovarian cancer predisposition. While mutations that lead to premature chain termination are typically subject to nonsense-mediated mRNA decay (NMD), the two most common pathogenic BRCA1 mutations, 185delAG and 5382insC, are not affected by NMD (Perrin-Vidoz et al., 2002). NMD of mRNA species with chain-terminating mutations in the 5’ region may be avoided by translation re-initiation at an alternative start site downstream of the premature stop codon (Buisson et al., 2006).

1.2 Other breast cancer predisposing genesThe fact that BRCA1/2 mutations account for only 40% of all familial breast cancer cases suggests that there should be other breast cancer susceptibility genes (Ford et al., 1998). Intensive genome-wide searches for other high penetrance genes that predispose for breast cancer has not yielded any plausible candidates that individually can account for the remaining hereditary breast cancer cases. Therefore it is now thought that this gap is explained by multiple low to moderate penetrance breast cancer genes (Pharoah et al., 2008). The identification of BRCA1 and BRCA2 as breast cancer susceptibility genes led to the idea that other proteins involved in the DNA damage response could predispose for breast cancer. In this way, ATM, CHEK2, PALB2 and BRIP1 could be identified as moderate breast cancer susceptibility genes associated with a 2-3 fold increased risk for developing breast cancer (reviewed in (Shuen and Foulkes, 2011). In addition, eighteen small nucleotide polymorphisms (SNPs) have recently been associated with increased breast cancer risk, together accounting for 8% of familial breast cancer cases (Turnbull et al., 2010).

1.3 BRCA1 in sporadic breast cancerA role for BRCA1 has not been clearly demonstrated in sporadic breast and ovarian cancers, which account for 90% of all cases. BRCA1 mutations appeared to be relatively rare in non-familial breast and ovarian cancer cases, even in sporadic TNBC, despite the high degree of loss of heterozygosity (LOH) at the BRCA1 locus (reviewed in (Catteau and Morris, 2002). Despite the absence of somatic BRCA1 mutations, the BRCA1 pathway may still be dysfunctional in nonhereditary basal-like breast cancers (Turner et al., 2007). Sporadic breast and ovarian carcinomas often display decreased expression of BRCA1 (Thompson et al., 1995; Magdinier et al., 1998; Russell et al., 2000). In these cases, BRCA1 was found to be downregulated by for instance epigenetic silencing (Galizia et al., 2010) or transcriptional repression (Baldassarre et al., 2003; Turner et al., 2007). Especially BRCA1 promoter hypermethylation has been identified as an important mechanism for BRCA1 inactivation in sporadic breast cancer (Dobrovic and Simpfendorfer, 1997; Esteller et al.,

Chapter 7

172

7

2000) and appears to correlate with reduced BRCA1 mRNA and protein (Baldwin et al., 2000; Rice et al., 2000). Depending on the study, BRCA1 promoter hypermethylation could be detected in sporadic breast cancer cases with proportions ranging from 11 to 31% (reviewed in (Catteau and Morris, 2002).

1.4 Role of BRCA1 in the DNA damage responseThe BRCA1 gene is located on chromosome 17q21 and encodes a large nuclear protein of 1863 amino acids (aa) (Miki et al., 1994). The two most conserved regions of the BRCA1 protein are located at both ends: an N-terminal RING domain and two BRCT repeats at its extreme C-terminus (reviewed in (Huen et al., 2010; Moynahan and Jasin, 2010), Figure 1A). BRCA1 interacts with its partner BRCA1-associated RING domain protein 1 (BARD1) through the RING domain and the BRCA1/BARD1 heterodimer has potent E3 ubiquitin ligase activity (Wu et al., 1996; Hashizume et al., 2001). The BRCA1 RING domain mediates the interaction with the class of UbcH5 E2 ubiquitin-conjugating enzymes leading to formation of mono- and polyubiquitination chains (Brzovic et al., 2006; Christensen et al., 2007). BRCA1-mediated ubiquitination of multiple substrates is important in regulation of several cellular processes, such as cell cycle checkpoint activation, mitotic spindle assembly and control of centrosome duplication (reviewed in (Huen et al., 2010; Moynahan and Jasin, 2010)). The tandem BRCT repeats at the BRCA1 C-terminus are important for recognition and binding of phosphorylated proteins, which are mainly involved in the DNA damage response (Manke et al., 2003; Rodriguez et al., 2003; Yu et al., 2003). BRCA1 forms at least three different protein complexes mediated by its BRCT domains, namely with Abraxas, BRCA1-interacting protein C-terminal helicase 1 (BACH1) and CtBP-interacting protein 1 (CtIP) (reviewed in (Huen et al., 2010), Figure 1A). The first indication for a role of BRCA1 in HR-mediated repair was the observation that BRCA1 colocalized with the known DNA repair protein RAD51 at sites of DNA damage (Scully et al., 1997). The BRCA1-Abraxas complex is necessary for the recruitment of BRCA1 to sites of DNA damage (reviewed in (Roy et al., 2011)), the BRCA1-BACH1 complex is associated with DNA repair during replication (Cantor et al., 2001) and the BRCA1-CtIP complex functions in DNA double-strand break (DSB) resection (Yu et al., 1998). BRCA1 directly binds to phosphorylated CtIP and localizes CtIP to DSBs, which results in resection of DSB ends and formation of single-stranded DNA (ssDNA) overhangs that form a key trigger for activation of the HR pathway (Yu et al., 1998; Chen et al., 2008). Next to the tandem BRCT repeats, BRCA1 also contains a SQ/TQ cluster (SCD) domain at its C-terminus, which contains approximately ten potential ataxia-telangiectasia mutated (ATM) phosphorylation sites (Figure 1A). Phosphorylation of BRCA1 by ATM has been reported to be essential for cell cycle checkpoint activation (Cortez et al., 1999; Xu et al., 2002). The C-terminus of BRCA1 also contains a coil-coiled domain that associates with partner and localizer of BRCA2 (PALB2), which provides the physical link between BRCA1 and BRCA2 since it also interacts with BRCA2 (Xia et al., 2006). Previously it was reported that BRCA1 forms a stable complex with BRCA2 (Chen et al., 1998), which is able to function in HR-mediated repair by directly interacting with RAD51 (reviewed in (Holloman, 2011)). The interaction between BRCA1 and PALB2 is required to recruit BRCA2 and RAD51 to sites of DNA damage (Sy et al., 2009; Zhang et al., 2009a, 2009b). BRCA2 binds directly to RAD51 and facilitates RAD51 loading on ssDNA (Jensen et al., 2010; Liu et al., 2010; Thorslund et al., 2010). The ensuing RAD51-ssDNA nucleoprotein filaments promote homology search

General discussion

173

7Figure 1. Structural organization and interaction partners of wild type and mutant BRCA1 proteins. (A) BRCA1 contains two conserved domains at its termini: the RING domain at the N-terminus and tandem BRCT repeats at the C-terminus. The RING domain is important for the interaction with BARD1 and the BRCA1/BARD1 heterodimer confers E3 ubiquitin ligase activity. The BRCT repeats mainly bind proteins involved in the DNA damage response (abraxas, BACH1, CtIP). The interaction of BRCA1 with PALB2 and BRCA2 is mediated by the coiled coil domain. The SQ/TQ cluster domain (SCD) contains multiple ATM phosphorylation sites. BRCA1 contains two nuclear localization signals (NLS) in exon 11 and two nuclear export sequences (NES) in the RING domain. (B) While the synthetic I26A missense mutation (indicated with star) only disrupts enzymatic activity but leaves formation of the BRCA1/BARD1 heterodimer intact, the common C61G missense mutation (indicated with star) disrupts both. Although the 185delAG nonsense mutation is described to produce a highly instable protein (indicated with dashed lines) of only 39 amino acids (aa), internal translation reinitiation can also lead to production of a RING-less protein. The 5382insC nonsense mutation generates a highly instable protein (indicated with dashed lines) with a small C-terminal truncation.

1.5 The potential role of BRCA1 ubiquitin ligase activity in tumor suppressionThe E3 ubiquitin ligase activity of BRCA1 has been predicted to be required for its tumor suppression function, since certain cancer-associated mutations in the BRCA1 RING domain specifically ablate this activity (Hashizume et al., 2001). Ubiquitin ligase activity of BRCA1 has also been implicated in heterochromatin-mediated gene silencing (Zhu et al., 2011). BRCA1 deficiency in mice resulted in a reduction of condensed DNA regions leading to disruption of gene silencing of satellite DNA, possibly through loss of BRCA1-mediated ubiquitination of histone H2A. Maintenance of heterochromatin integrity and gene silencing mediated by BRCA1 could thus be important for its tumor suppressive function. While mouse and human BRCA1-deficient tumors do show upregulation of satellite repeats and features of genomic instability are observed after ectopic expression of satellite transcripts (Zhu et al., 2011), the precise mechanism behind these observations is still unclear. Remarkably, there appeared to be no defect in tumor suppression in mice that expressed enzymatically inactive BRCA1 (Shakya et al., 2011). These mice expressed a mutant BRCA1 protein containing a synthetic missense mutation (I26A) in the RING

and strand invasion, which are essential for proper recombination.

A

B

Chapter 7

174

7

domain that allows formation of the BRCA1/BARD1 heterodimer, but prevents E3 ubiquitin ligase activity (Brzovic et al., 2003; Christensen et al., 2007). In contrast, mammary tumor development was accelerated in mice carrying the Brca1C61G mutation (Drost et al., 2011). The C61G mutation in the BRCA1 RING domain is one of the most frequently reported missense variants linked to the development of human breast and ovarian cancer ((Castilla et al., 1994; Friedman et al., 1994), Figure 1). Unlike the synthetic I26A mutation, the pathogenic C61G mutation impairs both E3 ubiquitin ligase activity and BRCA1/BARD1 heterodimerization (Hashizume et al., 2001; Ruffner et al., 2001; Mallery et al., 2002). This suggests that the tumor suppressive function of the BRCA1 RING is mediated by the BRCA1/BARD1 heterodimer without involvement of its E3 ubiquitin ligase activity. The formation of identical basal-like breast tumors after mammary-specific inactivation of Brca1 and/or Bard1 (Shakya et al., 2008) further supports the idea that the tumor suppression function of BRCA1 is dependent on the BRCA1/BARD1 heterodimer.

1.6 The potential role of BRCA1 cellular localization in tumor suppressionSo what other function of the BRCA1/BARD1 heterodimer, independent of its E3 ubiquitin ligase activity, could contribute to the role of BRCA1 as a tumor suppressor? Two of the processes that BRCA1 is involved in, namely transcription and DNA repair, exclusively take place in the nucleus. However, since BRCA1 is a very large protein of 220 kDa, it can only enter the nucleus via active transport across the nuclear membrane. BRCA1 contains two nuclear localization signals (NLSs), which are both located in exon 11 ((Thakur et al., 1997), Figure 1A). BRCA1 can enter the nucleus both via an NLS-dependent mechanism, which involves the classical importin alpha/beta pathway (Chen et al., 1996), as well as via an NLS-independent mechanism, which requires the BRCA1 RING domain and interaction with BARD1 (Fabbro et al., 2002). Also the BRCT domain at the C-terminus of BRCA1 appears to play a role in nuclear localization of BRCA1, since a BRCT mutant form of BRCA1 (5382insC) expressed in HCC1937 breast cancer cells was not able to form nuclear foci upon DNA damage (Scully et al., 1999; Zhong et al., 1999; Rodriguez et al., 2004). The N-terminal RING domain and C-terminal BRCT domain of BRCA1 even seem to cooperate in targeting BRCA1 to DNA damaged-induced nuclear foci (Au and Henderson, 2005). BRCA1 also undergoes receptor-mediated nuclear export accomplished by two distinct nuclear export sequences (NESs), which are both located in the BRCA1 RING domain ((Rodríguez and Henderson, 2000; Thompson et al., 2005), Figure 1A). BARD1 appears to be able to mask the N-terminal NES of BRCA1, which retains BRCA1 in the nucleus (Fabbro et al., 2002) and thereby prevents induction of apoptosis by cytoplasmic BRCA1 (Fabbro et al., 2004). BRCA1-mediated apoptosis might involve caspase 3-dependent cleavage of BRCA1 into a 90 kDa fragment, which contains the BRCT domain of BRCA1 and is mainly localized in the cytoplasm (Zhan et al., 2002; Dizin et al., 2008). Presumably, only when the level of DNA damage is beyond repair, BRCA1 needs to be exported from the nucleus to facilitate apoptosis in the cytoplasm. Therefore, tight regulation of BRCA1 nuclear import and export is likely to be important for maintenance of genomic integrity and tumor suppression. Presumably, several pathogenic BRCA1 mutations can have an impact on BRCA1 cellular localization and thereby disturb BRCA1 normal function. For example, BRCA1 mutant proteins with a small C-terminal truncation, like 5382insC (Figure 1B), show mainly cytoplasmic localization of BRCA1, while other mutant proteins exhibit enhanced nuclear staining (Rodriguez et al., 2004). As a consequence of altered subcellular localization, BRCA1 mutant proteins might

General discussion

175

7

also interact with different proteins and acquire unique functions that are beneficial for cancer cells. This might explain why loss of the BRCA1 wild type allele in tumors often coincides with an increased copy number of the mutant allele (Staff et al., 2000). Possibly cellular localization of BRCA1 may even be used as a functional biomarker to predict whether a BRCA1-mutated tumor will respond to therapy. Presumably, a tumor with mainly cytoplasmic BRCA1 will respond better to DNA-damaging therapy than a tumor with BRCA1 predominantly present in the nucleus.

1.7 Conventional chemotherapeutics in BRCA1-associated breast cancerPlatinum compounds are known to be very effective chemotherapeutic agents in ovarian cancer, especially in women with BRCA1/2 mutations. Patients with BRCA1/2-mutated ovarian carcinomas display longer recurrence-free survival than sporadic ovarian cancer patients, especially after treatment with platinum compounds (Boyd et al., 2000; Ben David et al., 2002; Cass et al., 2003; Chetrit et al., 2008). Platinum compounds, such as cisplatin and carboplatin, cause intrastrand and interstrand crosslinks (ICLs) which covalently link DNA and thereby prevent proper transcription and replication (reviewed in (Deans and West, 2011)). ICL repair is a multi-step process, which involves generation of a DSB that needs to be repaired by HR. Since BRCA1 is involved in HR-mediated DNA repair, BRCA1-deficient cells cannot repair the DNA DSBs, which renders them highly sensitive to platinum agents. Unfortunately, platinum compounds have toxic side effects in healthy cells, which can lead to nephro-, neuro- and ototoxicity. While multiple preclinical studies convincingly showed that especially BRCA1-mutated breast cancers are highly sensitive to treatment with DNA DSB-inducing agents like cisplatin (Bhattacharyya et al., 2000; Rottenberg et al., 2007; Tassone et al., 2009), it took a long time before these findings could be confirmed in a clinical setting. The high efficacy of traditional drug combinations in the general breast cancer population made it difficult to justify novel clinical trials involving these relatively toxic platinum agents. Moreover, since clinical trials mainly involve heavily pretreated patients with metastatic breast cancer, the observed responses are often rather marginal due to acquired multidrug resistance. Consequently, platinum agents are not routinely used in treatment of breast cancer nowadays. Recently, the first clinical trials have been performed to evaluate the use of cisplatin and carboplatin to treat BRCA1-mutated breast cancer. Neoadjuvant use of cisplatin appears to result in high rates of complete pathological response in BRCA1 mutation carriers with breast cancer (Byrski et al., 2009, 2010). BRCA1 mutation carriers even seem to respond better to cisplatin compared to triple-negative breast cancer patients without a BRCA1 mutation (Silver et al., 2010). Additionally, patients with BRCA1-like tumors, based on aCGH profile, responded better to adjuvant high-dose platinum-based versus conventional chemotherapy compared to patients with non-BRCA1-like tumors (Vollebergh et al., 2011).

1.8 Synthetic lethality and targeted inhibitors in BRCA1-associated breast cancerThe concept of synthetic lethality involves a functional relationship between two genes (reviewed in (Kaelin, 2005)). Cells remain viable when the function of one of these genes is compromised, but cell death occurs when both genes are inhibited or lost simultaneously. If synthetic lethality exists between a tumor suppressor gene and a second gene, this latter gene becomes a potential therapeutic target. Synthetic lethality can provide a wide

Chapter 7

176

7

therapeutic window, since only mutant tumor cells are damaged by a certain treatment, while normal cells remain essentially unharmed. The major goal of applying synthetic lethality in personalized cancer treatment is to increase therapeutic efficacy, while reducing toxic side effects to a minimum. Thus far, the only clinical application of synthetic lethality has been the use of poly (ADP-ribose) polymerase (PARP) inhibitors in patients with BRCA1/2-mutated cancers (Table I). PARP enzymes are involved in base excision repair (BER), which is responsible for repair of single-strand DNA breaks (SSBs). PARP inhibition prevents repair of DNA SSBs, which can potentially be converted into more lethal DNA DSBs upon cellular replication. In this way PARP inhibitors force cells to correct these breaks by HR, which is dependent on functional BRCA1 and BRCA2. Consequently, PARP inhibition is relatively harmless for healthy cells but detrimental for HR-deficient cells, like BRCA1/2-mutant tumor cells, thereby providing a wide therapeutic window. Preclinical work demonstrated the profound sensitivity of BRCA-mutant cells to PARP inhibitors (Bryant et al., 2005; Farmer et al., 2005; Evers et al., 2008; Rottenberg et al., 2008). These initial observations spurred the development of several clinical PARP inhibitors, including olaparib (Fong et al., 2009), veliparib (Donawho et al., 2007; Penning et al., 2009) and rucaparib (Plummer et al., 2008). The use of PARP inhibitors in early clinical trials of breast cancer patients with BRCA1/2 mutations has produced encouraging results. The PARP inhibitor olaparib, for example, was well tolerated (Fong et al., 2009) and resulted in tumor regression in over 40% of patients with BRCA-mutated, and often triple-negative, breast cancer ((Tutt et al., 2010), Table I). Similar effects were observed in a phase II trial with olaparib as a single agent in BRCA mutation carriers with metastatic ovarian cancer (Audeh et al., 2010). While synergistic effects were observed for combinations of olaparib with cisplatin or carboplatin in BRCA-deficient tumor cell lines (Evers et al., 2008) and mouse mammary tumors (Rottenberg et al., 2008), it remains to be investigated whether such combinations will also have beneficial effects in patients with BRCA-associated breast cancer (Table I).

1.9 Therapy resistance in BRCA1-associated breast cancerResistance to chemotherapy is a major problem in the treatment of cancer patients. While primary tumors can usually be treated effectively, most patients eventually die from drug-resistant distant metastases. As mentioned before, BRCA1/2-deficient cells are defective in DSB repair by HR and are therefore highly sensitive to DNA crosslinking agents or PARP inhibitors (Bhattacharyya et al., 2000; Bryant et al., 2005; Farmer et al., 2005). While platinum agents and PARP inhibitors have been shown to be effective in the treatment of BRCA1/2-mutated cancer in the clinic, the presence of a BRCA1/2 mutation is not always a warranty for success: Not all patients with BRCA1/2-mutated tumors respond to these agents and even patients that initially respond to therapy can eventually become resistant. These resistance mechanisms can be specific for one drug or result in cross-resistance to multiple agents. Resistance to platinum agents can for instance be caused by reduced drug uptake via altered expression of copper transporters or inactivation by increased glutathione expression (Rabik and Dolan, 2007). Furthermore, resistance to the PARP inhibitor olaparib in a mouse model for BRCA1-associated breast cancer was primarily driven by upregulation of P-glycoprotein efflux pumps (Rottenberg et al., 2008). However, a phase I clinical trial of BRCA1/2-mutated ovarian cancer patients showed a positive correlation between benefit from olaparib treatment and platinum sensitivity

General discussion

177

7

(Fong et al., 2010), suggestive of shared resistance mechanisms between PARP inhibitors and platinum agents. Especially restoration of DNA repair appears to play an important role in acquired resistance to multiple DNA-damaging agents. One of the most intriguing mechanisms of resistance to both cisplatin and PARP inhibitors in BRCA1/2-deficient tumors is restoration of BRCA1/2 function due to secondary BRCA1/2 mutations (Edwards et al., 2008; Sakai et al., 2008, 2009; Swisher et al., 2008; Norquist et al., 2011). Multiple factors can contribute to the appearance of secondary BRCA1/2 mutations; an increased mutation rate due to deficiency in HR, an increased mutation rate caused by treatment with DNA-damaging agents and a strong selective pressure for cells with functional BRCA1/2 due to DNA-damaging therapy. Secondary mutations may be acquired during the course of treatment or they may be pre-existing in a small number of tumor cells before chemotherapy. The latter has been shown before in lung cancer, where EGFR mutations that confer resistance to EGFR inhibitors could already be detected in rare circulating tumor cells prior to drug exposure (Maheswaran et al., 2008). In addition, data from a single patient showed that secondary BRCA1 mutations can be present in rare cells of the primary ovarian carcinoma (Norquist et al., 2011). However,

Table I. Current clinical trials with PARP inhibitors in BRCA-associated breast cancer

PARP inhibitor

Company Types of cancer CombinationPhase

clinical trial

Status

Olaparib (KU-

0059436, AZD2281)

Astrazeneca

Breast no IICompleted (Tutt et al.,

2010)

Breast, ovarian no IIActive, not recruiting

Breast, ovarian, prostate,

pancreaticno II

Active, not recruiting

Breast, ovarian carboplatin I Recruiting

Breast, ovarian carboplatin I Recruiting

Breast, ovarian, cervical,

endometrial, peritoneal,

fallopian tube

carboplatin I Recruiting

Veliparib (ABT-888)

Abbott

Solid temozolomide I Completed

Breast temozolomide IIActive, not recruiting

Breast, ovarian, peritoneal,

fallopian tube

cyclo phosphamide

II Recruiting

Rucaparib (CO-338,

AG-014699, PF-0136738)

Clovis Oncology

Solid no I/II Recruiting

Breast, ovarian no II Recruiting

Breast cisplatin II Recruiting

Source: ClinicalTrials.gov (search criteria: PARP inhibitors, Breast cancer, BRCA)

Chapter 7

178

7

since this patient received prior chemotherapy for breast cancer, it remains unknown whether secondary BRCA1/2 mutations can exist in primary ovarian carcinomas without previous exposure to chemotherapy. Thus far, Brca1/2 secondary mutations have not been observed as a mechanism of therapy resistance in mouse models for BRCA1/2-associated breast cancer, probably because most of these mouse models contain large intragenic Brca1/2 deletions that do not permit restoration of protein function by secondary mutations. However, we also found no evidence for genetic reversion as a mechanism of therapy resistance in mouse mammary tumors carrying defined patient-derived Brca1 mutations (Drost et al., 2011). Moreover, mutations or epigenetic alterations of genes other than BRCA1/2 can modulate the therapy response of BRCA1/2-mutant cells. For example, loss of 53BP1 restores HR in BRCA1-deficient cells (Bouwman et al., 2010; Bunting et al., 2010) and can cause resistance to the PARP inhibitor olaparib in BRCA1-deficient mouse mammary tumors (Jaspers et al., manuscript in preparation). In order to circumvent therapy resistance mechanisms described above and achieve full tumor eradication, mouse mammary tumors carrying a large intragenic Brca1 deletion were treated with the non-PgP substrate cisplatin (Rottenberg et al., 2007; Pajic et al., 2010). However, even despite dose-dense therapy, tumors kept growing back from small tumor remnants and could never be completely eradicated. This lack of tumor eradication suggested the potential existence of cisplatin-resistant tumor initiating cells. Expansion of cancer stem-like cells was identified as a potential cause of cisplatin resistance in a different mouse model for BRCA1-associated breast cancer, which contains a Brca1 allele lacking exon 11 (Shafee et al., 2008). However in the mouse model carrying a large intragenic Brca1 deletion, tumor initiating cells were not enriched in the tumor remnants after cisplatin treatment (Pajic et al., 2010). An alternative explanation for the lack of tumor eradication could be that tumor remnants contain cells that have undergone cell cycle arrest in order to make them less vulnerable to cisplatin. A high-throughput pharmacological screen showed that the bifunctional alkylators chlorambucil, melphalan and nimustine display specific toxicity against BRCA2-deficient mouse mammary tumor cells (Evers et al., 2010). The in vivo response of BRCA2-deficient tumors to melphalan and nimustine was even better than the response to cisplatin and the PARP inhibitor olaparib. Especially the combination of nimustine with olaparib resulted in very long recurrence-free survival times, suggestive of full tumor eradication. It remains to be investigated whether also BRCA1-deficient tumors can be completely eradicated by using bifunctional alkylators alone or in combination with PARP inhibition.

1.10 Effects of different BRCA1 mutations on therapy responseIn vivo analysis of defined BRCA1 founder mutations in a genetically engineered mouse model of BRCA1-associated breast cancer has shown that loss of specific BRCA1 functions may determine how tumors respond to DNA-damaging therapy. Mice carrying mammary tumors that express BRCA1-C61G mutant protein respond much poorer to treatment with cisplatin and olaparib than mice with Brca1 null mammary tumors (Drost et al., 2011). Furthermore, Brca1C61G tumors very rapidly develop resistance to these DNA-damaging agents without undergoing genetic reversion of the C61G mutation. Identical observations were made for mice carrying the Brca1185stop mutation, which closely resembles one of the most common human BRCA1 founder mutations, namely 185delAG

General discussion

179

7

(Figure 1). While the BRCA1C61G missense mutation leads to formation of stable protein lacking a functional BRCA1 RING domain (Brzovic et al., 1998; Hashizume et al., 2001; Ruffner et al., 2001), the BRCA1185delAG nonsense mutation causes a translational frameshift and premature stop codon, resulting in a highly instable protein of only 39 aa (Figure 1B). Surprisingly, expression of a nearly full-length BRCA1 protein was detected in Brca1185stop mouse mammary tumors and in the SUM1515MO2 human breast cancer cell line carrying the BRCA1185delAG mutation. Presumably, internal translation reinitiation in BRCA1185delAG mutant cells leads to production of a RING-less BRCA1 protein with similar properties as BRCA1-C61G (Figure 1B). These findings imply that a certain basal activity of the mutant BRCA1-ΔRING protein is already sufficient to reduce initial drug sensitivity and promote rapid induction of drug resistance. Presumably, the mutant BRCA1-ΔRING protein is to a certain extent involved in the DNA damage response, since BRCA1-ΔRING tumors have an increased level of RAD51 irradiation-induced foci (IRIFs) and less pH2AX-positive cells compared to Brca1 null tumors. While the BRCA1 RING domain appears to be dispensable for therapy resistance, another function of BRCA1 needs to be essential for a durable chemotherapy response. The fact that the C-terminal BRCT domains of BRCA1 are targeted by many pathogenic mutations (Glover, 2006), underscores how important these domains are for the tumor suppressive properties of BRCA1. Through its BRCT domains, BRCA1 forms at least three mutually exclusive complexes by directly interacting with Abraxas, Bach1 and CtIP (reviewed in (Wang, 2012). These so-called A, B and C complexes of BRCA1 are involved in checkpoint regulation and DNA DSB repair, and thereby probably contribute to maintenance of genomic stability and tumor suppression. It will be interesting to evaluate whether alterations in these complexes are involved in therapy resistance of tumors expressing different BRCA1 mutant proteins. The finding that mouse mammary tumors carrying the C-terminal Brca15382stop mutation respond much better to DNA-damaging therapy than tumors with the N-terminal Brca1185stop mutation supports a role of the BRCA1 C-terminus in DSB repair. In addition, identical to Brca1 null tumors, Brca15382stop mouse mammary tumors hardly ever develop platinum resistance. However, in contrast to Brca1185stop tumors, only low levels of BRCA1 mutant protein could be observed in Brca15382stop tumors. This makes it impossible to determine whether the exquisite therapy sensitivity of Brca15382stop tumors is caused by loss of a specific function of the BRCA1 C-terminus or whether it is simply due to absence of the (mutant) BRCA1 protein. It has been shown that a missense mutation that specifically ablates phosphoprotein binding by the C-terminal BRCT domains of BRCA1 causes tumor formation in several independent genetically engineered mouse models (Shakya et al., 2011). However, it is currently unknown whether this Brca1 missense mutation preserves stable (mutant) BRCA1 protein expression. If that is the case, this mouse model would be useful to decipher whether loss of phosphoprotein recognition by the BRCA1 BRCT repeats is essential for a durable response to DNA-damaging compounds.

2 Future perspectives2.1 Improved preclinical mouse models for BRCA1-related breast cancerIn the past, knowledge on drug response and resistance of breast tumors has mainly been gained from studying human breast cancer cell lines under cell culture conditions. However, these in vitro findings often did not translate correctly to the therapy responses that were observed in the clinic. In an attempt to bridge this gap, human breast cancer

Chapter 7

180

7

cell lines have been transplanted subcutaneously into immunocompromised nude mice to produce tumor cell line outgrowths. However, also these cell line-derived xenograft models are in most cases poor predictors of how drugs will behave in the clinic. In general, xenografts in mice tend to show a better drug response than human tumors. It is conceivable that xenograft models do not properly predict drug response and resistance, since most of the tumor cell lines used for xenografts are already heavily adapted to in vitro cell culture. Moreover, nude mice still have an intact innate immune system and might therefore develop an immune response against the xenograft following treatment. To avoid strong genetic drift due to in vitro selection, breast tumors were taken from human patients and directly transplanted into more immunodeficient NOD-Rag1-

/-;Il2rg-/- mice. These patient-derived xenograft (PDX) mouse models have the additional advantage that they are able to recapitulate the enormous heterogeneity in human breast cancer. Currently established PDX models for human breast cancer share morphological and genomic characteristics with the original tumor (Marangoni et al., 2007; DeRose et al., 2011) and also show comparable drug responses (Ter Brugge et al., manuscript in preparation). A large panel of individual PDX models could be used to test the efficacy of new (combinations of ) anticancer drugs or to discover biomarkers that can predict drug responses (Bertotti et al., 2011). However, these PDX mouse models for human breast cancer are very tedious to create, since human tumors need to be implanted freshly and transplantation ‘take rate’ is still low. A strong selection bias towards outgrowth of the most aggressive tumors is observed, while other breast cancer subtypes remain underrepresented (Marangoni et al., 2007). Both human cancer patients and PDX mouse models cannot be used easily to study causal relationships between genes, cancer and drug response in a controlled in vivo setting. Therefore, genetically engineered mouse models (GEMMs) which develop tumors that closely resemble human cancer remain instrumental. In these GEMMs, genetic modification allows expression or inhibition of specific genes in a time- and site-controlled manner (Politi and Pao, 2011). Moreover, evaluation of novel therapies and optimization of treatment schedules can be more easily performed in these mouse models than in human patients. While clinical trials in human patients are complicated by large heterogeneity, GEMMs offer a platform where therapy response and resistance can be studied in a relatively controlled environment. For example, GEMMs for BRCA1-associated breast cancer have shown to be valuable for the in vivo analysis of the effects of specific BRCA1 founder mutations on tumor development (Shakya et al., 2011) and treatment outcome (Drost et al., 2011) (Chapter 6). However, since GEMMs develop mouse tumors, they do not exclude potential species differences in therapy response. Another drawback of GEMMs is that development and validation of a new model is labor-intensive and time-consuming, especially when a novel mutation is introduced into an existing multi-allelic GEMM via conventional breeding. An alternative approach is to derive embryonic stem cells from GEMMs (GEMM-ESCs), perform ex vivo manipulations and subsequently produce chimeric mice from these modified GEMM-ESCs (Huijbers et al., 2011; van Miltenburg and Jonkers, 2012). In this way, the generation of GEMM-ESC chimeric mice is considerably faster than the traditional manner of producing GEMMs and allows screening and validation of candidate cancer genes in a high-throughput fashion.

2.2 Improved clinical trials for BRCA1-related breast cancerThe treatment regime of breast cancer often consists of surgery followed by systemic

General discussion

181

7

(chemo)therapy. The current choice of systemic therapy for breast cancer is based on the results obtained from large randomized clinical trials. Unfortunately, many breast cancer patients will not benefit from this kind of therapy, because these large trials ignore the molecular heterogeneity in breast cancer. To move towards personalized medicine, clinical trials should be designed in such a way that this heterogeneity is taken into account. Clinical trials that involve a defined group of patients require a much smaller cohort and a shorter follow-up. These more defined, small-scale clinical trials most likely need to be performed multi-centered, in order to include enough patients that fit to the strict selection criteria. Paired clinical tumor samples allow for the comparison of biological features of the tumor before and after therapy. Unfortunately, especially post-treatment samples of drug-resistant tumors are very difficult to obtain, since biopsies are rarely collected from patients with progressive disease. However, systematic collection of tumor samples before and after treatment that can be used for different molecular and genomic analyses is essential to study intrinsic and acquired drug resistance. Many retrospective studies are restricted because only paraffin-embedded material is available. Although paraffin material is suitable for most immunohistochemical stainings and DNA techniques, it is of limited use for procedures involving mRNA or protein. Therefore, newly designed prospective clinical trials should carefully describe procedures for tumor sampling in order to enable investigating drug resistance. One possibility would be to develop a rapid (‘warm’) autopsy or tissue procurement program that would allow patients to agree with immediate autopsy shortly after death. Direct autopsies of men with metastatic prostate cancer have already shown to provide high quality tumor material suitable for protein, DNA and RNA analysis (Rubin et al., 2000). Most clinical laboratories are currently still using a single gene approach for molecular diagnostics. However, there is a growing need to use broader approaches in order to identify more rare (somatic) mutations that could be important for clinical decision making. While a growing number of laboratories already make use of tests including larger panels of cancer genes based on mass spectroscopy (Sequenom) analysis or next-generation sequencing, the question rises whether one should not sequence the complete genome of a tumor (reviewed in (Corless, 2011)). A small pilot study in patients with advanced cancer showed that sequencing the whole tumor genome, exome and transcriptome can be accomplished in a timely and cost-effective manner (Roychowdhury et al., 2011). These combined datasets could provide valuable information on both germline and somatic mutations, potential druggable tumor markers and drug toxicity. The rapid progress in personalized medicines creates exiting opportunities for development of new anticancer agents, but also requires close collaboration between scientists, clinicians and pharmaceutical companies (reviewed in (Dancey et al., 2012)).

2.3 Improved therapeutic strategies for BRCA1-related breast cancerAs mentioned before, promising results were obtained by using PARP inhibitors in breast cancer patients with BRCA1/2 mutations (Fong et al., 2009; Tutt et al., 2010). However, it remains to be investigated whether combining chemo- and radiotherapy with PARP inhibition will have even more beneficial effects in BRCA-mutated breast cancer patients. PARP inhibitors have the potential to increase the therapeutic index of radiotherapy by increasing the damage in highly replicating tumor cells, while sparing noncycling normal tissues, which are often responsible for the dose-limiting damage after radiotherapy.

Chapter 7

182

7

While ionizing radiation (IR) used in the clinical treatment of cancer mainly generates DNA SSBs, PARP inhibition prevents the repair of DNA SSBs, which increases the level of toxic DNA DSBs in replicating cells. Preclinical studies in xenograft models for lung, colorectal and breast cancer have supported the potential role of PARP inhibitors as radiosensitizers (reviewed in (Chalmers, 2009)). In addition, potent sensitization to the monofunctional DNA-alkylating agent temozolomide by PARP inhibitors has been observed in xenografts of human glioma, glioblastoma, melanoma and colorectal tumor cell lines (reviewed in (Chalmers, 2009)). Normally most methylation products of temozolomide (N7-methylguanine and N3-methyladenine) do not contribute to the cytotoxic effects because they are rapidly repaired by BER. Inactivation of BER by PARP inhibition probably renders these lesions cytotoxic. However, drug intervention studies in BRCA1-deficient mouse mammary tumor models showed that combination of PARP inhibition with chemotherapeutic agents like cisplatin and topotecan can also lead to increased toxicity (Rottenberg et al., 2008; Zander et al., 2010). Drugs that inhibit HR may be used as (re-)sensitizers of tumors carrying specific BRCA1 mutations that are intrinsically resistant to therapy or of tumors that acquired therapy resistance through secondary BRCA1 mutations. Formation of RAD51 IRIFs, which is a marker for functional HR, can be inhibited by CDK inhibitors (Deans et al., 2006), proteasome inhibitors (Jacquemont and Taniguchi, 2007), HSP90 inhibitors (Dungey et al., 2009) and mild hyperthermia (Krawczyk et al., 2011). It would be interesting to test the efficacy of these treatments in combination with DNA-damaging drugs like cisplatin or PARP inhibitors in BRCA1-mutated tumors with intrinsic or acquired drug resistance through restoration of HR. Depleting BRCA1 nuclear localization might be another potential therapeutic strategy to sensitize tumor cells to DNA-damaging agents. Ectopic expression of the N-terminal RING domain fragment peptide tr-BRCA1 has been demonstrated to effectively shift BRCA1 from the nucleus to the cytoplasm (reviewed in (Yang and Xia, 2010)). This translocation of BRCA1 mediated by tr-BRCA1 has been shown to reduce HR and thereby sensitizes breast cancer cells to the EGFR inihibitor erlotinib (Li et al., 2008). Therefore, tr-BRCA1 might be a potential tool to deplete nuclear BRCA1 and enhance the therapeutic response. However, when applying all of these different strategies to inhibit HR, it will be of critical importance to specifically target the tumor in order to avoid normal tissue toxicity. In addition, several links have been found between BRCA1 and phopsho-inositol-3 kinase (PI3K) signalling pathways. A constitutively active form of PI3K was able to induce BRCA1 phosphorylation, which in term could be blocked by PI3K inhibition or expression of dominant negative AKT (Altiok et al., 1999). BRCA1 phosphorylation during cell cycle progression and in response to DNA-damaging agents can affect its function (reviewed in (Ouchi, 2006)). AKT was also shown to directly phosphorylate BRCA1 at a position located in its NLS. Thereby, AKT-mediated phosphorylation may influence BRCA1 nuclear localization and consequently its function. Furthermore, BRCA1 was also shown to negatively regulate AKT and loss of BRCA1 lead to increased AKT activity (Xiang et al., 2008, 2011). Moreover, gross mutations in the PTEN tumor suppressor gene, which functions as a negative regulator of the PI3K/AKT pathway, were specifically identified in BRCA1-deficient breast tumors (Saal et al., 2008). Together these findings suggest that BRCA1-deficient tumors may be critically dependent on altered PI3K/AKT signalling. Therefore, combinational treatment of DNA-damaging agents, like cisplatin and PARP inhibitors, with PI3K inhibitors might potentiate the efficacy of a single treatment

General discussion

183

7

modality in BRCA1-deficient tumors. The first proof-of-concept study showed that in vitro combination of a PARP inhibitor with a PI3K inhibitor impaired growth specifically in BRCA1-mutated human breast cancer cell lines, although to a varying extent (Kimbung et al., 2012). Before combinational treatment of PI3K inhibitors with PARP inhibitors can be evaluated in clinical trials involving patients with BRCA1-mutated breast cancer, it will be important to confirm these findings in sophisticated GEMMs and PDX mouse models.

References

Altiok, S., Batt, D., Altiok, N., Papautsky, A., Downward, J., Roberts, T.M., and Avraham, H. (1999). Heregulin induces phosphorylation of BRCA1 through phosphatidylinositol 3-Kinase/AKT in breast cancer cells. J. Biol. Chem. 274, 32274–32278.

Au, W.W.Y., and Henderson, B.R. (2005). The BRCA1 RING and BRCT domains cooperate in targeting BRCA1 to ionizing radiation-induced nuclear foci. J. Biol. Chem. 280, 6993–7001.

Audeh, M.W., Carmichael, J., Penson, R.T., Friedlander, M., Powell, B., Bell-McGuinn, K.M., Scott, C., Weitzel, J.N., Oaknin, A., Loman, N., et al. (2010). Oral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and recurrent ovarian cancer: a proof-of-concept trial. Lancet 376, 245–251.

Baldassarre, G., Battista, S., Belletti, B., Thakur, S., Pentimalli, F., Trapasso, F., Fedele, M., Pierantoni, G., Croce, C.M., and Fusco, A. (2003). Negative regulation of BRCA1 gene expression by HMGA1 proteins accounts for the reduced BRCA1 protein levels in sporadic breast carcinoma. Mol. Cell. Biol. 23, 2225–2238.

Baldwin, R.L., Nemeth, E., Tran, H., Shvartsman, H., Cass, I., Narod, S., and Karlan, B.Y. (2000). BRCA1 promoter region hypermethylation in ovarian carcinoma: a population-based study. Cancer Res. 60, 5329–5333.


Bertotti, A., Migliardi, G., Galimi, F., Sassi, F., Torti, D., Isella, C., Corà, D., Di Nicolantonio, F., Buscarino, M., Petti, C., et al. (2011). A Molecularly Annotated Platform of Patient-Derived Xenografts (’xenopatients’) Identifies HER2 as an Effective Therapeutic Target in Cetuximab-Resistant Colorectal Cancer. Cancer Discovery.

Bhattacharyya, A., Ear, U.S., Koller, B.H., Weichselbaum, R.R., and Bishop, D.K. (2000). The breast cancer susceptibility gene BRCA1 is required for subnuclear assembly of Rad51 and survival following treatment with the DNA cross-linking agent cisplatin. J. Biol. Chem. 275, 23899–23903.

Bouwman, P., Aly, A., Escandell, J.M., Pieterse, M., Bartkova, J., van der Gulden, H., Hiddingh, S., Thanasoula, M., Kulkarni, A., Yang, Q., et al. (2010). 53BP1 loss rescues BRCA1 deficiency and is associated with triple-negative and BRCA-mutated breast cancers. Nat. Struct. Mol. Biol. 17, 688–695.

Boyd, J., Sonoda, Y., Federici, M.G., Bogomolniy, F., Rhei, E., Maresco, D.L., Saigo, P.E., Almadrones, L.A., Barakat, R.R., Brown, C.L., et al. (2000). Clinicopathologic features of BRCA-linked and sporadic ovarian cancer. Jama 283, 2260–2265.


Brzovic, P.S., Keeffe, J.R., Nishikawa, H., Miyamoto, K., Fox, D., Fukuda, M., Ohta, T., and Klevit, R. (2003). Binding and recognition in the assembly of an active BRCA1/BARD1 ubiquitin-ligase complex. Proc Natl Acad Sci U S A 100, 5646–5651.

Chapter 7

184

7

Brzovic, P.S., Lissounov, A., Christensen, D.E., Hoyt, D.W., and Klevit, R.E. (2006). A UbcH5/ubiquitin noncovalent complex is required for processive BRCA1-directed ubiquitination. Mol. Cell 21, 873–880.

Brzovic, P.S., Meza, J., King, M.C., and Klevit, R.E. (1998). The cancer-predisposing mutation C61G disrupts homodimer formation in the NH2-terminal BRCA1 RING finger domain. J. Biol. Chem. 273, 7795–7799.

Buisson, M., Anczuków, O., Zetoune, A.B., Ware, M.D., and Mazoyer, S. (2006). The 185delAG mutation (c.68_69delAG) in the BRCA1 gene triggers translation reinitiation at a downstream AUG codon. Hum. Mutat. 27, 1024–1029.

Bunting, S.F., Callén, E., Wong, N., Chen, H.-T., Polato, F., Gunn, A., Bothmer, A., Feldhahn, N., Fernandez-Capetillo, O., Cao, L., et al. (2010). 53BP1 inhibits homologous recombination in Brca1-deficient cells by blocking resection of DNA breaks. Cell 141, 243–254.

Byrski, T., Gronwald, J., Huzarski, T., Grzybowska, E., Budryk, M., Stawicka, M., Mierzwa, T., Szwiec, M., Wisniowski, R., Siolek, M., et al. (2010). Pathologic complete response rates in young women with BRCA1-positive breast cancers after neoadjuvant chemotherapy. J. Clin. Oncol. 28, 375–379.

Byrski, T., Huzarski, T., Dent, R., Gronwald, J., Zuziak, D., Cybulski, C., Kladny, J., Gorski, B., Lubinski, J., and Narod, S.A. (2009). Response to neoadjuvant therapy with cisplatin in BRCA1-positive breast cancer patients. Breast Cancer Res. Treat. 115, 359–363.

Cantor, S.B., Bell, D.W., Ganesan, S., Kass, E.M., Drapkin, R., Grossman, S., Wahrer, D.C., Sgroi, D.C., Lane, W.S., Haber, D.A., et al. (2001). BACH1, a novel helicase-like protein, interacts directly with BRCA1 and contributes to its DNA repair function. Cell 105, 149–160.

Cass, I., Baldwin, R.L., Varkey, T., Moslehi, R., Narod, S.A., and Karlan, B.Y. (2003). Improved survival in women with BRCA-associated ovarian carcinoma. Cancer 97, 2187–2195.

Castilla, L.H., Couch, F.J., Erdos, M.R., Hoskins, K.F., Calzone, K., Garber, J.E., Boyd, J., Lubin, M.B., Deshano, M.L., Brody, L.C., et al. (1994). Mutations in the BRCA1 gene in families with early-onset breast and ovarian cancer. Nat Genet 8, 387–391.

Catteau, A., and Morris, J.R. (2002). BRCA1 methylation: a significant role in tumour development? Semin. Cancer Biol. 12, 359–371.

Chalmers, A.J. (2009). The potential role and application of PARP inhibitors in cancer treatment. Br. Med. Bull. 89, 23–40.

Chen, C.F., Li, S., Chen, Y., Chen, P.L., Sharp, Z.D., and Lee, W.H. (1996). The nuclear localization sequences of the BRCA1 protein interact with the importin-alpha subunit of the nuclear transport signal receptor. J. Biol. Chem. 271, 32863–32868.

Chen, J., Silver, D.P., Walpita, D., Cantor, S.B., Gazdar, A.F., Tomlinson, G., Couch, F.J., Weber, B.L., Ashley, T., Livingston, D.M., et al. (1998). Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Mol. Cell 2, 317–328.

Chen, L., Nievera, C.J., Lee, A.Y.-L., and Wu, X. (2008). Cell cycle-dependent complex formation of BRCA1.CtIP.MRN is important for DNA double-strand break repair. J. Biol. Chem. 283, 7713–7720.

Chetrit, A., Hirsh-Yechezkel, G., Ben-David, Y., Lubin, F., Friedman, E., and Sadetzki, S. (2008). Effect of BRCA1/2 mutations on long-term survival of patients with invasive ovarian cancer: the national Israeli study of ovarian cancer. J. Clin. Oncol. 26, 20–25.

Christensen, D.E., Brzovic, P.S., and Klevit, R.E. (2007). E2-BRCA1 RING interactions dictate synthesis of mono- or

General discussion

185

7

specific polyubiquitin chain linkages. Nat Struct Mol Biol 14, 941–948.

Clark, A.S., and Domchek, S.M. (2011). Clinical management of hereditary breast cancer syndromes. J Mammary Gland Biol Neoplasia 16, 17–25.

Corless, C.L. (2011). Medicine. Personalized cancer diagnostics. Science 334, 1217–1218.

Cortez, D., Wang, Y., Qin, J., and Elledge, S.J. (1999). Requirement of ATM-dependent phosphorylation of brca1 in the DNA damage response to double-strand breaks. Science 286, 1162–1166.

Crook, T., Crossland, S., Crompton, M.R., Osin, P., and Gusterson, B.A. (1997). p53 mutations in BRCA1-associated familial breast cancer. Lancet 350, 638–639.

Dancey, J.E., Bedard, P.L., Onetto, N., and Hudson, T.J. (2012). The genetic basis for cancer treatment decisions. Cell 148, 409–420.

Deans, A.J., Khanna, K.K., McNees, C.J., Mercurio, C., Heierhorst, J., and McArthur, G.A. (2006). Cyclin-dependent kinase 2 functions in normal DNA repair and is a therapeutic target in BRCA1-deficient cancers. Cancer Res. 66, 8219–8226.

Deans, A.J., and West, S.C. (2011). DNA interstrand crosslink repair and cancer. Nat. Rev. Cancer 11, 467–480.

DeRose, Y.S., Wang, G., Lin, Y.-C., Bernard, P.S., Buys, S.S., Ebbert, M.T.W., Factor, R., Matsen, C., Milash, B.A., Nelson, E., et al. (2011). Tumor grafts derived from women with breast cancer authentically reflect tumor pathology, growth, metastasis and disease outcomes. Nat. Med. 17, 1514–1520.

Dizin, E., Ray, H., Suau, F., Voeltzel, T., and Dalla Venezia, N. (2008). Caspase-dependent BRCA1 cleavage facilitates chemotherapy-induced apoptosis. Apoptosis 13, 237–246.

Dobrovic, A., and Simpfendorfer, D. (1997). Methylation of the BRCA1 gene in sporadic breast cancer. Cancer Res. 57, 3347–3350.

Donawho, C.K., Luo, Y., Luo, Y., Penning, T.D., Bauch, J.L., Bouska, J.J., Bontcheva-Diaz, V.D., Cox, B.F., DeWeese, T.L., Dillehay, L.E., et al. (2007). ABT-888, an orally active poly(ADP-ribose) polymerase inhibitor that potentiates DNA-damaging agents in preclinical tumor models. Clin. Cancer Res. 13, 2728–2737.

Drost, R., Bouwman, P., Rottenberg, S., Boon, U., Schut, E., Klarenbeek, S., Klijn, C., van der Heijden, I., van der Gulden, H., Wientjens, E., et al. (2011). BRCA1 RING Function Is Essential for Tumor Suppression but Dispensable for Therapy Resistance. Cancer Cell 20, 797–809.

Dungey, F.A., Caldecott, K.W., and Chalmers, A.J. (2009). Enhanced radiosensitization of human glioma cells by combining inhibition of poly(ADP-ribose) polymerase with inhibition of heat shock protein 90. Mol. Cancer Ther. 8, 2243–2254.

Edwards, S.L., Brough, R., Lord, C.J., Natrajan, R., Vatcheva, R., Levine, D.A., Boyd, J., Reis-Filho, J.S., and Ashworth, A. (2008). Resistance to therapy caused by intragenic deletion in BRCA2. Nature 451, 1111–1115.

Esteller, M., Silva, J.M., Dominguez, G., Bonilla, F., Matias-Guiu, X., Lerma, E., Bussaglia, E., Prat, J., Harkes, I.C., Repasky, E.A., et al. (2000). Promoter hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumors. J. Natl. Cancer Inst. 92, 564–569.

Evers, B., Drost, R., Schut, E., de Bruin, M., van der Burg, E., Derksen, P.W.B., Holstege, H., Liu, X., van Drunen, E., Beverloo, H.B., et al. (2008). Selective inhibition of BRCA2-deficient mammary tumor cell growth by AZD2281 and cisplatin. Clin. Cancer Res. 14, 3916–3925.

Evers, B., Schut, E., van der Burg, E., Braumuller, T.M., Egan, D.A., Holstege, H., Edser, P., Adams, D.J., Wade-Martins,

Chapter 7

186

7

R., Bouwman, P., et al. (2010). A high-throughput pharmaceutical screen identifies compounds with specific toxicity against BRCA2-deficient tumors. Clin. Cancer Res. 16, 99–108.

Fabbro, M., Rodriguez, J.A., Baer, R., and Henderson, B.R. (2002). BARD1 induces BRCA1 intranuclear foci formation by increasing RING-dependent BRCA1 nuclear import and inhibiting BRCA1 nuclear export. J. Biol. Chem. 277, 21315–21324.

Fabbro, M., Schuechner, S., Au, W.W.Y., and Henderson, B.R. (2004). BARD1 regulates BRCA1 apoptotic function by a mechanism involving nuclear retention. Exp. Cell Res. 298, 661–673.



Fong, P.C., Yap, T.A., Boss, D.S., Carden, C.P., Mergui-Roelvink, M., Gourley, C., De Greve, J., Lubinski, J., Shanley, S., Messiou, C., et al. (2010). Poly(ADP)-ribose polymerase inhibition: frequent durable responses in BRCA carrier ovarian cancer correlating with platinum-free interval. J. Clin. Oncol. 28, 2512–2519.

Ford, D., Easton, D.F., Stratton, M., Narod, S., Goldgar, D., Devilee, P., Bishop, D.T., Weber, B., Lenoir, G., Chang-Claude, J., et al. (1998). Genetic heterogeneity and penetrance analysis of the BRCA1 and BRCA2 genes in breast cancer families. The Breast Cancer Linkage Consortium. Am. J. Hum. Genet. 62, 676–689.

Friedman, L.S., Ostermeyer, E.A., Szabo, C.I., Dowd, P., Lynch, E.D., Rowell, S.E., and King, M.C. (1994). Confirmation of BRCA1 by analysis of germline mutations linked to breast and ovarian cancer in ten families. Nat Genet 8, 399–404.

Galizia, E., Giorgetti, G., Piccinini, G., Santinelli, A., Loretelli, C., Bianchi, F., Gagliardini, D., Carbonari, G., Pisa, E., Belvederesi, L., et al. (2010). BRCA1 expression in triple negative sporadic breast cancers. Anal. Quant. Cytol. Histol. 32, 24–29.

Glover, J.N.M. (2006). Insights into the molecular basis of human hereditary breast cancer from studies of the BRCA1 BRCT domain. Fam. Cancer 5, 89–93.


Holloman, W.K. (2011). Unraveling the mechanism of BRCA2 in homologous recombination. Nat. Struct. Mol. Biol. 18, 748–754.

Holstege, H., Joosse, S.A., van Oostrom, C.T.M., Nederlof, P.M., de Vries, A., and Jonkers, J. (2009). High incidence of protein-truncating TP53 mutations in BRCA1-related breast cancer. Cancer Res. 69, 3625–3633.

Huen, M.S.Y., Sy, S.M.H., and Chen, J. (2010). BRCA1 and its toolbox for the maintenance of genome integrity. Nat. Rev. Mol. Cell Biol. 11, 138–148.

Huijbers, I.J., Krimpenfort, P., Berns, A., and Jonkers, J. (2011). Rapid validation of cancer genes in chimeras derived from established genetically engineered mouse models. Bioessays 33, 701–710.

Jacquemont, C., and Taniguchi, T. (2007). Proteasome function is required for DNA damage response and fanconi anemia pathway activation. Cancer Res. 67, 7395–7405.

General discussion

187

7

Jemal, A., Bray, F., Center, M.M., Ferlay, J., Ward, E., and Forman, D. (2011). Global cancer statistics. CA Cancer J Clin 61, 69–90.

Jensen, R.B., Carreira, A., and Kowalczykowski, S.C. (2010). Purified human BRCA2 stimulates RAD51-mediated recombination. Nature 467, 678–683.

Kaelin, W.G., Jr (2005). The concept of synthetic lethality in the context of anticancer therapy. Nat. Rev. Cancer 5, 689–698.

Kimbung, S., Biskup, E., Johansson, I., Aaltonen, K., Ottosson-Wadlund, A., Gruvberger-Saal, S., Cunliffe, H., Fadeel, B., Loman, N., Berglund, P., et al. (2012). Co-targeting of the PI3K pathway improves the response of BRCA1 deficient breast cancer cells to PARP1 inhibition. Cancer Letters.

Krawczyk, P.M., Eppink, B., Essers, J., Stap, J., Rodermond, H., Odijk, H., Zelensky, A., van Bree, C., Stalpers, L.J., Buist, M.R., et al. (2011). Mild hyperthermia inhibits homologous recombination, induces BRCA2 degradation, and sensitizes cancer cells to poly (ADP-ribose) polymerase-1 inhibition. Proc. Natl. Acad. Sci. U.S.A. 108, 9851–9856.

Li, L., Wang, H., Yang, E.S., Arteaga, C.L., and Xia, F. (2008). Erlotinib attenuates homologous recombinational repair of chromosomal breaks in human breast cancer cells. Cancer Res. 68, 9141–9146.

Liu, J., Doty, T., Gibson, B., and Heyer, W.-D. (2010). Human BRCA2 protein promotes RAD51 filament formation on RPA-covered single-stranded DNA. Nat. Struct. Mol. Biol. 17, 1260–1262.

Magdinier, F., Ribieras, S., Lenoir, G.M., Frappart, L., and Dante, R. (1998). Down-regulation of BRCA1 in human sporadic breast cancer; analysis of DNA methylation patterns of the putative promoter region. Oncogene 17, 3169–3176.

Maheswaran, S., Sequist, L.V., Nagrath, S., Ulkus, L., Brannigan, B., Collura, C.V., Inserra, E., Diederichs, S., Iafrate, A.J., Bell, D.W., et al. (2008). Detection of mutations in EGFR in circulating lung-cancer cells. N. Engl. J. Med. 359, 366–377.

Mallery, D.L., Vandenberg, C.J., and Hiom, K. (2002). Activation of the E3 ligase function of the BRCA1/BARD1 complex by polyubiquitin chains. Embo J 21, 6755–6762.

Manke, I.A., Lowery, D.M., Nguyen, A., and Yaffe, M.B. (2003). BRCT repeats as phosphopeptide-binding modules involved in protein targeting. Science 302, 636–639.

Marangoni, E., Vincent-Salomon, A., Auger, N., Degeorges, A., Assayag, F., de Cremoux, P., de Plater, L., Guyader, C., De Pinieux, G., Judde, J.-G., et al. (2007). A new model of patient tumor-derived breast cancer xenografts for preclinical assays. Clin. Cancer Res. 13, 3989–3998.

Metcalfe, K.A., Poll, A., Royer, R., Llacuachaqui, M., Tulman, A., Sun, P., and Narod, S.A. (2010). Screening for founder mutations in BRCA1 and BRCA2 in unselected Jewish women. J. Clin. Oncol. 28, 387–391.

Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P.A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L.M., and Ding, W. (1994). A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266, 66–71.

van Miltenburg, M.H., and Jonkers, J. (2012). Using genetically engineered mouse models to validate candidate cancer genes and test new therapeutic approaches. Curr. Opin. Genet. Dev. 22, 21–27.

Moynahan, M.E., and Jasin, M. (2010). Mitotic homologous recombination maintains genomic stability and suppresses tumorigenesis. Nat. Rev. Mol. Cell Biol. 11, 196–207.

Norquist, B., Wurz, K.A., Pennil, C.C., Garcia, R., Gross, J., Sakai, W., Karlan, B.Y., Taniguchi, T., and Swisher, E.M. (2011). Secondary somatic mutations restoring BRCA1/2 predict chemotherapy resistance in hereditary ovarian

Chapter 7

188

7

carcinomas. J. Clin. Oncol. 29, 3008–3015.

Ouchi, T. (2006). BRCA1 phosphorylation: biological consequences. Cancer Biol. Ther. 5, 470–475.

Pajic, M., Kersbergen, A., van Diepen, F., Pfauth, A., Jonkers, J., Borst, P., and Rottenberg, S. (2010). Tumor-initiating cells are not enriched in cisplatin-surviving BRCA1;p53-deficient mammary tumor cells in vivo. Cell Cycle 9, 3780–3791.

Penning, T.D., Zhu, G.-D., Gandhi, V.B., Gong, J., Liu, X., Shi, Y., Klinghofer, V., Johnson, E.F., Donawho, C.K., Frost, D.J., et al. (2009). Discovery of the Poly(ADP-ribose) polymerase (PARP) inhibitor 2-[(R)-2-methylpyrrolidin-2-yl]-1H-benzimidazole-4-carboxamide (ABT-888) for the treatment of cancer. J. Med. Chem. 52, 514–523.

Perrin-Vidoz, L., Sinilnikova, O.M., Stoppa-Lyonnet, D., Lenoir, G.M., and Mazoyer, S. (2002). The nonsense-mediated mRNA decay pathway triggers degradation of most BRCA1 mRNAs bearing premature termination codons. Hum. Mol. Genet. 11, 2805–2814.

Pharoah, P.D.P., Antoniou, A.C., Easton, D.F., and Ponder, B.A.J. (2008). Polygenes, risk prediction, and targeted prevention of breast cancer. N. Engl. J. Med. 358, 2796–2803.

Plummer, R., Jones, C., Middleton, M., Wilson, R., Evans, J., Olsen, A., Curtin, N., Boddy, A., McHugh, P., Newell, D., et al. (2008). Phase I study of the poly(ADP-ribose) polymerase inhibitor, AG014699, in combination with temozolomide in patients with advanced solid tumors. Clin. Cancer Res. 14, 7917–7923.

Politi, K., and Pao, W. (2011). How genetically engineered mouse tumor models provide insights into human cancers. J. Clin. Oncol. 29, 2273–2281.

Rabik, C.A., and Dolan, M.E. (2007). Molecular mechanisms of resistance and toxicity associated with platinating agents. Cancer Treat. Rev. 33, 9–23.

Rakha, E.A., Reis-Filho, J.S., and Ellis, I.O. (2008). Basal-like breast cancer: a critical review. J. Clin. Oncol. 26, 2568–2581.

Reis-Filho, J.S., and Tutt, A.N.J. (2008). Triple negative tumours: a critical review. Histopathology 52, 108–118.

Rennert, G., Bisland-Naggan, S., Barnett-Griness, O., Bar-Joseph, N., Zhang, S., Rennert, H.S., and Narod, S.A. (2007). Clinical outcomes of breast cancer in carriers of BRCA1 and BRCA2 mutations. N. Engl. J. Med. 357, 115–123.

Rice, J.C., Ozcelik, H., Maxeiner, P., Andrulis, I., and Futscher, B.W. (2000). Methylation of the BRCA1 promoter is associated with decreased BRCA1 mRNA levels in clinical breast cancer specimens. Carcinogenesis 21, 1761–1765.

Risch, H.A., McLaughlin, J.R., Cole, D.E.C., Rosen, B., Bradley, L., Fan, I., Tang, J., Li, S., Zhang, S., Shaw, P.A., et al. (2006). Population BRCA1 and BRCA2 mutation frequencies and cancer penetrances: a kin-cohort study in Ontario, Canada. J. Natl. Cancer Inst. 98, 1694–1706.

Roa, B.B., Boyd, A.A., Volcik, K., and Richards, C.S. (1996). Ashkenazi Jewish population frequencies for common mutations in BRCA1 and BRCA2. Nat. Genet. 14, 185–187.

Rodriguez, J.A., Au, W.W.Y., and Henderson, B.R. (2004). Cytoplasmic mislocalization of BRCA1 caused by cancer-associated mutations in the BRCT domain. Exp. Cell Res. 293, 14–21.

Rodríguez, J.A., and Henderson, B.R. (2000). Identification of a functional nuclear export sequence in BRCA1. J. Biol. Chem. 275, 38589–38596.

Rodriguez, M., Yu, X., Chen, J., and Songyang, Z. (2003). Phosphopeptide binding specificities of BRCA1 COOH-terminal (BRCT) domains. J. Biol. Chem. 278, 52914–52918.

General discussion

189

7


Rottenberg, S., Nygren, A.O.H., Pajic, M., van Leeuwen, F.W.B., van der Heijden, I., van de Wetering, K., Liu, X., de Visser, K.E., Gilhuijs, K.G., van Tellingen, O., et al. (2007). Selective induction of chemotherapy resistance of mammary tumors in a conditional mouse model for hereditary breast cancer. Proc. Natl. Acad. Sci. U.S.A. 104, 12117–12122.

Roy, R., Chun, J., and Powell, S.N. (2011). BRCA1 and BRCA2: different roles in a common pathway of genome protection. Nat. Rev. Cancer 12, 68–78.

Roychowdhury, S., Iyer, M.K., Robinson, D.R., Lonigro, R.J., Wu, Y.-M., Cao, X., Kalyana-Sundaram, S., Sam, L., Balbin, O.A., Quist, M.J., et al. (2011). Personalized oncology through integrative high-throughput sequencing: a pilot study. Sci Transl Med 3, 111ra121.

Rubin, M.A., Putzi, M., Mucci, N., Smith, D.C., Wojno, K., Korenchuk, S., and Pienta, K.J. (2000). Rapid (“warm”) autopsy study for procurement of metastatic prostate cancer. Clin. Cancer Res. 6, 1038–1045.

Ruffner, H., Joazeiro, C.A., Hemmati, D., Hunter, T., and Verma, I.M. (2001). Cancer-predisposing mutations within the RING domain of BRCA1: loss of ubiquitin protein ligase activity and protection from radiation hypersensitivity. Proc Natl Acad Sci U S A 98, 5134–5139.

Russell, P.A., Pharoah, P.D., De Foy, K., Ramus, S.J., Symmonds, I., Wilson, A., Scott, I., Ponder, B.A., and Gayther, S.A. (2000). Frequent loss of BRCA1 mRNA and protein expression in sporadic ovarian cancers. Int. J. Cancer 87, 317–321.

Saal, L.H., Gruvberger-Saal, S.K., Persson, C., Lövgren, K., Jumppanen, M., Staaf, J., Jönsson, G., Pires, M.M., Maurer, M., Holm, K., et al. (2008). Recurrent gross mutations of the PTEN tumor suppressor gene in breast cancers with deficient DSB repair. Nat. Genet. 40, 102–107.



Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., Ashley, T., and Livingston, D.M. (1997). Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 88, 265–275.

Scully, R., Ganesan, S., Vlasakova, K., Chen, J., Socolovsky, M., and Livingston, D.M. (1999). Genetic analysis of BRCA1 function in a defined tumor cell line. Mol. Cell 4, 1093–1099.



Shakya, R., Szabolcs, M., McCarthy, E., Ospina, E., Basso, K., Nandula, S., Murty, V., Baer, R., and Ludwig, T. (2008). The basal-like mammary carcinomas induced by Brca1 or Bard1 inactivation implicate the BRCA1/BARD1

Chapter 7

190

7

heterodimer in tumor suppression. Proc Natl Acad Sci U S A 105, 7040–7045.

Shuen, A.Y., and Foulkes, W.D. (2011). Inherited mutations in breast cancer genes--risk and response. J Mammary Gland Biol Neoplasia 16, 3–15.

Silver, D.P., Richardson, A.L., Eklund, A.C., Wang, Z.C., Szallasi, Z., Li, Q., Juul, N., Leong, C.-O., Calogrias, D., Buraimoh, A., et al. (2010). Efficacy of neoadjuvant Cisplatin in triple-negative breast cancer. J. Clin. Oncol. 28, 1145–1153.

Staff, S., Nupponen, N.N., Borg, A., Isola, J.J., and Tanner, M.M. (2000). Multiple copies of mutant BRCA1 and BRCA2 alleles in breast tumors from germ-line mutation carriers. Genes Chromosomes Cancer 28, 432–442.


Sy, S.M.H., Huen, M.S.Y., and Chen, J. (2009). PALB2 is an integral component of the BRCA complex required for homologous recombination repair. Proc. Natl. Acad. Sci. U.S.A. 106, 7155–7160.

Tassone, P., Di Martino, M.T., Ventura, M., Pietragalla, A., Cucinotto, I., Calimeri, T., Bulotta, A., Neri, P., Caraglia, M., and Tagliaferri, P. (2009). Loss of BRCA1 function increases the antitumor activity of cisplatin against human breast cancer xenografts in vivo. Cancer Biol. Ther. 8, 648–653.

Thakur, S., Zhang, H.B., Peng, Y., Le, H., Carroll, B., Ward, T., Yao, J., Farid, L.M., Couch, F.J., Wilson, R.B., et al. (1997). Localization of BRCA1 and a splice variant identifies the nuclear localization signal. Mol. Cell. Biol. 17, 444–452.

Thompson, M.E., Jensen, R.A., Obermiller, P.S., Page, D.L., and Holt, J.T. (1995). Decreased expression of BRCA1 accelerates growth and is often present during sporadic breast cancer progression. Nat. Genet. 9, 444–450.

Thompson, M.E., Robinson-Benion, C.L., and Holt, J.T. (2005). An amino-terminal motif functions as a second nuclear export sequence in BRCA1. J. Biol. Chem. 280, 21854–21857.

Thorslund, T., McIlwraith, M.J., Compton, S.A., Lekomtsev, S., Petronczki, M., Griffith, J.D., and West, S.C. (2010). The breast cancer tumor suppressor BRCA2 promotes the specific targeting of RAD51 to single-stranded DNA. Nat. Struct. Mol. Biol. 17, 1263–1265.

Turnbull, C., Ahmed, S., Morrison, J., Pernet, D., Renwick, A., Maranian, M., Seal, S., Ghoussaini, M., Hines, S., Healey, C.S., et al. (2010). Genome-wide association study identifies five new breast cancer susceptibility loci. Nat. Genet. 42, 504–507.

Turner, N.C., Reis-Filho, J.S., Russell, A.M., Springall, R.J., Ryder, K., Steele, D., Savage, K., Gillett, C.E., Schmitt, F.C., Ashworth, A., et al. (2007). BRCA1 dysfunction in sporadic basal-like breast cancer. Oncogene 26, 2126–2132.


Vollebergh, M.A., Lips, E.H., Nederlof, P.M., Wessels, L.F.A., Schmidt, M.K., van Beers, E.H., Cornelissen, S., Holtkamp, M., Froklage, F.E., de Vries, E.G.E., et al. (2011). An aCGH classifier derived from BRCA1-mutated breast cancer and benefit of high-dose platinum-based chemotherapy in HER2-negative breast cancer patients. Ann. Oncol. 22, 1561–1570.

Wang, B. (2012). BRCA1 tumor suppressor network: focusing on its tail. Cell & Bioscience 2, 6.

Whittemore, A.S., Gong, G., and Itnyre, J. (1997). Prevalence and contribution of BRCA1 mutations in breast cancer and ovarian cancer: results from three U.S. population-based case-control studies of ovarian cancer. Am. J. Hum. Genet. 60, 496–504.

General discussion

191

7

Wu, L.C., Wang, Z.W., Tsan, J.T., Spillman, M.A., Phung, A., Xu, X.L., Yang, M.C., Hwang, L.Y., Bowcock, A.M., and Baer, R. (1996). Identification of a RING protein that can interact in vivo with the BRCA1 gene product. Nat Genet 14, 430–440.

Xia, B., Sheng, Q., Nakanishi, K., Ohashi, A., Wu, J., Christ, N., Liu, X., Jasin, M., Couch, F.J., and Livingston, D.M. (2006). Control of BRCA2 cellular and clinical functions by a nuclear partner, PALB2. Mol. Cell 22, 719–729.

Xiang, T., Jia, Y., Sherris, D., Li, S., Wang, H., Lu, D., and Yang, Q. (2011). Targeting the Akt/mTOR pathway in Brca1-deficient cancers. Oncogene 30, 2443–2450.

Xiang, T., Ohashi, A., Huang, Y., Pandita, T.K., Ludwig, T., Powell, S.N., and Yang, Q. (2008). Negative Regulation of AKT Activation by BRCA1. Cancer Res. 68, 10040–10044.

Xu, B., O’Donnell, A.H., Kim, S.-T., and Kastan, M.B. (2002). Phosphorylation of serine 1387 in Brca1 is specifically required for the Atm-mediated S-phase checkpoint after ionizing irradiation. Cancer Res. 62, 4588–4591.

Yang, E.S., and Xia, F. (2010). BRCA1 16 years later: DNA damage-induced BRCA1 shuttling. Febs J. 277, 3079–3085.

Yu, X., Chini, C.C.S., He, M., Mer, G., and Chen, J. (2003). The BRCT domain is a phospho-protein binding domain. Science 302, 639–642.

Yu, X., Wu, L.C., Bowcock, A.M., Aronheim, A., and Baer, R. (1998). The C-terminal (BRCT) domains of BRCA1 interact in vivo with CtIP, a protein implicated in the CtBP pathway of transcriptional repression. J. Biol. Chem. 273, 25388–25392.

Zander, S.A.L., Kersbergen, A., van der Burg, E., de Water, N., van Tellingen, O., Gunnarsdottir, S., Jaspers, J.E., Pajic, M., Nygren, A.O.H., Jonkers, J., et al. (2010). Sensitivity and acquired resistance of BRCA1;p53-deficient mouse mammary tumors to the topoisomerase I inhibitor topotecan. Cancer Res. 70, 1700–1710.

Zhan, Q., Jin, S., Ng, B., Plisket, J., Shangary, S., Rathi, A., Brown, K.D., and Baskaran, R. (2002). Caspase-3 mediated cleavage of BRCA1 during UV-induced apoptosis. Oncogene 21, 5335–5345.

Zhang, F., Fan, Q., Ren, K., and Andreassen, P.R. (2009a). PALB2 functionally connects the breast cancer susceptibility proteins BRCA1 and BRCA2. Mol. Cancer Res. 7, 1110–1118.

Zhang, F., Ma, J., Wu, J., Ye, L., Cai, H., Xia, B., and Yu, X. (2009b). PALB2 links BRCA1 and BRCA2 in the DNA-damage response. Curr. Biol. 19, 524–529.

Zhong, Q., Chen, C.F., Li, S., Chen, Y., Wang, C.C., Xiao, J., Chen, P.L., Sharp, Z.D., and Lee, W.H. (1999). Association of BRCA1 with the hRad50-hMre11-p95 complex and the DNA damage response. Science 285, 747–750.

Zhu, Q., Pao, G.M., Huynh, A.M., Suh, H., Tonnu, N., Nederlof, P.M., Gage, F.H., and Verma, I.M. (2011). BRCA1 tumour suppression occurs via heterochromatin-mediated silencing. Nature 477, 179–184.

Appendix English summary


Curriculum vitae

Publications

Dankwoord

Appendix

194

A

English summary

Genetically engineered mouse models (GEMMs) for BRCA1-associated breast cancer have contributed significantly to unraveling the various functions of BRCA1. These mouse models are continuously being improved in order to closely mimic as many features of human BRCA1-mutated breast cancer as possible. GEMMs that closely resemble human disease are particularly vital for the development of novel treatment strategies for this type of cancer and studying therapy resistance. Chapter 1 of this thesis gives a comprehensive overview of how both conventional and conditional mouse models for BRCA1-related breast cancer have contributed to our current knowledge of the functions of BRCA1. Additionally, in this chapter is discussed how GEMMs for BRCA1-associated breast cancer were very useful in predicting response and resistance to conventional and targeted therapeutics. Lastly, some suggestions are put forward on how existing GEMMs for BRCA1-related breast cancer can be further improved, which is substantiated by the findings in several other chapters of this thesis. While a number of different functions have been described for BRCA1, BRCA2 is mainly involved in the repair of DNA double-strand breaks (DSBs) by homologous recombination (HR). This homologous recombination deficiency (HRD) has proved to lead to increased sensitivity of BRCA2-deficient cells to DNA damaging agents. In addition, inhibition of the base excision repair (BER) pathway, for instance by inhibition of poly (ADP-ribose) polymerase (PARP), has been shown to be extremely detrimental in HR-deficient cells. In Chapter 2 we describe the isolation and characterization of the first panel of clonal cell lines derived from independent BRCA2-deficient mouse mammary tumors. Not only conventional chemotherapeutic drugs, but also the PARP inhibitor olaparib, specifically induced toxicity in BRCA2-deficient tumor cells compared to BRCA2-proficient control cells. Moreover, potent synergy was observed between the alkylating agent cisplatin and olaparib in BRCA2-deficient tumor cells. The findings in this chapter support the use of PARP inhibitors, alone or in combination with platinum compounds, in the treatment of BRCA-associated tumors. BRCA1 mutation carriers mainly develop basal-like breast tumors, which are generally characterized by a poor differentiation grade. BRCA1-deficient mouse mammary tumors and tumors from human BRCA1 mutation carriers showed increased expression of the polycomb group protein EZH2 (Chapter 3). As EZH2 is an epigenetic repressor of genes required for differentiation, EZH2 could be involved in the undifferentiated phenotype of BRCA1-deficient tumors. Since BRCA1-deficient tumors often lack expression of the estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor type 2 (HER2), these tumors do not benefit from hormonal therapy and are associated with poor survival. Currently, rationally designed treatment strategies are lacking for BRCA1-mutated breast cancers and conventional chemotherapy is the standard treatment. In Chapter 3 we use a GEMM to study the molecular mechanisms behind tumor development and evaluate whether targeting EZH2 would be a putative therapeutic strategy for BRCA1-deficient breast cancer. Both by knockdown experiments and chemical inhibition of EZH2, we show in vitro that BRCA1-deficient tumor cells are dependent on increased EZH2 expression and that EZH2 is a potential druggable target in BRCA1-mutated breast cancer. Only half of the hereditary breast cancer cases can be explained by mutations in the BRCA1 and BRCA2 genes. While thus far no other high penetrance breast cancer

English summary

195

A

genes could be identified, several genes have been found that confer a moderately increased risk of breast cancer. PALB2 is one of these moderate risk breast cancer genes, as mutations in the PALB2 gene lead to a 2-fold increased breast cancer risk. In Chapter 4 of this thesis, we describe the generation of a Palb2 knockout mouse model in order to study the role of PALB2 in development and tumorigenesis. We observed embryonic lethality of homozygous Palb2 knockout mice, which could be partially rescued on a p53-deficient background. PALB2 has been suggested to function as a haploinsufficient tumor suppressor, since no loss of the wild-type allele could be observed in the small number of PALB2-associated breast tumors that were studied thus far. However, we showed that Palb2 heterozygosity did not significantly affect tumor formation and characteristics in heterozygous or homozygous p53 knockout mice. Since several cancer-associated mutations have been found within the RING domain of the BRCA1 gene, BRCA1 RING function has been suggested to be important for the tumor suppressor activity of BRCA1. The C61G mutation in the RING domain is one of the most frequently reported BRCA1 missense mutations linked to breast and ovarian cancer predisposition. This mutation specifically disrupts proper formation of the BRCA1/BARD1 heterodimer and consequently reduces its E3 ubiquitin ligase activity. We have introduced the C61G mutation into a conditional mouse model for BRCA1-related breast cancer in order to unravel the function of the BRCA1 RING domain in tumor suppression and therapy response (Chapter 5). We discovered that the BRCA1 RING domain is indeed essential for tumor suppression, as mice carrying the C61G mutation develop mammary carcinomas with a similar latency and characteristics as Brca1 null mice. Nonetheless, in contrast to BRCA1-deficient tumors, BRCA1-C61G tumors responded poorly to DNA damaging drugs like cisplatin and the PARP inhibitor olaparib and rapidly developed resistance. While we found no evidence for genetic reversion of the mutation in therapy-resistant tumors, BRCA1-C61G tumors already showed some intrinsic capability of DNA repair. Therefore, we suggest that residual activity of the BRCA1-C61G mutant protein in the DNA damage response can explain the poor therapy response of BRCA1-C61G tumors. Thus, while this hypomorphic activity of the BRCA1-C61G mutant protein is unable to prevent tumor development, it can significantly affect therapy response. A few so-called BRCA1 founder mutations have been described, namely 185delAG and 5382insC, that account for almost all hereditary breast and/or ovarian cancer cases in certain ethnic populations. 185delAG and 5382insC are BRCA1 nonsense mutations that result in premature termination of protein translation and thereby produce truncated protein products. Our recent findings (Chapter 5), together with work of others, suggest that not all BRCA1 functionalities are equally important for tumor suppression and response to treatment with DNA damaging agents. The presence of mutant BRCA1 protein products with different biochemical activities could result in differences in therapy response and resistance between BRCA1 mutation carriers. In Chapter 6 of this thesis we have studied the effects of the BRCA1185delAG and BRCA15382insC mutations on tumor development, therapy response and resistance in a conditional mouse model for BRCA1-associated breast cancer. While animals carrying the Brca1185delAG and Brca15382insC mutation develop identical mammary carcinomas, tumors carrying the Brca1185delAG mutation have a considerably poorer response to HRD-targeted therapy than Brca15382insC tumors. We suggest that this poor therapy response of Brca1185delAG tumors is caused by expression of a RING-less BRCA1 protein, produced through internal translation reinitiation, which has residual activity in the DNA damage response. Since RING-less BRCA1 is also expressed in

Appendix

196

A

BRCA1185delAG human breast cancer cells, this mutant protein might also contribute to the development of therapy resistance in human BRCA1185delAG patients. This thesis is concluded with a general discussion of our current understanding of BRCA1-related breast cancer (Chapter 7). Special emphasis is on the different biochemical activities of the BRCA1 protein and how these activities can affect tumor development, therapy response and resistance. Current conventional and targeted treatment regimens for BRCA1-associated breast cancer are discussed in detail. In addition, we describe how different BRCA1 mutations can have a specific impact on therapy response and resistance by affecting different activities of the protein. Finally, we provide a future perspective on how we could improve current therapeutic options for patients with BRCA1-associated breast cancer by implementing knowledge obtained from more advanced preclinical mouse models and clinical trials.


197

A


Genetisch gemodificeerde muismodellen (GEMMs) voor BRCA1-geassocieerde borstkanker hebben een belangrijke bijdrage geleverd aan het onderzoek naar de verschillende functies van BRCA1. Deze muismodellen worden continu verbeterd om de verschillende eigenschappen van humane BRCA1-gemuteerde borstkanker zo goed mogelijk te kunnen recapituleren. Deze GEMMs zijn essentieel voor het ontwikkelen van nieuwe behandelingsmethoden en voor het bestuderen van therapieresistentie. Hoofdstuk 1 van dit proefschrift geeft een uitgebreid overzicht van hoe zowel conventionele als conditionele muismodellen voor BRCA1-gerelateerde borstkanker hebben bijgedragen aan onze huidige kennis over de functies van BRCA1. Daarnaast wordt in dit hoofdstuk beschreven hoe de GEMMs voor BRCA1-geassocieerde borstkanker zeer bruikbaar zijn gebleken in het voorspellen van de respons op conventionele en doelgerichte therapieën en de mogelijke ontwikkeling van resistentie. Tenslotte worden enkele suggesties gedaan hoe bestaande GEMMs voor BRCA1-gerelateerde borstkanker verder verbeterd kunnen worden, hetgeen verder verduidelijkt wordt in enkele andere hoofdstukken van dit proefschrift. Terwijl er een aantal verschillende functies zijn beschreven voor BRCA1, is BRCA2 voornamelijk betrokken bij het herstel van DNA dubbelstrengs breuken (DSBs) door middel van homologe recombinatie (HR). Het is aangetoond dat deze homologe recombinatie deficiëntie (HRD) leidt tot de verhoogde gevoeligheid van BRCA2-deficiënte cellen voor agentia die schade toebrengen aan het DNA. Daarnaast is gebleken dat inhibitie van DNA schade herstel door base excisie reparatie (BER), bijvoorbeeld door inhibitie van poly (ADP-ribose) polymerase (PARP), extreem schadelijk is voor HR-deficiënte cellen. In Hoofdstuk 2 beschrijven we de isolatie en karakterisering van het allereerste paar klonale cellijnen afgeleid van onafhankelijke BRCA2-deficiënte muis mammatumoren. Niet alleen conventionele chemotherapeutica, maar ook de PARP remmer olaparib, waren specifiek toxisch voor BRCA2-deficiënte tumorcellen en niet voor BRCA2-proficiënte controle cellen. Bovendien was er in BRCA2-deficiënte tumorcellen sterke synergie waarneembaar tussen de alkylerende stof cisplatinum en olaparib. De bevindingen in dit hoofdstuk ondersteunen het gebruik van PARP remmers, zowel als monotherapie of in combinatie met alkylerende stoffen, bij de behandeling van BRCA-geassocieerde tumoren. BRCA1 mutatiedragers ontwikkelen voornamelijk borstkanker van het basale subtype, gekenmerkt door een lage mate van differentiatie. Zowel BRCA1-deficiënte muis- als humane borsttumoren laten verhoogde expressie zien van het polycomb groep eiwit EZH2 (Hoofdstuk 3). EZH2 speelt een rol bij het onderdrukken van transcriptie van genen die benodigd zijn voor cellulaire differentiatie. Het hoge expressieniveau van EZH2 zou een verklaring kunnen zijn voor het ongedifferentieerde fenotype van BRCA1-deficiënte tumoren. Aangezien BRCA1-deficiënte tumoren vaak geen oestrogeen receptor (ER), progesteron receptor (PR) en humane epidermale groeifactor receptor type 2 (HER2) tot expressie brengen, kunnen deze tumoren niet behandeld worden met hormonale therapie. Tevens hebben patiënten met BRCA1-deficiënte tumoren een lage overlevingskans. Op dit moment ontbreken behandelingsstrategieën voor BRCA1-gemuteerde borstkanker die gebaseerd zijn op de biologische eigenschappen van de tumor en is chemotherapie de standaard behandelingsmethode. In Hoofdstuk 3 gebruiken we een GEMM om de moleculaire mechanismen achter de ontwikkeling van BRCA1-deficiënte tumoren te bestuderen. Daarnaast wordt geëvalueerd of inhibitie van

Appendix

198

A

EZH2 een bruikbare strategie is om BRCA1-deficiënte borstkanker te behandelen. Zowel met behulp van EZH2 knockdown experimenten als via chemische inhibitie van EZH2, laten we in vitro zien dat BRCA1-deficiënte tumorcellen afhankelijk zijn van verhoogde EZH2 expressie en dat EZH2 een potentiële kandidaat is om te remmen in de behandeling van BRCA1-gemuteerde borstkanker. Slechts de helft van alle erfelijke borstkankergevallen kan verklaard worden door mutaties in de BRCA1 en BRCA2 genen. Hoewel er tot nu toe nog geen genen geïdentificeerd zijn die de kans op borstkanker zo sterk vergroten als BRCA1 en BRCA2, zijn er wel een aantal andere genen gevonden die dat in mindere mate doen. Een van deze genen is PALB2 en mutaties in dit gen verdubbelen het risico op het ontwikkelen van borstkanker. In Hoofdstuk 4 van dit proefschrift beschrijven we de ontwikkeling van een Palb2 knockout muismodel om de rol van PALB2 in de embryonale ontwikkeling en tijdens het ontstaan van tumoren te kunnen bestuderen. Homozygote Palb2 knockout muizen sterven in een vroege fase van de embryogenese en dit fenotype is minder ernstig op een p53-deficiënte achtergrond. Aangezien er in het kleine aantal PALB2-geassocieerde borsttumoren dat tot nu toe bestudeerd is geen verlies van het wildtype allel is waargenomen, zou PALB2 kunnen functioneren als een haploinsufficiënte tumor suppressor. Wij tonen echter aan dat Palb2 heterozygositeit geen significant effect heeft op de tumorontwikkeling en de eigenschappen van de tumor in heterozygote en homozygote p53 knockout muizen. Aangezien verscheidene kankergeassocieerde mutaties zijn gevonden in het RING domein van het BRCA1 gen, lijkt de BRCA1 RING functie van belang te zijn voor de tumor suppressor activiteit van BRCA1. De C61G mutatie in het RING domein is een van de meest voorkomende BRCA1 missense mutaties die geassocieerd wordt met erfelijke aanleg voor borst- en ovariumkanker. Deze mutatie verhindert vorming van de BRCA1/BARD1 heterodimeer en vermindert daardoor de E3 ubiquitine ligase activiteit van de heterodimeer. Om de functie van het BRCA1 RING domein in tumorsuppressie en therapierespons te kunnen ontrafelen, hebben wij de C61G mutatie geïntroduceerd in een conditioneel muismodel voor BRCA1-gerelateerde borstkanker (Hoofdstuk 5). We hebben ontdekt dat het BRCA1 RING domain essentieel is voor tumorsuppressie, aangezien muizen met de C61G mutatie mammacarcinomen ontwikkelen met dezelfde latentietijd en kenmerken als Brca1 knockout muizen. Desondanks reageren BRCA1-C61G tumoren, in tegenstelling tot BRCA1-deficiënte tumoren, slecht op medicijnen die DNA schade aanbrengen, zoals cisplatinum en de PARP remmer olaparib. Tevens ontwikkelen BRCA1-C61G tumoren snel therapieresistentie. Het blijkt dat BRCA1-C61G tumoren intrinsiek al in staat te zijn tot een vorm van DNA schade herstel. Daarom stellen wij voor dat de slechte therapierespons van BRCA1-C61G tumoren het gevolg is van restactiviteit van het mutante BRCA1-C61G eiwit in de respons op DNA schade. Dus terwijl dit hypomorfe BRCA1-C61G eiwit niet voldoende is om de ontwikkeling van tumoren te voorkomen, kan het de respons op therapie wezenlijk beïnvloeden. Er zijn enkele zogenaamde founder mutaties bekend, zoals de 185delAG en 5382insC mutaties, die gezamenlijk vrijwel alle erfelijke borst- en ovariumkankergevallen binnen bepaalde etnische groepen kunnen verklaren. 185delAG en 5382insC zijn BRCA1 nonsense mutaties die leiden tot vroegtijdige terminatie van eiwit translatie en daardoor een verkorte versie van produceren. Onze recente bevindingen (Hoofdstuk 5), samen met het werk van anderen, suggereren dat niet alle functies van BRCA1 even belangrijk zijn voor tumorsuppressie en respons op behandeling met agentia die schade aanbrengen aan


199

A

het DNA. De aanwezigheid van mutante BRCA1 eiwitten met verschillende biochemische activiteiten kan resulteren in verschillen tussen BRCA1 mutatiedragers wat betreft therapierespons en ontwikkeling van resistentie. In Hoofdstuk 6 van dit proefschrift hebben we de effecten van de BRCA1185delAG en BRCA15382insC mutaties op tumorontwikkeling, therapierespons en -resistentie bestudeerd in een conditioneel muismodel voor BRCA1-geassocieerde borstkanker. Terwijl dieren met de Brca1185delAG en Brca15382insC mutatie identieke mammacarcinomen ontwikkelen, reageren tumoren met de Brca1185delAG mutatie aanzienlijk slechter op olaparib en cisplatinum dan Brca15382insC tumoren. We suggereren dat de slechte therapierespons van Brca1185delAG tumoren het gevolg is van expressie van een RING-loos BRCA1 eiwit, dat geproduceerd wordt via interne translatie herstart en restactiviteit heeft in de respons op DNA schade. Aangezien RING-loos BRCA1 ook tot expressie komt en functioneel is in humane BRCA1185delAG borstkankercellen, zou dit mutante eiwit ook bij kunnen dragen aan snelle ontwikkeling van therapieresistentie in BRCA1185delAG patiënten. Dit proefschrift wordt afgesloten met een algemene discussie over de huidige kennis op het gebied van BRCA1-gerelateerde borstkanker (Hoofdstuk 7). Speciale nadruk wordt gelegd op de verschillende biochemische activiteiten van het BRCA1 eiwit en hoe deze activiteiten invloed kunnen hebben op tumorontwikkeling, therapierespons en -resistentie. De huidige conventionele en doelgerichte behandelingsmethoden voor BRCA1-geassocieerde borstkanker worden gedetailleerd beschreven. Daarnaast beschrijven we hoe verschillende BRCA1 mutaties een specifieke impact kunnen hebben op therapierespons en -resistentie door verschillende functies van het eiwit te beïnvloeden. Ten slotte geven we onze visie op hoe we de huidige behandelingsmogelijkheden voor patiënten met BRCA1-geassocieerde borstkanker zouden kunnen verbeteren door gebruik te maken van de kennis verkregen uit meer geavanceerde preklinische muismodellen en uit klinische trials.

Appendix

200

A

Curriculum vitae

Rinske Marlien Drost was born on August 16th, 1983 in Utrecht (the Netherlands). In 1995 she attended the Cals College Nieuwegein, from which she graduated in 2001. In the same year she started her study Biology at Utrecht University. After writing a bachelor thesis on the cellular defense against HIV under supervision of Dr. Adri Thomas, she obtained her Bachelor of Science degree in 2004. Afterwards she started the master program Animal Biology at Utrecht University. During this master program, she performed a 9-month internship in the Biochemical Physiology group of Prof. Dick van der Horst at Utrecht University, under direct supervision of Masja van Oort. During this intership, she studied expression and translocation of the CD36 protein. Subsequently, she performed a 6-month internship at the division of Molecular Biology of the Netherlands Cancer Institute in the group of Dr. Jos Jonkers, under direct supervision of Bastiaan Evers. Here she investigated whether BRCA2-deficient mouse mammary epithelial cells could survive in vitro cell culture. She obtained her Master of Science degree in 2006. In November 2006, Rinske started as a PhD student in the group of Dr. Jos Jonkers, where she conducted the research described in this thesis.

Curriculum vitae & publications

201

A

Publications

Selective inhibition of BRCA2-deficient mammary tumor cell growth by AZD2281 and cisplatin.Evers B, Drost R, Schut E, de Bruin M, van der Burg E, Derksen PW, Holstege H, Liu X, van Drunen E, Beverloo HB, Smith GC, Martin NM, Lau A, O'Connor MJ, Jonkers J.Clin Cancer Res. 2008 Jun 15;14(12):3916-25.

BRCA1-deficient mammary tumor cells are dependent on EZH2 expression and sensitive to Polycomb Repressive Complex 2-inhibitor 3-deazaneplanocin A.Puppe J, Drost R, Liu X, Joosse SA, Evers B, Cornelissen-Steijger P, Nederlof P, Yu Q, Jonkers J, van Lohuizen M, Pietersen AM.Breast Cancer Res. 2009;11(4):R63.

Preclinical mouse models for BRCA1-associated breast cancer.Drost RM, Jonkers J.Br J Cancer. 2009 Nov 17;101(10):1651-7.

Loss of p53 partially rescues embryonic development of Palb2 knockout mice but does not foster haploinsufficiency of Palb2 in tumour suppression.Bouwman P, Drost R, Klijn C, Pieterse M, van der Gulden H, Song JY, Szuhai K, Jonkers J.J Pathol. 2011 May;224(1):10-21.

BRCA1 RING function is essential for tumor suppression but dispensable for therapy resistance.Drost R, Bouwman P, Rottenberg S, Boon U, Schut E, Klarenbeek S, Klijn C, van der Heijden I, van der Gulden H, Wientjens E, Pieterse M, Catteau A, Green P, Solomon E, Morris JR, Jonkers J.Cancer Cell. 2011 Dec 13;20(6):797-809.

Each of the four intracellular cysteines of CD36 is essential for insulin- or AMP-activated protein kinase-induced CD36 translocation.van Oort MM, Drost R, Janssen L, Kerver J, van Doorn J, van der Horst DJ, Luiken JJ, Rodenburg KW. Manuscript submitted

BRCA1185delAG tumors may acquire therapy resistance through expression of a RING-less BRCA1 protein via internal translation reinitiationDrost R, Boon U, Schut E, Wientjens E, Pieterse M, Chondronasiou D, Klijn C, Klarenbeek S, van der Gulden H, van der Heijden I, Rottenberg S, Bouwman P, Jonkers J.Manuscript in preparation

Appendix

202

A

Dankwoord

Zo…dan is voor mij nu ook de tijd aangebroken om het dankwoord voor mijn proefschrift te gaan schrijven. En dat betekent dat mijn proefschrift af is…wat een raar gevoel is dat! De eerste jaren van mijn promotie kon ik me er absoluut geen voorstelling van maken dat ik dit punt ooit ook zou bereiken en nu is het dan toch eindelijk zover! Het dankwoord is zelfs een van de allerbelangrijkste onderdelen van een proefschrift. Niet alleen omdat dit het enige is wat veel mensen ook daadwerkelijk lezen, maar natuurlijk vooral omdat dit proefschrift er niet was geweest zonder de hulp van een heleboel mensen! Jos, dit proefschrift is grotendeels jouw verdienste! Ik ben begonnen als masterstudent in jouw groep en ben erg blij dat ik de kans heb gekregen om daar ook te promoveren. Het was voor mij snel duidelijk dat ik bij jou in de groep wilde promoveren. Want naast goed en interessant onderzoek vind ik ook de sfeer in een groep erg belangrijk. En jij hebt een groep zeer gemotiveerde en enthousiaste mensen om je heen weten te verzamelen! Dit heeft zeker te maken met jouw enorm positieve instelling. Ondanks dat je in het onderzoek regelmatig te maken krijgt met tegenslagen, weet jij altijd je optimisme te behouden. Als mijn onderzoek even niet zo lekker liep, kon ik altijd even bij jou langs komen om vervolgens weer met frisse moed en een berg nieuwe ideeën terug te komen. Bedankt dat je altijd vertrouwen hebt gehad in mij en mijn onderzoek en ik hoop dat ik in de toekomst je advies mag blijven vragen. De consequentie van een hele berg ideeën is echter wel dat je prioriteiten moet stellen en moet kiezen met welke ideeën je verder gaat. Doordat je me daar altijd heel vrij in hebt gelaten, heb je veel bijgedragen in mijn ontwikkeling tot een zelfstandige onderzoeker. Ik kan alleen maar hopen dat ik op mijn toekomstige postdoc positie net zoveel mogelijkheden en vrijheid krijg om me verder te ontwikkelen. Peter, als er een co-copromotor zou bestaan, zou jij daar zeker voor in aanmerking komen! Het zegt al genoeg dat jij op vrijwel al mijn papers een prominente plaats inneemt. Ik heb heel veel van jou en van onze samenwerking geleerd, ondanks dat die soms niet helemaal vlekkeloos verliep door onze verschillende manier van werken. Ik waardeer het enorm dat ik altijd bij je terecht kon voor advies en hulp bij praktische/technische zaken. Jij loopt over van ideeën en wilt overal wel even een 'pilot'-experimentje aan wagen. Het staat buiten kijf dat jij een wetenschapper in hart en nieren bent! Ik hoop dat de toekomst wat meer duidelijkheid schept over het verdere verloop van je carrière. Ik wens je in elk geval alle goeds! Ute, wat leuk dat je mijn paranimf wilde zijn! We werken al samen bij de muisjes sinds jij stage kwam lopen in de groep van Jos. Vanaf het begin af aan ging die samenwerking heel goed. Je bent een echte team-player en ik ben blij dat je na je stage ook als analist in de groep kon blijven! Later had ik het geluk dat Eva ons ’muizen-team’ ook nog kwam versterken. En naast dat het natuurlijk errug gezellig was om met jullie samen te werken, heeft het ook wetenschappelijk zeer goed uitgepakt. Lieve dames, zonder jullie hulp was het echt nooit gelukt om die megalomane muizenprojecten tot een goed einde te brengen! Jullie hebben een groot aandeel gehad in mijn papers en dus ook in dit proefschrift. Ellen, ik ben blij dat ik de laatste loodjes van mijn promotie met jou heb mogen samenwerken! Samen met Liesbeth ben jij echt de drijvende kracht geweest achter het genereren van talloze tumorcellijnen. Ondanks al die uren in de celkweek, bleef jij altijd

Dankwoord

203

A

vrolijk en enthousiast! Iedereen kan bij jou terecht voor een serieus gesprek of een lolletje. Beetje jammer alleen dat jouw voetbalhart in Eindhoven ligt…;-)! En hoewel de cellijnen nog niet in dit proefschrift staan, hoop ik dat ze in de toekomst nog veel gebruikt zullen worden. Ik ben begonnen op het NKI als student bij Bastiaan. Hoewel ik jouw uitleg met behulp van rode en witte balletjes op dat moment iets minder kon waarderen, heb ik enorm veel van jou geleerd! Ik ben altijd erg onder de indruk geweest van jouw kritische blik en scherpe geest. En ik denk dat het je gelukt is om dat voor een deel op je wetenschappelijke nageslacht over te brengen ;-). Heel veel succes in de toekomst in Engeland/Zweden/Nederland/??? (doorhalen wat niet van toepassing is)! En wat een enorme bak aan kennis en ervaring hebben wij op het lab staan met Hanneke en Ingrid! Op het gebied van kloneren en DNA, heb ik van Hanneke alle kneepjes van het vak geleerd. En zonder Ingrid waren we nooit gekomen waar we nu zijn met die verdomd lastige BRCA1 western blots! Ik wil jullie enorm bedanken dat jullie altijd bereid waren om te helpen en al mijn vragen te beantwoorden. Jullie zijn echt de spil van het lab! Om zeker niet te vergeten, onze meest ervaren muizendames: Eline en Tanya! Eline, ik wil jou bedanken dat je mij alle technieken die je nodig hebt voor muisexperimenten zo grondig hebt aangeleerd. Hoewel je dan misschien niet direct betrokken bent geweest bij de experimenten voor mijn papers, sta je daarmee wel aan de basis van dit proefschrift! En ik waardeer jouw zeer betrokken en verantwoordelijke houding enorm! En dan onze one and only BT (black technician) aka LaTanya aka Carameleesha ;-)! Volgens mij ben jij zowat de enige in heb lab waarmee ik lekker kon ouwehoeren over de heerlijke onzinprogramma’s op tv zoals OhOh Cherso, the Bachelor, Echte meisjes in de jungle en ga zo maar door. Maar daarnaast ben ik ook heel blij dat jij onze muizenlijnen allemaal veilig hebt kunnen stellen door er ES cellen van te isoleren. Wat een klus is dat, respect hoor! Sjoerd, ik kan wel zeggen dat jij er mede verantwoordelijk voor bent dat ik aangestoken ben met het tennis-virus! Elke maandagochtend werden als eerste onze tenniswedstrijden van dat weekend even grondig geanalyseerd. Ik zal je bestorming van de ATP ranking met interesse blijven volgen! En als een tenniscarrière het dan toch niet wordt, heb je altijd je pathologendiploma en straks doctorstitel nog! Zoals jij altijd zegt: alles na je VWO-diploma is mooi meegenomen! Heel veel succes met de laatste loodjes van je promotie! Hulde aan Marieke vd V voor het geluid wat zij weet te produceren ;-). Toen zij in het Jonkers lab kwam had ik opeens een geduchte concurrent en werd het aantal geproduceerde decibellen meer dan verdubbeld. Het is waarschijnlijk niet voor niets geweest dat wij tweeën op één kamer kwamen bij collega’s die toch al een gehoorprobleem hadden… Nu even zonder gekkigheid: Marieke, met jouw spontane en enthousiaste verschijning heb je voor veel leven in de brouwerij gezorgd! Ik hoop dat onze ‘expeditie’ niet voor niets is geweest en dat je papers dit jaar nog gepubliceerd worden! Martine, jij bent een aanwinst voor de Jonkers groep, zowel op wetenschappelijk als op sociaal gebied! Thanx voor alle gezelligheid en je wijze raad op carrière-gebied! Dit boekje had er waarschijnlijk niet zo uitgezien zonder Linda. Thanx dat je me het rondgeleid door de donkere krochten van InDesign en dat ik jouw proefschrift als voorbeeld mocht gebruiken! Heel veel succes in de toekomst aan het ES cel-front samen met Martine en Tanya! Sjors, ik moet toch wel zeggen dat het een enorme opluchting was toen er nog

Appendix

204

A

een Ajax-fan bij ons in de groep kwam werken tussen al die PSV-ers! Ik twijfel er niet aan dat het helemaal goed gaat komen met je promotie met die Ajax winnaarsmentaliteit! Ewa, I hope that you can get your paper published soon and find a nice job in a warmer and less rainy country ;-)! Mirjam, we hebben maar korte tijd in dezelfde groep gezeten, maar ik vond het leuk je te leren kennen. Ik ben benieuwd wat er uit jouw onderzoek naar CAFs zal komen! De afgelopen jaren heb ik met veel plezier studenten begeleid tijdens hun onderzoeksstage. Naast dat ik het leuk vind om te proberen mensen wat bij te brengen, heb ik er ook zelf enorm veel van geleerd! Ute, ik ben blij dat ik een kleine bijdrage heb kunnen leveren aan de goede analist die je nu bent! Dafni, thanks for your contribution to chapter 6 of this thesis! I hope we can get this paper published soon. I wish you all the best in the rest of your career, whether it is inside or outside science! Keep me posted! Vanzelfsprekend wil ik ook alle ex-Jonkers labgenoten bedanken! Mark, mijn borrelmaatje, ik ga naar een stuk minder borrels nu jij in Zweden zit! Ik ben erg benieuwd wat je gaat doen als je weer terugkomt naar Nederland (als je tenminste niet een leuke Zweedse aan de haak slaat en in Zweden blijft ;-). Dank je wel voor al het meedenken en je hulp bij mijn experimenten! Henne, bedankt voor alle wijze raad tijdens het begin van mijn OIO-tijd! Jouw complimentjes hebben me toen een stuk zelfverzekerder gemaakt. Ik ben blij dat alles je nu voor de wind gaat! Chris, bedankt dat je bio-informatica voor mij iets minder ‘eng’ hebt weten te maken. Er is nog steeds geen waardig opvolger voor jou gevonden! Waarschijnlijk zit jij binnen no time bij Genentech aan de top ;-)! Marco, de enige mede-Utrechter/Utrechtenaar in de Jonkers groep. Wie weet volg ik jouw voorbeeld en ga ik na mijn promotie ‘back to my roots’. Gille(man), Chiel, Xiaoling and Patrick, the very ‘green’ student that you probably remember has now left the (NKI) building! Wow, time flies! Thanks for all your practical help and (career) advice! En dan hebben we natuurlijk ook nog de klinische wederhelft van de Jonkers groep: de Linn groep. Bij nader inzien; artsen vallen best wel mee ;-)! Hoewel de verschillen tussen fundamenteel en klinisch onderzoek soms best groot zijn, heb ik toch veel van jullie opgestoken! Ik weet nu bijvoorbeeld het verschil tussen een predictive en prognostic marker en hoe ik een nette survivalcurve moet maken. Marieke V, ik zit dit stukje toevallig te schrijven terwijl jij vanmiddag je proefschrift gaat verdedigen! Ik twijfel er niet over dat dat een succes zal worden, net zoals je toekomstige carrière als dokter Vollebergh! Philip, in je eentje wist jij het NKI een stuk studentikozer te maken ;-)! Ik heb me altijd kostelijk vermaakt om jouw verhalen over het Leidse studentenleven. Jij was een goede plaatsvervanger in de borrelcommissie, want volgens mij heb jij nog nooit een borrel overgeslagen! Helaas zitten de Jonkers groep en de De Visser groep inmiddels niet meer op dezelfde afdeling, ondanks de vele gemeenschappelijke (onderzoeks)interesses. Karin, Chris, Metamia, Kelly, Seth en Tisee, ik wil jullie bedanken voor alle nuttige discussies die we tijdens de werkbesprekingen gevoerd hebben en natuurlijk ook voor de gezelligheid tijdens retreats, barbecues en andere uitjes! Karin, ik hoop dat je in de komende jaren ook op papier de status van groepsleider zult krijgen, hoewel dit in de praktijk natuurlijk allang zo is! Je verdient ‘t! Chris, ik ben erg benieuwd of jij na je promotieonderzoek nog terug zult keren naar de kliniek. Het straalt ervan af dat je enorm veel plezier in het onderzoek hebt en je hebt er ook veel talent voor! Metamia, jammer dat we nu geen borrels meer samen kunnen geven! Maar je mag me natuurlijk altijd uitnodigen voor de borrel van jouw volgende high impact paper ;-)! En ik hoor het ook graag wanneer je een mooie

Dankwoord

205

A

postdoc positie hebt gevonden in the Big Apple. Kelly, de trein- en autoritjes tussen Amsterdam en Utrecht (en vice versa) waren me een waar genoegen! Ondanks af en toe wat haperingen bij de NS, weet ik zeker dat jouw promotie als een trein zal lopen! Zonder het werk van Sven en consorten in de Borst groep, was mijn onderzoek er nooit geweest! De keren dat ik naar jullie data heb verwezen in mijn presentaties en publicaties zijn ontelbaar! Sven, ik waardeer het enorm dat je altijd bereid was te helpen en mijn vele vragen te beantwoorden. Liesbeth, hartstikke bedankt dat je samen met Ellen hebt gestort op het maken van tumorcellijnen van mijn muismodellen! Ik zal jouw beschrijving van ‘rommelige’, ‘wollige’ of ‘ster-achtige’ tumorcellen nooit vergeten! Lieve Janneke, ik heb altijd bewondering gehad voor het aantal projecten wat jij succesvol draaiende hebt weten te houden. Ik weet zeker dat al dat werk in een mooi boekje zal resulteren! En hopelijk heb ik nog een kleine bijdrage kunnen leveren aan een van jouw papers. Hou me op de hoogte wat je na je promotie gaat doen! Henri, als student had ik er geen benul van wat precies jouw functie binnen het NKI was! Inmiddels kan ik niets meer bedenken waar jij NIET bij betrokken bent binnen het NKI. Fijn dat er altijd iemand op P2 was als ik in het weekend kwam werken! Tom en Linda, dank jullie wel voor jullie advies en hulp bij praktische zaken, zoals het versturen van de vele pakketjes op droogijs! Ook de hele te Riele groep wil ik bedanken voor de gezellige tijd op P2. Marleen, Sandra en Marieke, bedankt voor de ondersteuning bij de ES celkweek en de oligotargeting tijdens het prille begin van mijn OIO-carrière. Tanja, het schepte wel een band dat we ongeveer tegelijkertijd op dezelfde afdeling met onze promotie begonnen zijn! Succes met de laatste loodjes en ik weet zeker dat er een mooi boekje gaat komen! Sietske, thanx voor alle gezelligheid tijdens retreats, etentjes en promotiefeestjes! Jij weet vast ook San Francisco op zijn kop te zetten! Het laatste jaar van mijn promotie zijn we ook nog verhuisd van P2 naar C2. Ik wil alle mensen van C2 bedanken voor het warme welkom dat de Jonkers groep kreeg. Jullie hebben er zeker aan bijgedragen dat ik de laatste stressvolle maandjes van mijn promotie nog met plezier gewerkt heb! Mirna, bedankt voor de hulp met praktische zaken rondom het afronden van mijn promotie. Je hebt je in korte tijd onmisbaar weten te maken voor C2 en de Jonkers groep. Daarnaast wil ik ook alle medewerkers van de Genomics Core Facility (GCF), de Digital Microscopy Facility, het muizenhuis en de proefdierpathologie van het NKI bedanken. Met name de dierverzorgers van G3 (Marissa, Adrie en Klaas) en G2-zuid (Bjørn en Tanja) hebben eraan bijgedragen dat de experimenten beschreven in dit proefschrift zo succesvol zijn verlopen. Uiteraard was deze promotie nooit tot stand gekomen zonder mijn promotiecommissie. Ik wil de leden van mijn promotiecommissie bedanken voor de tijd en energie die zij gestoken hebben in het beoordelen van mijn proefschrift. Ik ga mijn uiterste best doen om uw kritische vragen tijdens mijn promotie zo goed mogelijk te beantwoorden. Beste Ton, bedankt dat u mijn promotor wilde zijn. Professor Kanaar, dank dat u als gastopponent mijn promotie wilt bijwonen. Naast al mijn collega’s zijn de mensen buiten het lab natuurlijk net zo belangrijk geweest tijdens mijn promotieonderzoek. Zonder al die leuke en mooie belevenissen met vrienden en familie, was het een stuk lastiger geweest om mijn promotie te doorstaan! Ik wil jullie allemaal bedanken voor het interesse dat jullie altijd gehad hebben in mijn onderzoek en promotie-perikelen, ondanks dat het soms lastig te begrijpen was waar ik nu precies mee bezig was. En hopelijk kan ik jullie hiervoor op 14 september persoonlijk

Appendix

206

A

bedanken en kunnen we samen proosten op mijn promotie! Marijk, we zijn al vriendinnen sinds het eerste moment dat ik op de Margrietschool kwam. En hoewel de 'New girls in een blikkie' inmiddels niet meer bestaan ;-), ben ik heel blij dat wij bijna 20 jaar later nog steeds vriendinnen zijn! Zonder probleem kunnen wij hele avonden doorbrengen met alleen maar kletsen over van alles en nog wat. Dank je wel voor al je interesse en advies! Ik heb er enorm veel respect voor hoe jij de afgelopen jaren samen met Folk door alle tegenslagen hebt heengeslagen. Alle goeds voor de toekomst! En dan mijn Utrechts mede-bioloogje Aniek! Ans, hadden we in 2001 ooit gedacht dat we allebei zouden promoveren op kankeronderzoek?! De afgelopen jaren hebben wij onder het genot van een hapje en drankje heel wat afgepraat over wetenschap en alles wat er bij komt kijken (voor velen, waaronder onze mannen, onbegrijpelijk)! Dank je wel voor al je advies! Ik twijfel er niet over dat jouw promotie in december goed gaat verlopen en dat jij een succesvolle carrière als onderzoeker tegemoet gaat! Super dat je een goede postdoc plek hebt gevonden in San Francisco, maar ik ga je wel missen hoor! Ik wens jou en Coen heel veel succes en plezier in SF en we komen jullie daar zeker weten een keertje op zoeken! Ik had me geen betere schoonfamilie kunnen wensen! Ans, Gijs, Daphne, Herman, Nanda en Laurence, dank jullie wel dat jullie me zo op mijn plek hebben laten voelen in de familie Koppers! Ik heb het enorm naar mijn zin gehad tijdens de vele feestjes, etentjes en weekendjes weg! Die hebben er zeker aan bijgedragen dat ik de stress van het promoveren even los kon laten! Ook bedankt voor de vele lieve smsjes/mailtjes/kaartjes en voor het feit dat jullie altijd zo geïnteresseerd zijn geweest in mij en mijn onderzoek. En ik ben zoooooo benieuwd of Jelte op 14 september, als ik dit proefschrift moet verdedigen, al een zusje heeft gekregen! Zo niet, dan graag wel voor ik en Marcel naar Nieuw Zeeland afreizen ;-). Onbetaalbaar: mijn lieve gezusters Karlijn en Milou! Ondanks dat we elkaar vroeger natuurlijk wel eens in de haren konden vliegen, ben ik heel blij dat we nu zo’n goede band hebben. En ik ben ook zoooooo trots op mijn kleine zusjes! Ik weet zeker dat jullie in de toekomst op vele vlakken nog heel veel gaan bereiken. Lieve Lijn, ik zou niemand liever naast me hebben staan tijdens mijn verdediging dan jij! Jouw vrolijkheid, energie en positieve instelling kan ik goed gebruiken! En daarnaast was jij op het voetbalveld ook altijd al een betere verdediger dan ik ;-). Lieve Lou, ik vind het zo cool dat je nu geschiedenis aan het studeren bent! Geschiedenis was ook altijd een van mijn verborgen interesses! En wie weet ben jij de volgende die gaat promoveren! By the way, ook leuk dat je een vriendje hebt gevonden waar ik lekker mee kan ouwehoeren over microarrays, aCGH, proteomics, sequencing enzovoorts ;-)! Joeri en Ronald, ook jullie wil ik natuurlijk bedanken voor alle gezelligheid en de interesse die jullie altijd getoond hebben in mijn onderzoek! Heel veel succes met (het afronden van) jullie studie! En blijf goed voor mijn kleine zusjes zorgen hè! Lieve paps en mams, zonder jullie was ik nooit geworden wat ik nu ben! Dank jullie wel dat jullie me alle kansen hebben gegeven om me te ontwikkelen en dat jullie altijd voor me klaarstonden met hulp en advies. Wat is het belangrijk om mensen om je heen te hebben waar je altijd op terug kunt vallen! Ik hoop dat ik dat ook voor jullie kan betekenen. Mam, hoewel ik me soms afvraag of nodig is om echt iedereen te vertellen wat ik doe ;-), ben ik toch blij om te merken dat je zo trots op me bent! Maar je moet weten dat ik ook enorm trots op jou ben! Je hebt je mooi wel door al die ellende van de afgelopen jaren heen weten te knokken en je gaat nu zelfs weer studeren! Papsie, jij

Dankwoord

207

A

hield jezelf iets meer op de vlakte, wat niet gek is in zo’n kippenhok ;-)! Je hebt jezelf altijd weggecijferd voor je meiden. En hoewel ik dat natuurlijk enorm waardeer, vind ik het fijn om te merken dat je nu meer je eigen dingen hebt. Pap en mam, ik hoop dat de toekomst veel moois voor jullie in petto heeft. Na regen komt zonneschijn! Luv you! Save the best for last! Mijn lieve lieve lieve Marcel! Dank je wel dat je de afgelopen jaren in elk opzicht achter me hebt gestaan! Door jouw nuchtere kijk op de wereld en relativeringsvermogen heb je mij heel wat keren met beide benen op de grond weten te houden. Jij kon altijd blijven lachen om mijn geklaag en gemopper. En hoewel ik het op dat moment soms heel irritant vond, kon ik er uiteindelijk zelf ook om lachen. “Get in the bowl…no YOU get in the bowl!” Ik kijk echt enorm uit naar ons avontuur in Nieuw Zeeland! En wie weet krijg ik je ooit nog wel mee naar Zuid-Amerika, Afrika of Azië ;-)… Jeg elsker deg!

uva-dare (digital academic repository) stepping into the ring: … · stepping into the ring rinske...

Documents