use of the oligonucleotide dsp30 with il2 in the investigation of low grade b cell lymphoid...
TRANSCRIPT
![Page 1: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/1.jpg)
Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms
Chris Lowe, Newcastle
Cytogenetic abnormalities of diagnostic and prognostic importance have been identified in some mature B cell neoplasms
In Newcastle, a targeted FISH approach has been used for detection
![Page 2: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/2.jpg)
FISH/morphology/phenotype strategy for CLL/MCL
Morphology
CLL CLL/MCL
Phenotype
CD5CD19FMC7-Weak sIg
CD5CD19FMC7+Strong sIg
CLL CLL/MCL
G-banding
Likely sub-type?
FISH
Abnormal Not abnormal
More FISH?
Rare or unexpected abnormalities to which FISH has not been directed
![Page 3: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/3.jpg)
Low success and abnormality rate in mature B cell neoplasms
In CLL, this is due to leukaemic cell arrest in G0 or early G1 of the cell cycle
B cell mitogens: EBV, Pokeweed, Lipopolysaccharide, TNF alpha,SAC, TPA and CD40L stimulation
The trouble with G-banding…..
![Page 4: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/4.jpg)
DSP30: single stranded, CpG unmethylated, phosphorothioate oligodeoxynucleotide
5’ TCGTCGCTGTCTCCGCTTCTTCTTGCC
CLL cells arrested in G0 or early G1; unable to apoptose
G1
M
S
G2 G0G1
M
S
G2 G0
Cell activation results in entryinto the cell cycle
DSP30 also induces the IL2 alpha receptor (possibly via CD25) in CLL cells thereby allowing IL2 to generate a co-stimulatory effect
Adapted from Liang et al, 2009
B cells, plasmacytoid DC cells
In CLL
![Page 5: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/5.jpg)
Study Neoplasm No. of cases Success
Rate
Abnormality
Rate
Dicker et al
2006
CLL 132 95% 81%
Mayr et al 2006
CLL 14 ? ~90%
Haferlach et al 2007
CLL 504 99% 83%
Put et al
2009
CLL 217 ? 51%
Wren et al
2010
CLL 24 75% 29%
Hereema et al 2010
CLL 229 ? 64%
Struski et al
2009
CLL 76 95% 98%
Other mature B
cell
neoplasms
51 79% 76%
Summary of use of DSP30 / IL2 as a B cell mitogen for cytogenetic studies
The CpG oligonucleotide DSP30 and cytokine IL2 are established as highly effective in CLL
![Page 6: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/6.jpg)
Unseparated samples of blood (12), marrow (17)
and lymph node (3)
Stimulated with DSP10 (2uM)and IL2 (200U/ml) for 72 hrs
Consumable cost ~£6 per culture
Unstimulated for 24 hr
Mature B cell neoplasm
CLL, MCL, WM, MM, NHL, HCL, lymphocytosis
Incidence ofabnormalities compared
![Page 7: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/7.jpg)
Results
0 5 10 15 20 25 30 35
Abnormal: FISHalone detectable
Abnormal: Gbanding alone
detectable
Abnormal
Successful
Total
No. of cases
In an initial study (n=19) the abnormality rate was significantly different between stimulated and unstimulated cultures (p=0.033 in a paired t-test)
32
27
14
12
2
Eg. add(2q) del(14q) t(13;22;19) 6 x complex
3 cases of clinical significance
SR 85%
AR 52%
![Page 8: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/8.jpg)
Case 175 year old man referred for atypical CLL
Without G-banding
IGH-CCND1 FISH Negative FISH/MLPA for abnormalities prognostic in CLL
With G-banding
43,XY,der(6;13),-9,add(12)(q24),der(14)t(6;14)(p21;q32),der(15)t(8;15),-17,der(17)t(11;17),-20,+mar
der(14)t(6;14)
Rare abnormality in mature B cell neoplasms including mantle cell lymphoma
![Page 9: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/9.jpg)
t(6;14)(p21;q32) results in IGH-CCND3 rearrangement
Supported by FISH using BACs flanking IGH and CCND3
Confirmed IGH-CCND3 fusion positive using a commercial dual fusion probe
der(14)
ish der(14)t(6;14)(RP11-7K24+,RP11-47P23+)
DSP30/IL2 G-banding Clinically important abnormality identified
![Page 10: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/10.jpg)
t(2;7)(p11;q22)
Rare abnormality in matureB cell neoplasms including
splenic marginal zone lymphoma
Cases 2 and 376 year old man and 77 year old woman both referred for lymphocytosis, ?MCL
Without G-banding
IGH-CCND1 FISH Negative Not IGH-CCND1 positive MCL
With G-banding
45~46,XY,t(2;7)(p11;q22),der(8;9)(q10;q10),del(13)(q12q14),add(17)(p13),+mar[cp11]/46,XY[1]
![Page 11: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/11.jpg)
t(2;7) results in IGK-CDK6 rearrangement Supported by FISH using BACs flanking CDK6 and IGK
Involvement of IGK confirmed using an IGK break apart probe
der(2)
der(7)
ish t(2;7)(distal IGK+;proximal IGK+)
der(7)
der(2)
ish t(2;7)(RP11-998E13+,RP11-452G6+;RP11-344017+,RP11-160N14+)
![Page 12: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/12.jpg)
Other advantages of G-banding
Metaphases may help in the evaluation of borderline positivity after interphase FISH
In high grade lymphoma it is important to exclude ‘dual hits’, necessitating a sequence of interphase FISH
G-banding: may be a more efficient means of establishing MYC +/- BCL2 and BCL6 rearrangements
may identify the partner chromosome
confirm the ‘hits’ are in the same cell (not possible with interphase FISH in the case of small clones)
![Page 13: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/13.jpg)
0 5 10 15
Unstimulated only
Both stimulated andunstimulated
Stimulated only
Total abnormal cases
Abn
orm
aliti
es
in
No. of cases
14
9
3
2
Caveats
1.
Analyse stimulated and unstimulated cultures
2. Normal G banding; Abnormal FISH Still need FISH
![Page 14: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/14.jpg)
Questions
Does DSP30/IL2 select for abnormal clones in general or for particular abnormalities?
Is DSP30 / IL2 applicable to all mature B cell neoplasms?
Is DSP30 / IL2 applicable to high grade lymphomas?
![Page 15: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/15.jpg)
Possible strategy ?mature B cell neoplasm
Stimulated and unstimulated cell culture
Confirmed neoplastic cells in sample
Phenotype and morphology strongly suggestive of a sub-type with associated abnormality
FISH
Report / further FISH toexclude other abnormalities
G banding analysis
Yes
+ve
No
-ve
FISH with a largepanel of probes
Report +/-confirmatory FISH
abnormal normal / fail
Abnormalities sometimes restricted to unstimulated culturesMay be needed to establish unselected clone size
May be more time consuming than single G banding analysistherefore reserve this until G banding option exhausted
![Page 16: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/16.jpg)
Conclusions
G-banding allows detection of rare abnormalities;some may be of clinical significance
The usefulness of incorporation of G-banding into a FISH/phenotype/morphology strategy is dependent upon the frequency of theseabnormalities
DSP30/IL2 is an effective, non-toxic and inexpensive adjunct to unstimulated cultures
![Page 17: Use of the oligonucleotide DSP30 with IL2 in the investigation of low grade B cell lymphoid neoplasms Chris Lowe, Newcastle Cytogenetic abnormalities of](https://reader035.vdocuments.us/reader035/viewer/2022062619/55161387550346d46f8b635a/html5/thumbnails/17.jpg)
Acknowledgements
Dicker et al, Immunostimulatory oligonucleotide induced metaphase cytogenetics detect chromosomal aberrations in 80% of CLL patients: a study of 132 CLL cases with correlation to FISH IgVH status and CD38 expression Blood (2006) 108(9) :3152-3160
Haferlach et al, Comprehensive genetic characterization of CLL: a study on 506 cases analysed with chromosome banding analysis, interphase FISH, IgVH status and immunophenotyping Leukemia (2007) 21, 2442–2451
Hereema et al, Stimulation of chronic lymphocytic leukemia cells with CpG oligodeoxynucleotide gives consistent karyotypic results among laboratories: a CLL Research Consortium (CRC) Study Cancer genetics and cytogenetics (2010) 203, 134-140
Liang et al, Toll-like receptor 9 signaling by CpG-B olidodeoxynucleotides induces an apoptotic pathway in human chronic lymphocytic leukemia B cells Blood (2010) 115(24), 5041-5052
Mayr et al, Chromosomal translocations are associated with a poor prognosis in chronic lymphocytic leukemia Blood (2006) 107:742-751
Put et al, Improved detection of chromosomal abnormalities in chronic lymphocytic leukemia by conventional cytogenetics using CpG oligonucleotide and interleukin -2 stimulation: A Belgian multicentric study Genes, Chromosomes and Cancer (2009) 48, 843-853
Struski et al, Stimulation of B-cell lymphoproliferations with CpG-oligonucleotide DSP30 plus IL-2 is more effective than with TPA to detect clonal abnormalities Leukemia (2009) 23, 617–619
The Centre for Applied Genomics, Toronto (BACs)
Charlotte Morris
Gavin Cuthbert
Nick Bown
and the Cancer Section of the Newcastle Cytogenetics Laboratory
References