Enhanced immunoassay using a rotating paper platform for

quantitative determination of low abundance protein

biomarkers

Abootaleb Sedighi and Ulrich. J. Krull*

Department of Chemical and Physical Sciences, University of Toronto Mississauga, 3359

Mississauga Road, Mississauga, Ontario, Canada, L5L 1C6

Abstract:

The changing concentrations of circulating protein biomarkers have been correlated with a

variety of diseases. Quantitative bioassays capable of sensitive and specific determination of

protein biomarkers at low levels can be essential for therapeutic treatments that can improve

outcomes for patients. Herein, we describe the investigation of a rotating paper device (RPD) for

quantitative determination of targeted proteins at the fM concentration level. The RPD consists

of two circular papers each separately supported with a plastic disc. Protein detection is

conducted via enhanced immunoassay using amplification in a sequential workflow, which

includes a sandwich immunoassay in the upper paper and a signal amplification reaction in the

lower paper. The sandwich immunoassay is conducted using bio-barcode nanoparticles (BNPs)

and results in the release of reporter oligonucleotides from BNPs. These oligonucleotides are

transferred to the bottom paper, where they engage in a target recycling methodology that leads

to the production of a colorimetric signal. The assay was evaluated for quantitation of

Interleukin-6 (IL-6), a cytokine biomarker in serum. A limit of detection of 63 fM and a dynamic

range of 63 200 fM - 8 pM was observed for the assay. The specificity of the assay was

successfully verified against several common protein biomarkers.

1

1. Introduction:

Protein biomarkers play an important role in modern medicine.1 A large number of proteins have

been identified where abundance in bodily fluids (e.g. blood, urine, saliva, tears) is used as an

indication of the state of health of an individual.2,3 Sensitive and selective quantitative

determination of certain biomarkers allows for disease diagnostics, selection of therapeutic

treatments, and accurate monitoring of responses to such therapies.4,5 A challenge when

considering the use of such biomarkers in the clinic is the low levels of protein biomarkers in

bodily fluids, 6 which are to be measured in the presence of high levels of interfering proteins

(e.g. plasma proteins). The background matrix renders the assays susceptible to false positive

and false negative results, hence demanding highly sensitive and specific protein bioassays.7

The gold standard method for quantitative determination of protein biomarkers is the enzyme-

linked immunosorbent assay (ELISA), which provides for the high sensitivity and selectivity

required for protein biomarker determinations. ELISA relies on a multi-step workflow consisting

of multiple blocking and washing steps that enhance assay sensitivity and specificity by

minimizing nonspecific adsorption. This multi-step workflow causes ELISA to be a labor-

intensive and slow as a bioassay platform.8,9 Other common platforms with simpler workflows

that are used for protein detection are lateral flow immunoassays (LFIA),10,11 and paper-based

analytical devices (PAD). 12–15 These platforms take advantage of properties of paper substrates

such as facile fabrication, surface modification and flow transport using capillary action.16

However, paper-based devices are commonly used to achieve qualitative and semi-quantitative

bioassays rather than quantitative determinations. Also, the limit of detection (LOD) achieved in

PADs tend to be in the nM range while the biologically relevant levels of many protein

biomarkers are at the pM-fM range.17

Herein, we report an investigation of a solid-phase enzyme amplification scheme by means of a

rotating paper device (RPD) for quantitative determination of protein biomarkers at the pM-fM

2

range. RPD consists of two rotating circular papers each supported by a plastic disk (Figure 1).

Sandwich immunoassays using bio-barcode nanoparticles (BNPs) were conducted in the

immunoassay (IA) zones of the upper paper, while colorimetric detection was achieved using a

Foerster resonance energy transfer (FRET)-based signal amplification method in the bottom

paper. Several strategies were used to enhance the protein bioassay and enable reliable

quantification at low levels: (1) A BNP approach was coupled with a FRET-based signal

amplification strategy; (2) the surfaces of paper substrates and BNPs were passivated using

polyethylene glycol (PEG) layers to reduce nonspecific adsorption; (3) an internal calibration

method was used to improve accuracy and precision for quantitative assays. Inteleukin-6, an

important cytokine biomarker with meaningful diagnostic levels at pM-fM range for a variety of

diseases,18 was chosen as a model protein to evaluate the performance of the enzyme

amplification using the RPD system.

2. Experimental Section

2.1. Materials. An ELISA kit containing recombinant human IL-6 standard, anti IL-6

capture antibody, anti IL-6 detection antibody and blocking buffer (10% fetal bovine

serum in PBS) was from Thermo Fischer Scientific (San Diego, CA, USA). Exonuclease

III (EXO) and 10X CutSmart buffer were from New England Biolabs (Ipswich, MA, USA)

and used without further purification. Green-emitting CdSe/ZnS core/shell quantum dots

(PL at 518 nm) were from Cytodiagnostics (Burlington, ON, Canada). Diethylaminoethyl

(DEAE)-functionalized magnetic beads (MB, 1 μm) were from Bioclone Inc. (San Diego,

CA, USA). Hexahistidine-maleimide peptide sequences were from Canpeptide Inc.

(Montreal, QC, Canada). Prostate cancer antigen (PSA), EpCAM recombinant human

protein was from Thermo Fischer Scientific (Burlington, Canada). llustra NAP-5 size

exclusion chromatography columns were from GE Life Sciences (Quebec, Canada).

3

Recombinant Protein G was from Abcam (Ontario, Canada). Amicon Ultra-0.5

centrifugal filters were from Fisher Scientific (Ontario, Canada). Polyethylene glycols of

different sizes (800, 2k, and 5k Da), Whatman® cellulose chromatography papers

(Grade 1, CHR-1, 200 × 200 mm), sodium tetraborate, L-glutathione (GSH, reduced,

≥98%), avidin, DTT, tetramethylammonium hydroxide solution (TMAH, 25% w/w in

methanol), sodium (meta)periodate (NaIO4, ≥ 99%), 1-(3-aminopropyl)imidazole (API,

98%), gold nanoparticles of 15 and 40 nm in diameter, 4-(2-hydroxyethyl)piperazine-1-

ethanesulfonic acid (HEPES, ≥ 99.5%), sodium cyanoborohydride (NaCNBH3, 95%),

and albumin from bovine serum (BSA, ≥ 98%) were from Sigma Aldrich (Oakville, ON,

Canada). All buffer solutions were prepared using a water purification system (Milli-Q,

18 MΩ cm−1), and were autoclaved prior to use. The buffer solutions included 100 mM

tris-borate buffer (TB, pH 7.4), 50 mM borate buffer (BB, pH 7.4), and phosphate buffer

(PB, pH 7.4), borate buffer saline (BBS, borate buffer 5 mM, pH 9.2, 100 mM NaCl), and

phosphate buffer saline (PBS, 10 mM phosphate, 137 mM NaCl, 2.7 mM KCl, pH 7.4).

All oligonucleotides were from Integrated DNA Technologies (Coralville, IA, USA), and

are identified in Table S1.

Table 1. The oligonucleotide sequences

Name Sequence

MB 5'- /SH/-CTGAGCACAGTCCTCAGCGAAA -/Cy3/-3' R-oligo 5'- TTTCGCTGAGGACTGTTTTT -3'C-oligo 5'- /SH/ -AAA AAC AGT CCT CAG CGA AA -3'

4

2.2. Preparation of barcode nanoparticles (BNPs). Conjugation of oligonucleotides to the

surface of AuNPs of 15 and 40 nm diameter were done using the magnetic bead-loading (MBL)

method that wasa previously reported methodpreviously.19,20 In this method, the negatively-

charged nanoparticles and DNA oligonucleotides are electrostatically loaded on the surfaces of

the positively-charged magnetic beads. The accumulation of oligonucleotides in the vicinity of

nanoparticles at the magnetic bead surface lead to high density nanoparticle-DNA conjugates

within seconds.19,20 Briefly, 0.3 mg magnetic beads (MBs) were dispersed in 200 µL TBS buffer

(tris-borate 100 mM, 1 M NaCl, pH 7.4) in a 2-ml Eppendorf tube, vortexed and isolated using a

magnet. The procedure was repeated once again in TBS buffer and then twice in phosphate

buffer (PB, 10 mM, pH 7.4). 500 fmol of 15 nm AuNPs or 100 fmol of 40 nm AuNPs dispersed in

PB were added to the washed MBs in 100 µL PB and the tube was vortexed for 30 s. C-oligo

(600 pmol) was added and the tube was vortexed for 1 min. The MBs were isolated using a

magnet, then re-dispersed in 100 µL PBS. 600 pmol reporter oligonucleotide (R-oligo) was

added and the solution was agitated for 20 min. The MBs were isolated and washed in BBS

(borate buffered saline, 50 mM, 200 mM NaCl, pH 9.2) twice. To release NPs, MBs were

dispersed in elution buffer (borate buffer, 50 mM, 1M NaCl, pH 10), vortexed for 30 s and

isolated using a magnet. The supernatant containing oligonucleotide coated AuNPs (BNP-2)

was diluted 10 times in PBST (PBS plus 0.02% tween 20) and centrifuged. The centrifugation

was done at 7000 rpm for 5 min for AuNP-40 and at 13000 rpm for 15 min for AuNP-15. To

produce BNP-3, 500 ng protein G was added to BNP-2 in PBST. After 1 h incubation, BNP-3

was centrifuged and re-dispersed in PBST. BNP-4 was prepared by incubation of BNP-3 in 100

µL of IL-6 detection antibody solution for 60 min. Then, NPs were centrifuged and re-dispersed

in 100 µL PBST. The concentration of NPs was obtained using absorption spectroscopy.21 To

PEGylate NP surfaces, the BNP-4 was incubated in PBST solutions of PEG-thiol with molecular

weight of 800, 2k and 6k for 1 h. Finally, the NPs were purified twice by centrifugation, re-

dispersed in PBST and stored at 4 ˚C for later use.

5

24.3. Preparation of molecular beacon probes (MB). A 22-mer oligonucleotide that was

modified with Cy3 dye at the 3’-end and a thiol group at the 5’-end was the molecular beacon

(MB) probe. The thiol group was first reduced via 500× DTT in 1x PBS for 2 h. The unreacted

DTT was then removed by ethyl acetate extraction (4 times). The molecular beacon-

quantum dot conjugates (MB-QDs) were prepared using the magnetic bead loading (MBL)

method as described in the previous section. To prepare MB-QD probesBriefly, the MB

oligonucleotide was first functionalized with hexahistidine tags (H6) by incubation with 5 molar

equivalents of a maleimide functionalized peptide (Maleimide-G(Aib)GHHHHHH), for 24 h.

Unreacted peptide was removed by running the sample through two consecutive NAP-5

desalting columns.

Water-soluble glutathione-coated QDs (GSH-QD) were prepared using a previously reported

method.22 The immobilization MB probes on QD surfaces was done using the magnetic loading

method.19 Briefly, 5 pmol GSH-QD was added to 0.1 mg MB in 100 µL TBS buffer (Tris-borate

100 mM, pH 7.4) and the tube was agitated for 30 s. Then 50 pmol of H6-MB was added to the

solution and the tube was agitated for another 30 s. The MBs were isolated using a magnet and

re-dispersed in BBS. The MBs were again isolated using a magnet and re-dispersed in 50 uL

release buffer (borate buffer 50 mM, pH 10, with 1 M NaCl). The MBs were isolated again and

the concentration of the MB-QDs was determined using absorption spectroscopy.

2.4. Preparation of paper substrate. The upper and lower circular papers were prepared using

a method previously described by our group.23,24 Briefly, chromatography paper grade 1

substrates were patterned with wax using a Xerox ColorQube 8570DN solid ink printer. The

patterned circular paper sheets of 120 mm diameter were cut using a compass cutter. The

upper paper contained two alternating radial arrays of 8 by 3 circular zones of 5 mm diameter,

which included one array of immunoassay (IA) reaction zones and another array of holes that

allowed for addition of amplification mix to the lower paper. The lower paper contained two

6

radial arrays including one 8 by 3 array of 5 mm detection zones and another 8 by 3 array of 10

mm circular washing zones. The wax printed papers were subsequently incubated in an oven at

120 C for 2.5 min to melt and affix the wax. The upper and lower support discs were treated

with Repel Silane (Sigma Aldrich, Oakville, Canada), and the upper paper was then loaded on

the RPD. In order to activate the immunoassay zones for immobilization of capture antibody, the

cellulose surface was functionalized with aldehyde groups by two consecutive additions of 10 μL

of aqueous solutions of NaIO4 (50 mM) and LiCl (700 mM) followed by incubation of the paper at

50 C for 30 min.25 The paper was then washed with DI water and left to dry for 30 min. Capture

antibodies were immobilized on the IA zones by adding 10 μL of 4 μg/ml solutions with reaction

for 1 hour. To wash the IA zones, they were aligned on top of the washing zones (in the lower

paper) and the central spring was pushed down to place the two papers at a close distance (2

mm). 200 μL of wash solution (PBST) was gradually pipetted on the IA zones and allowed for

flow and absorption into the cotton packing underneath the washing zone paper. The spring was

released and the paper was allowed to dry in desiccator for 20 min. This washing procedure

was used in all subsequent steps of IA reactions. In order to passivate IA zones, 10 μL of

amine-functionalized PEG (MW 750 Da, 1 μg/mL) was added to the IA zones and the reaction

was allowed to proceed for 30 min. The IA zones were washed using the procedure described

above. This washing procedure was adopted throughout the enzyme amplification after each

step of the reactions.

In order to immobilize MB-QDs onto the amplification zones in the bottom paper, the paper

zones were modified with imidazole groups in two subsequent steps. First, the cellulose paper

was modified with aldehyde groups by 2 cycles of additions of aqueous solutions of NaIO4 (50

mM) and LiCl (700 mM) and incubation of the paper at 50 C for 30 min. Next, the papers were

functionalized with imidazole groups by spotting 10 μL of a solution containing API at 200 mM

and NaCNBH3 at 300 mM, in HEPES buffer pH 8. The reactions were allowed to proceed at

7

room temperature for 30 min. MB-QDs (300 nM,10 μL) were added to the signal amplification

zones and the reactions were allowed to proceed for 30 min. The papers were then rinsed with

BB and loaded on the RPD.

2.5. Enhanced immunoassay procedure. Different concentrations of IL-6 standards in PBS

were added to IA zones (10 µL/zone), and the reactions were allowed to proceed for 10 min.

The zones assigned to internal calibration standard including NC, LS, MS and HS were spotted

with solutions containing 0, 0.2, 2 and 8 pM of IL-6 standards in PBS, respectively. The IA

zones were washed once using the washing procedure described in the previous section. Next,

10 µL of BNP solutions (1 nM in PBS) was added to each zone and the reactions were allowed

to proceed for 20 min. Then, the IA zones were washed once using the optimized washing

procedure. The upper disc was rotated once to align the IA zones on top of the amplification

zones. To dehybridize release R-oligos (bound through DNA hybridization with C-oligos) and

release them from BNPs, 15 µL MilliQ water was added to each IA zone. After 10 min of

reaction time, the RPD was rotated to align IA zones on top of the amplification zones in the

lower paper and the central spring was pushed down to transfer the liquid to the detection zone.

Then, the upper disc was rotated for the second time to align the holes on top of the

amplification zones. Next, the immunoassay signal was amplified using a target recycling

strategy, called the EXO method, in which the released R-DNAs serve as the templates (See

section 3.5).26 3 µL of The amplification mix (3 µL) containing 15 unit/µL EXO and 5x CutSmart

buffer (250 mM potassium acetate, 100 mM tris-acetate, 50 mM magnesium acetate, 500 μg/ml

BSA, pH 7.9) was added to each amplification zone and the amplification reactions were

allowed to proceed for 30 min.

Digital color images from the bottom paper were acquired using an iPhone 7 (Apple, Cupertino,

CA, U.S.A.). Papers were illuminated at a distance of 20 cm with an ultraviolet (UV) lamp

(UVGL-58, LW/ SW, 6W The Science Company, Denver, CO, U.S.A.) operated at the long

8

wavelength (365 nm) setting. The digital images were split into corresponding R-G-B color

channels using ImageJ software and the amplification signal was quantified by ratiometric

analysis of each zone using equation 1:

Amplification (%)=( IGI R )S−( IGIR )NC

( IGI R )NC×100(1)

where IG and IR are the mean color intensity of green channel (G) and red channel (R) for a

given zone, respectively. The subscript S denotes a measurement made in the presence of the

analyte, while NC denotes the negative control.

3. Results and Discussion:

Figure 1: Schematic representation and photograph of the rotating paper device (RPD)

9

3.1. RPD design. The RPD consisted of two circular papers that were wax printed to create

zones of 5 mm diameter to constrain liquids. One circular paper was placed over the other, each

being supported by a plastic disc. The upper paper contained two series of 24 reaction zones of

5 mm diameter. One series of zones were used for immunoassay reactions (IA zones), and the

other series were punched to allow for pipetting the amplification mix into the lower paper. The

upper paper was supported by a 2 mm thick plastic disc containing 48 circular holes, each

aligned on one paper zone. The lower paper also contained two series of circular paper zones.

One series included 24 paper zones of 10 mm diameter that were used as the drain zones for

washing. The second series included 24 zones of 5 mm diameter intended as the signal

amplification zones. The lower paper was supported from the bottom by a 10 mm thick plastic

disc with an identical design to the lower paper. The 10 mm holes of the lower disc were filled

with cotton wadding to hold the wash solutions. The upper paper was positioned 10 mm above

the lower paper using a central spring. To transfer solutions from the upper to the lower paper

for washing and transfer of reporter oligonucleotides, the upper disc was pushed down to let the

solution drain into the lower zones by wicking action. To proceed from the immunoassay step to

the signal amplification step, the upper disk was rotated 22˚ to align the immunoassay zones

with the amplification zones.

10

Figure 2: Schematic representations of different steps of the assay including (A) preparation of

barcode nanoparticles (BNPs), (B) sandwich Immunoassay reaction, and (C) signal

amplification using the EXO method.

3.2. Barcode nanoparticle (BNP) design. Figure 2A shows different steps for the preparation

of BNPs that involve immobilization of different ligands on the surface of gold nanoparticles

(AuNPs). The two functional reagents are the detection antibodies (D-Abs) used in the sandwich

immunoassay reactions and the reporter oligonucleotides (R-Oligos) that serve as the template

in the exonuclease III DNA amplification (EXO) method. Both the antibodies and

11

oligonucleotides are immobilized onto AuNPs through auxiliary ligands that are directly

immobilized on the AuNP surfaces. R-Oligo is attached by hybridization with its complementary

immobilized strand (capture oligonucleotide, C-Oligo), and D-Ab is immobilized by interaction

with Protein G. Given the critical role of BNPs in the sensitivity and specificity of the enzyme

amplification method, surface immobilization strategies have been used that allow for adequate

control of the packing density and orientation of these reagents. An interfacial NP decoration

method using magnetic beads, called the magnetic bead loading (MBL) method,19 that we have

recently reported was used to immobilize capture oligonucleotides (C-oligos, BNP-1) and to

subsequently hybridize R-oligo to the surface of AuNPs (BNP-2). In addition to the rapid

immobilization kinetics, tThe MBL is method allowed for maximization of the packing density of

C-oligos, and hence maximizing the R-Oligo loading capacity of BNPs. The average loading of

R-Oligos on the AuNP surfaces as well as the fraction of those R-Oligos released upon

dispersion of NPs in deionized (DI) water were determined using previously reported methods.19

We have determined that the average loading was 94 ± 12 and 326 ± 29 R-oligos on the

surfaces of AuNPs of 15 nm and 40 nm diameter, respectively. It was determined that on

average, 34 ± 6 R-oligos from 15 nm AuNPs and 103 ± 13 R-Oligo from 40 nm AuNPs were

released upon dispersion of NPs in deionized (DI) water. In the MBL method, a portion of the

NP surface area is unavailable due to contact with the magnetic bead surfaces during the

process of oligonucleotide immobilization. This unreacted area becomes available for

conjugation after release of the nanoparticles from the surface of magnetic beads. According to

our previous results the fraction of the surface available for further conjugation is 18-30% of the

total surface area of the NPs.19 This available surface area was then used for immobilization of

D-Ab, which was conjugated via thiol-functionalized Protein G. This immobilization strategy

allowed for optimum surface orientation of D-Ab which was necessary to enhance its antigen

binding efficiency.27

12

A sandwich immunoassay reaction was developed for detection of IL-6, which was localized in

the immunoassay reaction zones (Figure 2B). First, the capture antibody (C-Ab) was

immobilized on aldehyde-modified paper substrates of the IA zones. Then, the solid-phase

immunoassay was conducted by sequential addition of IL-6 sample solutions and BNP solutions

to the IA zones. Finally, the R-oligos were released from BNPs by the addition of deionized (DI)

water to the IA zones. A particular feature of the RPD is the washing procedure, which offers

simplicity, speed and maintains the selectivity of the assay. In the assembled device, each IA

zone associated with the upper paper was aligned with a circular 10 mm diameter drain zone in

the lower paper. To wash an immunoassay zone the upper plastic disc was pressed against the

lower disc, forcing contact between the upper and lower papers, allowing for the continuous

drainage of the wash buffer into the drain zone. Wash buffer (20 times the reaction volume) was

then added to the IA zone. The drain zones of the lower disc were packed with cotton to

facilitate the movement of the wash buffer via wicking action. In a single wash step, this

dynamic wash procedure adequately eliminated interference that would arise from nonspecific

adsorption (See Figure S1), presenting an advantage over conventional ELISA methods as the

latter typically requires multiple washing steps.

3.3. PEGylation. The prevention of nonspecific adsorption of BNPs onto the paper matrix of the

IA zone is a crucial factor for assay specificity. Therefore, surface modification of both the paper

substrates of the IA zones and the BNPs was implemented to suppress nonspecific interactions.

Polyethylene glycol and bovine serum albumin (BSA) are the most common passivation agents

used to reduce nonspecific adsorption onto the surfaces of biosensors and nanoparticles.28–30

The surfaces of BNPs were passivated using BSA, or by polyethylene glycol methyl ether

(mPEG) using polymer of 0.8, 2 or 6 kDa size. The IA zones were passivated either by physical

adsorption of BSA or by covalent immobilization of methoxy-PEG-amine (mPEG 750, MW 750

Da) following the immobilization of capture antibody. In order to assess the nonspecific

13

adsorption of BNPs onto the paper, BNPs were added to the IA zones in the absence of IL-6

(i.e. negative control solution). After washing, the R-oligos were released from residual BNPs

and were analysed using gel electrophoresis. The gel electrophoresis results in Figure 3A

indicate significant adsorption of non-passivated BNPs (BNP-4) regardless of the modification

on the paper surface. The intensity of the R-oligo bands seen in the gel images were reduced

when BNPs were modified with BSA and 0.8 kDa PEG (PEG-800), and complete suppression of

the band was achieved when BNPs were coated with PEG of 2 or 6 kDa size (PEG-2k, PEG-6k)

and the IA zones were coated with mPEG 750. In another approach, colorimetric quantification

of BNPs was used to determine nonspecific adsorption and to verify the findings derived from

gel electrophoresis. Figure 4A and 4B show the colorimetric signals obtained from IA reactions

on mPEG 750-modified IA zones where sample solutions were the negative control or contained

5 nM IL-6. When BNP-4 or BNP-5 PEG-800 were used, significant signals were observed on

the negative control (NC) zones. Use of BNP-5 PEG-2k and BNP-5 PEG-6k resulted in

complete suppression of the colorimetric signal. These results are consistent with the gel

electrophoresis analysis of the released R-Oligos indicating that a complete suppression of

nonspecific adsorption is only achieved when BNPs were passivated with the larger PEGs

(Figure 3A). The compromise was that the BNP-5 PEG-2k and BNP-5 PEG-6k resulted in a

23% and 52% reduction in signal, respectively, in comparison to unmodified BNP-5, indicating

that the immunoassay sensitivity was reduced by the presence and the size of the PEG

polymers. The differences in specificities and sensitivities induced when BNPs were coated with

PEGs of different sizes may be attributed to thickness of PEG layer relative to the size of other

ligands on the NP surfaces. The thickness of PEG coating increased with the molecular size of

the PEG molecules as well as with the NP surface density (i.e. cumulative density of all the

ligands on the NP surface). For example, Abou-Saleh et al. reported that the thickness of a

PEG-2k layer on NP surfaces ranged from 2.7 nm in a mushroom conformation to 6.9 nm in a

dense brush conformation.31 In comparison, the thickness of PEG-5k was reported to be in the

14

range of 5.5-20 nm at different surface densities.32 Dynamic light scatter (DLS) data showed that

the hydrodynamic diameter (dh) of BNPs significantly increased upon passivation by PEG-2k

and PEG-6k but not when PEG-800 was coated on the surface. This suggested that only the

larger PEGs created a sufficiently thick layer to block the non-specific binding sites on BNP

surfaces located at the IA zones. It is clear that a sufficiently thick PEG layer will also block

some of the surface-immobilized antibody preventing the binding between the antibody and IL-

6. These results suggest that there will be an optimal PEG polymer size to maximize sensitivity

and specificity, and for the BNPs in this study the optimal selection was 2 kDa PEG.

15

Figure 3: Investigation of the nonspecific adsorption of BNPs on paper substrates. A Gel

electrophoresis data indicates the released R-oligos from C-Ab functionalized immunoassay

zones after addition of different BNPs and subsequent washing. B and C show the gel

electrophoresis and hydrodynamic diameter of BNPs after addition of different ligands,

respectively. D Schematic shows the relative sizes of PEG compared to other ligands on NP

surfaces (only approximate scales). The abbreviations represent AuNPs after sequential

conjugation of C-oligo (BNP-1), R-oligo (BNP-2), protein G (BNP-3), D-Ab (BNP-4) and

subsequent modification with different blocking agents including BSA (BNP-5 BSA) and thiol-

PEGs with molecular weights of 800 Da (BNP-5 PEG-800), 2 kDa (BNP-5 PEG-2k) and 6 kDa

(BNP-5 PEG-6k).

16

Figure 4. The effect of PEGylation on the nonspecific adsorption of BNPs in the IA zones. A and

B show the optical image and the corresponding histogram bar graph of the immunoassay

reactions with BNPs passivated with different PEG layers. Reactions in rows 1-4 and rows 5-8

were done using 0 and 5 nM of IL-6 solutions. Different BNPs used were BNP-4 (1, 5), BNP-5

PEG-800 (2, 6), BNP-5 PEG-2k (3, 7), and BNP-5 PEG-6k (4, 8).

3.4 .Influence of AuNP size. The effect of AuNP size was investigated by studying the kinetics

and sensitivity of IA reactions when BNPs were prepared using AuNPs of 15 and 40 nm

17

diameter. Figure 5A shows the time-based colorimetric IA signals obtained for the IL-6 binding

step (Step 4 in Fig. 2B) and the subsequent BNP addition step (Step 6 in Fig. 2B) as the

reactions were allowed to proceed for 2-60 min. The results in Figure 5A show that the IA signal

reached a plateau when IL-6 was allowed to react with a zone coated with C-Ab for ~10 min.

This relatively rapid reaction33 is attributed to the fast mass transport in the paper matrix

facilitated by capillary action. A comparison of time-based signal evolution from BNPs prepared

using AuNPs of 15 nm and 40 nm diameters (Figure 5B) shows that the reaction kinetics

decrease with AuNP size, which was expected considering the slower mass transport of the

larger nanoparticles. In addition to faster kinetics, the smaller AuNPs also provided for a higher

sensitivity. Figure 5C shows the signals obtained from the gel electrophoresis analysis of R-

DNAs released from the reaction zones. The results show more than a 2-fold increased signal

when 15 nm AuNPs were used as compared to 40 nm AuNPs for the IA analysis. It was

reported already that a smaller number of R-oligos are released from each 15 nm BNP as

compared to the larger 40 nm BNPs (Section 3.2). Therefore, this observation of higher total

released R-DNA obtained from the 15 nm BNPs indicates the higher efficacy of binding between

15 nm BNP and the captured IL-6, resulting in a higher overall signal intensity. Thus, 15 nm

AuNPs were selected for preparation of BNPs and used in the optimized enhanced

immunoassay reaction.

18

0

Figure 5. (A) and (B) Time-based colorimetric immunoassay signals obtained from IA zones

where the IL-6 (A) and BNP solutions (B) were allowed to react for 2-60 min. (C) The

normalised signal from gel electrophoresis analysis of the R-oligos released from BNP prepared

from AuNPs of 15 and 40 nm in diameter. A sample solution containing 5 nM IL-6 was used in

all experiments.

3.5. Colorimetric detection using exonuclease-assisted amplification (EXO). Signal

amplification and colorimetric detection were done using an exonuclease III target recycling

approach (EXO method) that we have recently reported for paper substrates.26 Here, the R-

19

oligos released from the BNPs were transferred to the detection zones in the lower paper where

they hybridized to a molecular beacon probe (MB, Table 1). The MB operated by FRET and

possessed a green-emitting quantum dot donor (gQD) at the 5’-end and a Cy3 acceptor dye at

the 3’-end (Figure 1C). Upon hybridization of the probe to R-oligo, the EXO enzyme initiated to

remove nucleotides from the 3’-end of the probe strand, resulting in the release of Cy3-dye and

a reduction in the FRET signal. Colorimetric detection was conducted by irradiating the lower

paper with UV light and capturing an image using a cellphone camera. The changes in red-to-

green intensity ratio in RGB images (see experimental section), which indicated the changes in

the FRET signal, were correlated with R-oligo concentration. The curve shown in Figure S2 was

obtained from the amplification of R-oligos of 1-5000 pM using the EXO method. The curve

shows that the amplification signal linearly increased with the R-DNA concentration across the

range of 20 - 1000 pM.

3.6. IL-6 quantification using an internal calibration method. In order to conduct a complete

assay, R-oligos released from immunoreaction zones were transferred into the detection zones

where they were detected and quantified by the EXO method. An external calibration method

was based on a calibration curve prepared using standards added to one paper with the linear

response equation being used to quantify samples tested on different papers. For internal

calibration, both the standards and samples were determined using a single paper.

An external calibration method showed that the EXO response linearly increased with IL-6

concentration in the range of 0.2 - 8 pM (Figure S46). However, the quantification was limited by

the experimental variability as the range of RSD% for the replicates within one paper were

<15% while the RSD% from multiple papers were 33-79%. To address this challenge, an

internal calibration system for the assays was designed which allowed for quantification using 4

sets of standards that were concurrently analysed with samples. These standards included a

negative control (NC), and three calibration solutions containing IL-6 concentrations of 0.2 (LS,

20

low sensitivity), 2 (MS, medium), and 8 (HS, high) pM representing the dynamic range for IL-6.

Figure 6A 7A and 6B 7B present green and red channel images, respectively, of the lower

paper that includes the results from the four sets of calibration standards as well as the four IL-6

samples. A 3-point calibration curve was created and used to determine the concentrations of

IL-6 in the samples (Figure 6C7C). The recovery using spiked samples and the RSD% were

evaluated to represent accuracy and precision of the assay, respectively. The results in Figure

6D 7D show recoveries of 85-116% and RSD of 7-14% for the method. The limit of detection

(LOD) of the method was calculated to be 63 fM using 3 standard deviations of the background

as the statistical criterion. The robustness was verified by conducting the assay in goat serum

(95% v/v), which resulted in an assay response that was within the experimental error of the one

conducted in PBS buffer (Figure 6E7E). To evaluate the specificity of the assay, IL-6 was

replaced with various proteins including BSA, prostate specific antigen (PSA), avidin, and

epithelial cell adhesion molecule (EpCAM). The minimal signals obtained for all proteins other

than IL-6 support the specificity of the assay.

21

Figure 6. The external calibration curve prepared for determination of IL-6 using enhanced immunoassay in the RPD. (A) shows the entire range of IL-6 concentration (1 fM – 100 pM) that was investigates, and (B) shows the linear range at 0.2 – 8 pM. (C) shows the assay recoveries (Recovery%) and RSD% for four different quality control samples. The recovery% was

calculated using as the following equation: Recovery%= determined conc .actual concentration

×100.The

samples were tested in triplicate using three different papers.

Figure 67. Quantitative determination of IL-6. A & B show the green (QD) and red (Cy3)

channels of the optical images from the lower paper of the RPD. The signals were obtained

22

from 4 sets of calibration standards including negative control (NC), and standard solutions

containing 0.2, 2, and 8 pM of IL-6 as well as 4 IL-6 sample solutions. (C) shows a 3-point

internal calibration curve prepared using signal intensities of the standard solutions. (D)

Recovery % and RSD % values for four IL-6 samples at different point of dynamic range. The

recovery% was calculated using as the following equation: ❑❑(E) assay signals when 1 pM IL-6

was in PBS and goat serum solutions or when 10 pM of other proteins were dissolved in PBS in

absence of IL-6.

4. Conclusion

A rotating paper device has been investigated for quantification of protein biomarkers at the fM

level using an immunoassay method with subsequent amplification. Several strategies were

combined to enable accurate and precise quantification of protein biomarkers at low

concentration levels. A bio-barcode method was coupled to a signal amplification approach to

enhance sensitivity. Paper substrates and barcode nanoparticle surfaces were passivated with

PEG layers to suppress nonspecific adsorption. An internal calibration approach was used to

enhance reproducibility and accuracy.

A number of novel immunoassay-based technologies have recently been developed that aim to

provide an improvement in simplicity and speed over ELISA while maintaining the same level of

LOD and multiplexing capabilities. Table 1 provides a summary of some of these technologies.

A comparison of different qualities show that tThe RPD offers simplicity and speed fits well

within the list of these successful attempts. While the method provides a significant reduction in

the analysis time and the number of steps, a moderate simplicity remains the primary limitation

of the device. of the paper-based analytical devices, while the analytical figures of merit and the

multiplexing capabilities are competitive with ELISA methods. The performance of the device for

23

real clinical samples needs to be verified, however, the device presents qualities that suggest

promise for quantitative determination of low abundance protein biomarkers.

Table 1. Examples of recently developed methods for detection of IL-6

Protein LOD (fM)

Analysis Time1

Simplicity2

Multiplexing capability

ELISA34 IL-6 42 3h – 2 days

Complex High

Bio-barcode assay35 Multiple cytokines

5 8-10 h Complex High

~D4 Assay36 IL-6 265 ~2 h Simple HighPhotoelectrochemical

immunoassay37

IL-6 0.0013 >1h moderate low

Digital microfluidic assay38 IL-6 50,000 ~90 min moderate highMicrofluidic biochip

platform39

IL-6 5,200 ~5 min moderate low

RPD IL-6 63 ~2 h moderate high1 The assay times were estimated based on the reported protocols.2 The simplicity was evaluated based on the number / complexity of steps in analysis, detection instruments, and complexity of data analysis.

5. Acknowledgements

We are grateful to the Natural Sciences and Engineering Research Council of Canada for

financial support of this work (Grants STPGP 479222-15; RGPIN-2014–04121).

6. References:

(1) Rifai, N.; Gillette, M. A.; Carr, S. A. Protein Biomarker Discovery and Validation: The

24

Long and Uncertain Path to Clinical Utility. Nat. Biotechnol. 2006, 24 (8), 971–983.

(2) Goossens, N.; Nakagawa, S.; Sun, X.; Hoshida, Y. Cancer Biomarker Discovery and

Validation. Transl Cancer Res. 2015, 4 (3), 256–269.

(3) Das, P.; Sedighi, A.; Krull, U. J. Analytica Chimica Acta Cancer Biomarker Determination

by Resonance Energy Transfer Using Functional Fl Uorescent Nanoprobes. Anal. Chim.

Acta 2018, 1041, 1–24.

(4) Hanash, S. M.; Pitteri, S. J.; Faca, V. M. Mining the Plasma Proteome for Cancer

Biomarkers. Nature 2008, 452 (7187), 571–579.

(5) Chinen, A. B.; Guan, C. M.; Ferrer, J. R.; Barnaby, S. N.; Merkel, T. J.; Mirkin, C. A.

Nanoparticle Probes for the Detection of Cancer Biomarkers, Cells, and Tissues by

Fluorescence. Chem. Rev. 2015, 115 (19), 10530–10574.

(6) Füzéry, A. K.; Levin, J.; Chan, M. M.; Chan, D. W. Translation of Proteomic Biomarkers

into FDA Approved Cancer Diagnostics: Issues and Challenges. Clin. Proteomics 2013,

10 (1), 1.

(7) Surinova, S.; Schiess, R.; Hu, R.; Cerciello, F. On the Development of Plasma Protein

Biomarkers. 2011, 5–16.

(8) Pei, X.; Zhang, B.; Tang, J.; Liu, B.; Lai, W.; Tang, D. Analytica Chimica Acta Sandwich-

Type Immunosensors and Immunoassays Exploiting Nanostructure Labels : A Review.

Anal. Chim. Acta 2013, 758, 1–18.

(9) Li, L.; Guo, W.; Lin, Y.; Tang, D. Analytical Methods Facile and Feasible Conductometric

Immunoanalytical Assay for Alpha-Fetoprotein Using Platinum-Functionalized Graphitic

Carbon Nitride. 2018, 4886–4893.

(10) Gao, Z.; Ye, H.; Tang, D.; Tao, J.; Habibi, S.; Minerick, A.; Tang, D.; Xia, X. Platinum-

25

Decorated Gold Nanoparticles with Dual Functionalities for Ultrasensitive Colorimetric in

Vitro Diagnostics. 2017.

(11) Parolo, C.; de la Escosura-Muñiz, A.; Merkoçi, A. Enhanced Lateral Flow Immunoassay

Using Gold Nanoparticles Loaded with Enzymes. Biosens. Bioelectron. 2013, 40 (1),

412–416.

(12) Qiu, Z.; Shu, J.; Tang, D. Bioresponsive Release System for Visual Fluorescence

Detection of Carcinoembryonic Antigen from Mesoporous Silica Nanocontainers

Mediated Optical Color on Quantum Dot-Enzyme-Impregnated Paper. 2017.

(13) Lv, S.; Tang, Y.; Zhang, K.; Tang, D. Wet NH3-Triggered NH2-MIL-125(Ti) Structural

Switch for Visible Fluorescence Immunoassay Impregnated on Paper. Anal. Chem. 2018,

90, 14121–14125.

(14) Han, K. N.; Choi, J. S.; Kwon, J. Three-Dimensional Paper-Based Slip Device for One-

Step Point-of-Care Testing. Sci. Rep. 2016, 6 (April), 1–7.

(15) Ge, L.; Wang, S.; Song, X.; Ge, S.; Yu, J. 3D Origami-Based Multifunction-Integrated

Immunodevice: Low-Cost and Multiplexed Sandwich Chemiluminescence Immunoassay

on Microfluidic Paper-Based Analytical Device. Lab Chip 2012, 12 (17), 3150.

(16) Xia, Y.; Si, J.; Li, Z. Fabrication Techniques for Microfluidic Paper-Based Analytical

Devices and Their Applications for Biological Testing: A Review. Biosens. Bioelectron.

2016, 77, 774–789.

(17) Posthuma-Trumpie, G. A.; Korf, J.; Van Amerongen, A. Lateral Flow (Immuno)Assay: Its

Strengths, Weaknesses, Opportunities and Threats. A Literature Survey. Anal. Bioanal.

Chem. 2009, 393 (2), 569–582.

(18) Monastero, R. N.; Pentyala, S. Cytokines as Biomarkers and Their Respective Clinical

26

Cutoff Levels. Int. J. Inflam. 2017, 2017.

(19) Sedighi, A.; Krull, U. J. Rapid Immobilization of Oligonucleotides at High Density on

Semiconductor Quantum Dots and Gold Nanoparticles. Langmuir 2016, 32 (50), 13500–

13509.

(20) Nguyen, T. H.; Chen, X.; Sedighi, A.; Krull, U. J.; Ren, C. L. A Droplet-Based Microfluidic

Platform for Rapid Immobilization of Quantum Dots on Individual Magnetic Microbeads.

Microfluid. Nanofluidics 2018, 22 (6), 1–11.

(21) Liu, X.; Atwater, M.; Wang, J.; Huo, Q. Extinction Coefficient of Gold Nanoparticles with

Different Sizes and Different Capping Ligands. 2007, 58, 3–7.

(22) Han, Y.; Noor, M. O.; Sedighi, A.; Uddayasankar, U.; Doughan, S.; Krull, U. J. Inorganic

Nanoparticles as Donors in Resonance Energy Transfer for Solid-Phase Bioassays and

Biosensors. Langmuir 2017, 33 (45), 12839–12858.

(23) Noor, M. O.; Krull, U. J. Paper-Based Solid-Phase Multiplexed Nucleic Acid Hybridization

Assay with Tunable Dynamic Range Using Immobilized Quantum Dots as Donors in

Fluorescence Resonance Energy Transfer. Anal. Chem. 2013.

(24) Noor, M. O.; Krull, U. J. Camera-Based Ratiometric Fluorescence Transduction of

Nucleic Acid Hybridization with Reagentless Signal Amplification on a Paper-Based

Platform Using Immobilized Quantum Dots as Donors. Anal. Chem. 2014, 86 (20),

10331–10339.

(25) Noor, M. O.; Shahmuradyan, A.; Krull, U. J. Paper-Based Solid-Phase Nucleic Acid

Hybridization Assay Using Immobilized Quantum Dots as Donors in Fluorescence

Resonance Energy Transfer. 2013.

(26) Sedighi, A.; Krull, U. J. Enzymatic Amplification of Oligonucleotides in Paper Substrates.

27

Talanta 2018, 186 (February), 568–575.

(27) Elshafey, R.; Tavares, A. C.; Siaj, M.; Zourob, M. Electrochemical Impedance

Immunosensor Based on Gold Nanoparticles-Protein G for the Detection of Cancer

Marker Epidermal Growth Factor Receptor in Human Plasma and Brain Tissue. Biosens.

Bioelectron. 2013, 50, 143–149.

(28) Zang, D.; Ge, L.; Yan, M.; Song, X.; Yu, J. Electrochemical Immunoassay on a 3D

Microfluidic Paper-Based Device. Chem. Commun. 2012, 48 (39), 4683.

(29) Lin, P. C.; Chou, P. H.; Chen, S. H.; Liao, H. K.; Wang, K. Y.; Chen, Y. J.; Lin, C. C.

Ethylene Glycol-Protected Magnetic Nanoparticles for a Multiplexed Immunoassay in

Human Plasma. Small 2006, 2 (4), 485–489.

(30) Sun, C.; Miao, J.; Yan, J.; Yang, K.; Mao, C.; Ju, J.; Shen, J. Applications of

Antibiofouling PEG-Coating in Electrochemical Biosensors for Determination of Glucose

in Whole Blood. Electrochim. Acta 2013, 89, 549–554.

(31) Abou-Saleh, R. H.; Swain, M.; Evans, S. D.; Thomson, N. H. Poly(Ethylene Glycol) Lipid-

Shelled Microbubbles: Abundance, Stability, and Mechanical Properties. Langmuir 2014,

30 (19), 5557–5563.

(32) Perry, J. L.; Reuter, K. G.; Kai, M. P.; Herlihy, K. P.; Jones, S. W.; Luft, J. C.; Napier, M.;

Bear, J. E.; Desimone, J. M. PEGylated PRINT Nanoparticles: The Impact of PEG

Density on Protein Binding, Macrophage Association, Biodistribution, and

Pharmacokinetics. Nano Lett. 2012, 12 (10), 5304–5310.

(33) Guo, H.; Zhou, X.; Zhang, Y.; Gu, C.; Song, B.; Shi, H. RSC Advances Interaction

Performed by Planar Waveguide Fl Uorescence Immunosensor †. 2016, 13837–13845.

(34) Kit, H. I.-E. Human IL-6 ELISA Kit.

28

(35) Li, W.; Jiang, W.; Dai, S.; Wang, L. Multiplexed Detection of Cytokines Based on Dual

Bar-Code Strategy and Single-Molecule Counting. 2016.

(36) Joh, D. Y.; Hucknall, A. M.; Wei, Q.; Mason, K. A.; Lund, M. L.; Fontes, C. M.; Hill, R. T.;

Blair, R.; Zimmers, Z.; Achar, R. K.; et al. Inkjet-Printed Point-of-Care Immunoassay on a

Nanoscale Polymer Brush Enables Subpicomolar Detection of Analytes in Blood. 2017,

114 (39).

(37) Liu, X.; Xie, X.; Wei, Y.; Mao, C.; Chen, J.; Niu, H.; Song, J. Photoelectrochemical

Immunoassay for Human Interleukin 6 Based on the Use of Perovskite-Type LaFeO 3

Nanoparticles on Fluorine-Doped Tin Oxide Glass. 2018.

(38) Mok, J.; Mindrinos, M. N.; Davis, R. W.; Javanmard, M. Digital Microfluidic Assay for

Protein Detection. 2013, 2013.

(39) Valera, E.; Berger, J.; Hassan, U.; Ghonge, T.; Liu, J.; Rappleye, M.; Winter, J.; Abboud,

D.; Haidry, Z.; Healey, R.; et al. Lab on a Chip Quantification of Proteins †. 2018, 1461–

1470.

29