university of nova gorica graduate schoollibrary/doktorati/genetika/13safini.pdfuniversity of nova...
TRANSCRIPT
UNIVERSITY OF NOVA GORICA GRADUATE SCHOOL
R O L E O F A U T OPH A G Y A ND I TS E N H A N C IN G IN T H E C L E A R A N C E O F T DP-43 A G G R E G A T ES
DISSERTATION
Najete Safini
Mentor: Dr.Sergio G. Tisminetzky
Nova Gorica, 2014
UNIVERZA V NOVI GORICI
FAKULTETA ZA PODIPLOMSKI !TUDIJ
VLOGA AVTOFAGIJE IN NJEN VPLIV NA IZBOLJ!ANJE
"I!"ENJA AGREGATOV TDP-43
DISERTACIJA
Najete Safini
Mentor: dr. Sergio G. Tisminetzky
Nova Gorica, 2014
2
A BST R A C T
Neurodegenerative diseases, such as Amyotrophic Lateral Sclerosis (ALS) and
Fronto-Temporal Lobar Degeneration (FTLD), are characterized by imbalance
between generation and degradation of misfolded TDP-43 protein, resulting in the
formation of cytoplasmic inclusions followed by a loss of nuclear TDP-43 in affected
neuronal cells. Previously established cell-based TDP-43 aggregation model, where
tandem repeats carrying the C-terminal Gln/Asn-rich region of TDP-43 (EGFP-
12XQ/N) were able to trigger the formation of phosphorylated and ubiquitinated
aggregates, have been used in this study to investigate the autophagy-endolysosomal
cell pathway response. Cotransfection with EGFP-12xQ/N and HcRed-hLC3 (LC3
Light chain 3is marker of autophagosome and autophagy induction), immunostaining
with anti-p62 (p62 is an autophagy adaptor) and anti-Lamp1 (Lamp1 is marker of
late endosome/lysosome marker) show that EGFP-12xQ/N is able to generate
cytoplasmic aggregates that have the ability to induce an autophagy-endolysosomal
pathway cell response. Observed autophagic response incidence in EGFP-12XQ/N
aggregates led us to try Dextran Sulfate 5000 Da (DS), previously associated with
the autophagy induction, as a therapeutic effector aimed at reducing the aggregation
phenomenon. We found that DS treatment enhances inclusions clearance and
significantly increase the proportion of the LC3-positive aggregates, suggesting an
improved autophagic response of the cell. In addition, it was shown that DS
decreases the amount of flag-TDP43 wild type in the insoluble fraction suggesting its
release from the aggregates sequestration. Observed DS-triggered clearance is in
correlation with the increased LC3-II/LC3-I ratio, as well as with the significant p62
decay in the treated cells. It has been demonstrated that DS-induced EGFP-12xQ/N
clearance was abolished in an autophagy-deficient cells confirming DS clearing
potential through the autophagy pathway activation. Furthermore, we have identified
the histone deacetylase-6 (HDAC6), as an important player of DS clearance action.
Indeed, DS treatment failed to clear EGFP-12xQ/N in the HDAC6 deficient cells,
while by re-introducing HDAC6 wild type protein DS-triggered clearance has been
restored. Moreover, it has been demonstrated that DS-induced EGFP-12xQ/N
product decay requires catalytically active HDAC6.
Our study suggests that DS may help the cell to clear TDP-43 aggregates, in this
model, through the autophagy resulting in the more efficient cargo degradation in
3
HDAC6-dependent manner, thus revealing DS therapeutic potential in TDP-43
proteinopathies.
K eywords: Dextran sulfate (DS), Autophagy, TDP-43 proteinopathies, Amyotrophic Lateral
Sclerosis (ALS) and Frontotemporal Lobar Degeneration (FTLD).
4
Izvleček
Nevrodegenerativna obolenja, kot so amiotrofična lateralna skleroza (ALS) in
frontotemporalna lobarna degeneracija (FTLD), so posledica neravnovesja med
tvorbo in degradacijo nepravilno zvitega TDP-43 proteina, kar vodi do kopičenja
TDP-43 v citoplazmi v obliki vključkov in izgube v jedrih prizadetih nevronskih
celic. V raziskavah sem za študij odgovora avtofagne-endolizosomalne celične poti
uporabila predhodno uveljavljen celični model tvorbe agregatov TDP-43, kjer
tandemske ponovitve vključujejo C-terminalno Gln/Asn-bogato regijo proteina TDP-
43 (EGFP-12XQ/N) in povzročijo tvorbo fosforiliranih in ubikvitiniranih agregatov.
Sočasna transfekcija EGFP-12xQ/N in HcRed-hLC3 ter imunooznačevanje s
protitelesi proti p62 in Lamp1 so pokazali, da je model EGFP-12xQ/N zmožen
tvorbe agregatov v citoplazmi, kar lahko sprožiavtofagno-endolizosomalni celični
odgovor. Zaradi opaženega avtofagnega odgovora v agregatih EGFP-12XQ/N smo
preverjali možen terapevtski vpliv dekstran sulfata 5000 Da (DS), ki je bil predhodno
povezan s pojavom avtofagije in za katerega smo predpostavljali, da lahko zmanjša
proces agregacije. Ugotovili smo, da tretiranje z DS povzroži degradacijo vključkov
in signifikantno poveča delež LC3-pozitivnih agregatov, kar nakazuje na izboljšan
avtofagni odgovor celic. V nadaljevanju smo pokazali, da DS zmanjša količino
proteinov flag-TDP43 divjega tipa v netopni frakciji, z možnim vzrokom sprostitve
le-teh iz nastajajočih agregatov. Ugotovili smo, da je opaženo zmanjšanje agregatov
zaradi aktivnosti DS v povezavi s povečanim razmerjem LC3-II/LC3-I ter
signifikantnim zmanjšanjem p62 v tretiranih celicah. Prav tako smo pokazali, da z
DS-inducirana degradacija agregatov ni prisotna v celicah nezmožnih avtofagije, kar
je potrdilo velik potencial DS pri zmanjšanju agregatov in aktivaciji avtofagne poti.
V nadaljevanju smo kot pomemben člen pri degradaciji vključkov z DS določili
histonsko deacetilazo 6 (HDAC6). Tretiranje z DS ni povzročilo izgube EGFP-
12xQ/N v celicah brez HDAC6 in ponovno izražanje proteina divjega tipa HDAC6
je povrnilo degradacijo vključkov z DS. Pokazali smo, da je za tovrstno aktivnost
potreben katalitično aktiven HDAC6.
Naše raziskave nakazujejo, da lahko DS pomembno pripomore pri uničenju
agregatov TDP-43. V predstavljenem modelu preko avtofagije povzroči učinkovito
5
degradacijo, odvisno od aktivnosti HDAC6, kar predstavlja pomemben terapevstki
potencial DS pri TDP-43 proteinopatijah.
Ključne besede: dekstran sulfat (DS), avtofagija, TDP-43 proteinopatije, amiotrofična lateralna
skleroza (ALS) in frontotemporalna lobarna degeneracija (FTLD).
6
A C K N O W L E D G M E N TS
I would like to express my gratitude to my Thesis mentor, Dr. Sergio Tisminetzky,
for allowing me to work on this project in his lab and for his great supervision and
support throughout my PhD experience.
A very special thank go out to Dr. Natasa Skoko, for her understanding, and
patience. I appreciate her vast knowledge and skill in many areas, and her close
assistance on the bench and also in writing reports (i.e., proposals, and this
thesis),which without her this work would have never happened.
Prof. Francesco Baralle, and Dr. Marco Baralle for allowing me the opportunity to
use their aggregation model (EGFP-12xQ/N construct), and for their very helpful
discussions and suggestions.
The members of the commity for reading carefully this thesis and offering their
precious time to make my dissertation better. I really appreciate the time you have
taken to evaluate this work.
I am deeply grateful to all the current biotechnology development group members for
their encouragement, support, and help.
I would like to thank Mojca Tajnik for the translation of my abstract to Slovinien,
Thank you so much (hvala).
Thanks to Dr. Maurizio Budini for the pEGFP-12xQ/N construct, for Dr. Francesca
Arnoldi for the siATG7, for Dr Francesca DeMarchi and Dr Isei Tanida for the
HcRed-LC3 plasmid.
I would like to extend my acknowledgments to all wonderful people and friends I
had the honor to meet them during my stay in ICGEB. Especially, mio Sylvia
DellaMea and her family, Fatemeh, Cristiana, Maureen, and Betul. Your support and
friendship have been priceless.
7
And finally, I would like to thank deeply my parent, and sisters for their
unconditional love and support, which made all of this possible. And also, for my ex-
boyfriend Mohammad, you were really a good person that marked my life and will
stay in my heart, thanks for your support, I will never forget that.
8
Abbreviations ALS Amyotrophic lateral sclerosis AD Alzheimer’s disease ALIS Aggresome-like inducible structures ALS Amyotrophic lateral sclerosis a-Syn alpha-Synuclein Atg Autophagy-related genes CMA Chaperone-mediated autophagy Cvt Cytoplasm to vacuole targeting ESCRT Endosomal sorting complex required for transport FIP200 Focal adhesion kinase family interacting protein of 200 kDa FUS/TLS fused in sarcoma/translocated in liposarcoma HD Huntington’s diseases HDAC6 Histone deacetylase 6 HDL high-density lipoprotein KO Knock out LAMP2A Lysosome-associated membrane protein type-2A LDL low-density lipoprotein LC3 Light chain 3 LIR LC3-interacting region mAtg Mammalian Autophagy geneMTOC Microtubule-organizing centre MVB Multivesicular body NBR1 Neighbour of BRCA1 gene 1 NES Nuclear export sequence ROS Oxygene species SCA Spinocerebellar ataxia SOD1 Cu/Zn superoxide dismutase 1 SQSTM1 Sequestome 1 TOR Target of rapamycin TORC1/2 TOR complex 1 or 2 TARDBP TDP-43 Tar DNA-binding protein UBA Ubiquitin-associated ULK1 Unc-51-like kinase 1 UPS Ubiquitin-proteasome system UVRAG Ultraviolet irradiation resistance-associated gene VCP Valosin-containing protein VLDL very low-density lipoprotein
9
C O N T E N TS
A BST R A C T ....................................................................................... 2
Izvleček ............................................................................................... 4
A C K N O W L E D G M E N TS ................................................................ 6
Abbreviations .................................................................................... 8
C O N T E N TS....................................................................................... 9
L ist of figures ................................................................................... 12
IN T R O DU C T I O N .......................................................................... 14
1.1. Protein degradation ................................................................. 14
1.1.1 UPS pathway:......................................................................... 15
1.1.2 Autophagy: ............................................................................. 19
1.1.2.1 Physiological role of Autophagy: ....................................... 28
1.1.2.2. Selective autophagy ........................................................... 30
1.1.2.3. Aggrephagy ......................................................................... 31
1.2. Autophagy and proteinopathies ............................................. 34
1.3 Amyotrophic Lateral Sclerosis ................................................ 37
1.3.1 G enetics of Amyotrophic Lateral Sclerosis ......................... 39
1.3.2 T DP-43 aggregation ............................................................... 43
1.4 T reatment of A LS ..................................................................... 49
1.5 A LS treatment through autophagy induction ....................... 53
1.6 Dextran sulfate as inducer of autophagy ................................ 55
2. M A T E RI A LS A ND M E T H O DS .......................................... 59
2.1. Chemical reagents: ................................................................ 59
2.2. Standard solutions: ................................................................ 59
10
2.3. Cells: ....................................................................................... 60
2.4. Cell growth media: ................................................................ 60
2.5. Preparation of bacter ial competent cells: ........................... 61
2.6. Amplification of selected DN A fragments (PC R): ............. 61
2.7. Enzymatic modifications of DN A : ....................................... 62
2.8. T ransformation of bacteria: ................................................. 63
2.9. RN A preparation from cultured cells: ................................ 64
2.10. Estimation of nucleic acid concentration: ........................... 64
2.11. cDN A preparation and R T-PC R: ........................................ 64
2.12. Mammalian cell line and cell culture conditions: ............... 65
2.13. Plasmids: ................................................................................ 66
2.14. T ransfection: .......................................................................... 66
2.15. G eneration of F lp-In™ T-Rex™ HEK 293 cells that
inducibly expressing E G FP-12xQ/N: ............................................ 67
2.16. Antibodies: ............................................................................. 68
2.17. RN A interference (siH D A C6) and adding-back exper iment
(H D A C6-W T ,H D A C6-D C): ........................................................... 68
2.18. SDS-PA G E : ............................................................................ 69
2.19. W estern blot analysis: ........................................................... 69
2.20. Immunofluorescence microscopy: ....................................... 70
2.21. C learance assay in stable H ek293 cells expressing E G FP-
12xQ/N ............................................................................................. 71
2.22. V iable cell count determination: .......................................... 71
3. R ESU L TS ............................................................................... 72
3.1. Cellular model of T DP-43 aggregation and autophagy-
lysosome pathway involvement ..................................................... 72
3.2. Dextran sulfate 5000 Da decreases the number of cells
containing E G FP-12xQ /N aggregates ........................................... 78
11
3.3 Positive trend in autophagic response to the aggregation
upon DS treatment .......................................................................... 80
3.4. Establishing stable cell model of E G FP-12xQ /N aggregation
82
3.5. Dextran sulfate 5000 Da enhances the clearance of E G FP-
12xQ/N aggregates in stable H E K 293 cell line ............................ 83
3.6. DS induces E G FP-12xQ /N aggregates clearance through the
autophagy pathway ......................................................................... 87
3.7. E G FP-12xQ/N aggregates are able to sequester T DP-43 wild
type in the cytoplasm ...................................................................... 91
3.8. DS decreases the capture of flag-T DP43 wild type in the
insoluble fraction ............................................................................. 95
3.9. DS-induced E G FP-12xQ /N clearance requires H D A C6 ...... 99
3.10. Mouse motor neuronal-like cell line NSC-34 model of
E G FP-12xQ/N aggregation .......................................................... 103
3.12. Dextran sulfate 5000 Da is not toxic for the motor
neuronal-like cell line NSC-34 ..................................................... 104
4. D ISC USSI O N ............................................................................ 106
5.C O N C L USI O NS ........................................................................ 119
6. B IB L I O G R APH Y .................................................................... 120
12
L ist of figures
F igure 1. Intracellular protein degradation via two main proteolytic systems: the ubiquitin-proteasome system (UPS) and the lysosomal autophagy pathway………18 F igure 2. Schematic representation of macroautophagy……………………..........20 F igure 3. Molecular pathway of autophagy initiation……………………………..23 F igure 4. Autophagy elongation………………………...........................................25 F igure 5. Atg12 and Atg8/LC3 ubiquitin-like conjugation pathways required for autophagosome formation……………………………………………………….....25 F igure 6. Molecules involved in the maturation step of autophagy………………..28 F igure 7. Aggrephagy main players ……………………………………………......34 F igure 8. TDP-43 proteinstructure…………………………..…………………….43 F igure 9. Chemical structure of dextran sulfate……………………………………56 F igure 10. EGFP-12x Q/N aggregates are labeled with LC3, p62 and Lamp1……75 F igure 11. Dextran sulfate 5000 Da decreases the number of cells containing EGFP-12xQ/N aggregates………………………………………………………………….78 F igure 12. Positive trend in autophagic response to the aggregation upon DS treatment………………………………………………………………….................80 F igure 13. EGFP-12xQ/N aggregates formed in HEK293 Flp-In T-Rex stable cell line after tetracycline induction…………………………………………………… 82 F igure 14. Dextran sulfate 5000 Da (DS) enhances the clearance of EGFP-12xQ/N aggregates…………………………………………………………………...............86 F igure 15. DS enhances the clearance of EGFP-12xQ/N aggregates…………….. 85 F igure 16. DS enhances the clearance of EGFP-12xQ/N aggregates through the autophagy……………………………………………………………………………87 F igure 17. Autophagy inhibition with siRNA against Atg7 counteracts the clearance action of DS…………………………………………………………………………89 F igure 18. EGFP-12xQ/N aggregates colocalize with autophagy marker LC3 in stable cell line. …………………………………………………………………… 90
13
F igure 19. EGFP-12xQ/N aggregates may entrap endogenous TDP-43 and flag-TDP-43 wild type…………………………………………………………………95 F igure 20. EGFP-12xQ/N aggregation model is able to produce truncation products of TDP-43…………………………………………………………………………94 F igure 21. DS decreases the capture of flag-TDP43 wild type in the insoluble fraction……………………………………………………………………………..95 F igure 22. DS enhances EGFP-12xQ/N aggregates clearance and decreases TDP-43 wild type retention in the cytoplasm………………………………………………97 F igure 23. DS is decreasing acetylated tubulin level in HEK293 cells forming EGFP-12xQ/N aggregates…………………………………………………………99 F igure 24. DS action on EGFP-12xQ/N clearance is HDAC6 dependent……….101 F igure 25. EGFP-12xQ/N aggregates are co-localizing with autophagosome marker LC3………………………………………………………………………………..102 F igure 26. Dextran sulfate 5000 Da is not toxic for the neuronal-like cell line NSC-34…………………………………………………………………………………..104 Tables Table 1.Some genes and loci for familial ALS ……………………………………40 Table 2.Chemical structure and mechanism of action of compounds reported to treat ALS disease ………………………………………………………………………..53
14
1. IN T R O DU C T I O N
1.1. Protein degradation
Eukaryotic cells are continuously synthesizing proteins in order to endure, to
survive, and to maintain proper homeostasis. In physiological conditions, cells need
to eliminate misfolded/unfolded proteins. However, an imbalance between synthesis
and mis/unfolded proteins degradation is frequently observed. Cells accumulating
unfolded proteins have an impaired internal homeostasis that leads subsequently to
their death. Thus, it is essential to identify the mechanisms behind protein formation
and degradation, in order to propose a specific therapeutic strategy to target disease
which is characterized by an abnormal accumulation of mis/unfolded proteins.
Since early 1898, Hahn and colleagues have described cellular proteolytic activities,
using yeast(Hahn 1898). Later on, De Duve and Novikoff were able to obtain the
first electron micrographs of the partially purified hepatic lysosomes and have shown
the localization of acid phosphatase activity in these organelles(Essner E. &
Novikoff 1961).In the following years, researchers have studied different types of
cells using electron microscope and discovered a wide variety of vesicles involved in
the proteolytic pathway of the cell. As some of the vesicles contained engulfed
cytoplasmic material, it was suggested that these particular vesicles were pre-
lysosomes. These pre-lysosomes were found to be formed de novo in the cytoplasm
from a cup-shaped membrane called a phagophore. The extremities of the
phagophore expand while becoming spherical until they seal, enclosing the engulfed
pieces of cytoplasm with whatever might lie inside, and giving rise to a double-
membrane vesicle. Farquhar, for the first time, observed these closed vesicles, which
are later on called autophagosomes. Autophagosomes take up damaged molecules or
organelles and carry this cargo to the lysosomes. When De Duve observed
autophagosomes, he realized that cells could degrade their own components and
named the process "autophagy" (Smith & Farquhar 1966; De Duve Christian 1965).
Few years later, it was shown that the degradation of the proteins can happen not
only inside lysosomes, but also outside these structures in an energy-dependent
manner through the proteasomes(Coux et al. 1996; Hilt & Wolf 1996; Hochstrasser
1995; Peters 1994; Rubin & Finley 1995).
15
Autophagy seems to be active in the degradation of long-lived proteins and was in
the beginning identified as a bulk degradation mechanism for protein turnover during
periods of nutrient starvation (Klionsky & Emr 2000). In contrast to autophagy,
degradation depending on proteasome removes selectively ubiquitinated, and
aberrant short-lived proteins(Heinemeyer et al. 1991), thus it is denoted as the
ubiquitin-proteasome system (UPS). Since many of these short-lived proteins have
essential cellular regulatory roles; UPS plays a major role in different cellular
activities such as in the regulation of the cell cycle, and gene expression, in response
to variant cellular stresses, and in apoptosis (Attaix et al. 2001; Hershko et al. 2000).
Nevertheless, both UPS and autophagy are involved in the removal of misfolded
protein that fails to be refolded by chaperones, as well as different cytoplasmic
cargoes under various conditions (Figure 1).
1.1.1 UPS pathway:
The UPS machinery is composed of the proteasome and the enzymatic cascade,
through which the targeted ubiquitinated substrates are catalysed for the degradation.
First of all, the unfolded protein is tagged for proteasomal degradation with a chain
of 4 or more ubiquitin units by ubiquitin ligases. Ubiquitin (Ub) is a highly
conserved protein of 76 amino acids that is covalently linked to lysine residue(s) of
the targeted protein. Further on, these units form polyubiquitin chains that are bound
to each other through seven internal lysines (K6, K11, K27, K29, K33, K48, and
K63). It was reported that degradation by the UPS depends mainly on K48-linked
polyubiquitination of the targeted misfolded substrate(Komander 2009). Although
K48 represent the canonical proteasomal degradation tag, yet some substrates tagged
with K63-linked polyubiquitin can be also degraded through the
proteasome(Komander 2009). Next, these tagged substrates are delivered to the
proteasome where they will be degraded to short peptides and reusable ubiquitin.
The proteasome that is exclusively used in mammals is the cytosolic 26S
proteasome. It is a barrel-shaped structure with a molecular weight of about 2000
kDa, containing one 20S proteolytic core particle and two 19S regulatory particles.
26S proteasome structure has two openings at the ends where the target protein is
allowed to enter. 19S regulatory particle contains at least 18 subunits with the
16
multiple ATPase active sites and ubiquitin binding sites. This structure is responsible
for the recognition of the polyubiquitinated proteins, their unfolding and
translocation into the catalytic core. Catalytic core is composed of four rings that
form a central pore. The two inner rings are made of seven β subunitsthat contain
three to seven protease active sites. The target protein must enter the central pore
through these sites to be degraded. The two other outer rings have seven α
subunitswhose function is to maintain the pore entry through which proteins enter the
barrel (Komander 2009).
Autophagy (discussed fully in the following chapter) and UPS are both critical in the
maintenance of cellular homeostasis suggesting that their activity should be highly
orchestrated. Nevertheless, it was reported a complex and often an unexpected
interplay between these two cellular waste conveyors.
The narrow size of the proteasomal catalytic pore suggests that protein substrates
need to be partially-unfolded prior to their entry into the proteasome. Thus, protein
complexes and aggregates that have bigger size are reported to be poor proteasome
substrates (Nandi et al. 2006).In contrast to the UPS, macroautophagy is capable of
degrading a much wider spectrum of substrates, which, on average, tend to be
longer-lived and bulkier. These substrates include misfolded soluble proteins, protein
complexes, and aggregates. Ubiquitination appears to be a universal tag targeting
substrates for destruction via both catabolic systems, yet the exact type of
modification recognised by each pathway appears to be different. While K48-linked
polyubiquitin chains are employed by the UPS, substrates recognised by
autophagosome-lysosome pathway are thought to be modified either by K63-linked
chains (adopting a more open conformation than K48 chains), or might be just
monoubiquitylated (Welchman et al. 2005).
Several studies have focused on how changes in the activity of one of the degradative
pathways affect the flux through the other system (Ding et al. 2007).
Impairment of the UPS leads to an increase of the autophagic function.
Autophagy here is considered as a compensatory mechanism, since it is
allowing cells to reduce the accumulated UPS substrates. Indeed, in cells and
17
mice, where proteasome activity was inhibited using lactacystin, it was
shown that treating these cells and mice with rapamycin (inducer of
autophagy) tends to protect them against cell death by reducing the
accumulated UPS substrates (Pan et al. 2008). It was also shown that
upregulation of autophagy has a protective role when the UPS is impaired in
Drosophila (Pandey et al. 2007). Moreover, this protective effect is reported
to be HDAC6 (histone deacetylase 6) dependent (Pandey et al. 2007; Iwata et
al. 2005). However, the role of HDAC6 in this process is to ensure an
efficient delivery of autophagic machinery substrates for degradation.
HDAC6 was earlier found to regulate the formation of ubiquitinated inclusion
bodies, called aggresomes (see further in aggrephagy session) (Kawaguchi et
al. 2003). These aggresomes has been hypothesised to be formed in order to
be degraded more efficiently by autophagy (Iwata et al. 2005). These
molecular mechanisms may not be mutually exclusive and may be of
different importance in different cell types after the proteasome inhibition.
Thus more studies have to be done to identify different players connecting
two cellular proteolytic pathways.
On the other hand, when autophagy is inactivated in vivo and in vitro by the
knockout of essential autophagic genes (Atg5 or Atg7), significant
accumulation and aggregation of ubiquitinated proteins was reported (Hara et
al. 2006; Komatsu et al. 2006).Autophagy pathway clearance impairment
leads to the dysfunctional UPS. Indeed, several studies support this claim, as
it was shown that impaired autophagy also leads to the impaired degradation
of specific UPS substrates (Korolchuk, Mansilla, et al. 2009)
Decreased UPS flux in autophagy-compromised cells was not due to
impaired catalytic activity of proteasomes isolated from these cells, but due to
the accumulation of p62 protein that acts as an autophagy receptor and
connects ubiquitinated protein aggregates to the autophagic machinery.In
fact, when p62 was knocked down, the levels of UPS substrates in these
autophagy-deficient cells was rescued(Korolchuk, Menzies, et al. 2009).
Thus, lack of compensation for autophagy dysfunction by the UPS is in
agreement with the fact that p62, when accumulates, oligomerizes and is
therefore too bulky to be a good substrate for the proteasome with its narrow
18
catalytic pore. Yet, further studies are recommended to be done in order to
understand more, the molecular cross talk between the two main degradative
pathways.
F igure 1. Intracellular protein degradation via two main proteolytic systems: the ubiquitin-proteasome system (UPS) and the lysosomal-autophagy pathway. Delivery of cytoplasmic material to the lysosomes by autophagy can occur by three different pathways: (1) macroautophagy, which involves the sequestration of cytoplasmic components by a membrane forming an autophagosome, which fuses with the lysosome (2) microautophagy, which involves engulfment of small volumes of cytoplasm by a direct invagination of the lysosomal membrane (3) Chaperone-Mediated Autophagy (C M A), a process by which soluble substrates associated with a specific chaperone complex are translocated into the lysosome through the LAMP-2A lysosomal receptor. Proteins tagged with the polyubiquitin chain can be targeted by both the UPS and autophagy. Adapted from (Nedelsky et al. 2008).
19
1.1.2 Autophagy:
The term autophagy (originated from Greek word: auto phagin) means self-eating or
self-cannibalism. The term “autophagy” was first introduced by Christian De Duve
in mid-sixties to define the digestion of endogenous cellular material. Autophagy is
an evolutionarily conserved process through which the intracellular cytoplasmic
material (cargo) is delivered to lysosomes for degradation. Three major types of
autophagy in eukaryotes are known: chaperone-mediated autophagy (CMA),
microautophagy and macroautophagy (Figure 1).
Chaperone-mediated autophagy (C M A)Two main properties differentiate
chaperone-mediated autophagy (CMA) from the other types of autophagy in
mammalian cells: (1) the selectivity towards a particular pool of cytosolic proteins
and (2) the mechanism of delivery of the substrate proteins to the lysosomes. Mostly,
proteins bearing a targeting motif in their amino acid sequence, biochemically related
to the pentapeptide KFERQ, are selectively recognized by the Heat shock cognate
protein of 70 kDa (Hsc70), the chaperone that mediates their delivery to lysosomes
for degradation via CMA. It is estimated that about 30% of soluble cytosolic proteins
contain this CMA-targeting motif. After this targeting step, the substrate protein–
chaperone complex enclosures at the lysosomal membrane through interaction with
the cytosolic end the lysosome associated membrane protein type 2A (LAMP-2A),
which acts as a receptor for this autophagic pathway. Translocation of the substrate
across the lysosomal membrane also requires the presence of a luminal form of
Hsc70 (lysHsc70). After translocation, substrate proteins are rapidly degraded by the
abundant array of lysosomal hydrolases(Chiang et al. 1989; Cuervo 2010; Cuervo &
Dice 1996).
Microautophagy was first described in 1966 by De Duve and Wattiaux (De Duve
& Wattiaux 1966). Microautophagy is the non-selective lysosomal degradative
process. This process translocates cytoplasmic materials into the lysosome or
endosomes for degradation by direct invagination, protrusion, or septation of the
lysosomal or vacuolar membrane (Ahlberg & Glaumann 1985).With its constitutive
characteristics, microautophagy of soluble substrates can be induced by amino-acids
starvation or rapamycin via regulatory signaling complex pathways (Dubouloz et al.
2005). The maintenance of the organelles size, membrane homeostasis, and cell
survival under nutrients restriction are the main functions of microautophagy. In
20
addition, microautophagy is coordinated and complements macroautophagy and
chaperone-mediated autophagy (Dubouloz et al. 2005; Mijaljica et al. 2011). The
exact mechanism and molecular core machinery involved in the microautophagy in
mammalian cells is still unknown. Reviewed in Ref.(Li et al. 2012).
Macroautophagy, referred hereafter as autophagy, is the most studied form of
autophagy. Autophagy is a process of self-degradation of cellular components in
which double-membrane autophagosomes sequester organelles or portions of cytosol
and fuse with lysosomes or vacuoles for degradation. Autophagy is induced in
response to extra- or intracellular stress and signals such as starvation, growth factor
deprivation, ER stress, and pathogen infection. Nevertheless, autophagy can also be
observed at basal level in the cell, since cells have to maintain its integrity by
selectively removing unfolded proteins, damaged organelles, or invasive pathogens.
Cargo-specific names have been given to describe these various forms of selective
autophagy (e.g. mitophagy and pexophagy for the selective degradation of damaged
mitochondria and peroxisomes, respectively) (Klionsky et al. 2007; Mizushima et al.
2008).
F igure 2:Schematic representation of macroautophagy. Autophagosomes form from a pre-autophagic structure (phagophore) of unknown origin. The phagophore extends to envelop cytoplasmic constituents and damaged organelles. This structure elongates generating autophagosomes that are directed to the endocytic/lysosomal compartments that form autolysosome where engulfed constituents are degraded.
21
The most typical inducer of autophagy is nutrient starvation; in this sense, lack of
any type of essential nutrient can induce autophagy. In yeast, nitrogen starvation is
the most potent stimulus, but withdrawal of other essential factors such as carbon,
auxotrophic amino acids and nucleic acids, and even sulphate can induce autophagy.
In mammals, it is well known that serum starvation can induce autophagy in many
types of cultured cell. Amino acid and insulin/growth factor signals are thought to
turn on mTOR (mammalian target of rapamycin), which is a master regulator of
nutrient signalling (Yorimitsu & Klionsky 2005). Indeed, treatment with inhibitors of
mTOR such as rapamycin induces autophagy. In addition to insulin and amino acid
signaling, the involvement of many other factors in autophagy regulation has
recently been reported. These include Bcl-2, reactive oxygen species (ROS), AMP-
activated protein kinase (AMPK), and myo-inositol-1,4,5-triphosphate (IP3).
More than 30 different genes regulating autophagy (Atgs) have been identified in
yeast, and many of these have mammalian orthologs. These genes are involved at
key stages of the autophagy pathway: initiation, elongation, and maturation/ fusion
with the lysosomes (Figure 2)(Harding 1995; Thumm et al. 1994; Tsukada &
Ohsumi 1993).
A . Initiation of autophagy
Autophagy is initiated by the formation of an essential vesicle that is typical for
autophagy: the autophagosome. Membrane dynamics during autophagy are highly
conserved from yeast to plants and animals. Autophagy initiation starts by the
autophagosome formation, where cytoplasmic constituents, including organelles are
sequestered by a unique membrane called the phagophore or isolation membrane.
Where and how autophagosomes emerge has been a major question. It has been
hypothesized that autophagosomes can either be generated de novo from pre-existing
intracellular precursor molecules, or could arise from other intracellular
membranestructures like the endoplasmic reticulum (ER). The latter hypothesis has
recently been supported by more evidence suggesting that ER could contribute to
autophagosome formation, as an accumulation of vesicles associated with the ER
22
outer surface was seen in cells that had a block in maturation of pre-autophagosomal
structures. Thus, ER may be one of the membrane sources contributing to the
formation of pre-autophagosomal structures, so-called phagophores.The formation of
new autophagosomes requires the activity of (1) the class III phosphatidylinositol 3-
kinase complex (PI3K) (also known as Vps34/Beclin1 complex), and (2) FIP200-
ULK1/Atg1 complex (Figure 3).
Vps34 is the only identified PI3K in yeast so far, and its essential role in vacuolar
protein delivery was initially described through yeast genetics studies (Herman &
Emr 1990). The essential role of Vps34 in autophagy has been established largely
through the use of the pharmacological inhibitors wortmannin and 3-methyladenine
(3-MA), which have been used to suppress autophagy in many studies.Moreover, it
was shown that inhibition of Vps34 activity with wortmannin leads to
autophagosome formation inhibition. Furthermore, Vps34 is activated upon its
interaction with Beclin 1 that is the orthologus gene of Atg6 in yeast and is one of the
main pro-autophagic genes. In fact, if Vps34/Beclin1 interaction is disrupted, the
autophagosome formation is impaired. Upon Vps34 and Beclin1 interaction, Vps34
phosphorylates a phosphatidylinositol. Phosphatidylinositol-3-phosphate (PI-3-P) is
the major product of this activity. PI-3-P plays an essential role in the early stages of
the autophagy pathway. Recent studies have identified strong colocalization of early
autophagosome markers in PI-3-P-enriched structures that were formed upon
starvation(Kim et al. 2013).
A second macromolecular complex associated with the initiation step of
autophagosome formation is the FIP200 -ULK1/Atg1 complex. Upon starvation,
Atg13 binds to the mammalian Atg1 homolog ULK1 and mediates their interaction
with FIP200, thereby forming a ULK1-Atg13-FIP200 stable complex that triggers
the autophagic response downstream of mTOR. Under nutrient-rich conditions,
mTORC1 suppresses autophagy through direct interaction with this complex and
mediates phosphorylation-dependent inhibition of the kinase activities of Atg13 and
ULK1. Under starvation conditions or rapamycin treatment, mTOR dissociates from
the complex, resulting in the inhibition of mTOR-mediated phosphorylation of Atg13
and ULK1. This leads to dephosphorylation-dependent activation of ULK1 and
23
ULK1-mediated phosphorylations of Atg13, FIP200, and ULK1 itself, which triggers
autophagy. Therefore, the ULK1-Atg13-FIP200 complex acts as an integrator of the
autophagy signals downstream of mTORC1 (Hosokawa et al. 2009). However, it is
not clear yet how phosphorylation of these proteins regulates their activities (Figure
3).
F igure 3. Molecular pathway of autophagy initiation:the first step of the
autophagy pathway is its initiation (shown inside the frame) the initiation step starts
when Vps34 interacts with Beclin 1, in one hand and with FIP200-ULK1 complex,
on the other hand initiating the phagophore formation, once sensing the presence of
autophagic cargos in the cytoplasm.
B . E longation
The elongation of the membrane sac called: isolation membrane involved many Atg
proteins. Atg9 is one of the proteins that plays an essential role in phagophore
elongation. Atg9 is a transmembrane protein that cycles between the trans-Golgi
network and endosomes, probably carrying membrane for expansion of phagophore
24
(Figure 4). Furthermore, it has been reported that this process requires different other
Atgs, that are involved and grouped in two ubiquitin-like reactions (Figure 5).
(1) In the first cascade of the reactions, the ubiquitin-like protein Atg12 is covalently
tagged to Atg5. Atg12 is first activated by Atg7 (E1 ubiquitin activating enzyme-
like) and then transferred to Atg10 (E2 ubiquitin conjugating enzyme-like). Atg12 is
then linked by its C-terminal glycine to an internal lysine residue of Atg5. The
Atg12-Atg5 later on forms a conjugate with Atg16L1 (Atg12-Atg5-Atg16L1),
resulting in an 800-kDa complex tetramers. This complex is essential for the
elongation of the pre-autophagosomal membrane, but it dissociates once the fully
autophagosomes are formed (Mizushima et al. 1998).
(2) The second cascade ubiquitin-like reaction involves the protein microtubule-
associated protein 1 light chain 3 (MAP1-LC3/LC3/Atg8). LC3 is synthesized as a
precursor form and is cleaved at its C- terminus by the protease Atg4B, resulting in
the cytosolic isoform LC3-I. LC3-I is conjugated to PhosphatidylEthanolamine (PE)
in a reaction involving Atg7 (E1-like) and Atg3 (E2-like) to form LC3-II. LC3-II is
specifically targeted to the elongating autophagosome membrane and, unlike the
Atg12-Atg5-Atg16L1 complex, remains on completed autophagosomes until fusion
with the lysosomes. After fusion LC3-II on the cytoplasmic face of autolysosomes
can be delipidated by Atg4 and recycled. In addition, LC3 is also found on the
internal surface of autophagosomes that is degraded in the autolysosomes. The
association of LC3-II with autophagosomes makes it a specific marker for studying
autophagy. Upon vesicle completion and engulfing the sequestered substrates,
autophagosomes are delivered to lysosomes in the maturation step.
25
F igure 5. A tg12 and Atg8/L C3 ubiquitin-like conjugation pathways
required for autophagosome formation. Atg4 encodes a cysteine protease that
cleaves Atg8/LC3. Atg7 is similar to an E1-like protein, and Atg10 and Atg3
encode E2-like proteins. Atg5, Atg12 and Atg16 are physically associated with
the isolation membrane, whereas Atg8/LC3 is directly conjugated to the lipid
PhosphatidylEthanolamine (PE) that is inserted in the isolation membrane.
Adapted from (Geng & Klionsky 2008).
F igure 4.Autophagy elongation:Atg9 exists already on the surface of circulating
vesicles inside cytoplasm, once the pre-autophagosomal structure is formed, Atg9
vesicles fuse with these structures, and subsequently Atg9 becomes integrated into
the outer autophagosomal membrane. The autophagosomal membrane elongation
requires also Atg8 (LC3) and the complex formed by Atg16/Atg5/Atg12.
26
C . Maturation and fusion
Nascent autophagosomes undergo a stepwise maturation, resulting in the creation of
amphisomes and autolysosomes by fusion with multiple endocytic compartments,
such as early endosomes, multivesicular bodies (MVBs), late endosomes, and
lysosome (Tooze et al. 1990). Amphisomes, an intermediate hybrid vesicular
compartment, contain both autophagosomal and endosomal contents, while
autolysosomes are formed either from amphisomes or directly from autophagosomes
by fusion with lysosomes.These degrading structures are generally called
“autolysosomes” or “autophagolysosomes.”
While in yeast the autophagosome fuses directly with the vacuole, in higher
eukaryotes the process seems to be more complicated. Endocytosis is a process
involving a simple invagination of plasma membrane when the extracellular material
is internalized, whereas, the fusion step of autophagy involves proteins such as
endosomal sorting complex ESCRT, Rab7 and UVRAG/VPS34 protein (Figure 5).
ESCRTs are necessary for formation of multivesicular bodies (MVBs) and they are
indeed involved in sorting ubiquitylated membrane proteins into multivesicular
bodies (Simonsen & Tooze 2009). UVRAG, a Beclin 1 interacting protein, is also
involved in the maturation step by regulating positively the maturation of both
autophagosomes and endosomes. This function is independent of its interaction with
Beclin 1 (an ortholog of Atg6 and is a positive regulator of autophagy). UVRAG
recruits the VPS34 and via this interaction activates Rab7. Rab7 is found to be
important in the maturation of the autophagosome (Gutierrez et al. 2004; Stein et al.
2005). It is involved in vesicle transport from early endosomes to late
endosomes/lysosomes as well as in the fusion between autophagosomes and
lysosomes. Moreover, Rab7 is associated with mature autophagosomes and
autolysosomes, as well as with LC3, which preferentially labels immature
autophagosomes. Indeed, Rab7 is not essential for the initial step of autophagosome
maturation, but is involved in the final step of the maturation of late autophagic
vacuoles, possibly in the fusion with lysosome.
In mammalian cells, autophagosomes/lysosomes fusion is facilitated by microtubules
and appears to necessitate dynein. While, in yeast autophagosome/vacuole fusion
seems not to require these structures (Aplin et al. 1992; Fass et al. 2006; Fengsrud et
27
al. 1995; Kirisako et al. 1999; Köchl et al. 2006; Punnonen & Reunanen 1990;
Ravikumar et al. 2005; Webb et al. 2004). In mammalian cells, the destabilization of
microtubules by either vinblastin or nocodazole blocks the maturation of
autophagosomes, whereas their stabilization by taxol increases the fusion between
autophagic vacuoles and lysosomes. Autophagosomes move bidirectionally along
microtubules. Their centripetal movement is dependent on the dynein motor.
Dyneins are the motors that move intracellular cargos (including organelles and
vesicles) along microtubule tracks. It was suggested that dyneins could simply act by
moving autophagosomes to perinuclear locations where the lysosomes are
concentrated. Yet, the exact mechanism by which dyneins facilitate
autophagosomes/lysosomes fusion require further studies.
Another molecule recently added to the core machinery of maturation step is histone
deacetylase-6 (HDAC6), an ubiquitin-binding deacetylase, which selectively targets
the ubiquitinated proteins to autophagosomes. It has been shown that knockdown of
HDAC6 leads to the accumulation of autophagosomes, suggesting that HDAC6
controls the autophagosomematuration rather than theautophagosome formation.
Moreover, it has been demonstrated that HDAC6 role in this step is to control the
actin cytoskeleton (Lee et al. 2010). Despite of such recent progress, molecular
mechanisms underlying coordinated regulation of multiple maturation steps by these
factors are still incompletely understood. The maturation step is ended by lysosomal
degradation of cargos. The autophagosome content is degraded inside autolysosome
structures that contain different hydrolytic enzymes, such as proteases, lipases, and
nucleases that are capable of breaking down all types of biological polymers.
Here, it is also essential to mention that lysosomal positioning is dynamically
regulated by nutritional conditions, hence by autophagy. Starvation induces
preferential re-localization of lysosomes from cell peripheries to juxtanuclear regions
close to the microtubule-organizing center (MTOC), thus regulating the autophagic
flux in cells (Maday et al. 2012). It is important to mention that in neurons,
bidirectional movements of lysosomes within axons are observed, while
autophagosomes and endosomes are also bidirectionally moved mainly in distal
axons. They are then transported exclusively in retrograde direction after fusion with
lysosomes to the cell body of the neuron for complete degradation of their cargos.
28
Taken together, lysosomal degradation of engulfed cargos in neurons could be
strictly dependent on retrograde transport and late autophagosome/lysosomal
trafficking (Katsumata et al. 2010).
F igure 6. Molecules involved in the maturation step of autophagy:
UVRAG interacts independently with Vps 34 and ESCRT complex to promote
autophagosome maturation that is later on fused either with endosome or lysosome to
generate autolysosome, UVRAG-Vps34 is also involved in the endosome–lysosome
transition by activation of Rab7. Adapted from (Liang et al. 2008).
1.1.2.1 Physiological role of Autophagy:
To understand the various roles of autophagy, it may be useful to subclassify
macroautophagy into “induced autophagy” and “basal autophagy” (Mizushima
2005). The former is used to produce amino acids following starvation, while the
latter is important for constitutive turnover of cytosolic components. However, this
distinction is too simplified and cannot be applied to more complicated issues.
Autophagy has a greater variety of physiological roles than expected, such as
starvation adaptation, intracellular protein and organelle clearance, development,
anti-aging, elimination of microorganisms, cell death, and the antigen presentation.
The physiological roles of autophagy are based on the respective processes involved
29
in, such as usage of degradation products, elimination of macromolecules and
organelles, and sequestration/packing.
A-U tilization of degradation products:
Under normal conditions and during very short periods of starvation, maintenance of
the amino acid pool seems to rely primarily on the ubiquitin–proteasome system
rather than autophagy (Vabulas & Hartl 2005). However, during starvation that
persists for several hours, necessary amino acids are produced by autophagy, which
is up-regulated as an adaptive response. It is important to emphasize that excess
production of amino acids by autophagy is an acute response or emergency action.
Therefore, induction of autophagy can support cell survival only for a short time. For
example, during cell growth, autophagy is activated at initial stages, but returns to
basal levels after a normal conditions are stablished (Degenhardt et al. 2006). In
contrast, little is known about how useful autophagy is in overcoming chronic
starvation.
B-Elimination of macromolecules and organelles:
The second purpose of autophagy is the elimination of cytoplasmic contents.
Although this role has been thought to be the specialty of the ubiquitin–proteasome
system, many recent studies have shown that autophagy also participates in
intracellular clearance or protein/organelle quality control. The most direct evidence
is the accumulation of abnormal proteins and organelles in autophagy-deficient
hepatocytes, neurons, and cardiomyocytes even in the absence of any
disease(Komatsu et al. 2005; Hara et al. 2006; Nakai et al. 2007), ubiquitin-positive
inclusion bodies, and deformed organelles accumulate in these cells. Since induced
autophagy is not observed in the brain during starvation, low levels of basal
autophagy are likely sufficient for quality control.Some types of induced autophagy
are aimed at the elimination of excess or unneeded organelles. For example,
peroxisomes induced by metabolic demand are selectively degraded primarily by
microautophagy(Sakai et al. 1998).The elimination of cytoplasmic contents by
autophagy is so important that defects cause various cellular malfunctions. One of
the possible outcome of autophagy defects is neurodegeneration. Indeed, The
accumulation of autophagic vacuoles has been observed in many human
30
neurodegenerative diseases, including Alzheimer’s disease for instance (Okamoto et
al. 1991). It remains largely unknown whether these represent up-regulation of
autophagy or blockage of autophagic flux.
C-Sequestration/packing:
In some cases, sequestration in autophagic membranes, even without degradation,
seems to be important to exert special functions. Autophagy can be induced by
several stresses, including ER stress. ER stress-induced autophagy is basically
protective against cell death in both yeast and mammals(Bernales et al. 2006; Ogata
et al. 2006). How autophagy protects cells during ER stress is not exactly known, but
it was suggested that sequestration of ER into autophagosomes might be sufficient to
relieve ER stress(Bernales et al. 2006).Moreover, autophagy has been suggested in
the context of neurodegenerative disease. Autophagy likely has a beneficial role in
the clearance of misfolded or other harmful proteins. However, if autophagic
degradation is not rapid enough, sequestration of cytoplasm might rather have an
adverse effect. It was proposed that autophagosome maturation into autolysosomes is
impaired in Alzheimer’s disease brains for instance(Yu et al. 2005).
In fact, defective physiological autophagic role plays a significant effect in human
pathologies, neurodegeneration diseases, for instance.
1.1.2.2. Selective autophagy
Although autophagy is historically described as a non-selective bulk protein
degradation system, recent findings confirm that it can be also a highly selective
process. Selective autophagy is mediated by both autophagy receptors and adaptor
proteins that link the cargo with the core autophagic machinery. The term selective
autophagy refers to the selective degradation of organelles, bacteria, ribosomes,
specific proteins, and protein aggregates by autophagy. When autophagy is
selectively recognizing a specific cargo, its name is attributed according to the
targeted cargo such as aggrephagy (aberrant protein aggregates), mitophagy
(damaged mitochondria), reticulophagy (ER) and xenophagy (invasive pathogenes)
(Klionsky et al. 2007). Selective autophagy functions as a quality control system, but
the signals involved in recognition of selective cargo for autophagy degradation are
31
still poorly understood. Autophagy receptors, such as p62 and NBR1 are the main
proteins involved in the selective autophagy of protein aggregates, so-called
aggrephagy.
Furthermore, autophagy receptors could also bindto other specific adaptors, which
function as scaffolding proteins that selectively bring the cargo-receptor complex in
contact with the core autophagic machinery to allow sequestration of the substrate. In
addition to the autophagy receptors and specific adaptors, such as Atg19, Atg34, p62,
NBR1, NDP52 (nuclear dot protein 52 kDa for bacteria recognition), OPTN
(optineurin), Nix (NIP3-like protein X), and ATG32, selective autophagy in general
relies on the same molecular core machinery of non-specific autophagy.
The protein aggregates represent intermediates in autophagic degradation of
aggregation-prone proteins. The assembly of autophagy substrates into larger
aggregates or clustered structures is a common feature of selective autophagy. Their
assembly may facilitate uptake into autophagosomes, and aggregates may work as
nucleation sites for the phagophore. Damaged proteins are recognized and sorted by
chaperone and co-chaperone complexes containing chaperone-assisted ubiquitin E3
ligases to three different degradation pathways: UPS, CMA, and/or aggrephagy. In
the following section, current knowledge about aggrephagy will be discussed.
1.1.2.3. Aggrephagy
To accomplish their normal cellular function, proteins have to be correctly folded. In
fact, the accumulation of misfolded or unfolded proteins into protein aggregates is a
pathological trait of many clinical disorders. The term aggrephagy was introduced
for the first time by Per O. Seglen to describe the selective sequestration of protein
aggregates by autophagy(Øverbye et al. 2007). Generally, protein aggregation is
caused by an abnormal protein conformation, leading to the formation of oligomeric
intermediates, and further on to the small protein aggregates(Merlini et al. 2001).
These small protein aggregates can again form variety of structures (Dobson 2003),
termed as intracellular inclusions bodies (Grune et al. 2004; Kopito 2000). Larger
cytoplasmic inclusions can develop further and fuse to form an aggresome, a
32
pericentriolar, membrane-free cytoplasmic inclusion formed specifically at
themicrotubule organizing center (MTOC) containing misfolded, and ubiquitinated
proteins (Johnston et al. 1998; Kopito 2000).
Aggresome is thought to be a protective cellular structure, since it is made by
sequestered misfolded proteins that cannot be degraded by the proteasome and that
could be toxic circulating in the cytoplasm (Johnston et al. 1998; Kopito 2000). On
this way, the misfolded proteins inside the aggresome are straightly transported
through autophagy for degradation. Protein aggregates are able to be sequestrated
inside the cell because of a variety of cellular stressors, such as mis/unfolded protein
formation, impaired proteasomes, oxidative stress, or aging (Kopito 2000).
Misfolded proteins generally become poly-ubiquitinated. Such proteins are normally
degraded by the UPS, while aggregate-prone proteins are poor substrates for
proteasomal degradation as they are highly insoluble and too big to pass through the
narrow proteasome pore (Stefanis et al. 2001; Verhoef et al. 2002). It has been also
shown that the ubiqutin linked chain K48 is a classical signal for UPS dependent
degradation and it has been suggested that autophagic substrates present a modified
K63-linked ubiquitin chains (Tan et al. 2008). Moreover, it has been demonstrated
that the autophagy receptors p62 and NBR1 recognize K63-linked ubiquitin
chains(Kirkin et al. 2009; Long et al. 2008; Wooten et al. 2008) and inclusions
containing K63-linked ubiquitin chains and target them for autophagic degradation
(Tan et al. 2008).
p62/A170/ SQSTM1 (hereafter referred to as ‘p62’) and NBR1 (neighbor of BRCA1
gene 1) are the components of the ubiquitin-positive inclusion bodies found in some
neurodegenerative and liver diseases. These molecules have unique features, N-
terminal Phox and Bem1p domain (PB1), which has the ability in self-
oligomerization, C-terminal ubiquitin associated domain (UBA) capable of
interaction with ubiquitinated proteins and LC3-interacting region (LIR) responsible
for the interaction with ATG8 family proteins. Both p62 and NBR1 mediate
aggregate formation, also called p62 bodies, sequestosomes or aggresome-like
inducible structures (ALIS) (Bjørkøy et al. 2005; Szeto et al. 2006; Clausen et al.
2010)and thus connect ubiquitinated protein aggregates to the autophagic machinery
players(Bjørkøy et al. 2005; Lelouard et al. 2002; Szeto et al. 2006) (Figure 7).
33
It was shown through two main studies that p62 is critical for protein aggregates
formation and their clearance by autophagy. In the first study, in p62 deficient
models, it was observed that the aggresome-like inclusion bodies formation is
notably impaired (Pankiv et al. 2007; Clausen et al. 2010). In accordance with this,
using Atg7 knock-out (KO) mice or Atg8 mutant flies, it was confirmed that large
ubiquitin-positive protein aggregates accumulate in these mutated models, and no
longer persist when P62 is impaired(Komatsu et al. 2007; Nezis et al. 2008).
Accordingly, over-expression of p62 leads to accumulation of ubiquitinated protein
aggregates(Bjørkøy et al. 2005; Seibenhener et al. 2004). In the second study, using
electronic microscopy p62 was localized inside double membrane vesicles (Bjørkøy
et al. 2005). It is important to point out that p62 was also identified as one of the
specific substrates that are degraded through the autophagy–lysosomal pathway.
Recently, the ubiquitin-binding histone deacetylase 6 (HDAC6) is reported to be a
key player in recruiting ubiquitinated, misfolded proteins to the aggresome (Iwata et
al. 2005; Kawaguchi et al. 2003; Olzmann et al. 2007). While most members of the
histone deacetylase (HDAC) family are localized in the nucleus, HDAC6 is found
exclusively inside cytoplasm and it has been shown to contain an ubiquitin-binding
domain (BUZ finger). As it has been demonstrated that HDAC6 may bind to the
microtubule motor protein dynein as well, it was proposed that HDAC6 can facilitate
transport of aggregates to the MTOC in order to form the aggresome (Kawaguchi et
al. 2003). In HDAC6 deficient cells dispersed micro-aggregates were formed inside
the cytoplasm, while formation of aggresomes was impaired suggesting a failure in
aggregates transport to the MTOC region (Kawaguchi et al. 2003).
34
F igure 7. Aggrephagy main players. P62 and NBR1 mediate aggresome/inclusion
body formation and are substrates prone to autophagosome engulfement and
degradation inside the autolysosome. In addition, aggresome formation is
coordinated by HDAC6 and is directly carried to lysosome via microtubules (e.g:
dynein), adopted from(Kraft et al. 2010).
1.2. Autophagy and proteinopathies Proteinopathies belong to conformational diseases that are caused by the failure of a
protein to attain or maintain correct conformation which is usually due to genetic
mutations. With aging, an increase in intracellular oxidative molecules leads to the
accumulation of unfolded proteins in cells, too. Misfolded proteins are engaged in
inappropriate interactions with other cellular components and can accumulate in
potentially toxic protein inclusions(Lashuel & Lansbury 2006). A number of studies
have identified small oligomeric aggregates as species linked to toxicity(Kayed et al.
2003). For example, in mammalian cell culture and yeast, accumulation of small
oligomeric Huntingtin aggregates has shown to correlate with toxicity(Kitamura et
al. 2006; Finkbeiner et al. 2006).
On the other hand, some studies have shown that soluble oligomers coming out from
proteasomal degradation of misfolded proteins in neurons could be more toxic than
their sequestration into aggregates. So, formation of aggregates might prevent their
toxicity awaiting for their transport to lysosomes for a complete degradation via
autophagy(Arrasate et al. 2004; Szeto et al. 2006; Tanaka et al. 2004). In the same
context, it has been suggested that formation of insoluble amyloid inclusions can also
promote cell survival and may serve as a protective mechanism by sequestering
potentially harmful aggregates from the cytosol. Several studies suggest that the
formation of tightly packed Huntingtin deposits is beneficial for cell survival. When
Greenberg and colleagues have transfected with mutant Huntingtin primary striatal
neuron, they could induce the formation of inclusions. These inclusions resembled
the protein deposits found in the brains of Huntington patients, as they were
intranuclear and ubiquitinylated. But these inclusions were not sufficient to induce
apoptosis(Saudou et al. 1998). Incorporation of toxic oligomers into protective
amyloid-like protein inclusions has been observed to reduce toxicity of Huntingtin
35
expressed in mammalian cells and mouse models(Cohen et al. 2009; Cheng et al.
2007). These studies support the hypothesis that sequestration into an
aggresomeremoves toxic misfolded species from the cellular environment.
Under normal conditions the cell can efficiently degrade misfolded/unfolded proteins
through targeted proteolysis. The UPS and autophagy are the two major intracellular
protein degradation pathways. While UPS is mediating degradation of most normal
proteins after performing their normal functions as well as the removal of the
abnormal soluble proteins, autophagy is mainly responsible for the degradation of
defective organelles and the bulk of aggregated proteins. UPS proteolytic function
often becomes inadequate in proteinopathies, which leads to activation of autophagy
for the removal of abnormal proteins especially the aggregated forms. Enhancement
of autophagy via pharmacological intervention has shown great promises in relieving
proteinopathies in the cell. Even though few different strategies are employed to
increase proteasome function, it seems that UPS is not as efficient as autophagy in
alleviating proteinopathies (Díaz-Hernández et al. 2003).
Proteinopathies are exemplified mainly by human neurodegenerative diseases such
as: Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease (HD)
and Amyotrophic Lateral Sclerosis (ALS) (Ravikumar 2002; Berger et al. 2006).
Mentioned disorders characterize intracellular protein aggregates that contain a bulk
of misfolded or abnormal aggregate-prone proteins, such as: β-amyloid protein(Aβ),
polyglutamine-rich repeats of Huntingtin protein, alpha synuclein, and SOD1 or
recently reported TDP-43 protein.
A direct link between autophagy and neurodegeneration has been established by loss
of basal autophagy in mouse brains through conditional knockout of key autophagy
genes, Atg5 or Atg7, which results in a neurodegeneration phenotype with the
accumulation of ubiquitinated protein aggregates (Hara et al. 2008; Komatsu et al.
2006). This suggests that autophagy is vital for cellular quality control in neurons for
the turnover of proteins and organelles (Rubinsztein 2006). Thus, cellular quality
control through the autophagy is essential for neuronal survival. Growing evidences
propose that autophagy has a protective role in neurodegenerative diseases, yet its
detailed mechanism is still unclear. Moreover, the basal level of autophagy is usually
36
low in healthy neurons, because of the very rapid turnover of autophagosomes
(Boland et al. 2008). Neurons might indeed be susceptible to the alterations in any of
autophagy steps. Indeed, abnormal number of autophagosomes and/or amphisomes
(fusion product of autophagosomes and late endosomes) indicating an impaired
autophagy, are observed in neurodegenerative diseases. The defect in autophagy
could be thus due to the deficiency of the endocytosis at the late endosome-lysosome
stage, the inhibition of autophagosome maturation, and/or lysosomal degradative
function impairment (Wong & Cuervo 2010). In fact, a decrease in autophagosome
maturation and autophagic flux turnover impairment explains the overdue
phenotypes often characteristic for many of the neurodegenerative proteinopathies.
On the other hand, it was shown that abundant autophagy vacuoles sequestration and
the increase of autophagy proteins such as p62were found in different experimental
models of motor neuron degeneration and in ALS (Laird et al. 2008; Sasaki 2011). In
fact, the increase in autophagy proteins is due to the impairment of autophagy
progression as a sort of non-effective compensatory mechanism. In the presence of a
defective autophagy progression, LC3 II levels increase and an excess of misfolded
proteins and/or altered organelles is observed.
Growing evidence are proposing that strengthening autophagy could be a beneficial
approach in neurodegenerative diseases treatment (Xilouri & Stefanis 2011). It is
widely suggested that induction of autophagosome formation would be a solution to
clear the aggregates specially at early stages of the disease (Xilouri & Stefanis 2011).
In contrast, other studies suggested that boosting autophagosome formation is not a
wise solution, especially if the maturation of autophagosomes to lysosomes is
interrupted. Therefore, an increase in the autophagic flux progression might be a
better way to delay the onset of neurodegenerative diseases.
Autophagy inducer, rapamycin (mTOR inhibitor), has shown neuroprotective effect
in several neurodegenerative disease models, including Huntington disease.
Rapamycin protects against mutant Huntingtin-induced neurodegeneration in cell, fly
and mouse models of Huntington's disease (Ravikumar et al. 2004). Spilman et al.,
have shown that long-term inhibition of mTOR by rapamycin prevented AD-like
cognitive deficits and lowered levels of Aβ42, a major toxic species in mouse
37
Alzheimer’s disease model (Spilman et al. 2010). In line with this, inParkinson
disease PC12 cell-based α-synuclein aggregation model, treatment with rapamycin
has shown increased clearance of these aggregates (Webb et al. 2003).
Despite its beneficial role in the aggregation clearance, the use of mTOR inhibitors
are considered not to be a prominent long term treatment in neurodegenerative
disease patients because mTOR has many vital cellular functions, like translation and
cell growth. Therefore, induction of autophagy independent of mTOR may provide a
more rational treatment approach. Further studies reported by Rubinzstein’s group
demonstrated the first mTOR-independent autophagy pathway in which autophagy
could be induced by other agents like lithium and carbamazepine (Sarkar et al. 2005).
The same group, via chemical screening, identified a number of small-molecule
enhancers of rapamycin effect (SMERs) that have been shown to induce autophagy
independent of mTOR and rapamycin. Sarkar et al., have shown using Huntingtin
aggregation model that these small molecules have beneficial effect by enhancing the
clearance of aggregate-prone proteins, and may therefore counteract the autophagy
dysfunction in proteinopathies (Sarkar et al. 2007).
1.3 Amyotrophic Lateral Sclerosis
Amyotrophic lateral sclerosis (ALS), known as Lou Gehrig‘s disease, is a
neurodegenerative motor neuron disease. Since 1869, the French neurologist Jean-
Marin Charcot (Rowland 2001), has diagnosed the first clinical trait of ALS and has
defined it as a progressive motor function disability due to motor neuron
degeneration in the primary motor cortex, brainstem and spinal cord (Shaw et al.
2001). The earliest symptoms of ALS are obvious muscle weakness and/or atrophy.
The parts of the body affected by these early symptoms depend on which specific
motor neuron populations in the body are damaged first. About 75% of ALS cases
have “limb onset ALS” which affects one of the legs or arms. Patients might feel
awkwardness while walking or running. The other 25% of cases show “bulbar onset
ALS”. These patients will have problems in speaking clearly, and consequently a
dramatic loss of tongue mobility. As the disease progresses, muscle weakness and
atrophy will quickly extend the rest of the body (Brooks 1994; H Mitsumoto 1997;
H. Mitsumoto 1997) with eventual paralysis and death within 2-5 years of clinical
onset (Rowland 1998). ALS disease progression leads ultimately to the death mainly
due to the enervation of respiratory muscles and subsequent respiratory failure. ALS
38
disease is settled in patients that have ages between 55-65 years (Haverkamp et al.
1995),(Leigh 2007) and its incidence is between 1 to 2 per 100 000 each year in
Europe and North America, for instance (Worms 2001).
Although ALS disease has been discovered over a hundred of years ago, up to now
there is no unambiguous test to clearly diagnose ALS since clinical symptoms are
frequent to several other neuromuscular and skeletal disorders. In order to assist the
diagnosis of ALS patients for research and drug trials, the World Federation of
Neurology (WFN), Research Group on Motor Neuron Disease developed diagnostic
criteria since early 1990s (Brooks 1994; Brooks et al. 2000). Through these criteria,
patients can be classified into the several categories: “Definite ALS”, “Probable
ALS”, “Probable ALS- Laboratory supported”, “Possible ALS” or “Suspected ALS”,
based on which regions of the bodyhave been degenerated. The development of these
diagnostic guidelines has been defined in order to facilitate the diagnosis and
therefore encouraging the advancement of our understanding of ALS and the
implementation of efficient treatment.
It is still not known the cause of ALS and its exact molecular core involved in motor
neuron degeneration. Although, the majority of ALS cases happen sporadically, it is
proposed that genetic background and environmental factors are both involved in
ALS development. Clear evidence to define the exact factors in sporadic cases has
still to be elucidated, yet the evidence for the influence of genetic contribution has
been suggested to be highly involved.
Since 1980s, our understanding of ALS physiopathology has significantly increased.
Because the progressive paralysis in ALS is due to motor neurons degeneration, early
thought about the pathogenesis suggested that motor neurons are dying
autonomously. Many mechanisms have been proposed to lead directly to motor
neurons degeneration such as: oxidative stress (Yim et al. 1996), abnormal protein
accumulation (Johnston et al. 2000; Watanabe et al. 2001), glutamate excitotoxicity
(Rothstein et al. 1992), dysfunctional mitochondria (Cozzolino et al. 2008); (Shaw
2005) and recently described, deficient RNA processing(Lagier-Tourenne et al.
39
2010). In addition, many mutations in multiple genes are associated with motor
neurons death (Valdmanis & Rouleau 2008).
1.3.1 G enetics of Amyotrophic Lateral Sclerosis
Even though ALS disease has common clinical feature due to motor neuron
degeneration, it remains a heterogeneous disease. More than 90% of ALS cases
occur sporadically (sALS), and the 5-10% of cases have a familial background
(fALS) caused by mutations in more than ten different genes (Valdmanis & Rouleau
2008). Interestingly, fALS cases are identical to sALS from a neuropathological
point of view, hence proposing a common pathogenesis feature (Bruijn et al. 2004).
Eleven disease-associated mutations in the superoxide dismutase (SOD1) gene were
discovered for the first time by Rosenet al in 1993 (Rosen et al. 1993). Since then,
many other genes has been shown to be affected in ALS patients, such as FUS/TLS,
OPTN (optineurin), and TDP-43 (Table 1). Despite an outstanding heterogeneity of
ALS, the presence of ubiquitin-positive inclusion bodies in the cytoplasm of defected
neurons of ALS patients seems to represent a common pathological feature
(Giordana et al. 2010). In 2006, a staggering study conducted by Neumann et
al.(Neumann et al. 2006), identified the TAR DNA binding protein 43 (TDP-43) as
the main component in ALS patient’s aggregated protein inclusions. Later studies
have shown that about 4% of fALS cases and up to 2% of sALS carry dominant
missense mutations in the TARDBP gene further suggesting that TDP-43 plays an
important role in neurodegeneration (Corrado et al. 2009; Daoud et al. 2009; Van
Deerlin et al. 2008). Therewith, other studies have shown mutations in another
RNA/DNA binding protein, known mainly as Fused in Sarcoma (FUS) or
Translocated in Liposarcoma (TLS). Alltogether, it is estimated that in around 1-2%
of fALS cases RNA processing and metabolism is affected (Kwiatkowski et al. 2009;
Vance et al. 2009).
Adapted from Habib and Mitsumoto(Habib & Mitsumoto 2011)
A LS Subtype Gene Onset Inheritance Locus Protein
A LS1 SOD1 Adult Dominant 21q22.1
Cu/Zn superoxide dismutase
A LS10 TDP-43 Adult Dominant 1p36.22
40
TAR DNA-binding protein A LS-F T D*1
Unknown Adult Dominant 9q21-22 -
A LS-F T D2 Unknown Adult Dominant 9p13.3-21.3 -
Undesignated OPTN Adult Dominant 10p15-15 Optineurin
Table 1. Some genes and loci for familial A LS*Frontotemporal Dementia
SO D1 gene
The Cu/Zn superoxide dismutase 1 (SOD1) is a gene encoding a 32kDa cytoplasmic
enzyme that is involved in the catabolism of toxic superoxide radicals (O2-) to
innocuous molecular oxygen (O2) and hydrogen peroxide (H2O2) (McCord &
Fridovich 1969). Moreover, SOD1 is ubiquitously expressed and highly conserved
among species. Since 1993, when the first SOD1 missense mutations were described
(Rosen et al. 1993), the number of mutations linked with fALS in this gene has been
amplified to more than 140. Mutations in SOD1 are described in about 20% of
familial cases and infrequently among sporadic ALS cases (Andersen et al. 2003).
Some reports based on mutant SOD1 mouse models have demonstrated that mutation
in SOD1 results in disease due to a toxic gain of function more than the loss of SOD1
activity (Bruijn et al. 2004). Mutant SOD1 proteins have been known to accumulate
abnormally in the form of insoluble inclusions within affected spinal motor neurons
of SOD1- related ALS patients (Bruijn et al. 1998).
F US
FUS/TLS or fused in sarcoma/translocated in liposarcoma is a 526 amino acid
protein encoded by 15 exons and characterized by an N-terminal domain enriched in
glutamine, glycine, serine and tyrosine residues (QGSY region), a glycine-rich
region, an RRM, multiple arginine/glycine/glycine (RGG) repeats in an arginine- and
glycine-rich region and a C-terminal zinc finger motif. FUS/TLS is predominantly
localized in nucleus (Andersson et al. 2008). Mutations in this RNA/DNA-binding
protein were mostly described in familial ALS (Kwiatkowski et al. 2009). Most of
these mutations are clustered in the glycine-rich region and in the extreme C-terminal
part of the protein. It was also reported, that the patient’s cells contain an abnormal,
41
high levels of ubiquitinated full-length FUS/TLS protein, as well as C-terminal
fragments in cytoplasmic insoluble fractions.
T DP-43
Human TDP-43 protein is 43-kDa protein composed of 414 amino acids and encoded
by the Tar DNA-binding protein gene (TARDBP) located on chromosome 1. TDP-
43 is a highly conserved, ubiquitously expressed, mainly a nuclear protein capable of
shuttling between the nucleus and cytoplasm (Ayala et al. 2008; Banks et al. 2008;
Winton et al. 2008). TDP-43 protein is composed of five functional domains: two
conserved RNA recognition motifs (RRM1 and RRM2), a nuclear localization signal
and a nuclear export sequence that mediate nuclear shuttling, in addition to a
carboxy-terminal glycine-rich domain implicated in TDP-43 protein interactions and
aggregation (Lagier-Tourenne et al. 2010) (Figure. 8). This structure places TDP-43
in the heterogeneous nuclear ribonucleoprotein protein family (hnRNP) (Dreyfuss et
al. 1993).
TDP-43 is able to bind single stranded DNA and RNA and has been shown to have a
role in repression of gene transcription (Ou et al. 1995), alternative splicing (Buratti
& Baralle 2001),(Lagier-Tourenne et al. 2010), and mRNA stability (Strong et al.
2007). Despite TDP-43 is an ubiquitously expressed protein, Northern analyses have
shown that mRNA expression levels of this protein are heterogeneous among
different tissues (Ou et al. 1995), which suggest that TDP-43 may have different
functions in different tissues. Increased expression levels of TDP-43 have been found
in the brain and spinal cord tissue of wild-type mice (Sephton et al. 2010), that can
explain why motor neurons located in these regions are specifically susceptible to
degeneration in ALS.
In 2006, Neumann et al. identified TDP-43 as a major component of ubiquitinated
inclusions in FTLD (Frontotemporal lateral dementia) and ALS patients. Wild-type
TDP-43 is found in aggregates in spinal cord motor neurons, hippocampal and
frontal cortex neurons and glial cells in the vast majority of ALS patients. In FTLD,
TDP-43 aggregates are present in the most common subtype of the disease with
ubiquitinated inclusions, referred to as FTLD-TDP.
42
In early 2008, successful identification of dominant mutations as a primary cause of
ALS provided evidence that aberrant TDP-43 can directly trigger neurodegeneration.
Therefore, understanding how the mutants cause neurodegeneration offers a
convenient entry point for exploring how TDP-43 plays this role. The first question
is whether a gain, or a loss of function mediates neurotoxicity. A resolution to this
question is of critical importance because it sets the direction of further research on
the disease mechanism and on the design of therapeutic strategies. To answer this
question, model systems of both gain or loss of function must be employed. Gain-of-
function models are usually achieved by gene overexpression, and loss-of-function
models by gene knockout or knockdown. The precise role and the exact mechanism
by which TDP-43 participates in ALS pathogenesis are still to be elucidated.
F igure 8.T DP-43 protein structure. TDP-43 has five functional regions including
two RNA recognition motifs (RRM1 and RRM2), a nuclear localization signal
(NLS) and nuclear export signal (NES) that mediates nucleo-cytoplasmic shuttling,
and a glycine rich region (GRR) that mediates protein-protein interactions. Below,
the prion-like Q/N rich region has been highlighted, in addition to the location of the
majority of ALS-associated mutations. A structural region mediating TDP-43
association with stress granules (SGs), as identified in two independent studies, also
spans part of the prion-like Q/N rich sequence adopted from(Dewey et al. 2012).
43
1.3.2 T DP-43 aggregation
Overview:
In the physiological conditions, TDP-43 is located mainly in the nucleus and it has a
role in the regulation of gene expression. In contrast, in the pathophysiological
conditions, TDP-43 is found located in cytoplasmic inclusions, where is hardly
soluble, hyperphosphorylated, ubiquitinated, and later on cleaved into small
fragments (Arai et al. 2006; Mackenzie 2007) demonstrating that the aberrant
subcellular localization is important for disease pathogenesis progress. In the
beginning, it was debated whether TDP-43 and its abnormal subcellular localization
and accumulation in inclusion bodies are directly involved in the development of
ALS. An increasing number of studies based on mutations in the TARDBP gene from
patients with fALS and sALS are suggesting that TDP-43 is directly involved in ALS
pathology. Up to now, more than 35 various mutations in the TARDBP gene have
been reported (Corrado et al. 2009; Daoud et al. 2009; Van Deerlin et al. 2008).
Interestingly, most of these mutations have been cited to be found in the C-terminal
glycine-rich domain of TDP-43 known to be involved in the interaction with other
hnRNP family proteins (Warraich et al. 2010; Lagier-Tourenne et al. 2010). These
findings propose that the mechanism of pathogenicity in ALS could be tightly related
to the interruption of the protein-protein interactions. However, this domain is also
the least conserved region of the protein and this low homology is thought to reflect
the differences in species-specific functions (Ayala et al. 2008).
TDP-43 is an intrinsically aggregation-prone protein capable of forming homodimers
in vitro(Shiina et al. 2010);(Arai et al. 2006). Several ALS-linked TDP-43 mutations
have been shown to increase its tendency to form aggregates(Johnson et al. 2009;
Kabashi et al. 2010). Protein extracts from affected brain andspinal cord has defined
a biochemical signature of disease that includes hyperphosphorylation and
ubiquitination of TDP-43, and the production of several C-terminal fragments
(CTFs) around 25 kDa and 35 kDa. These observations have leadinvestigators to
propose a toxic gain-of-function mechanism in the pathogenesis of ALS. The "gain
of function” model is based on potential aberrant action of TDP-43 when localized in
the cytoplasm, as an increased degradation can yield to toxic fragments and thus to
the potential toxic properties of the aggregates themselves. In fact, overexpression of
44
wild type TDP-43 has a toxic effect in yeast and cultured primary neurons derived
from mouse embryos, as well as in Drosophila (Li et al. 2010).
On the other hand, when TDP-43 is sequestrated in the cytoplasmic aggregates of
degenerative neurons, a dramatic depletion of TDP-43 from the nucleus is evident,
suggesting a redistribution/mislocalization of the protein (Winton et al. 2008).
Hence, functional TDP-43 is mandatory for the regulation of gene expression the
pathogenesis of the disease is likely to happen, at least partly, due to the normal
nuclear TDP-43 function(s) lost. This “loss of function” model is based on the
hypothesis that the cytoplasmic aggregates act as a “TDP-43 sink” and determine the
clearance of this protein from the nucleus. Indeed, this leads to the disruption of the
processes controlled by TDP-43 in the nuclear compartment.
Whether the TDP-43 in patients lead to disease due to the “gain of function” or “loss
of function” is still widely debated. Both models could either be mutually associated
or are exclusively acting in different time of the onset and progression of the disease.
Models of A LS:
Up to date, many different in vivo and in vitro models to study ALS were made based
on SOD1, FUS, or TDP-43 mutations, from yeast toCaenorhabditis elegans, flies,
zebrafish, and mouse. How accurately these models replicate ALS clinical symptoms
remains a troublesome question. Each model has its own advantages and
disadvantages. Choosing an appropriate model depends on the question being asked.
In vivo models of A LS SO D1 models: A number of C . elegans models have been developed that recapitulate many aspects
of ALS pathogenesis. These transgenic models mainly expressed either the SOD1
protein under the control of various gene promoters. The first C . elegans ALS model
was generated in 2001 by introducing human wild type and various human fALS
SOD1-linked mutations (A4V, G37R and G93A) under muscle-specific promoters
(Oeda et al. 2001). Some of the SOD1 mutants (G85R, G93A, 127X) in C . elegans
muscle cells resulted in mild cellular dysfunction(Gidalevitz et al. 2009).
45
Initial ALS studies in Drosophila Sod null flies showed either reduced longevity
and/or fertility, increased susceptibility to oxidative stress, motor deficits and/or
necrotic cell death in the fly eye(Phillips 1989).Several studies in this model showed
that selective expression of WT or human SOD1 disease linked mutants (A4V,
G85R) in motor neurons induced progressive motor dysfunctions, coupled with
electrophysiological defects and abnormal accumulation of the protein and a stress
response in surrounding glial cells (Watson et al. 2008).
Transgenic mice ubiquitously overexpressing various SOD1 gene mutations with
different biochemical properties, even in the presence of endogenous mouse Sod1
gene, develop a neurodegenerative disease that is quite similar to the human ALS.
Interestingly, transgenic mice overexpressing WT human SOD1 or mutant SOD1
only in neurons or only in glial cells do not develop disease (Bruijn et al. 1998; Gong
et al. 2000). A toxic gain-of-function rather than a loss-of-function of mutant SOD1
gene is therefore believed to be involved in ALS-linked SOD1 patients.
F US models
Overexpression of mutant FUS/TLS caused an accumulation of ubiquitinated
proteins, a pathological hallmark feature of ALS. A pathogenic role of human ALS-
associated FUS/TLS mutations (R524S and P525L) using Drosiphila has been
described (Chen et al. 2011). In this model overexpression of either wild type or
ALS-mutant in different neuronal subpopulations, including photoreceptors and
motor neurons led to an age-dependent progressive neuronal degeneration, including
axonal loss, morphological changes and functional impairment in motor neurons.
The drosophila ortholog of human FUS/TLS called Cabeza (Caz) has been also
disrupted in order to study FUS function. The Caz deficient fly exhibited reduced life
span and locomotion deficiency as compared with controls.
T DP-43 models:
Models of TDP-43-linked ALS have also been developed using different organisms,
such as Danio rerio and Caenorhabditis elegans.
46
Two groups have expressed human wild-type and mutant TDP-43 in zebrafish
embryos. Laird et al. haveobserved that expression of wild-type and mutant TARDBP
results in decreased axonal length and increased aberrant branching, with mutant
TDP-43 (TARDBPA315T) presenting more severe phenotypes than wild-type (Laird
et al. 2010).Interestingly, they noticed that both mutant and wild-type TDP-43
localized to the nucleus, suggesting mislocalization of the protein is not required for
axonal defects. Similarly, Kabashi et al. created transgenic zebrafish models
expressing wild-type or mutant (A315T, G348C or A382T) TARDBP. They found
that overexpression of mutant, but less so of wild-type TDP-43, causes motor defects
such as shorter motor neuron axons, aberrant branching and swimming deficits
(Kabashi et al. 2010). Altogether, these studies consistently show that overexpression
of wild-type TDP-43 is toxic in these systems and ALS-associated mutations in the
TARDBP gene seem to exacerbate the toxic phenotypes caused by overexpression of
this protein. Overall, these studies in zebrafish and C . elegans focuses on the
neuronal specific toxicity caused by expression of wild-type and mutant TDP-43
without providing insight into the way in which mutation in the TDP-43 gene can be
pathogenic in ALS. Despite their valuable contribution to the study of ALS, these
models have yet to address some of the main questions that still remain unclear in the
field, such as the mechanisms of neurodegeneration that lead to ALS pathology, or
the role that TDP-43 aggregation in the progression of the disease.
The fruit fly, Drosophila melanogaster, has long been recognized as one of the most
powerful genetic systems for studying neuromuscular development and function and
as such, it is no surprise that many current studies of ALS are using this organism to
advance our knowledge of this devastating disease. Recently, a number of studies
have demonstrated the importance of TDP-43 function in various aspects of neuronal
development and function in Drosophila (Feiguin et al. 2009; Hanson et al. 2010; Li
et al. 2010; Lu et al. 2009; Voigt et al. 2010). Loss of function analyses showed that
flies lacking the Drosophila TARDBP gene, TBPH, display anatomical abnormalities
at the neuromuscular junctions, reduced lifespan and motility defects (Feiguin et al.
2009). Interestingly, overexpression studies in Drosophila have demonstrated that
excess of human TDP-43 also results in a similar phenotypic outcome suggesting
that the cellular functions of this protein are complex and likely to be tightly
regulated since both loss and overexpression of the protein leads to pathology
47
(Hanson et al. 2010; Li et al. 2010). Therefore, the molecular mechanisms that
underlie TDP-43-linked ALS pathology are likely to be highly complex and both
loss- and gain- of function mechanisms of TDP-43 could have convergent
pathological outcomes. Furthermore, the expression of the ALS/FTLD-linked TDP-
43 mutations A315T and M337V in flies resulted in an increased neurodegeneration
(Estes et al. 2011);(Ritson et al. 2010).
New in vitro model of T DP-43 aggregation
TDP-43 became the one of the main players in ALS since was identified as the major
component of protein aggregates found in ALS/FLTD patients (Neumann et al.
2006). TDP-43 aggregation has been also found in the brain of patients affected by
other neurodegenerative disease such as Alzheimer disease (Geser et al. 2009). TDP-
43 is structurally similar to heterogeneous ribonucleoprotein (hnRNP) A∕B family
members. It contains two RNA recognition motifs (RRM) and a C-terminal domain
rich in glycine residues. It was first identified as a protein capable of binding the
TAR DNA and RNA sequences. Later it was identified as a factor that binds to an
intronic (UG) repeat element in the cystic fibrosis transmembrane receptor mRNA
and modulates its splicing. Glycine-rich C-terminal part of the protein was reported
to mediate protein-protein interactions with other hnRNPs (Buratti et al. 2005). This
region spans the part where the majority of human genetic mutations have been
identified(Del Bo et al. 2009; Kabashi et al. 2008; Kühnlein et al. 2008; Rutherford
et al. 2008; Van Deerlin et al. 2008). Currently, over 40 TARDBP mutations have
been found in ALS patients, while 3 have been found in FTLD patients (Borroni et
al. 2009; Gitcho et al. 2009).In addition, C-terminal region is cleaved through
caspase-3 generating C-terminal fragments (CTFs) that are associated with cellular
toxicity and/or increased TDP-43 mislocalization (Zhang et al. 2007).
Within the C-terminal region there is a domain rich in glutamine (Q) and asparagine
(N) residues, also known as aggregation-prone domain and is thought to confer
prion-like properties Therefore, wild-type form of TDP-43 is already highly
aggregation-prone and potentially toxic (Fuentealba et al. 2010). In fact, inclusion
bodies found in the central nervous system of a subset of ALS and FTLD patients
without TDP-43 mutations are immunopositive for TDP-43.The neurotoxicity of
48
TDP-43 may be related to its high propensity to aggregate and its cytoplasmic
mislocalization. Thus other factors that contribute to the severe toxicity of TDP-43
could be related to its function in transcription regulation and RNA processing.
Interestingly, Gln/Asn-rich region was found to be responsible for sequestration of
TDP-43 in polyglutamine aggregates causing the loss-of-function effects (Fuentealba
et al. 2010; Udan & Baloh 2011). Other studies focused on the TDP-43 mutations in
the region of 342-366 aminoacids leading to increased aggregation and toxicity in
vivo and in vitro (Rutherford et al. 2008; Del Bo et al. 2009).
Better understanding of the biochemical features of the C-terminal region of TDP-43
had open the doors to establish a novel aggregation model able to mimic the majority
of patient’s inclusion features.
For several members of the hnRNP-A/B protein family was demonstrated to be able
to interact with TDP-43 region spaning 321–366 aminoacids. In addition, for these
interactions was shown to be very important to maintain the splicing functionality of
TDP-43 (Buratti et al. 2005; D’Ambrogio et al. 2009). D’Ambrogio et al., have
finely mapped the region of the TDP-43 between aminoacid residues 321 and 366 to
be responsible for the interaction with hnRNP A2. When using 321–366 synthetic
peptide they were able to disrupt the TDP-43-hnRNP-A2 complex, suggesting the
stronger interaction of TDP-43 with its own sequence was stronger than the
interaction with hnRNP-A2(D’Ambrogio et al. 2009). Further on, Budini et al.,
investigating in details the minimal sequence needed for these interactions came out
with the residues 331–369. Rich composition in Gln/Asn residues of this sequence
and the observation that all the competing peptides caused the production of pre-
aggregates, they have decided to make a cellular model that could better mimic the
patient’s cytoplasmic aggregates. As an aggregation focus, they have choose to
engineere several plasmids carring 1, 4, or 12 tandem repeats of the 331–369 region
fused to EGFP(Budini et al. 2012).
Twelve tandem repeats of 331-369 Q/N-rich region of TDP-43 (12xQ/N) was able to
trigger the formation of the phosphorylated and ubiquitinated aggregates, both in
non-neuronal and neuronal cells, that recapitulates many features of the aggregates
observed in patients (Budini et al. 2012). Observed aggregates are indeedround,
large, ubiquitinated and phosphorylated formationspredominantly in cytoplasm. It is
49
interesting to note that these cytoplasmic aggregations caused nuclear TDP-43
depletion in this cell-based model of ALS, as already seen in the patient’s cells.
This novel research tool demonstarted an aggregation process that involves mainly
TDP-43 self-interactions that leads to phosphorylation, ubiquitination and possibly
nuclear TDP-43 depletion. Such a model is valuable to investigate the impact of the
aggregation on the cellular metabolism in the final stage of the aggregates observed
in patient’s brain, as well as a powerful tool to test new therapeutic strategies aimed
at reducing this phenomenon.
1.4 T reatment of A LS In addition to protein misfolding and aggregation, many other cellular pathologies
have been described in ALS patients, such as: glutamate excitotoxity, an excessive
stimulation of neurons by neurotransmitters such as glutamate, mitochondrial
dysfunction, inflammation and oxidative stress (Dunkel et al. 2012). Thus,
therapeutic approaches were mainly based around targeting one or more of these
cellular mechanisms.
Since its approval in the 1990‘s, riluzole, a presynaptic glutamate release inhibitor,
remains the only prescribed treatment for ALS patients offering a very modest
survival benefit of 2 to 3 months (Miller et al. 2007). Riluzole is shown to act solely
as an inhibitor of glutamate release. In addition it was reported that it is blocking
muscle sodium channels and the acetylcholine receptor involved in muscle
strengthning. Yet, it seems that Riluzole does not significantly affect muscle
strength or functional outcome in the patients. There are increasing number of the
drugs that are under investigation as a good candidate for ALS pathology treatment
(Table 2). Neuroprotective compounds from steroid family such as
Dihydrotestosterone (DHT) or the neurosteroid dehydroepiandrosterone (DHEA). It
was reported using ALS mouse models that these compounds are acting on
strengthening muscle through their neuroprotective effect, since ALS patients display
a severe muscle wasting and atrophy. Yet the exact mechanism underlying their
effect is still unknown(Hayes-Punzo et al. 2012). Arimoclomol, is a Heat-shock
protein (Hsp) co-inducer drug actually in Phase III clinical trial (Kalmar et al. 2008),
51
Compound Chemical Name structure Effect/Mechanism
Refrences/notes
Riluzole 6-(trifluoromethoxy)benzo[d]thiazol-2-amine
Glutamate signalling reduction
(McDonnell et al. 2012) F D A-approved riluzole
Dexpramipexole (R)-N6-propyl-4,5,6,7-tetrahydrobenzo[d]thiazole-2,6-diamine
Stabilizing mitochondria
in phase I I I clini cal trial (Glicksman 2011),(Dunkel et al. 2012)
Arimoclomol (R,Z)-3-(chloro((2-hydroxy-3-(piperidin-1-yl)propoxy)imino)methyl)pyridine 1-oxide
Co-inducer of heat-shock protein
in phase I I I clinical trial (Glicksman 2011),(Dunkel et al. 2012)
Olesoxime (8S,9S,10R,13R,14S,17R,E)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-6,7,8,9,10,11,12,13,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3(2H)-one oxime
Modulation of Mitochondrial pore
in phase I I I clinical trial (Dunkel et al. 2012), (Glicksman 2011)
Tamoxifen (Z)-2-[4-(1,2-diphenylbut-1-enyl)phenoxy]-N,N-dimethylethanamine
Autophagy inducer (Wang et al. 2012)
Spermidine N1-(3-aminopropyl)butane-1,4-diamine
Autophagy inducer (Wang et al. 2012)
52
Carbamazepine 5H-dibenzo[b,f]azepine-5-carboxamide
Autophagy inducer (Wang et al. 2012)
Rapamycin (3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-9,27-dihydroxy-3-[(1R)-2-[(1S,3R,4R)-4-hydroxy-3-methoxycyclohexyl]-1-methylethyl]-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-23,27-epoxy-3H-pyrido[2,1-c][1,4]-oxaazacyclohentriacontine-1,5,11,28,29 (4H,6H,31H)-pentone
Autophagy inducer (Staats et al. 2013)
DHT dihydrotestosterone
Neuroprotective (Yoo & Ko 2012)
DHEA dehydroepiandrosterone
neuroprotective (Hayes-Punzo et al. 2012)
53
Table 2: Chemical structure and mechanism of action of compounds reported to treat A LS disease. Adopted and reviewed in details in (Limpert et al. 2013)
Several other drugs are targeting dysfunctional mitochondria such as: olesoxime and
dexpramipexole. Both are involved in the prevention of mitochondrial dysfunction
and maintenance of energy production in stressed mitochondria within motor
neurons. Eventhough, dexpramipexole gave some promising results in the preclinical
trials, yet it failed in phase III of the clinical trial (Limpert et al. 2013; Glicksman
2011; Dunkel et al. 2012).
1.5 A LS treatment through autophagy induction
As many neurodegenerative diseases are described as proteinopathies and face a
problem with the intracytoplasmic protein inclusions, a viable therapeutic strategy is
PBA sodium phenylbutyrate
HDAC inhibitor (Ryu et al. 2005)
Trichostatin A 7-[4-(dimethylamino)phenyl]-N-hydroxy-4,6-dimethyl-7-oxohepta-2,4-dienamide
HDAC inhibitor (Yoo & Ko 2011)
DCA dichloroacetate
inhibits the pyruvate dehydrogenase enzyme, and modulates mitochondrial activity
(Miquel et al. 2012)
54
needed to overcome the aggregation problem. Indeed, promoting the clearance of
aggregate-prone proteins via pharmacological induction of autophagy-endolysosomal
pathway has proved to be a useful mechanism protecting against neuronal loss.
Autophagy is shown to be critical for motor neuron survival in many
neurodegenerative disorders such as spinal and bulbar muscular atrophy (SBMA,
Kennedy’s disease). Clinical symptoms and the histopathology of SBMA show many
similarities with ALS.SBMA is a progressive neuromuscular disorder in which
degeneration of lower motor neurons results in proximal muscle weakness, and
muscle atrophy. SBMA is among polyglutamine (polyQ) diseases that are caused by
the expansion in specific genes of a trinucleotides repeat, cytosine–adenine–guanine
(CAG), which encodes glutamine. CAG repeat expansion in the androgen receptor
(polyQ AR) accumulates in ubiquitin-positive aggregatesinside affected neurons of
SBMA patients(La Spada et al. 1991). In 2009, it has been demonstrated that
autophagy was able to degrade the aberrant proteins (polyQ AR) retained inside the
cytoplasm in mouse model of SBMA, thus pointing out the importance of the
autophagy activation in prevention of the motor neuron death (Montie et al. 2009).
In different ALS and TDP-43 models, similar studies have shown that autophagy
seems to have a major protective role in spinal motor neurons against
neurodegeneration. Full-length TDP43 has an exceptionally long half-life of 12–34 h
in most cell types, whereas TDP43 C-terminal fragments (CTFs) have a half-life of
only ~4 h. It is believed that both UPS and autophagic degradation pathways are
involved in maintaining the normal levels of TDP-43 inside cell and also the removal
of CTFs. Disruption of the UPS and autophagy might contribute to increased levels
of ubiquitylated TDP43 in ALS and FTLD-TDP. Indeed, inhibition of the UPS and
autophagy leads to increased levels of phosphorylated TDP43 aggregates in cultured
cells(Winton et al. 2008). Investigating the proteolytic pathways especially
autophagy, could be a promising strategy to treat TDP-43 aggregated disorders.
In fact, in primary motor neuron cultures, obtained from SOD1-G93A transgenic
mice (model of ALS), several autophagy substrates such as SOD1, ubiquitin, and
alpha-synuclein were significantly cleared when autophagy was induced using
lithium or rapamycin (Fornai, Longone, Cafaro, et al. 2008). Moreover, Kabuta and
55
colleagues reported that using wild-type and mutant SOD1 in neuronal and non-
neuronal cells, autophagy decreases mutant SOD1-mediated toxicity and its mutant
SOD1 protein aggregates levels (Kabuta et al. 2006).In line with this, Caccamo and
co-workers have overexpressed 25-kDa C-terminal fragment of TDP-43, that tends to
accumulate together with endogenous full-length TDP-43 in the cell, and were able
to modulate this accumulation and TDP-43 localization with the autophagy
activation(Caccamo et al. 2010). Wang et al., overexpressed TDP-43 and its
pathogenic form TDP-25 in HEK 293 cells and have demonstrated that the protein
levels of TDP-43 and TDP-25 were increased in cells treated with an autophagy
inhibitor, 3-MA, whereas, they were decreased in cells treated with an enhancer of
autophagy, trehalose(Wang et al. 2012).
Another study also confirmed the effect of rapamycin, as well as other autophagy
inducers, such as: spermidine, carbamazepine, and tamoxifen, in rescuing the motor
dysfunction of TDP-43 affected mice through autophagy pathway.Using FTLD-U
mouse model with TDP-43 proteinopathy, Wang et al., have shown that rapamycin
treatment effectively rescues the learning/memory impairment of these mice at 3
months of age, and it significantly slows down the age-dependent loss of their motor
function. These behavioral improvements upon rapamycin treatment are
accompanied by decreased level of caspase-3 and a reduction of neuron loss in the
brain of these mice. Furthermore, the number of cells with cytosolic TDP-43 positive
inclusions and the amounts of full-length TDP-43 as well as its cleavage products (35
kDa and 25 kDa) are significantly decreased upon rapamycin treatment. All these
studies suggest that autophagy induction may be a valid therapeutic target for TDP-
43 proteinopathies (Wang et al. 2012).
1.6 Dextran sulfate as inducer of autophagy
Dextran sulfate (DS) is a synthetic branched polyanionic sulfated compound derived
from purified dextran, that is originally synthesized by bacteria Leuconostoc
mesenterioides and then synthetically sulphated. Dextran sulfate can reach the level
of sulfur between 17 and 20 % of the total molecule. Once after being sulfated, every
glucose residue will present between 2 and 3 sulfate groups per glucosyl residue,
normally localized on carbons 2 and 4. 95% of the linkages between monomeres are
α-D-(16), and the other 5% are bindings of the type α-D-(13), directly related to
56
the chain branching of DS (Figure 9). DS is available commercially, with different
molecular weights, depending on the total amount of type α-D-(13) bindings
present and they can range from 5000 Da to 500.000 Da.
DS is a well-known compound used routinely in the biological field for decades. It
has been shown that low concentrations of DS can be used to selectively precipitate
lipoproteins such as VLDL and LDL, and higher concentrations of DS can also be
used to precipitate HDL. DS is in use as an agent able to separate DNA from histone
complexes, inhibit the binding of DNA with ribosomes, inhibit ribonucleases and it
has also been proven to inhibit initial binding of several viruses with cells, such as
the herpes virus and the HIV virus. Sulfated glycosaminoglycans, such as DS, have
been widely used in biotechnology as cell culture media additives, as they have
shown to promote cell growth, disperse cell clumps, increase viable cell yield, and
overall recombinant protein productivity.
Furthermore, for DS it has been shown to be safe for human consumption and indeed
DS has been used as an alimentary supplement for more than 20 years(Gräßler et al.
2013). It was originally discovered that DS possesses an anticoagulant capacity. Oral
F igure 9.Chemical structure of dextran sulfate
57
intake of DS is responsible for the reduced levels of LDL-cholesterol, HDL-
cholesterol, and triglyceride, confirming its action in reducing lipid metabolites in
humans. In this manner, DS has been used to prevent the progression of
atherosclerosis through its action as a competitor for the binding of modified LDL
with scavenger receptors in macrophages (Tsubamoto et al. 1994). Moreover, it has
also been reported that DS suppresses the expression of adhesion factors involved in
metastases, conferring anti-metastatic capacity to this polyanion (Takagi et al. 2005).
Furthermore, DS was able to work as a cytoprotectant of myocardial ischaemic and
damaged endothelium (Banz et al. 2005).
It has been proven that DS 5.000 Da, due to the presence of the sulfated groups, has
the capacity of mimicking endogenous glycosaminoglycans, thus showing many
effects on cells.Recently, DS was shown to act as an anti-apoptotic agent on CHO
cells, under staurosporine-induced apoptosis (Jing et al. 2011).They have shown that
dextran sulfate action involves mitochondrial pathway, since they were able to
measure a significant decrease of pro-caspase-9 activation, cleaved caspase-3 levels,
cytochrome c release into the cytosol and mitochondrial transmembrane potential
collapse.
In this note, our group have shown that DS5000 Da (DS5000) is able to prolong the
life of cells interfering with the apoptotic pathway (Menvielle et al. 2013). At a
molecular level, we show that DS inhibits apoptosis by DNA fragmentation delay
and decrease of annexinV-labeled cells, causes a G0/G1 cell-cycle arrest, decreases
p53 expression and increases the pro-survival factor Hsc70 expression. Moreover,
we were able to demonstrate that DS treatment also resulted in an enhanced LC3-I to
LC3-II conversion and increased autophagosomes formation employing tagged-LC3.
The experimental evidence provided in this work indicates that DS 5000 Da
treatment in low doses is able to induce autophagosome formation most likely in a
cell type independent manner. Nonetheless, our findings strongly suggest that
sulfated glycosaminoglycans should be re-considered, in this new context, as
autophagy inducers.
Aim of the study:
58
Previously established cell-based TDP-43 aggregation model, where tandem repeats
carrying the C-terminal Q/N-rich region of TDP-43 were able to trigger the
formation of phosphorylated and ubiquitinated aggregates, will be used in this study
to investigate the autophagy-endolysosomal cell pathway response.
As there is continuous need for the new and more effective agents in the treatment of
proteinopathies, it would be interesting to investigate if TDP-43 12xQ/N cell-based
model of aggregation could benefit from the autophagy induction and if DS
treatment is able to enhance inclusions clearance and modulate subcellular
distribution of TDP-43.
With such approach we hope to gain more knowledge about new therapeutic
strategies/effectors, which might have a broad therapeutic potential in human TDP-
43 proteinopathies.
59
2. M A T E RI A LS A ND M E T H O DS 2.1. Chemical reagents:
General chemicals were purchased from Sigma Chemical Co., Merck, Gibco
BRL, Boehringer Mannheim, Carlo Erba and Riedel-de Haen.
Dextran sulfate sodium salt 5000 Da (DS, Sigma) was dissolved in water and
sterilized through 0.22 µm filter.
Trichostatin A (TSA, from Sigma) was dissolved in DMSO, Four hours before
harvesting, cells were treated with 5 µM final concentration of TSA, and the
same concentration of TSA was kept in the cell lysis buffer, DMSO (Riedel-de
Haen) was used as vector control.
2.2. Standard solutions:
All solutions are identified in the text except for the following:
TE: 10 mM Tris-HCl (pH 7.4), 1 mM EDTA (pH 7.4)
PBS: 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4
10X TBE: 108 g/l Tris, 55 g/l Boric Acid, 9.5 g/l EDTA
5X DNA sample buffer: 0.25 % w/v bromophenol blue, 0.25 % w/v xylene
cyanol FF, 30 % v/v glycerol in H2O.
Transfer buffer (proteins transfer from the SDS-PAGE 10% gel to the
nitrocellulose membrane):
Electro-transfer buffer 10X: 1 liter of this buffer should be prepared as follows:
Reagent Quantity
Tris (Invitrogen, cat. Nº 15504-020, or similar) 30,3 gr
Glycine(Sigma, cat. Nº 33226, or similar). 144 gr
Running buffer 10X: 1 liter of this buffer should be prepared as follows:
Reagent Quantity
60
Tris (Invitrogen, cat. Nº 15504-020, or similar) 30,3 gr
Glycine(Sigma, cat. Nº 33226, or similar). 144 gr
SDS (BDH, cat. Nº 301754L, or similar) 5 ml
2.3. Cells:
Bacter ia (for cloning)
E .coli D H5α competent cells
Genotype: F- 80dlacZ M15 (lacZY A-argF) U169 recA1 endA1hsdR17 (rk-, mk+)
phoAsupE44-thi-1 gyrA96 relA1.
Mammalian cells
H E K 293 F lp-In™ 293 T-Rex (Invitrogen™): Human Embryonic Kidney 293 cell
lines is designed for rapid generation of stable cell lines that ensure homogenous
expression of your protein of interest from a Flp-In™ expression vector. These cells
contain a single stably integrated FRT site at a transcriptionally active genomic
locus. Targeted integration of a Flp-In™ expression vector ensures high-level
inducible expression of the gene of interest (EGFP-12xQ/N) upon the addition of
tetracycline (see further).
U2OS: U2OS cell line, originally known as the 2T line, was cultivated from the bone
tissue of a fifteen-year-old human female suffering from osteosarcoma.
NSC-34 cell line: The motor neuron-like cell line NSC-34 is a hybrid cell line
produced by fusion of neuroblastoma with mouse motor neuron-enriched primary
spinal cord cells.Cultures contain two populations of cells: small, undifferentiated
cells that have the capacity to undergo cell division and larger, multi-nucleate cells
that express many properties of motor neurons.
2.4. Cell growth media:
Bacteria
61
Luria-Bertani (L B) medium: 10 g bacto-trypton, 5 g bacto-yeast extract, 10 g NaCl
per 1 liter medium. Ampicillin was added at a concentration of 50-100 µg/ml. For
hardening 1.5% agar-agar was added to the liquid medium.
Mammalian cells: D M E M complete media D M E M/Glutamax-I: Dulbecco's modified minimal
essential medium (Gibco-Invitrogen) supplemented with antibiotic-antimycotic
solution (Sigma) and decomplemented 10 % fetal calf serum (FCS, Gibco-
Invitrogen).
C ryo medium: For long-term storage, cells were frozen in liquid nitrogen in 90 %
FBS + 10 % DMSO.
2.5. Preparation of bacter ial competent cells:
Bacterial competent cells were prepared following the method described by Chung
and Niemela (Chung et al. 1989). Effectively, E.coli strains were grown overnight in
10 ml of LB at 37° C. The following day, 140 ml of fresh LB were added and the
bacteria were grown in the shaker at room temperature for 30-40 min until the
Optical Density (OD)600 nm was 0.3-0.38 at λ=600 nm. The cells were transferred
into a 50 ml falcon, then placed in ice, and then centrifuged at 4° C and 1000 rpm for
10 minutes. The pellet was resuspended in 1/10 of the initial volume of cold TSS
solution (10% w/v PEG molecular weight 4000, 5% v/v DMSO, 35 mM MgCl2, pH
6.5 in LB medium). The cells were aliquoted, rapidly frozen in liquid nitrogen and
stored in -80° C. Competence was determined by transformation with 0.1 ng of
PUC19 and was deemed satisfactory if this procedure resulted in more than 100
colonies.
2.6. Amplification of selected DN A fragments (PC R):
The polymerase chain reaction (PCR) was performed using plasmid DNA as
template, and following the basic protocols of Roche Diagnostic TaqDNA
polymerase. The volume of the reaction used was 50µl and comprised: 1x Taq
buffer, dNTPs mix (250 µM each), oligonucleotide primers (100 nM each), Taq
DNApolymerase (between 2.5 and 5 U), and 100 ng of the DNA template. All
62
synthetic DNA oligonucleotides used for PCR amplification were purchased from
integrated DNA technologies (http://www.idtdna.com). The standard amplification
conditions were the following: 94°C for 5 minutes for the initial denaturation, 94°C
for 45 seconds, 55° C for other 45 seconds, 72°C for 1 minute. This was repeated for
35 cycles, and after there was a final elongation phase at 72°C for 10 minutes.
Products of the PCR were routinely fractionated in 0.8-1% agarose gels. All
amplifications were performed on Cetus DNA thermal cycle (Perkin Elmer).
2.7. Enzymatic modifications of DN A :
Restriction enzymes
Restriction enzymes used for analytical digests were used according to
manufacturer's instructions. For these analysis, 100 to 500 ng of DNA were digested
in a volume of 20 µl containing the appropriate buffer for each particular enzyme.
The digested was incubated for 2 to 4 hours at the optimal temperature required by
the enzyme that is used. Preparative digestions of vectors and inserts were made of 5
to 10 µg DNA using the appropriate condition needed by the restriction enzyme in
100 to 200 µl reaction volume. Enzymatic activity was then removed either by heat
inactivation or by phenol-chloroform extraction.
DN A polymerase I , Large (K lenow) fragment
Klenow enzyme was used to treat PCR products from blunt-end creation by 3'
recessed fill-in. Briefly, the product obtained was supplemented with 1 µg of Klenow
fragment for every µg of DNA, and 4 mM MgCl2. The samples were afterwards
incubated for 30 minutes at 37° C. Enzyme was later inactivated by incubation at 65°
C for 20 minutes.
Calf intestinal phosphatase
Calf intestinal phosphatase CIP, provided from New England Biolabs Inc., catalyzes
the removal of 5' phosphate groups from DNA. When cloning a DNA fragment onto
a particular vector, CIP-treated fragments lack the 5' phosphoryl termini required by
ligases, for which vectors would be unable to self-ligate. This strategy was therefore
used in order to reduce the vector background in cloning strategies. The standard
63
reaction was carried out in a final volume of 50-100 µl using 1 U of enzyme for
every 0.5 µg of DNA, at 37° C for one hour.
Agarose gel electrophoresis of nucleic acid
DNA samples were size fractionated by electrophoresis in agarose gels ranging in
concentrations from 0.8% w/v (large fragments) to 1.5% w/v (small fragments). The
gels contained Ethidium Bromide (0.5 µg/ml) and 1X TBE solution. Horizontal gels
were used for fast analysis of DNA restriction enzyme digests, estimation of DNA
concentration, or DNA fragment separation prior to elution from the gel. DNA was
visualized by UV transillumination and the result recorded by digital photography.
E lution and purification of DN A fragments from agarose gels
This protocol was used to purify both vectors and inserts of DNA for cloning
purposes. The DNA samples were electrophoresed onto an agarose gel as described
previously. The DNA was visualized with UV light and the required DNA fragment
band was excised from the gel. This slab was cut into pieces, and the QIAquick gel
extraction kit was used, according to the manufacturer's instructions. Briefly, 1
volume of binding buffer QX1 was added to 1 volume of gel for DNA fragments and
incubated in 65° C until the gel was completely dissolved. Afterwards, the mixture of
binding buffer with the DNA was put into a prepared column, which was later
centrifuged at 10000g for 1 minute. Flow-through was discarded. Two rounds of
washing steps were later performed with 750 µl of wash PE buffer. After, the DNA
bound to the column was eluted with 30-50 µl of sterile water.
2.8. T ransformation of bacteria:
Transformation of bacterial clones was carried out using 1 ng of the plasmid DNA.
The DNA was incubated with 60 µl of competent cells for 20 minutes on ice and
then at 42° C for 2 minutes. After the step of the heat shock, 60 µl of LB were added
and the bacteria allowed to recover for 10 minutes at 37° C. the cells were then
spread onto agar plates containing the appropriate antibiotic. The plates were then
incubated for 12-15 hours at 37° C. When DNA inserts were cloned into β-
64
galactosidase-based virgin plasmids, 30 µl of IPTG 100 mM and 20 µl of X-Gal (4%
w/v in dimethylformamide) were spread onto the surface of the agar before plating to
facilitate screening of positive clones (white colonies) through identification of β-
galactosidase activity (blue colonies) which indicates the negative clones.
2.9. RN A preparation from cultured cells:
Cultured cells were washed and then RNA Trizol (Invitrogen SRL, Milano, Italia)
was added. Then, chloroform extraction was performed. Supernatant was
precipitated with isopropanol. The pellet was resuspended in 50 µl of dH2O and
digested with 1U of DNase RNase free. The mix was incubated at RT for 30 minutes,
and then the RNA was purified by acid phenol extraction. The final pellet was
resuspended in 33 µl of dH2O and frozen at -80° C. the RNA quality was checked by
electrophoresis on 0.8% agarose gels.
2.10. Estimation of nucleic acid concentration:
The concentration of a DNA sample can be checked by the use of UV
spectrophotometry. DNA absorbs UV lights, thus making it possible to detect and
quantify on very low concentrations. The nitrogenous bases in nucleotides have an
absorption maximum at about 260 nm. An optical density of 1.0 at 260 nm is usually
taken to be equivalent to a concentration of 50 µg/ml for double stranded DNA, and
approximately 40 µg/ml for single-stranded DNA and RNA. The ratio of the
absorbance at 260 nm vs 280 nm is a major of the purity of a sample. A sample in
which this ratio equals of tops the value of 1.8 is considered a pure sample. If this
value is lower than 1.8, then it is considered that samples present protein
contamination.
2.11. cDN A preparation and R T-PC R:
In order to synthesize cDNA, 3 µg of total RNA extracted from cells were mixed
with random primers (Finnzymes Oy., Vantaa, Finland) in a final volume of 20 µl.
After denaturation at 65° C for 5 minutes, the RNA and the primer were incubated
65
for 1 hour at 37° C in the following solution: 1X First standard Buffer (Gibco), 0.1
mM DTT, 10 mM dNTPs, RNase inhibitor 20U (Ambion) and Moloney murine
leukemia virus reverse transcriptase 100 U (Gibco) and retrotranscribed with
poly(dT) primer. 3µl of the cDNA reaction mix was used for the RT-PCR analysis.
The conditions used for the RT-PCRs were the following: 94° C for 5 minutes for the
initial denaturation, 94° C for 45 seconds, 56° C for 45 seconds, 72° C for 45
seconds, for 35 cycles, and 72° C for 10 minutes for the final extension. The RT-
PCRs were optimized to be in the exponential phase of amplification. PCR products
were resolved by 1% agarose gel electrophoresis (it was used to quantify mRNA of
Atg7 in the siAtg7 experiment before buying the Atg7 antibody).
2.12. Mammalian cell line and cell culture conditions:
U2OS, HEK 293 and HeLa cell lines were grown in DMEM/Glutamax-I (Gibco)
supplemented with 10% fetal bovine serum (Gibco) and antibiotic/antimycotic
suspension (Sigma).
NSC34 cell line was grown in DMEM/Glutamax-I (Gibco) supplemented with 5%
fetal bovine serum (Sigma) and antibiotic/antimycotic suspension (Sigma) and
differentiation was induced decreasing the serum concentration to 1% for at least 48
hours.
All cells were maintained at 37°C in a humidified atmosphere of 5% CO2. Cells
were grown in flasks and passaged once a week. Flp-In T-Rex HEK 293 were
maintained under Hygromycin and 5 µg/l of Blasticidin.
Passage of cell lines:
Plates containing a confluent monolayer of cells (U2OS, andFlp-In T-RexHEK 293
cell lines) were washed with PBS solution, then incubated at 37° C with 1-2 ml of
PBS/EDTA/Trypsin solution (PBS containing 0.04% w/v EDTA and 0.1% Trypsin)
for two minutes or until cells were dislodged. After adding 10 ml of media, cells
were pelleted by gentle centrifugation and resuspended in 5 ml pre-warmed medium.
1-2 ml of this cell suspension was added to 10 ml medium in a fresh plate and was
gently mixed before incubation.
66
NSC34 cells were plated in P100 plates, and only "Corning"® tubes were used, these
cells should not be treated with trypsin, instead NSC-34 cells were harvested by
scrapping them gently using cell scraper.
The cells suspension was split into flasks, dishes, plates or coverslips as required.
2.13. Plasmids:
pE G FP-12xQ /N construct was generated as mentioned in (Budini et al. 2012).
Construction of pF L A G-C M V4-T DP-43wt plasmid was described before (Ayala et
al. 2005). HcRed-hLC3 plasmid was a gift from Dr. Isei Tanida.
Plasmids ptfL C3 (Addgene 21074),
pcDN A-H D A C6-flag (Addgene 30482) and pcDN A-H D A C6.D C-flag (Addgene
30483) were purchased from Addgene.
Generation of the F L A G-tagged H D A C6 wild-type and catalytically-inactive
mutant
To make siRNA-resistant constructs pcDNA-HDAC6-flag and pcDNA-HDAC6.DC-
flag were mutated introducing the silent mutations with the use of the following
forward primer HDAC216G219T: gggactgcagggtatggatctgaac and corresponding
reverse primer.
2.14. T ransfection:
For transient transfection in U2OS cells, pEGFP-12xQ/N andHcRed-hLC3 we used
Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
The plasmid pFLAG-CMV4-TDP-43wt, in the adding back experiment of pcDNA-
HDAC216G219T.WT-flag and the catalytically inactive mutant(pcDNA-
HDAC216G219T.DC-flag) were introduced with calcium phosphate transfection
method.
Calcium phosphate transfection method:
The calcium phosphate transfection method is based on the formation of a calcium
phosphate-DNA precipitate. The calcium phosphate is thought tofacilitate the
67
binding of the DNA to the cell surface; subsequently, the DNA enters the cell by
endocytosis.
The transfection was done in this study according to the method established in the
lab. 4 hours before transfection, we change the medium for the cells. In one
Eppendorf tube, 25 µl of 500 mM CaCl2 and 5 µg of plasmid DNA were added, and
the final volume was adjusted to 50 µl with ddH2O. The formed DNA-CaCl2
complex was added drop by drop to 50 µl of 1X HBS prepared in another tube.
Aeration was cared to form during this step in order to obtain the maximum contact
between the DNA-CaCl2 complex and the HBS buffer, therefore very fine DNA-
CaCl2 precipitate. The DNA precipitate was drop wise added to the cells after
incubation for 25-30 minutes at RT. The cells were further incubated overnight at
37°C in a CO2 5% incubator.
2.15. G eneration of F lp-In™ T-Rex™ HEK 293 cells that
inducibly expressing E G FP-12xQ/N:
For these studies, we chose to use Human Embryonic Kidney 293 (HEK-293) cells
transfected with the Flp-In™ T-Rex™ Expression System (Flp-In™ T-REx™ 293
Cell Line, Invitrogen). This expression system uses a tetracycline-based repressor to
control transgene expression. In the Flp-In system, the integration of the expression
construct or thetransgene into the host cell genome occurs via Flp recombinase-
mediated intermolecular DNA recombination.We took EGFP-12xQ/N fragment from
the homonymous plasmid as XhoI and BamHI (Budini et al. 2012) and blunt-ended it
using Klenow fragment. Next, the expression vector pcDNA5/FRT/TO (Invitrogen)
was digested with the same restriction enzymes and EGFP-12xQ/N insert was cloned
inside. The pcDNA5/FRT/TO vector has a tetracycline-inducible promoter upstream
of the multiple cloning sites allowing the regulation of EGFP-12xQ/N expression.
Flp recombinase is expressed by the pOG44 plasmid. The recombination occurs
between the specific FRT sites on theinteracting DNA molecules.
The Flp-In™ TRex™ 293 cells were maintained in Dulbecco’s Modified Eagle
Medium (DMEM, Gibco), containing 10% fetal bovine serum (FBS) and
penicillin/streptomycin.EGFP-12xQ/N repetitions were digested from pEGFP-
68
12×Q/N plasmid and sub-cloned in the pCDNA5/FRT/TO vector. Flp-In-293 T-Rex
stable cell line was constructed upon co-transfection with the pCDNA5/FRT/TO-
EGFP-12xQ/N and pOG44 vector encoding Flp recombinase in a 1:4 ratio with
Lipofectamine The Flp-In T-Rex 293 cells were maintained in a humidified
incubator at 37ºC with 5% CO2under selective pressure (100 μg/ml hygromycin,
Invivogen). When necessary, the expression of pEGFP-12×Q/N was induced upon
tetracycline in the concentration 1.0 μg/ml.
2.16. Antibodies:
Antibody anti-Atg7 was obtained from Sigma (A2856), anti-LC3 (Sigma, L7543),
anti-p62 (Abcam, ab96134 for immunofluorescence), anti-p62 (Progen, GP62-C for
immunoblotting), anti-lamp1 (Abcam, ab25630), anti-flag (Sigma, F1804), anti-
TDP-43 (anti-TDP-43deltaQ/N, Protein Tech, 10782-2-AP), anti-actin (Sigma,
A2066), anti-tubulin (Sigma, T5168), anti-p84 (Abcam, ab487), anti-GFP (Santa
Cruz, sc-8334), anti-HDAC6 (Santa Cruz, sc-11420), anti-acetylated tubulin (Sigma,
611B-1), goat anti-mouse-AlexaFluor (Molecuar probe, A-11005), and goat anti-
rabbit-Texas red (Molecular probe, T-2767).
2.17. RN A interference (siH D A C6) and adding-back
experiment (H D A C6-W T ,H D A C6-D C):
Flp-In-293 T-Rex stable cell line expressing EGFP-12xQ/N was transfected twice
with oligofectamine (Invitrogen), distanced 24 hours, with 20 µM of siRNA for
Atg7. Sense strand of RNAi oligo (Sigma) for Atg7 was
GGUCAAAGGAUGAAGAUAA and siCONTROL against the firefly luciferase
gene was used as a non-targeting siRNA control. Cells were collected 24 hours after
the second transfection for total protein and total RNA extractions. Trizol reagent
(Invitrogen) was used for total RNA isolation. The level of Atg7 expression was
checked both by RT-PCR and immunoblotting using anti-Atg7 antibody.
Flp-In-293 T-Rex stable cell line expressing EGFP-12xQ/N were transfected three
times with 160nM of siRNA for HDAC6 using Hiperfectamine HiperFect (Qiagen)
in three consecutive days. Sense strand of RNAi oligo (Sigma) for HDAC6 was
69
CUGCAAGGGAUGGAUCUGAAC and siCONTROL against the firefly luciferase
gene was used as a non-targeting siRNA control. The first 24 hours the cells were
treated with tetracycline for EGFP-12xQ/N expression. The third day the cells were
transfected with siRNA-resistant pcDNA-HDAC6-flag and pcDNA-HDAC6.DC-
flag constructs and six hours post-transfection 100mg/l of dextran sulfate was added
to the cells culture media. The cells were harvested on the day four and whole cell
lysates were prepared for further immunoblotting.
2.18. SDS-PA G E :
For assessing the protein expression level, we ran protein samples on NuPAGE®
Novex® 4-12% Bis-Tris Precast Gel (Life technologies). Electrophoresis was
performed using a XCell SureLock® Mini-Cell, according to the manufacturer
instructions. In brief, protein samples were added with 2.5 µl of NuPAGE® LDS
sample buffer and 1 µl of NuPAGE® reducing agent, and water was added until a
volume of 10 µl was reached. Samples were then heated for 10 minutes at 70°C. for
preparing the 1X running buffer, 50 ml of 20X NuPAGE® MES running buffer were
added to 950 ml of deionized water. Sample was loaded onto the gel. After, both
upper and lower chambers were filled with 1X running buffer. Samples were ran for
40 minutes at constant 200V.
2.19. W estern blot analysis:
Cell pellets were lysed on ice in 300 μl of lysis buffer (15 mM HEPES, pH 7.5, 250
mM NaCl, 0.5% Nonidet P-40, and 10% glycerol) supplemented with proteases
inhibitors (Roche Applied Science mixture) and phosphatase inhibitors (10 mM NaF,
1 mM β-glycerol phosphate, and 1 mM Na3VO4). Cells were sonicated with 10
pulses at 50% of power (Bioruptor UCD-200, Diagenode) and centrifuged at 700 × g
for 10 min at 4 °C. Pellet was discarded and the total protein concentration in the cell
lysate was determined with Bradford reagent. Samples were resolved on a 4-12%
NuPAGE gel (Invitrogen), and then transferred to nitrocellulose membrane. Blots
were probed with different primary and secondary antibodies. The primary antibody
was diluted in 2% milk-PBS-Tween 0.1% v/v and left incubating overnight.
70
Secondary antibody was diluted 1:2000 in 2% milk-PBS-Tween 0.1% v/v and left
incubating for 1 hour. Reactive species were visualized by ECL chemiluminescence
kit (Thermo scientific).
Cell lysate fractionation and filter trap assay:
For the cell lysate fractionation, 50 μg of each total cell lysate was centrifuged at
16,000 × g for 30 min at 4 °C. The supernatant was transferred into a new tube as a
soluble fractions (S), and the pellet (insoluble fractions, P) was washed again with
lysis buffer and resuspended in 8 M Urea, and sonicated again. To analyze each
fraction by immunoblotting, 50 μg of total lysates (IN), the entire soluble fraction
(S), and all pellet volume (P) were loaded in a 10% SDS-PAGE under reducing
conditions. The membrane was tested with anti-GFP, anti-flag, anti-actin and anti-
tubulin antibodies. For filter trap assay 50 µg of total lysates were loaded on the pre-
wetted cellulose acetate 0.2 µm membrane (Sterlitech) using a slot-blot device. Each
well was washed twice with PBS and immunoblotting with anti-GFP antibody was
performed.
2.20. Immunofluorescence microscopy:
U2OS cells (1×105) and Flp-In-293 T-Rex stable cell line (5x104) were plated in 6-
well plates containing coverslips. The next day U2OS cells were transfected with
pEGFP-12×Q/N plasmid. Flp-In-293 T-Rex stable cells were treated with
tetracycline for 24 hours in order to induce EFGP-12xQ/N expression. When
immunofluorescence required, the cells were washed with PBS and fixed in 4%
paraformaldehyde in PBS (15 min at room temperature) and permeabilized by using
0.3% Triton X-100 in PBS for 5 min on ice. After blocking with 2% BSA/PBS for 20
min at room temperature, an immunolabeling was carried out at room temperature
for 1 h in 2% BSA/PBS. Cells were washed 3 times with PBS and incubated with
conjugated secondary antibody at room temperature for 1 h. Nuclei were stained with
4, 6-diamidino-2-phenylindole (DAPI). The analysis was done on a Zeiss LSM 510
confocal microscope (63x1.4NA plan-apochromat oil immersion lens) using Zeiss
LSM510 software. Image J software was used for subsequent image processing.
71
Colocalization was determined by calculating the Pearson’s coefficient from the
individual cells with Volocity software (Perkin Elmer).
2.21. Clearance assay in stable Hek293 cells expressing
E G FP-12xQ/N
Expression of EGFP-12xQ/N in Flp-In-293 T-Rex stable cell line was induced with
1ug/ml tetracycline for 24 hours and then the transgene expression was switched off
by removing tetracycline from the medium. Further on, cells were treated with
dextran sulfate (100 μg/ml) and the amount of transgene product decay was detected
after 48 hours later by immunoblotting with antibody against GFP. In addition,
approximately 800 cells were counted by fluorescence microscope for the proportion
of cells with EGFP-12xQ/N aggregates after DS treatment in comparison to the
control. Error bars represent standard deviations from three independent experiments.
2.22. Viable cell count determination:
Tetrazolium dye assay (MTT) was used to measure cytotoxicity (loss of viable cells)
after dextran sulfate 5000 Da additions into the media. NSC34 cells were plated (10
000 cells per well) before or after EGFP-12xQ/N transfection using lipofectamine
2000. After 6 hours dextran sulfate was added into the media and the number of
viable cells was assessed after 48 hours. 20 µl of 5mg/ml of MTT solution (Sigma)
was added to each well and incubated for 4 hours at 37°C in a humidified, 5% CO2
atmosphere. Later, the micro-plate was centrifuged at 1500 rpm, 15 min, 5ºC and the
culture media was removed from the wells by gentle vacuum suction. The micro-
plate was frozen for at least one hour and 100 µl of isopropanol was added in each
well, mixed and the absorbance was read at a spectrophotometer (570 nm).
72
3. R ESU L TS
3.1. Cellular model of T DP-43 aggregation and autophagy-lysosome
pathwayinvolvement
TDP-43 became one of the main players in Amyotrophic Lateral Sclerosis (ALS) and
Fronto-Temporal Dementia (FTD) since it was identified as the major component of
the pathological protein aggregates in patients. In patient’s affected neurons TDP-43
is mislocalized to the cytoplasm, forming inclusions that contain ubiquitinated,
hyperphosphorylated and cleaved TDP-43 (Neumann et al. 2006; Arai et al.
2006).Over 40 TDP-43 mutations have been associated with pathological conditions
collectively termed as TDP-43 proteinopathies (Barmada & Finkbeiner 2010). Most
of these mutations were localized in C-terminal region of TDP-43 (Pesiridis et al.
2009), generally found to be responsible to mediate protein-protein interactions
(D’Ambrogio et al. 2009). In addition, C-terminal region once cleaved, it generates
C-terminal fragments (CTFs) that were found associated with cellular toxicity and
TDP-43 mislocalization in ALS patients (Winton et al. 2008; Zhang et al. 2009). C-
terminal region of TDP-43 was mapped and has been shown to contain Gln/Asn
(Q/N) rich domain able to enhance inclusion formation(Igaz et al. 2009), thus acting
as a potential prion-like domain(Udan & Baloh 2011). In previous works, it has been
demonstrated that the C-terminal Q/N–rich region of TDP-43 is involved in the
73
interaction with the other members of the hnRNP family and with itself
(D’Ambrogio et al. 2009; Fuentealba et al. 2010). On the base of these findings,
Budini et al., have made twelve tandem repeats of 331-369 Q/N-rich region
(12xQ/N) fused to EGFP that was able to trigger the formation of cytoplasmic
aggregates in non-neuronal and neuronal cell lines. Indeed, these EGFP-12xQ/N
aggregates are predominantly cytoplasmic, phosphorylated and ubiquitinated and are
able to recapitulate many features observed in the ALS patients (Budini et al. 2012).
Therefore, since one of the major problems of ALS patients are intra-cytoplasmic
protein inclusions, this cellular model is considered as a useful in vitro model of
TDP-43 aggregation that can be used to investigate differential roles of cellular
protein degradation pathways.
Ubiquitin proteasome system (UPS) and autophagy-lysosome pathway are the two
main cellular mechanisms for abnormal proteins removal. The UPS usually
successfully degrades misfolded and/or damaged proteins. If the amount of proteins
targeted to the UPS surpasses the degradation efficiency rate of the proteasome,
subsequent oligomerization and accumulation of proteins activate autophagy
(Korolchuk et al. 2010). On this way, aggregated proteins that are too large to enter
the UPS pore become substrates for autophagy (Verhoef et al. 2002). Autophagy is
the catabolic process by which the cell degrades cytoplasmic components within
lysosomes (Kroemer et al. 2010). Autophagy has been long thought to be an essential
non-selective bulk degradation pathway. However, recently accumulating evidence
has highlighted the selective elimination of unwanted components such as aberrant
protein aggregates, dysfunctional organelles and invading pathogens by autophagy
(Hubbard et al. 2012). The selective degradation of protein aggregates by autophagy
is called aggrephagy (Lamark & Johansen 2012). Some of the molecular components
involved in selective autophagy have been identified, such as specific autophagy
receptors able to guide the cargo to the site of autophagosomal engulfment. For
example, protein ubiquitination can be a sensor that targets proteins to the
autophagosomes (McEwan & Dikic 2011). The recognition of ubiquitinated
substrates is mediated by molecular adaptors including p62, NBR1, and optineurin,
which bind on one side to ubiquitin and on the other to the autophagosome-specific
proteins, such as LC3/GABARAP/Gate16 family members (Johansen & Lamark
2011).
74
We decided to use EGFP-12xQ/N TDP-43 aggregation model in transiently
transfected U2OS cells as described by Budini et al. to test the autophagic response
of the cell. In order to test this, we performed immunocytochemistry using
autophagy-lysosome pathway markers. A commonly used method to measure
autophagic activity is the direct determination of LC3 localization employing tagged-
LC3 (Mizushima 2004).Tagged LC3 can be seen diffused throughout the cell, while
inside autophagosomes can be distinguished as clear fluorescent dots. To
characterize aggregates labeling by an autophagosome marker LC3 (Kabeya et al.
2000), we cotransfected U2OS cells with pEGFP-12xQ/N and pHcRed-hLC3
constructs and followed their expression and localization under fluorescence
microscope. We were able to see certain cells where exogenous LC3 (in red)
colocalize with EGFP-12xQ/N aggregates (in green) (Figure 10A). This result
suggested an autophagic fate of the EGFP-12xQ/N aggregates.
As amyotrophic lateral sclerosis disease is a late-onset progressive neurodegenerative
disease affecting motor neurons, we wanted to see if the aggregation pattern of
EGFP-12xQ/N would be maintained in the motor neuronal cells in vitro. NSC-34 is a
hybrid cell line produced by fusion of motor neuron enriched, embryonic mouse
spinal cord cells with mouse neuroblastoma, therefore suitable for this study. We
decided to assess the expression of EGFP-12xQ/N in NSC-34 cells and to check
whether it is possible to see GFP-12xQ/N aggregates sequestered inside
autophagosomes. Therefore, 48 hours post differentiation (cell culture medium
conditions change from 5% to 1% of serum), we cotransfected NSC-34 cells with
EGFP-12xQ/N and HcRed-hLC3 plasmids. Cells were fixed and visualized under
confocal microscope. We were able to see some cells where EGFP-12xQ/N
aggregates were sequestered inside the autophagosomes (Figure 10B) in agreement
with the results obtained in U2OS.
We further examined the localization of degradation adaptor protein, p62/SQSTM1
(p62/sequestosome) and EGFP-12xQ/N aggregates. Protein p62 is involved in
targeting ubiquitinated proteins to the autophagy pathway and is responsible for
autophagy elimination of misfolded proteins(Johansen & Lamark 2011). In addition,
it has been reported that aggregated TDP-43 in ALS and FTD tissue were labeled by
p62. We have found some large EGFP-12xQ/N aggregates (in green) decorated with
75
an endogenous p62 (in red) (Figure 10C). This evidence indicated adaptor protein
p62 recruitment in response to the EGFP-12xQ/N aggregation.
Furthermore in order to confirm autophagy-lysosome pathway respond to the
aggregation we sought to investigate if EGFP-12xQ/N aggregates are labeled with
the late endosome/lysosome marker Lamp 1 (lysosomal associated membrane protein
1). After transfecting U2OS cells with EGFP-12xQ/N plasmid, the cells were stained
for the endogenous Lamp1. Under the fluorescence microscope some cells show an
overlapping of EGFP-12xQ/N (in green) and Lamp1 (in red) signals (Figure 10D).
Our findings to date suggested that autophagy-lysosome markers LC3 and Lamp 1
and adaptor protein p62 label some EGFP-12xQ/N aggregates in our cellular TDP-43
aggregation model, probably targeting them for degradation through the autophagy.
77
(A) U2OS cells cotransfected with pEGFP-12xQ/N (in green) and HcRed-hLC3
(in red) plasmids show clear colocalization of an autophagosome marker
LC3 with aggregates (merge in yellow). To visualize the cells, nuclei were
stained with 4, 6-diamidino-2-phenylindole (DAPI). Cells were analyzed on
Leica DMIRE2 inverted fluorescence microscope. Images were acquired
using 63X oil immersion objective. (B) Mouse motor neuronal-like cells
NSC-34 cells were cotransfected with pEGFP-12xQ/N (in green) and
HcRed-hLC3 (in red). Merge channel shows a clear colocalization of an
autophagosome marker LC3 with aggregates (merge in yellow). Nuclei are
shown with dotted lines. Images were acquired using Zeiss LSM 510
confocal microscope under 63X oil immersion objective. (C) EGFP-12xQ/N
expressing U2OS cells were labeled with p62 antibody (in red) in order to
visualize this degradation adaptor protein within cell. Some cells with
aggregates (in green) show clear colocalization with p62 protein (in red).
Cells were analyzed on Zeiss LSM 510 confocal microscope. Images
represent a single confocal section of 0.1 µm acquired using 63X oil
immersion objective and 2X zoom. (D) Antibody against lysosome marker
Lamp1 (in red) revealed colocalization of this late endosome/lysosome
marker with EGFP-12xQ/N aggregates (in green) in some U2OS transfected
cells. Dotted lines are showing the position of the nuclei. Cells were
analyzed on Zeiss LSM 510 confocal microscope. Images represent a single
confocal section of 0.1 µm acquired using 63X oil immersion objective and
2X zoom.
78
3.2. Dextran sulfate 5000 Da decreases the number of cells containing E G FP-
12xQ /N aggregates
Viable therapeutic strategy is needed to overcome the aggregation problem in TDP-
43 proteinopathies and one of the strategies would be to promote the clearance of
aggregates via pharmacological induction of the intracellular protein-degradation
pathways such as autophagy-lysosome pathway. Indeed, inducing autophagy-
lysosomal pathway has been proved to be a useful mechanism against aggregation in
ALS (Otomo et al. 2012). One of the well-known inducers of autophagy and widely
tested in different protein-aggregates prone models is rapamycin. Even in ALS
model, rapamycin has been tested and proved to have a beneficial effect in correcting
TDP-43 mislocalization through the enhancement of autophagy (Caccamo et al.
2009).
In this context, it was rational to use our EGFP-12xQ/N cellular model of TDP-43
aggregation as a useful tool to test possible drug candidate able to reduce
aggregation. In the previous work we have shown that sulfated polyanion dextran
sulfate 5000 Da (DS) was able to enhance survival of the different stressed cell
cultures, not just through the apoptosis inhibition, but also through the autophagy
induction (Menvielle et al. 2013). As this finding suggested that DS in low
concentration favors autophagy, we decided to investigate if our TDP-43 aggregation
model could benefit from it.
To investigate the effect of DS on protein aggregation, we transfected U2OS cells
with pEGFP-12xQ/N construct and six hours after transfection, cells were treated
with different concentrations of dextran sulfate 5000 Da (50, 100 and 150 mg/l).
After 24 hours of DS treatment, the cells with aggregates were counted within the
population of the transfected cells under the microscope. Figure 11A is showing the
profile of cells expressing EGFP-12xQ/N in control and DS treated sample. In the
control, most of the transfected cells are showing dot like structures in the cytoplasm
(green dots), whereas among transfected cells that are treated with different
concentrations of DS, cells were containing either the aggregates or diffused GFP
signal in the cytoplasm. We have counted approximately 100 EGFP-12xQ/N
expressing cells for each sample and scored as positive any EGFP-expressing cell
that has at least one dot (big or small sized aggregates) and any cell showing a
diffused GFP profile was scored as negative. Figure 11B shows statistical analysis
79
from three independent experiments for control and each DS concentration. DS
treatment decreased the percentage of cells with aggregates to about 50% in all three
tested concentrations (t-test, **p<0.01) (Figure 11B). Since all three tested DS
concentrations have been shown to be effective in aggregation reduction, we have
decided to use 100 mg/l concentration for further experiments.
F igure 11. Dextran sulfate 5000 Da decreases the number of cells containing
E G FP-12xQ /N aggregates. (A)U2OS cells were transfected with EGFP-12xQ/N
constructand analyzedunder fluorescence microscope. EGFP-12xQ/N aggregates are
visible as green dot-like structures in the cytoplasm.Treatment with dextran sulfate
decreased significantly number of aggregates-containing cells. Upon DS treatment
green signal was diffused in the 50% of transfected cells after 24 hours. To visualize
the cells, nuclei were stained with 4, 6-diamidino-2-phenylindole (DAPI). Cells were
analyzed on Leica DMIRE2 inverted fluorescence microscope. Images were acquired
using 63X oil immersion objective. (B) Percentages of transfected cells with EGFP-
12xQ/N aggregates were determined for control and dextran sulfate treated samples
from 100 transfected cells. DS treatment decreased the percentage of cells with
aggregates in all three tested concentrations. Three independent experiments were
included for three different DS concentrations (50, 100, and 150 mg/l). Statistical
significance was evaluated using t-test (n=3, independent experiments, t-test,
**p<0.01). Error bars represent SD.
80
3.3 Positive trend in autophagic response to the aggregation upon DS treatment
In order to quantify the aggregates labeled with LC3 and thus marked for autophagy,
the cells were co-transfected with EGFP-12xQ/N and HcRed-hLC3 plasmids and
treated with 100 mg/l of DS. Percentage of cells with pEGFP-12xQ/N aggregates
that are positive for autophagy (cells with more than 8 LC3 red dots, thus exceeding
the basal autophagy) was determined by fluorescence microscopy. We noted that
almost all DS-treated cells with aggregates are LC3 positive (containing more than 8
dots) unlike the non-treated cells (n=3, independent experiments, t-test, ***p<0.001)
(Figure 12A). This result is suggesting that the cells with aggregates after DS
treatment show more autophagic activity compared to the non-treated cells.
Additionally, we have used Pearson’s correlation coefficient to quantify
colocalization between EGFP-12xQ/N and EGFP-LC3 by tracing individual cells
with Volocity software (Perkin Elmer). DS treatment increased colocalization of
EGFP-12xQ/N and red-LC3 when compared with control (Figure 12B and 12C).
This effect is an indicator of more efficient LC3 recruitment (autophagosomes) on
the EGFP-12xQ/N aggregates upon DS treatment in the cell. Altogether, these
findings led us to the idea that DS treatment is able to enhance an autophagic activity
in the cells with EGFP-12xQ/N inclusions.
81
F igure 12.Positive trend in autophagic response to the aggregation upon DS
treatment.(A) U2OS cells were seeded on cover slips and cotransfected with both
pEGFP-12xQ/N and pHcRed-LC3 plasmids. Six hours post transfection dextran
sulfate 5000 Da was added in the media in 100 mg/l concentration. 24 hours later,
cells were examined under fluorescence microscope for the number of cells with
EGFP-12xQ/N aggregates containing more than 8 LC3 puncta. Positive cells for LC3
(>8 red-dots per cell) within the population of cells with EGFP-12xQ/N aggregates
were counted from 340 cells in control and dextran sulfate treated samples in three
independent experiments (n=3, independent experiments, t-test, ***p<0.001). Error
bars represent SD (B) Colocalization between EGFP-12xQ/N and red-LC3 is
expressed in terms of the Pearson’s coefficient. Pearson’s correlation coefficient was
calculated using Volocity software (Perkin Elmer) in 38 control and 30 DS treated
cells from three independent experiments (n=3, independent experiments, t-test,
*p<0.05). Error bars represent SEM. (C) Cells were analyzed on Zeiss LSM 510
82
confocal microscope. Images displayed are a single confocal section of 0.1 m.
Images were acquired using 63X oil immersion objective and 2x zoomed.
3.4. Establishing stable cell model of E G FP-12xQ /N aggregation
We have demonstrated that U2OS cells transiently transfected with EGFP-12xQ/N
and treated with DS show significant reduction of the EGFP-12xQ/N aggregation
compared with the control (Figure 11). In order to examine in details the observed
DS enhanced aggregates clearance, to exclude the possibility that DS inhibit
aggregates formation and to obtain more consistent and regulated expression system,
we have developed stable HEK293 cell line expressing EGFP-12xQ/N under
tetracycline inducible promoter. We used Human Embryonic Kidney 293 cells (HEK
293) transfected with the Flp-In™ T-Rex™ Expression System (Flp-In™ T-REx™
293 Cell Line, Invitrogen) as an inducible cell line model. This system, enable us to
have one copy of EGFP-12xQ/N integrated in the genome. Moreover, this expression
system uses a tetracycline-based repressor to control transgene expression, which
allows us to switch on/off the system within any desired time.
To make HEK293 stable cell line, we took EGFP-12xQ/N fragment from the
homonymous plasmid as XhoI and BamHI (Budini et al. 2012) and blunt-ended it
using Klenow fragment. Next, the expression vector pcDNA5/FRT/TO (Invitrogen)
was digested with the same restriction enzymes and EGFP-12xQ/N insert was cloned
inside. The pcDNA5/FRT/TO vector has a tetracycline-inducible promoter upstream
of the multiple cloning sites allowing the regulation of EGFP-12xQ/N expression.
The advantage of the Flp-In™ T-Rex™ expression system is the use of the FRT
recombination sites in the pcDNA5/FRT/TO expression vector to mediate the site-
specific recombination of the target gene into the genome. We took the advantage of
the Flp recombinase protein, encoded by the pOG44 vector (Invitrogen) that
mediates DNA recombination, to introduce the gene of interest into the genome. On
this way, pcDNA5/FRT/TO-GFP-12xQ/N vector was cotransfected with pOG44
vector into the HEK 293 cells following the manufacturer’s protocol. Following a
single positive clone selection with hygromycin (100 µg/ml), the expression of
EGFP-12xQ/N construct was confirmed under the fluorescence microscope upon 24
hours of tetracycline induction. This system was capable to reproduce the feature of
thetransiently transfected U2OS cells where dot-like structures are extensively
formed in the cytoplasm (Figure 13).
83
F igure 13. E G FP-12xQ /N aggregates formed inH E K293 F lp-In T-Rex stable cell
lineafter tetracycline induction. HEK293 cells were seeded on cover slip and
treated with tetracycline for 24 hours. Aggregates are visible as green fluorescent
dots in the cytoplasm of all cells. Cell nuclei were visualized with DAPI (blue). Cells
were analyzed on Leica DMIRE2 inverted fluorescence microscope. Images were
acquired using 63X oil immersion objective. Right panel is the zoomed image.
3.5. Dextran sulfate 5000 Da enhances the clearance of E G FP-12xQ /N
aggregates in stable H E K 293 cell line
Next, we examined if DS 5000 Da is able to enhance the clearance of EGFP-12xQ/N
in stable HEK 293 cell line using the assay conditions previously described by
Sarkar et al. This method named clearance assay is used when targeted transgene
expression is under inducible promoter and it allows one to assess if specific agent is
able to alter the clearance of the transgene product, following the amount of
transgene product decay when its synthesis is stopped (Sarkar et al. 2007).
Effectively, we used the same principle to test if DS was able to enhance the
clearance of EGFP-12xQ/N aggregates. The transgene expression was first induced
with tetracycline and 24 hours later EGFP-12xQ/N expression was switched off by
removing tetracycline from the media and DS was added at 100 mg/l concentration.
48 hours later, approximately 800 cells were counted under the fluorescence
microscope for the proportion of cells with EGFP-12xQ/N aggregates. As positive
were counted cells with small and/or big green fluorescent aggregates, while cells
with green diffused signal were considered as negative. DS increased the clearance
of the EGFP-12xQ/N inclusions, as the number of cells containing aggregates is
84
reduced by 65% in comparison to the control (n=3, independent experiments, t-test,
***p<0.001) (Figure 14). Error bars represent standard deviations from three
independent experiments.
F igure 14. Dextran sulfate 5000 Da enhances the clearance of E G FP-12xQ /N
aggregates. (A) A microscopic view of EGFP-12xQ/N aggregates (in green) in both
control and DS samples. HEK293 Flp-In T-Rex EGFP-12xQ/N were seeded on
cover slips and treated with tetracycline for 24 hours, then expression of EGFP-
12xQ/N is switch off by taking out tetracycline from the medium and dextran sulfate
(100mg/l) was added for additional 48 hours. Cells were then fixed and visualized
under fluorescence microscope. Cells expressing EGFP-12xQ/N with green big
and/or small sized dots were considered as positive, while cells with green diffused
signal are scoredas negative. DS is enhancing the clearance of EGFP-12xQ/N
aggregates from the cell. Nuclei were stained in blue with DAPI and upper figures
are merged views from green and blue channels. Cells were analyzed on Leica
DMIRE2 inverted fluorescence microscope. Images were acquired using 63X oil
immersion objective. (B) Statistical analysis of aggregates in control and DS treated
cells in the clearance assay.
85
Next, and in order to confirm the DS clearance activity in our TDP-43 aggregation
model, we performed a western blot of whole cell lysates with anti-GFP antibody.
DS treated cells' extracts showed a significant EGFP-12xQ/N product decay
compared to the control (Figure 15A) giving an evidence of the enhanced clearance
of the transgene product when its synthesis is stopped.It should be noted that the
efficiency of the aggregate clearance induced by Dextran Sulfate showed variations
with different Dextran Sulfate batches, we are currentlytrying to understand the role
of possible impurities in the DS preparations.We next measured the effect of DS on
EGFP-12xQ/N insoluble fraction using filter binding assay, where whole cell lysates
from control and DS treated cells were applied on a pre-wetted cellulose acetate 0.2
µm filter using a slot blot chamber. After washing with PBS the membrane was
usedto perform a Western blot with anti-GFP antibody. Insoluble aggregates are not
able to pass through the filter and are detected with anti-GFP antibody, while soluble
proteins are passing through the membrane. HEK293 cells expressing GFP were
used as a protein solubility control as all GFP is soluble and should not be leaving
the track on the filter (Figure 15B, GFP line). In the clearance assay, 48 hours DS
treated samples showed aggregates content reduction to 0.6 fold of control as
quantified with Image J software (Figure 15B, DS vs ctrl). These results allowed us
to propose DS 5000 Da as an effective EGFP-12xQ/N aggregates clearance agent.
86
F igure 15. DS enhances the clearance of E G FP-12xQ /N aggregates. (A)Western
blot analysis of whole cell lysates of control and DS treated cells in the clearance
assay. DS is causing significant decay in the EGFP-12xQ/N product amount after 48
hours in the clearance assay quantified with Image J software.Please note that some
problems of reproducibility and variability in the aggregateclearance efficiency was
observed if the DS batches were changed (See text).(B)Filter trap assay was used to
quantify the aggregates in DS treated samples in comparison to the control.
Wholecell lysates were prepared and loaded on the cellulose acetate membrane (0.2
µm), where insoluble aggregates cannot pass the membrane pores unlike soluble
proteins GFP which its expressing cell'extract was used as a protein solubility control
(line GFP). Membrane was used for western blot with anti-GFP antibody. DS is
reducing EGFP-12xQ/N aggregates content to 0.6-fold of the control as quantified
with Image J software (graph on the right).
87
3.6. DS induces E G FP-12xQ /N aggregates clearance through the autophagy
pathway
Macroautophagy (here referred to as autophagy) is an intracellular process
responsible for the degradation of protein aggregates. During autophagy, a double-
membrane vesicle (the autophagosome) engulfs the cargo and subsequently fuses
with the lysosome, which degrades the cargo from the autophagosome. Over the last
few years it has been shown that autophagic membranes can selectively target cargo
via [MAP1(LC3)] and gamma-aminobutyrate receptor associated protein
(GABARAP), which act as receptor molecules for further degradation. Important
players acting as autophagy adaptor proteins, such as p62 and NBR1 that bind
directly to LC3 were identified. The autophagy receptors are themselves degraded by
autophagy, and they mediate selective autophagy via interactions with substrates that
are simultaneously degraded(Bjørkøy et al. 2005; Ichimura et al. 2008; Pankiv et al.
2007).
In order to check if autophagy was involved in EGFP-12xQ/N aggregates clearance
upon DS treatment, we determine the level of LC3-I to LC3-II conversion in both
control and DS treated cells. Autophagy can be measured by changes in LC3
localization as the level of conversion of LC3-I to LC3-II provides an indicator of
autophagic activity. In particular the level of LC3-II correlates with autophagosome
formation, due to its association with the autophagosome membrane. We performed
a clearance assay, as described before, and after 48 hours of DS addition into the
media whole cell lysates were prepared. Here again, we checked for a level of EGFP-
12xQ/N in the DS treated cells versus control and confirmed the decline of the
product (Figure 16, EGFP-12xQ/N). Next, we observed an increase of LC3-II
formation versus LC3-I after DS treatment (Figure 16, LC3I/LC3II) suggesting an
autophagy promotion upon DS treatment.
The other important player involved in the autophagy pathway isp62, an aggregate-
bound protein that recruits the autophagy machinery to the aggregates(Myeku &
Figueiredo-Pereira 2011). Moreover, the protein itself is degraded by autophagy and
accumulates when autophagy is inhibited, and thus may be used as a marker to study
autophagic flux. Therefore, we decided to evaluate, by immunobloting, cellular p62
level after DS treatment versus control in the clearance assay. We found that p62
level was significantly decreased in DS treated samples when compared to the
88
control, suggesting its more efficient degradation within autophagy pathway (Figure
16, p62). This result supports the idea that DS is enhancing the clearance of the
EGFP-12xQ/N aggregates through the autophagy.
F igure 16.DS enhances the clearance of E G FP-12xQ /N aggregates through the
autophagy. Stable HEK 293 cells were induced for EGFP-12xQ/N expression for 24
hours and then switched to the media without tetracycline inducer and treated with
DS 100mg/l for next 48 hours. Western blot analysis of whole cell lysates of control
and DS treated cells in the clearance assay. Antibody anti-GFP detects EGFP-
12xQ/N amount, anti-LC3 antibody reacts with two forms of LC3, upper band of 18
kDa corresponds to LC3-I and the lower band of 16 kDa to LC3-II, antibody anti-p62
reveals the cellular level of p62 protein and anti-actin antibody was used to check the
total amount of the proteins loaded on the gel. DS is causing the significant decay in
the EGFP-12xQ/N product amount after 48 hours in the clearance assay quantified
with ImageJ software. An increase of LC3-II/LC3-I and decrease of p62 level in the
cell could be related to an increase of autophagy in DS-treated cells.
89
A number of studies have identified autophagy as a crucial cellular process to avoid
accumulation of abnormal proteins in different degenerative diseases (reviewed in
(Nixon 2006)). Inhibiting autophagy using known chemical inhibitors such as
wortmanin, 3-MA, chloroquine and bafilomycin, or via silencing genes involved in
the initiation of autophagic activity was commonly used in several works linked to
degenerative diseases, in order to check autophagy direct involvement. For instance,
conditional liver-specific knock-out of Atg7,an essential autophagy gene that
functions as an E1 enzyme essential for multi-substrates such as ATG8/LC3 to
initiate the autophagy, demonstrated liver dysfunction accompanied by intracellular
accumulation of ubiquitinated protein aggregates(Komatsu et al. 2005). Indeed,
many reports agreed that autophagy is necessary in the cell in order to prevent
accumulation of ubiquitinated protein aggregates (Hara et al. 2006; Komatsu et al.
2006).
After demonstrating that DS is enhancing EGFP-12xQ/N aggregates clearance most
probably through the autophagy activation in the cell we wanted to investigate this
link in the autophagy deficient cells. We decided to inhibit the autophagy initiation
through the silencing of the one of the essential proteins for mammalian autophagy,
Atg7 (autophagy-related gene 7) using Atg7 siRNA. In the Atg7 silenced cells, the
effect of DS on EGFP-12xQ/N aggregates clearance was abolished (Figure 17, lane 1
and 2). Control cells that were treated with siRNA against luciferase maintain the DS
clearance potential (Figure 17, lane 3 and 4). With this experiment, conclusively, we
have demonstrated that DS-induced EGFP-12xQ/N clearance was abolished in an
autophagy-deficient cells confirming DS clearing potential through the autophagy
pathway.
90
F igure 17.Autophagy inhibition with siRN A against A tg7 counteracts the
clearance action of DS. Stable HEK 293 cells were induced for EGFP-12xQ/N
expression for 24 hours and then switched off by removing tetracycline. Cells were
then silenced twice within 48 hours for Atg7, an essential gene for autophagy
initiation, and treated with DS 100 mg/l for next 48 hours. Control cells were
silenced for luciferase to keep the same silencing conditions. Western blot was done
using anti-GFP antibody to detect the presence of EGFP-12xQ/N, anti-ATG7
antibody to confirm the silencing, and anti-tubulin to normalize the protein loading.
DS is enhancing EGFP-12xQ/N clearance in the cells treated with the control siRNA
against luciferase while the clearance was abolished in Atg7 silenced cells.
91
3.7. E G FP-12xQ /N aggregates are able to sequester T DP-43 wild type in the
cytoplasm
We were wondering if stable cell line HEK293 expressing EGFP-12xQ/N is able to
reproduce the same morphological and physiological response shown before for
transiently transfected cells (Budini et al. 2012).Therefore, we have decided to check
colocalization of EGFP-12xQ/N aggregates with autophagosome marker LC3, as
shown before for transiently transfected U2OS cells in the Figure 10. Here we
performed an immunofluorescence with anti-LC3 antibody in order to detect
endogenous LC3. LC3 can be seen as diffused signal throughout the cell or as clear
fluorescent dots inside the autophagosomes. We confirmed a certain degree of
colocalization between different sized aggregates (in green) and LC3 red fluorescent
dots (Figure 18), suggesting once again an autophagy response of the cell on the
EGFP-12xQ/N aggregation.
F igure 18.E G FP-12xQ /N aggregates colocalize with autophagy marker L C3 in
stable cell line.Immunofluorescence of HEK 293 T-Rex Flp-In EGFP-12xQ/N cells
upon tetracycline induction and labeling with anti-LC3 antibody, where aggregates
are present as green dots and LC3, inside autophagosomes, as red fluorescent dots.
Merged channels are showing that some EGFP-12xQ/N aggregates are inside the
autophagosomes (in yellow). Cells were analyzed on Zeiss LSM 510
92
confocalmicroscope. Images displayed are a single confocal section of 0.1 m.
Images were acquired using 100X oil immersion objective.
Another feature to investigate was the ability of EGFP-12xQ/N to recruit the wild
type TDP-43 protein in the aggregates as demonstrated before in the transfected
U2OS cells. Budini et al., have shown that 331-369 TDP-43 amino acid sequences
are able to interact with an endogenous TDP-43. In fact, they were able to see the
sequestration of endogenous and exogenous TDP-43 wild type within the EGFP-
12xQ/N aggregates with occasional, depletion of an endogenous TDP-43 from the
nucleus. Thus the pathological significance of the aggregates mainly resides in their
ability to function as a "TDP-43 sink" in the cytoplasm, where an increasing capture
of TDP-43 by growing cytoplasmic aggregates may lower the amount of TDP-43
returning to the nucleus, resulting in various loss-of-function effects(Budini et al.
2012).
Therefore, to investigate the mentioned interactions in our stable cell line, we
induced EGFP-12xQ/N expression with tetracycline and 24 hours later we performed
immunofluorescence with anti-TDP-43deltaQ/N antibody that is reacting with
endogenous TDP-43, without recognizing its C-terminal part, thus not reacting with
EGFP-12xQ/N product. On this way we were able to see EGFP-12xQ/N aggregates
as clear green dots and endogenous TDP-43 as red fluorescent signal (Figure 19A).
We were able to detect some cells with aggregates that had the ability to recruit the
wild-type TDP-43 protein (shown with an arrow in Figure 19A). However, we have
to underline that this phenomenon was not observed in all cells.
In parallel, we transfected stable cells with flag-TDP-43 wild type, induced EGFP-
12xQ/N expression with tetracycline and 24 hours later we performed
immunofluorescence with anti-flag antibody that can recognize an exogenous flag-
TDP-43. In the figure 19B, EGFP-12xQ/N aggregates are shown as green fluorescent
dots and flag-TDP-43 wild type as red fluorescent signal. Consistently with the
previously published results, in some cells the aggregates may colocalize with
overexpressed flag-TDP43 wild type (shown with an arrow in the figure 19B).
From the data presented, we confirmed the ability of EGFP-12xQ/N to sequester the
wild type TDP-43 protein to form the aggregates.
93
F igure 19.E G FP-12xQ /N aggregates may entrap endogenous T DP-43 and flag-
T DP-43 wild type.(A)EGFP-12xQ/N aggregates (green) may entrap endogenous
TDP-43 (in red) in our inducible cell line model. Immunofluorescence of HEK 293
T-Rex Flp-In EGFP-12xQ/N cells was done upon tetracycline induction and labeling
with anti-TDP-43deltaQ/N antibody. (B)HEK293 cells expressing EGFP-12xQ/N (in
green) and flag-TDP-43 wild type (in red) labeled with anti-flag antibody. Flag-TDP-
43 wild type is colocalizing with EGFP-12xQ/N aggregates in some cells (shown in
yellow in merged channels). Cells were analyzed on Zeiss LSM 510 confocal
microscope. Images displayed are a single confocal section of 0.1 µm. Images were
acquired using 100X (A) and 63X (B) oil immersion objective.
To further follow TDP-43 wild type fate in EGFP-12xQ/N aggregation model, we
performed western blots of whole cell extracts from our stable cell line with and
without tetracycline induction, and with and without flag-TDP-43 wild type co-
expression. We were able to see, for the first time, TDP-43 cleaved products (35 kDa
TDP-43 fragment, and in several instances 25 kDa truncation product) in our
aggregation model. TDP-43 truncation species have been found just in the
conditionswhere EGFP-12xQ/N expression is induced (+Tet) together with
constitutive overexpression of flag-TDP-43 wild type (Figure 20, line 4). It is
94
important to mention that the antibody used in this experiment was anti-TDP-
43deltaQ/N which does not react with C-terminal part of TDP-43 protein, thus not
recognizing EGFP-12xQ/N product. On this way we are sure that detected products
are truncation fragments solely produced from TDP-43 wild type.
C-terminal fragments of TDP-43 (35 kDa and 25 kDa) are commonly observed in the
neurons of affected patients(Neumann et al. 2006; Arai et al. 2006). It is also known
that two C-terminal fragments of TDP-43 are products of caspase-3 cleavage
action(Zhang et al. 2007). To understand if the observed TDP-43 fragments are
caspase cleaved products, we used pan caspase inhibitor Z-VAD-FMK (N-
benzyloxycarbonyl-Val-Ala-Asp-fluoromethyl ketone). The inhibitor was added to
the cell culture immediately after transfection in the concentration of 100 µM(Zhang
et al. 2007). Indeed, TDP-43 fragments were not present any more when caspase
action was inhibited in the cell (Figure 20, line 5), clearly demonstrating their
caspase cleavage nature.
On this way, we have shown that our aggregation model of TDP-43 is able to
produce C-terminal truncation products of caspase-cleaved TDP-43 in described
conditions, mimicking TDP-43 inclusions found in patients. Described observations
are giving an extra value to the EGFP-12xQ/N cell-based aggregation model of TDP-
43.
95
F igure 20.E G FP-12xQ /N aggregation model is able to produce truncation
products of T DP-43.Total cell extracts from stable HEK293 cell line without (-Tet)
or with (+Tet) tetracycline induction of EGFP-12xQ/N expression and without or
with coexpression of flag-TDP 43. In lane 4 we can appreciate 35 kDa TDP-43
fragment beside full length TDP-43 upon EGFP-12xQ/N and flag-TDP-43 wt
coexpression. Observed cleavage product was absent if the cells were treated with
pan caspase inhibitor Z-VAD-FMK (line 5). Western blot was performed with anti-
TDP-43deltaQ/N antibody reacting with TDP-43, without recognizing C-terminal
part of TDP-43 including 331-369 Q/N-rich region. Antibody anti-actin was used as
protein loading control.
3.8. DS decreases the capture of flag-T DP43 wild type in the insoluble fraction
The ability of EGFP-12xQ/N to recruit the wild type TDP-43 in the aggregates
demonstrated before (Budini et al. 2012) and here (Figure 21) was exploit to examine
if DS is able to reduce this sequestration in the clearance assay in stable EGFP-
12xQ/N expressing cell line after transfection with flag-TDP-43 wt. Clearance assay
was performed as mentioned in the previous section, and 48 hours after DS
supplementation whole cell lysates were prepared. The soluble (S) and insoluble (P)
fractions were separated as described in the section material and methods
andimmunobloted with antibodies against GFP, FLAG, Actin and Tubulin (Figure
21). First three lines correspond to the situation where EGFP-12xQ/N expression is
switched off (-Tet), while flag-TDP-43 wt is constitutively expressed. It is known
that TDP-43 has a natural tendency to aggregate and accordingly small fraction
(around 10%) of the protein flag-TDP 43 wt was found to be insoluble when EGFP-
12xQ/N expression is switched off (Flag-TDP-43, ctrl-Tet, fraction P). When EGFP-
12xQ/N expression was turned on, (ctrl+Tet) aggregates formation occurs (see
insoluble fraction P in EGFP-12xQ/N line) leading to the 2-fold change of the
insoluble flag-TDP-43 wild type portion in the cell. This result is suggesting an
increased capturing of the flag-TDP-43 wt protein in the aggregated insoluble
fraction. DS is decreasingthe amount of flag-TDP-43 wt in the P fraction (0.4-fold
change) with respect to the control, in line with the EGFP-12xQ/N aggregates
behavior (0.5-fold change). As the entrapment of TDP-43 wild type inside the
96
insoluble fraction was diminished due to the presence of DS, we hypothesize that the
enhanced clearance of TDP-43 aggregates by the DS could be a potential therapeutic
agent able to lower the capture of the TDP-43 wild type protein in the cytoplasm,
thus compensating its loss from the nucleus, as the main compartment of its normal
cellular function. On this way, we are proposing the scenario where by increasing the
efficacy of the main degradation pathway for TDP-43 aggregates with low doses of
DS 5000 Da, we may decrease TDP-43 wild type entrapment in the cytoplasm and
thus restore the nuclear loss of TPD-43 level and function in TDP-43
proteinopathies.
F igure 21. DS decreases the capture of flag-T DP43 wild type in the insoluble
fraction.Stable HEK 293 cells were transfected with flag-TDP-43 wt, induced for
EGFP-12xQ/N expression for 24 hours (+Tet) and then switched to the media
without tetracycline inducer and treated with DS 100 mg/l for next 48 hours. Whole
cell lysates were prepared (inputs IN) and fractioned in soluble (S) and insoluble (P)
fractions and the presence of EGFP-12xQ/N was detected with antibody anti-GFP
and flag-TDP-43 with anti-FLAG antibody in the Western blot. Actin and tubulin
levels were used as loading controls. In the cells with no EGFP-12xQ/N aggregates
(first three lines) flag-TDP-43 wild type is present in the insoluble form (P) in around
10%. Under EGFP-12xQ/N expression, aggregates are formed (insoluble fraction P)
97
and 2-fold change of insoluble flag-TDP-43 wt is observed. DS decreases the
insoluble portion of EGFP-12xQ/N (0.5-fold change), as well as flag-TDP-43 wt
(0.4-fold change).
Additionally, the distribution of EGFP-12xQ/N, flag-TDP-43 wt and endogenous
TDP-43 wt was investigated in the clearance assay using biochemical fractionation
of the cytoplasm and nucleus. It was observed that EGFP-12xQ/N product decays in
the cytoplasmic fraction (C) in DS treated cells versus control consistent with the
former result (Figure 22, anti GFP). As TDP-43 is predominantly nuclear, we were
able to detect flag-TDP-43 wt just in the nuclear fractions, using antibody anti-FLAG
under the described conditions. Despite no flag-TDP-43 was detected in the
cytoplasm wewere able to detect the higher level of flag-TDP-43 in the nuclear
fraction of DS treated cells comparing to the control, probably indicating the higher
rescue from the aggregate sequestration in the cytoplasm (Figure 22, anti FLAG).
The same pattern was observed with antibody anti TDP-43deltaQ/N that can
recognize an endogenous TDP-43 wt and flag-TDP-43 wt together with cleavage
fragments (TDP 35 kDa and 25 kDa), but not EGFP-12xQ/N product. Once again,
we succeeded to detect cleaved TDP fragments of 35 kDa and 25 kDa in our
aggregation model as demonstrated before in the figure 20 (Figure 22, anti
TDP43deltaQ/N). The amount of cytoplasmic TDP cleaved fragments is slightly
decreased (after normalization with tubulin level) while the amount of nuclear TDP-
43 is slightly increased upon DS treatment suggestinglower TDP wt cytoplasmic
retention, strengthening the action of DS as the clearance agent. To exclude an
eventual nuclear or cytoplasmic contamination during fractionation, we included
cytoplasm-specific (tubulin) and nucleus-specific controls (p84) in the immunoblots.
98
F igure 22. DS enhances E G FP-12xQ /N aggregates clearance and decreases
T DP-43 wild type retention in the cytoplasm. Stable HEK 293 cells were
transfected with flag-TDP-43 wt, induced for EGFP-12xQ/N expression for 24 hours
and then switched to the media without tetracycline and treated with DS 100 mg/l for
next 48 hours. Biochemical fractionation of the cytoplasm and nucleus was done as
described in the material and methods and the presence of EGFP-12xQ/N was
detected with antibody anti-GFP, flag-TDP-43 with anti-FLAG antibody and anti-
TDP-43deltaQ/N antibody was used to detect TDP-43 wild type in the Western blot.
Tubulin and p84 were used as cytoplasm and nucleus-specific proteins. EGFP-
12xQ/N product decays upon DS treatment in the cytoplasm (C), while flag-TDP-43
wt amount increases in the nucleus. After normalization with tubulin level, slight
decrease of TDP-43 and its cleavage products of 35 and 25 kDa, in the cytoplasmic
fraction (C), was observed in DS treated cells in comparison with the control.
99
3.9. DS-induced E G FP-12xQ /N clearance requires H D A C6
HDAC6 (Histone deacetylase 6) is an unusual microtubule-associated deacetylase
characterized by cytoplasmic localization, ubiquitin‑binding capacity, and impact on
tubulin and actin cytoskeleton(Boyault et al. 2007). HDAC6 has been associated with
autophagic degradation of aggregated proteins (Kawaguchi et al. 2003) and was shown
to rescue neurodegeneration in a fly model of spinal muscular atrophy where
accumulation of ubiquitin-positive protein aggregates in neurons occurs(Pandey et al.
2007). Since the discovery of an ubiquitin-binding domain in HDAC6(Verdel &
Khochbin 1999), it has been shown to participate in cellular functions through protein
ubiquitination and decision of the fate of polyubiquitinated proteins. Furthermore,
HDAC6 has been associated with maturation of autophagosomes and knockdown of
HDAC6 results in autophagosomes and protein-prone aggregates accumulation(Lee et
al. 2010). Therefore, HDAC6 putatively has an important role in proteinopathies.
Besides, it was also shown that TDP-43 binds to HDAC6 mRNA and the knockdown
of TDP-43 destabilizes HDAC6 mRNA and leads to downregulation of HDAC6
expression (Fiesel et al. 2010). Taking into the consideration HDAC6 involvement in
the turnover of aggregation‑prone proteins associated with neurodegenerative diseases
we decided to investigate whether DS is promoting autophagy through the HDAC6.
First of all, we checked HDAC6 protein level in the cells where EGFP-12xQ/N
expression was induced for 24 hours and then switched off by removing the
tetracycline from the media. Then the cells were treated with 100mg/l of DS for next
48 hours. We could not observe any difference in HDAC6 protein expression level
upon dextran sulfate treatment compared to the control (Figure 23, lane 1 and lane 3,
anti-HDAC6). It is known that HDAC6 is able to deacetylate several substrates and
the best characterized one is alpha-tubulin (Zhang et al. 2003). This catalytic property
of HDAC6 enabled us to evaluate indirectly HDAC6 activity under DS treatment and
we decided to check the acetylation level of tubulin in DS treated cells versus control.
In fact, figure 23 shows that upon DS treatment acetylated tubulin was significantly
decreased in comparison to the control (Lane 1 and lane 3, anti ac-TUB). These
findings support the idea of the DS action through the enhanced HDAC6 deacetylase
activity and decreased tubulin acetylation. The field had benefitted enormously from
the early identification of chemical compounds, such as Trichostatin A (TSA), which
100
inhibit the histone deacetylases and thus led to hyperacetylation of histones and
tubulin. We decided to treat the cells that form EGFP-12xQ/N aggregates with TSA
together with DS and to look at the acetylation level of tubulin in the Western blot. We
have demonstrated that TSA treatment reversed the effect of DS on tubulin acetylation
level in the cell (Figure 23, compare lane 4 with lane 3, antiac-tubulin). On this way,
we gave an evidence for the link between the DS action and an enhanced HDAC 6
activity in the cells with TDP-43 aggregates.
F igure 23.DS is decreasing acetylated tubulin level in H E K293 cells forming
E G FP-12xQ /N aggregates. HEK 293 cells were induced for EGFP-12xQ/N
expression for 24 hours with tetracycline and then treated with 100mg/l of DS in the
absence of presence of the HDAC6 inhibitor Trichostatin A (TSA). Biochemical
analysis of the whole cell extracts by Western blot using anti-HDAC6 and anti-
acetylated tubulin antibodies is demonstrating significantly lower level of acetylated
tubulin in DS treated cells (DS) in comparison with the control (ctrl). The effect was
abolished when HDAC6 activity was inhibited with TSA. Tubulin was used as a
control of equal protein loading.
Furthermore, and in order to confirm the hypothesis that DS action on EGFP-12xQ/N
enhanced clearance is HDAC6 dependent, we knockdown HDAC6 from the cells
with specific siRNA. In the Figure 24, we have demonstrated that the DS induced
EGFP-12xQ/N product decay in clearance assay (Figure 24, lane 3 versus lane 1,
anti-GFP) was blocked in the HDAC6-deficient cells (lane 4 DS+siHDAC6 vs lane 3
DS-siHDAC6, anti-GFP). Control cells were mock silenced with siRNA against
Luciferase in order to maintain the same conditions of silencing. An efficient
101
knockdown of HDAC6 was confirmed with antibody anti-HDAC6 in the Western
blot (Line 2 and line 4, anti-HDAC6) and the concomitant accumulation of the
HDAC6 substrate acetyl‑tubulin (Line 2 and line 4, anti-ac TUB) due to HDAC6
silencing was comparable to the effects achieved with the inhibitor TSA in the
previous experiment.
Next, to confirm that the DS clearance action depends on the deacetylase activity of
HDAC6, we decided to perform an adding back experiments. We reintroduced wild-
type HDAC6 (HDAC6-WT) and catalytically inactive mutant HDAC6-DC
(deacetylase-deficient mutant) into the silenced cells with expression plasmids
containing the silent mutations in the sequences targeted by the HDAC6 siRNA in
order to protect them from degradation As shown in the Figure 24, reintroduction of
HDAC6 wild type in the HDAC6 silenced cells led to a significant EGFP-12xQ/N
aggregates clearance upon DS treatment compared to its respective control (line 6 vs
line 5, anti-GFP), while catalytically inactive HDAC6 mutant had no effect (line 8 vs
line 7, anti-GFP). We have to mention that antibody anti-HDAC6 was not able to
recognize HDAC6-DC mutant protein in the Western blot, so the expression level of
the same was confirmed with the antibody anti-FLAG (line 7 and line 8, anti-FLAG).
Here we have identified the histone deacetylase-6 (HDAC6), as an effector of the DS
clearance action in our TDP-43 aggregation model. This finding supports the
conclusion that the observed DS induced EGFP-12xQ/N product decay is mediated
by HDAC6. Indeed, it seems that DS-induced autophagic degradation of EGFP-
12xQ/N aggregates requires catalytically active deacetylase HDAC6.
102
F igure 24.DS action on E G FP-12xQ /N clearance is H D A C6 dependent. HEK 293
cells were induced for EGFP-12xQ/N expression for 24 hours with tetracycline,
while also silenced with siRNA against HDAC6. The next day we removed
tetracycline from the medium and silenced HDAC6 again. On the third day, we
silenced HDAC6 and transfected cells with siRNA resistant HDAC6-wt or HDAC6-
DC constructs and six hours post transfection we added 100 mg/l of dextran sulfate
into the media. We harvested the cells on day four and prepared whole cell lysates.
Mock cells were silenced with siRNA against luciferase to maintain the same
silencing conditions. Cell lysates were Western blotted and probed with antibodies
against GFP, HDAC6, Flag, acetyl-tubulin and total tubulin. DS induced EGFP-
12xQ/N clearance was abolished with HDAC6 silencing and restored again with
overexpression of HDAC6 wild type, but not with catalytically inactive mutant
HDAC6-DC.
103
3.10. Mouse motor neuronal-like cell line NSC-34 model of E G FP-12xQ /N
aggregation
Amyotrophic lateral sclerosis disease is a late-onset progressive neurodegenerative
disease affecting motor neurons. We wanted to see if the aggregation pattern of EGFP-
12xQ/N would be maintained in the motor neuronal cells in vitro. NSC-34 is a hybrid
cell line produced by fusion of motor neuron enriched, embryonic mouse spinal cord
cells with mouse neuroblastoma, therefore suitable for this study. We decided to assess
the expression of EGFP-12xQ/N in NSC-34 cells and to check whether it is possible to
see GFP-12xQ/N aggregates sequestered inside autophagosomes. Therefore, we co-
transfected NSC-34 cells, after 48 hours of differentiation (cell culture medium
conditions change from 5% to 1% of serum), with EGFP-12xQ/N and HcRed-hLC3
plasmids. Cells were fixed and visualized under confocal microscope. We were able to
see some cells where EGFP-12/Q/N aggregates were sequestered inside the
autophagosomes (Figure 25) in agreement with the results obtained before in U2OS
and HEK 293 cells. On this way we tested the motor neuron-like cell model of EGFP-
12xQ/N aggregation that will be useful for further evaluation of DS suitability as a
potential anti-aggregation agent in neurons.
F igure 25. E G FP-12xQ /N aggregates are co-localizing with autophagosome
marker L C3. NSC-34 cells were co-transfected with pEGFP-12xQ/N (in green) and
HcRed-hLC3 (in red). Merge channel shows a clear co-localization of the
autophagosomal marker LC3 with aggregates (merge in yellow). Nuclei are shown
with dotted lines. Images were acquired using Zeiss LSM 510 confocal microscope
under 63X oil immersion objective.
104
3.12. Dextran sulfate 5000 Da is not toxic for the motor neuronal-like cell line
NSC-34
In vitro models are valuable in assessing of chemicals toxicity to the neuronal cells.
In the literature, NSC-34 cells were proposed as a good model for neurotoxicity
testing(Durham et al. 1993). To assess the toxicity of different compounds many
endpoints can be used, such as cell viability, cell morphology, cell proliferation and
membrane damage. The most standardized and validated are tests that assess cell
viability as enzyme release, neutral red uptake and MTT reduction assay(Balls &
Horner 1985). We have decided, by using the MTT reduction assay as an indicator of
cell redox activity, to measure cytotoxicity or viable cells loss on NSC-34 cells after
dextran sulfate 5000 Da addition to the medium. On this way we wanted to test if DS
usage as a potential anti aggregation drug on neurons is not causing the cellular
death.
NSC-34 cells were plated without or with EGFP-12xQ/N expression plasmid.
Dextran sulfate 100 mg/l was added into the cell culture media and the number of
viable cells was assessed after 48 hours of dextran sulfate supplementation. MTT
solution was added into the cell media and four hours later the reaction was stopped
as described in the material and methods. MTT reduction was determined in
spectrophotometer and presented as a percentage of the control (100%). In three
independent experiments, DS in concentration of 100 mg/l did not show any toxicity
in NSC-34 cells in either the absence (Figure 26, panel A) or presence of EGFP-
12xQ/N aggregates (Figure 26, panel B). The data reported here are supporting the
DS safe-use for the motor neuronal-like cell line and might have a broad therapeutic
potential in human TDP-43 proteinopathies, as a potential non-toxic
pharmacologically active compound able to reduce the aggregation of TDP-43.
105
F igure 26.Dextran sulfate 5000 Da is not toxic for the neuronal-like cell line
NSC-34.(A) NSC-34 cells were seeded in the 96-well plate and six hours later
dextran sulfate 100 mg/l was added to the cell culture media (DS). 48 hours later
MTT assay was performed and the reduction of MTT was determined by multiwall
scanning spectrophotometer. No toxicity in NSC-34 cells was detected by DS
treatment in comparison with the control (ctrl). Results are meanSD of three
independent experiments expressed as a percentage of the control (100%). (B) NSC-
34 cells were transfected with EGFP-12xQ/N construct in 6 well-plate, 24 hours later
the cells were transferred to 96-well plate and six hours later 100 mg/l of DS was
added (DS). No toxicity in EGFP-12xQ/N transfected NSC-34 cells was detected by
DS treatment in comparison with the control (ctrl). Results are meanSD of three
independent experiments expressed as a percentage of the control (100%).
106
4. DISC USSI O N
The presence of abnormal protein aggregates or inclusions containing specific
misfolded proteins is a commun feature in the nervous system of most
neurodegenerative diseased patients such as frontotemporal lobar degeneration with
ubiquitinated inclusions (FTLD-U), amyotrophic lateral sclerosis (ALS), Alzheimer
disease (AD), Parkinson disease (PD), and Huntington disease (HD). The underlying
pathogenic mechanism involves the misfolding of normally soluble proteins into β-
pleated conformation and the deposition of the misfolded proteins into insoluble
fibrillar aggregates with the physical and chemical properties of amyloid. For
example, most of these neurodegenerative disease-specific aggregates (as
exemplified by tangles and plaques in AD and Lewy bodies in PD) are filamentous
and display the ultrastructural and dye-binding properties of amyloids. However,
inclusions in FTLD-U/ALS are not detected by amyloid-binding dyes, suggesting
that FTLD-U/ALS might be a unique neurodegenerative proteinopathy characterized
by protein misfolding in the absence of brain amyloidosis,reviewed by (Kwong et al.
2007). In FTLD-U/ALS patients inclusions, transactive response DNA-binding
protein 43 (TDP-43) was shown to be the major component of these ubiquitinated
inclusions(Neumann et al. 2006; Arai et al. 2006). The pathological samples of these
diseases, which have been termed TDP-43 proteinopathies, are characterized by
cytoplasmic and, to a much lesser extent, nuclear TDP-43-positive (+) and
ubiquitinated inclusions (UBIs) containing full-length TDP-43, polyubiquinated
TDP-43, phosphorylated TDP-43, as well as 35- and 25-kDa carboxyl fragments of
TDP-43, for reviews, see refs. (Chen-Plotkin et al. 2010; Arai et al. 2006; Neumann
et al. 2006; Neumann et al. 2009; Da Cruz & Cleveland 2011). It has been estimated
that ∼50% of FTLD-U and 80–90% of ALS are TDP-43 (+) (Logroscino et al.
2010).
TDP-43 is a 43-kDa, ubiquitously expressed protein, well conserved among
eukaryotes(Wang et al. 2004). This DNA/RNA-binding factor is predominantly
located in the nucleus(Kuo et al. 2009), and it has been implicated in multiple
cellular functions, e.g., transcriptional repression, splicing, and translation(Buratti &
107
Baralle 2008), (Wang et al. 2008), (Lagier-Tourenne et al. 2010), (Polymenidou et al.
2011).
To date, numerous experimental data have suggested that misregulation of the
metabolism of TDP-43 leading to the accumulation of TDP-43 in the cytoplasm
including the formation of TDP-43 (+) UBIs, plays a causative role in the
pathogenesis (for reviews, see refs.(Wang et al. 2008; Chen-Plotkin et al. 2010;
Kwong et al. 2007). Evidence that the dysregulation of TDP-43 can cause disease
comes from many animal models. A neurodegenerative ALS-like phenotype can be
generated by either overexpression or knockdown of TDP-43 in flies, fish and
mice(Kabashi et al. 2010), (Li et al. 2010);(Schmid et al. 2013). These publications
are pointing out that overexpression of both mutant and wild type TDP-43 can cause
a neurodegenerative phenotype thus supporting a gain-of-function mechanism (Da
Cruz & Cleveland 2011). Loss-of-function models generated in different species
showed neurological and neurodegenerative phenotypes as well (Feiguin et al. 2009;
Lu et al. 2009; Li et al. 2010; Estes et al. 2011; Kabashi et al. 2010; Zhang et al.
2012). However, the degenerative phenotypes in the loss-of-function models appear
less overwhelming than the overexpression models and are often difficult to separate
the developmental effectsfrom a lack of TDP-43 function. Importantly, there is a lack
of evidence in mammalian models that a loss of TDP-43 function causes
neurodegeneration. This is largely due to the failure in generating such a model using
a gene knockout approach. In ALS patients carrying TDP-43 mutations, TDP-43 was
found in inclusions of their spinal cords and brains. It is unclear whether TDP-43
mutations lead to motor neuron loss through a gain of toxic properties or a loss of
TDP-43 normal function. This loss of function is proposed to be due to its
sequestration in nuclear or cytoplasmic inclusions and the corresponding disruption
of its interactions with protein or RNA targets.
The accumulation of abnormally modified TDP-43 in FTLD-U and ALS patients
suggests that dysfunction in the intracellular quality control systems in clearing the
abnormal aggregated proteins may be involved in the disease pathogenesis.Previous
studies provide evidences, finding that wild-type TDP-43 either is degraded by the
UPS (Wang et al. 2010; Zhang et al. 2010) or by a synergistic effect between both
UPS and autophagy (Urushitani et al. 2010). Recently, Scotter and colleagues have
shown that inhibiting UPS and autophagy have a strong effect on degradation,
108
localization and mobility of soluble and insoluble TDP-43. In their study, it was
suggested that soluble TDP-43 is degraded primarily by the UPS, whereas the
clearance of aggregated TDP-43 requires autophagy(Scotter et al. 2014).
Consistently, a very recent work of Huang et al.(Huang et al. 2014), have shown that
the endogenous and exogenously over-expressed TDP-43 are degraded not only by
ubiquitin proteasome system (UPS) and macroautophagy (MA), but also by the
chaperone-mediated autophagy (CMA) mediated through interaction between (Heat
shock conjugate 70) Hsc70 and ubiquitinated TDP-43(Huang et al. 2014).Although,
it is still unclear whether aggregation of TDP-43 is a primary event in ALS
pathogenesis or whether it is by-product of the disease process.
The misregulation of TDP-43 in both FTLD-U and ALS is age-dependent. This
indicates that one or more age-related changes in brain function may act as a co-
trigger and induce TDP-43 accumulation. Age is a major risk factor for the prevalent
of many neurodegenerative diseases. In fact, ageing affects many cellular
processes that predispose to neurodegeneration, and age-related changes in
cellular function predispose to the pathogenesis of ALS/FTLD in one hand,
and on the other hand a number of studies suggest a role of autophagy in
aging. Interestingly, protein degradation and specifically via autophagy (both
macroautophagy and chaperone mediated autophagy CMA) decline with age,
in the central nervous system (Martinez-Vicente et al. 2008; Ward 2002; Cuervo et
al. 2005). Age related decline of Atg genes has been shown in D . melanogaster,
while Atg8 overexpression increases the fly's lifespan (Simonsen et al. 2008),
whereas silencing autophagy genes in C . elegans leads to decreased lifespan (Hars et
al. 2007). In ALS, it was reported that lithium, at least in part by inducing autophagy,
delayed the progression of amyotrophic lateral sclerosis (ALS) in 44 human patients
affected by ALS (Fornai, Longone, Cafaro, et al. 2008), all lithium treated patients
were alive until the end of the clinical trial follow up, while 30% of the Riluzole
treated patients died before. It is tempting to speculate that the age-dependent decline
in autophagy function may contribute to TDP-43 accumulation, as it may alter the
balance between production and degradation of TDP-43 and its C-terminal
fragments.
It was demonstrated that autophagy degrade both TDP-43 and its pathological
fragment TDP-25. In particular, it was found that TDP-25 more than TDP-43 , is
109
greatly increased in cells treated with autophagy inhibitors, and it decreases in cells
treated with an autophagy enhancer(Wang et al. 2010), suggesting that autophagy is
primarily involved in clearing the pathological forms of TDP-43. Moreover, TDP-25
was found to colocalize with punctuated LC3 in transfected cells(Wang et al. 2010),
thus suggesting that TDP-25 is more specifically regulated by autophagy, and Huang
et al, very recently have also demonstrated that TDP-25/TDP-35 fragments are the
main substrates for autophagy degradation(Huang et al. 2014).
The macro-autophagy pathway (referred to as autophagy) is the main route to the
degradation of long-lived proteins, damaged organelles, and large protein aggregates.
Although autophagy was initially thought to operate mainly as a central mechanism
for survival under conditions of nutrient starvation, studies using brain-specific
knock out mice for autophagy specific genes (i.e., Atg7or Atg5) show a key role of
autophagy in maintaining and balancing protein homeostasis in neurons (Hara et al.
2006; Komatsu et al. 2006) In neurons, macroautophagy is the only cellular
mechanism capable of degrading expired organelles (reviewed by (Jaeger & Wyss-
Coray 2009)). Moreover, autophagy is a potential mechanism of clearance for protein
aggregates that occur frequently in aging neurons. Moreover, in the normal brain
autophagosome numbers (Nixon et al. 2005) and the levels of LC3-II protein (Yu et
al. 2005; Pickford et al. 2008) are low when compared with other tissues.
Nevertheless, recent findings show that autophagy in neurons is indeed constitutively
active (Hara et al. 2006; Komatsu et al. 2006) and autophagosomes accumulate
rapidly when their clearance is blocked (Boland et al. 2008), indicating the fast basal
turnover in normal neurons.
Distinct steps of the autophagic pathway can be altered in variety of
neurodegenerative diseases and possible linked to neuronal death. The different
alterations linked to neurodegeneration affecting autophagic flux including reduced
autophagy induction, altered cargo recognition, inefficient autophagosome/lysosome
fusion, and/or ineffective autophagosome clearance. In Alzheimer disease, it was
reported that autophagosome maturation was impaired (Yu et al. 2005). In
Huntington disorder, macroautophagy was shown to be impaired in early stage of the
disease (Pasquali et al. 2009). Autophagy progression seems to be impaired in ALS
patients, as sized autophagosomes and autolysosomes were found inside diseased
neurons of the ALS patients(Sasaki 2011), in agreement with the similar findings in
110
the animal model of ALS(Li, Liang; Zhang, Xiaojie; Le 2008). There is a solid
evidence that links directly a defective autophagy to ALS. This was for the first time
demonstrated by Fornai et al. (Fornai, Longone, Cafaro, et al. 2008; Fornai,
Longone, Ferrucci, et al. 2008), in SOD1 mice model aggregates and firmly
confirmed by other subsequent work (Laird et al. 2008). In fact, autophagy inhibitors
worsen the viability of motor neurons in a variety of ALS models while the
stimulation of autophagy alleviates motor neuron degeneration(Wang et al. 2012).
Autophagy inducers such as trehalose (Gomes et al. 2010), rapamycin (Berger et al.
2006),SMERs(Sarkar et al. 2007), lithium(Fornai, Longone, Cafaro, et al. 2008), and
resveratrol (Kim et al. 2007) have shown beneficial effects by decreasing protein
aggregation through the autophagy pathway activation and promoting neuronal
survival in different neurodegenerative diseases. Therefore, it is reasonable to expect
that tuning autophagy to enhance autophagy mediated clearance may have an actual
therapeutic impact to alleviate the central cause of degeneration: accumulation of
protein aggregates.
Yet, one has to take into consideration that induction of autophagy might also show
to be non beneficial. Indeed, Zhang et al., have shown that in the SOD1G93A mice,
treatment with autophagy enhancer rapamycin accelerates the MNs degeneration,
shortens the life span of the ALS mice, and did not have any positive effects on the
reduction of SOD1 aggregates (Zhang et al. 2011). Rapamycin treatment augments
motor neuron degeneration in SOD1G93A mouse model of amyotrophic lateral
sclerosis.). Since this negative effect was reported up to now just on rapamycin,
another work could explain why this effect was negatively affecting SOD1
aggregates clearance. In fact, rapamycin could suppress protective immune responses
while enhancing protective autophagy reactions during the ALS disease process.
Their results indicate that maximal therapeutic benefit may be achieved through the
use of compounds that enhance autophagy without causing immune
suppression(Staats et al. 2013).
Interestingly, it was shown that autophagy itself is regulated by TDP-43. Indeed,
Bose et al, have shown that TDP-43 functions as maintenance factor of the
autophagy system. Moreover, they have shown that the depletion of TDP-43 with the
consequent loss of the Atg7 mRNA/ATG7 protein causes impairment of the
111
autophagy and facilitates the accumulation of TDP-43 inclusions (Bose et al.
2011)(Tdp- et al. 2011).
Taking all this facts together, we have decided to investigate the autophagy role in
TDP-43 aggregation model previously established in the lab (Budini et al. 2012),
where 12 repetitions of TDP-43 amino-acid sequence 331-369 are able to induce
cytoplasmic aggregates formation. It has been previously shown by Budini et al that
the EGFP-12xQ/N aggregates are able to sequester full-length TDP-43 wild type and
are showing ubiquitinated and phosphorylated features. Thus the first thing to
investigate was if these TDP-43 inclusions may colocalize with some markers of
autophagosome-lysosome pathway. We have shown that EGFP-12xQ/N inclusions
were able to colocalize with some players of the autophagy-lysosome pathway in
transfected non-neuronal cells U2OS and mouse motor neuron-like cells NSC-34.
This observation of colocalization of EGFP-12xQ/N inclusions with autophagic
markers LC3 and p62 (sequestosome-1 (SQSTM1) (Figure 10 Panel A, B, and C)
and with lysosomal marker Lamp1 (Figure 10 Panel D) is in aggreement with the
data published by Sasaki et al, where the round bodies and skein-like inclusions from
degenerated motor neurons of ALS patients were immunostained for LC3 and for
p62(Sasaki 2011). P62 is one of the first proteins recognized as an adaptor for
delivering cargo marked by ubiquitination to the autophagic organelles(Bjørkøy et al.
2005). P62 binds ubiquitin and polyubiquitinated proteins via its C-terminal UBA
domain and it bridges the cargo and autophagic machinery by binding directly to the
autophagic effector protein LC3 Several other studies have shown an evidence that
neuronal inclusions were p62-positive and that p62 binds directly to TDP-43 in
brains of FTLD patients with TDP-43 inclusions, and furtheremore the aggregation
of TDP-43 C-terminal fragments was reported to be regulated by p62
phosphorylation through autophagy and proteasome-mediated degradation pathways
(King et al. 2011; Tanji et al. 2012; Al-Sarraj et al. 2011; Brady et al. 2011). Hence,
these results suggest that autophagy-endolysosomal pathway markers LC3, Lamp 1
and the adaptor protein p62 label EGFP-12xQ/N aggregates, probably targeting them
for degradation through the autophagy-lysosome pathway.
Inducing autophagy-lysosome pathway has proved to be an useful mechanism
against protein aggregation in different neurodegenerative diseases such as
huntington disorder (Qin et al. 2003). One of the well-known inducer of autophagy,
112
rapamycin has been used to induce TDP-43 clearance and the correction of the TDP-
43 mislocalization through the autophagy in ALS and FTD models(Wang et al. 2012;
Caccamo et al. 2009). Therefore, there is still a great interest and need to investigate
possible drug candidates able to reduce TDP-43 aggregates. We have previously
shown in our lab that the sulfated polyanion dextran sulfate 5000 Da (DS) in low
concentration favors autophagy (Menvielle et al. 2013).Therefore, we have tested if
DS could help the cell to clear the aggregates in our TDP-43 aggregation model. We
have shown that upon DS treatment, less cells were possessing dot-like structure
inside the cytoplasm and more diffused GFP signal in comparison with the control
(Figure 11A and B). This result encouraged us to investigate DS-related aggregates
LC3-labelling. When U2OS cells were co-transfected with both EGFP-12xQ/N and
HcRed-hLC3 plasmids we noted that most of DS-treated cells with EGFP-12xQ/N
aggregates were LC3 positive (cells containing more than 8 LC3 red-dots) (Figure
12A). Moreover, DS treatment increased colocalization of EGFP-12xQ/N and red-
LC3 compared with control (Figure12B and 12C). This result is suggesting that there
was more LC3 recruitment (autophagosomes) to the EGFP-12xQ/N aggregates in DS
treated cells when compared to the control.
In order to obtain more consistent and regulated expression system we then
developed a stable HEK293 cell line expressing EGFP-12xQ/N under tetracycline
inducible promoter. We have demonstrated that our inducible stable cell system is
able to reproduce the dot-like EGFP-12xQ/N inclusions in the cytoplasm (Figure 13).
Next, we confirmed that DS increased the EGFP-12xQ/N product clearance as the
product amount decays when its synthesis is stopped in comparison to the control.In
addition as mentioned in the Results section we have observed significantvariability
of the aggregate clearance efficiency using different DS batches andcurrent
experiments are trying to pin down the cause.(Figure 14A, 14B, and 15A). We
further measured the effect of DS on EGFP-12xQ/N insoluble fraction by filter-trap
assay, where insoluble aggregates are not able to pass through the membrane unlike
the soluble GFP used as a negative control (Figure15B). DS-treated sample showed
aggregate content reduction of 0.6-fold in comparison to the control (Figure 15B,
GFP line) giving the confirmation of the DS induces aggregates clearance.
As the EGFP-12xQ/N aggregates were shown to be labelled with autophagosome-
lysosome markers, we aimed at investigation if autophagy is involved in enhanced
113
aggregates clearance upon DS addition. We checked the autophagy marker LC3-I to
LC3-II conversion, as an indicator of the autophagic activity in DS treated cells in
comparison to the untreated ones. In fact, we observed an increase of the autophagic
response upon DS treatment (Figure 16, LC3-I/II). As mentioned before, another
important player in autophagy is p62/SQSTM1, an aggregate bound protein that
recruits the autophagy machinery to the aggregates(Myeku & Figueiredo-Pereira
2011). Moreover, p62 is degraded by autophagy whereas, it is found accumulated
when the autophagic flux is inhibited. P62 level was significantly decreased in DS
samples compared to the control (Figure 16, p62). Taken together our data supports
the idea that DS plays an active role in the clearance of TDP-43 aggregates through
the adaptor protein p62 within the autophagy.
Suppression of the autophagy promoting genes such as Atg7 or Atg5, could be a tool
to check the direct involvement of autophagy in the DS enhenced EGFP-12xQ/N
clearance. For this purpose, we silenced one of the essential proteins for mammalian
autophagy, autophagy related gene 7 (Atg7), and we were able to abolish the DS
clearance action, compared to the respective control (siAtg7 ctrl in Figure 17) giving
the final evidence of the autophagy related DS clearance action.
As mentioned before, “loss of function” theory is putting the TDP-43 nuclear
depletion (as the consequence of TDP-43 retention, aggregation in the cytoplasm) in
the first line for the cause of the neuronal death in TDP-43 proteinopathies. Budini et
al. have shown before that some EGFP-12xQ/N aggregates are able to colocalize
with endogenous TDP-43 wild type suggesting the sequestration of the wild type
protein within the aggregates. In agreement with this, we were able to show
overlapping of the EGFP-12xQ/N signal with the endogenous TDP-43 (Figure 19A)
as well as with the overexpressed flag-TDP-43 wild type (Figure 19B) in some cells.
We therefore confirmed the ability of EGFP-12xQ/N to sequester TDP-43 wild type
in our stable inducible system. We further examined if DS treatment was able to
reduce this sequestration and to release TDP-43 wild type from the insoluble
fraction. We expressed simultaneously EGFP-12xQ/N and the exogenous flag-TDP-
43 wt in the clearance assay and separated the soluble (S) and the insoluble (P)
fractions and immunobloted with antibodies against GFP, flag, actin and tubulin. We
have shown that DS decreased the amount of flag-TDP-43 wt in the insoluble
fraction (P) compared to the control (0.4-fold change), consistenly with the EGFP-
114
12xQ/N aggregates behavior (0.5-fold change). This observation led us to propose
the model where DS treatment enhances the clearance of the aggregated EGFP-
12xQ/N through the autophagy leading to the decreased entrapment of TDP-43 wt
inside the insoluble fraction in the cell.
We further hypothesized that the enhanced clearance of TDP-43 aggregates by DS
could lower the capture of the cytoplasmic TDP-43 wild type, thus compensating its
loss from the nucleus, as TDP-43 is normaly nuclear protein. It was previously
shown the direct involvement of autophagy in rescuing the TDP-43 mislocalization
using rapamycin, suggesting that the cytoplasmic TDP-43 is normally degraded by
autophagy(Caccamo et al. 2009). In the same study it was given an in vivo evidence
that supports the hypothesis that accelerating autophagy may alleviate TDP-43-
mediated toxicity(Caccamo et al. 2009). Thus, we have decided to perform
nuclear/cytoplasmic fractionation to evaluate the level of TDP-43 wild type trapped
in the cytoplasm inuntreated and DS treated cells. We observed an enhanced TDP-43
wild type level in the nuclear fraction upon DS treatment when compared to the
control (Figure 22). Our findings support the scenario where low doses of DS 5000
Damay increase the efficacy of the main degradation pathway for TDP-43 aggregates
and decrease TDP-43 wild type sequestration in the cytoplasm. Projecting this model
to the ALS/FTD patient’s affected neurons where endogenous TDP-43 is captured by
cytoplasmic aggregates, leading to its nuclear loss of function, we suggest that DS
promoted autophagy would decrease TDP-43 sequestration in the cytoplasm and
restore normal nuclear level. This observation leads DS toward its possible
therapeutic use.
Interestingly, when we overexpressed TDP-43 wild type in our aggregation TDP-43
model, we noticed the appearance of small fragments of TDP-43 that correspond to
C-terminal fragments: 35 kDa and 25 kDa. Recent findings have shown that TDP-43
C-terminal fragments form cytoplasmic aggregates and cause cytotoxicity(Zhang et
al. 2009; Nonaka et al. 2009; Igaz et al. 2009; Johnson et al. 2008). Thus, TDP-43
truncation may play an important role in the pathogenesis of ALS, FTLD-U and
other TDP-43 proteinopathies. The degradation of TDP-43 by caspases was reported
to be responsible for generation of the C-terminal fragments due to the intrinsic
caspase cleavage sites in its primary sequence(Zhang et al. 2007; Rohn 2008; Rohn
& Kokoulina 2009). We aimed to confirm the caspase involved TDP degradation in
115
our model by the help of the pan caspase inhibitor Z-VAD (OMe)-FMK. The
generation of proteolytic fragments was inhibited by this caspase inhibitor as shown
in the Figure 20. After confirming that the fragments seen correspond to TDP-43 C-
terminal fragments, we checked if DS could decrease TDP-43 C-fragments amount
compared to the control. We have seen a slight decrease of the TDP-43 C-terminal
fragments in the cytoplasmic fraction in the DS sample compared to the control
(Figure22, anti TDP-43deltaQ/N). Yet, it is important to stand out that DS also could
have such action by decreasing caspase-3 action on TDP-43 degradation. In fact, it
was shown by Zhang et al., that the treatment with staurosporine (1µM), a potent
inducer of apoptosis and caspase-3 activator, leads to the high degradation of TDP-
43 and hence the presence of C-terminal fragments in the cytoplasm(Zhang et al.
2007). It was also reported that DS inhibits staurosporine-induced apoptosis via
decreasing the pro-caspase-9 activation, cleaved caspase-3 levels and the
cytochrome c release into the cytosol(Jing et al. 2011). Nevertheless, more
experiments are required to reveal the mechanism by which DS interferes with the
caspase action on TDP-43 or whether DS while enhancing EGFP-12xQ/N aggregates
clearance clear the C-terminal fragments too.
We further aimed to investigate the molecular bases by which DS would be acting as
an enhancer of EGFP-12xQ/N clearance through the autophagy. HDAC6 has
emerged as an important player in the cellular management of protein
aggregates(Rodriguez-Gonzalez et al. 2008). It is now well known that histone
deacetylase-6 (HDAC6) recruits and binds the polyubiquitinated misfolded protein
cargo to dynein motors for transportation to the aggresome(Kawaguchi et al. 2003), a
process required for autophagic degradation of aberrant aggregated proteins like
Huntingtin(Iwata et al. 2005). In addition, several studies showed that HDAC6
mutations reduce the transportation of autophagosomes to perinuclear regions where
lysosomes are more abundant, resulting in the impairment of autophagosome-
lysosome fusion and reduced clearance of aggregate-prone proteins(Lee et al. 2010).
HDAC6 also colocalizes with α-syn and ubiquitin in the Lewy bodies of PD and
Dementia with Lewy Bodies (Kawaguchi et al. 2003; Boyault et al. 2006). Therefore,
HDAC6 may be a key regulator in the cellular clearance of abnormal proteins.
Here,we sought to investigate whether HDAC6 regulates the aggresome-autophagic
clearance of EGFP-12xQ/N and if DS may interfere with HDAC6. Despite the fact
116
that no HDAC6 protein expression level difference upon DS treatment in comparison
with the control was noticed (Figure 24, lane 1 and lane 3, HDAC6), we decided to
check if HDAC6 activity could be altered by DS. It is known that HDAC6 works as a
tubulin deacetylase protein(Zhang et al. 2003), so we looked if the level of acetylated
tubulin was altered in the DS treated cells in comparison to the non treated control.
In fact, upon DS treatment, we could see reduction of the acetylated tubulin (figure
24, ac-tubulin) that could indicate the effect of DS on HDAC6 activity, rather than
protein expression level. Inhibiting HDAC6 with Trichostatin A (TSA) abolished the
effect of DS on tubulin acetylation (Figure 24, lane 4 and 3, anti ac-tubulin). We
found that both pharmacological inhibition of HDAC6 as well as its depletion with
specific siRNA enhance microtubule acetylation, and eliminate DS clearance effect
on EGFP-12xQ/N aggregates (shown in Figure 23). In order to confirm that DS
action on EGFP-12xQ/N clearance is HDAC6 activity dependent, we reintroduced
wild type (HDAC6-wt) or the catalytically inactivate HDAC6 (HDAC6-DC) into the
HDAC-6 silenced cells. We actually used expression plasmids with silent mutations
in the sequences targeted by the HDAC6 siRNA in order to protect them from
degradation(Kawaguchi et al. 2003). We have shown that adding back HDAC6 wt in
the silenced cells restored the DS clearance effect in the treated cells compared to its
respective control, whereas, catalytically inactive HDAC6 mutant had no effect
(Figure 24, line 7 and line 8). Our findings demonstrated that the observed DS
induced EGFP-12xQ/N product decay is mediated by HDAC6. Moreover, this DS-
mediated autophagy action requires a catalytically deacetylase activity of HDAC6. In
fact, it was suggested that HDAC6 also plays a role in the eventual clearance of the
aggresomes in an autophagy-dependent manner, implying a functional connection
between HDAC6 and autophagy(Iwata et al. 2005; Pandey et al. 2007). In addition,
for HDAC6 has been shown to promote fusion of autophagosomes and lysosomes
and facilitates clearance of protein aggregates(Lee et al. 2010). Even more
specifically HDAC6 catalytic activity has been shown to be essential for turnover of
abberant proteins by autophagy(Pandey et al. 2007).As HDAC6 seems to play a
regulatory role in the clearance of misfolded proteins, activation of HDAC6
deacetylase function could be a promising strategy in processing aberrant protein
aggregation in ALS and other proteinopathies. It seems that in general
pharmacological activation of deacetylation reactions in the cytoplasm is positively
117
correlated with the autophagy induction. Indeed, for resveratrol and a panel of
phenolic compounds was demonstrated to stimulate the deacetylation of cytoplasmic
proteins and protects against neurotoxicity in AD and ALS mouse models through
the autophagic flux promotion(Kim et al. 2007; Pietrocola et al. 2012).
Interestingly, it has been suggested that the defect in autophagosome-lysosome
fusion may be an important factor in the development of neurodegenerative disease,
giving abnormal autophagic structures found in Alzheimer’s disease patients
neurons(Nixon et al. 2005). Taking together DS clearance action through the
HDAC6 and HDAC6 involvement in the autophagosome-lysosome fusion one could
investigate a possible link of DS and the maturation step of autophagy. The construct
ptfLC3 that contains mRFP-EGFP tandem fluorescent-tagged LC3 is showing a GFP
and mRFP signal within autophagosomes, but only mRFP signal after
autophagosomes fusion with lysosomes due to the GFP lost in the acidic lysosomal
environment (Kimura et al. 2007). The number of yellow puncta (colocalization of
GFP and mRFP signals) is reflecting the number of autophagosomes per cell,
whereas the red puncta (mRFP signal) is reflecting the number of lysosomes per cell.
On this way mRFP-EGFP-LC3 reporter could be very useful to discriminate between
acidic (autolysosomes) and neutral (autophagosomes) LC3-positive vesicles. The use
of EGFP-12xQ/N construct in this assay is not possible due to the green signal
overlap with GFP fluorescence from LC3. Our preliminary data with HeLa cells
transfected with mRFP-EGFP-LC3 reporter and treated with DS are showing the
lower number of autophagosomes in favor of autolysosomes (red puncta) in the DS
treated samples in comparison to the control conditions (data not shown). This result
may suggest that autophagic turnover in the cell could be faster upon DS treatment.
This observation is leading to the interpretation where DS may help the cell to clear
TDP-43 aggregates through the more effective autophagosomes fusion to lysosomes
resulting in the more efficient cargo degradation. Further experiments are necessary
to confirm and analyze in details DS tendency toward autophagy flux promotion and
link with HDAC6, but the autophagosome-lysosome fusion stimulation, rather than
autophagy activation is doubtless an attractive therapeutic approach for
neurodegenerative disease.
On the base of our data, we are suggesting the DS as a potential therapeutic agent for
TDP-43 proteinopathies. In this respect, we have decided to investigate DS toxicity
118
on the motor neuronal-like cells. NSC-34 cell line was proposed to be a good model
for neurotoxicity testing (Durham et al. 1993). In order to assess DS toxicity, many
assays could be used, such as cell viability, cell morphology, cell proliferation and
cellular membrane damage. We decided to use the most standardized test that assess
cell viability, MTT reduction assay as an indicator of cell redox activity. NSC-34
cells viability was assessed 48 hours after DS 5000 Da (100 mg/l) addition into the
medium, in the presence or absence of EGFP-12xQ/N aggregates. In three
independent experiments, DS did not show any toxicity in NSC-34 cells (Figure 26A
and 26B). This is in the agreement with our previously published data obtained with
HeLa and CHO cells (Menvielle et al. 2013), where we showed that DS is able to
enhance the cells survival through autophagy induction and apoptosis inhibition. DS-
mediated apoptosis inhibition was also shown in staurosporine-induced apoptosis
model in the cells(Jing et al. 2011).
Dextran sulfate is a semisynthetic analog of the glycosaminoglycan family, which
includes heparin, heparan sulfate, dermatan sulfate, and chondroitin sulfate. For
some low molecular weight heparins was shown to be able to pass through the blood-
brain barrier (Leveugle et al. 1998; Ma et al. 2002) and act as neuroprotective agents
(Pérez et al. 1998; Stutzmann et al. 2002; Ma et al. 2007). Dextran sulfate 5000 Da is
not toxic for the motor neuronal-like cell line NSC-34, that together with the fact that
DS already passed the test of time for human use, experiencing over 40 years of its
consumption in Japan to treat arteriosclerosis and high cholesterol, may be
considered as a promising therapeutic agent to treat TDP-43 proteinopathies in
humans.
119
5. C O N C L USI O NS
Protein clearing systems play a key role in TDP-43 proteinopathies. In particular,
autophagy represents the main pathway which through the clearance of the misfolded
proteins removes the potentially toxic material countering to cell death. There is now
a solid evidence that links directly a defective autophagy to ALS. Many studies have
shown that increasing autophagic flux with pharmacological inducers of autophagy
could counteract the pathophysiology of ALS.
EGFP-12xQ/N model of TDP-43 aggregation is a valuable tool to investigate cellular
protein degradation responses. We have shown that some EGFP-12xQ/N aggregates
were labeled with autophagy-lysosomal pathway markers: LC3, p62, and Lamp1
targeting them for degradation through the autophagy. Next, we have demonstrated
that dextran sulfate 5000 Da was able to promote the clearance of the EGFP-12xQ/N
aggregates via autophagy stimulation. Projecting this model to the ALS patient's
affected neurons where endogenous TDP-43 is captured by cytoplasmic aggregates
leading to its nuclear loss, we have demonstrated DS-induced lower TDP-43 wild
type sequestration inside the insoluble fraction. Additionally, we observed a
reduction of acetylated tubulin in DS-treated cells through the higher HDAC6
activity, indicating the role of HDAC6 in DS-mediated TDP-43 EGFP-12xQ/N
aggregates clearance.
120
In conclusion, we propose a model where DS leads to autophagy activation through
the stimulation of HDAC6 activity. As HDAC6 seems to play a regulatory role in the
clearance of misfolded proteins, its pharmacological activation could be a promising
strategy in processing aberrant protein aggregation in ALS, as it was shown before
for Huntington's disease model(Iwata et al. 2005; Pandey et al. 2007).
Data obtained in this study leads DS toward its possible therapeutic use. We have
shown here that DS 5000 Da is not toxic per se for the motor neuronal-like cell line
NSC-34 and may be considered as a promising therapeutic agent to treat TDP-43
proteinopathies in humans.
6. BIB L I O G R APH Y Ahlberg, J. & Glaumann, H., 1985. Uptake--microautophagy--and degradation of
exogenous proteins by isolated rat liver lysosomes. Effects of pH, ATP, and inhibitors of proteolysis. Experimental and molecular pathology, 42(1), pp.78–88.
Al-Sarraj, S. et al., 2011. p62 positive, TDP-43 negative, neuronal cytoplasmic and intranuclear inclusions in the cerebellum and hippocampus define the pathology of C9orf72-linked FTLD and MND/ALS. Acta neuropathologica, 122(6), pp.691–702.
Andersen, P.M. et al., 2003. Sixteen novel mutations in the Cu/Zn superoxide dismutase gene in amyotrophic lateral sclerosis: a decade of discoveries, defects and disputes. Amyotrophic lateral sclerosis and other motor neuron disorders : official publication of the World F ederation of Neurology, Research Group on Motor Neuron Diseases, 4(2), pp.62–73.
Andersson, M.K. et al., 2008. The multifunctional FUS, EWS and TAF15 proto-oncoproteins show cell type-specific expression patterns and involvement in cell spreading and stress response. BMC cell biology, 9(1), p.37.
Aplin, A. et al., 1992. Cytoskeletal elements are required for the formation and maturation of autophagic vacuoles. Journal of cellular physiology, 152(3), pp.458–66.
Arai, T. et al., 2006. TDP-43 is a component of ubiquitin-positive tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Biochemical and biophysical research communications, 351(3), pp.602–11.
121
Arrasate, M. et al., 2004. Inclusion body formation reduces levels of mutant huntingtin and the risk of neuronal death. Nature, 431(7010), pp.805–10.
Attaix, D. et al., 2001. Regulation of proteolysis. Current opinion in clinical nutrition and metabolic care, 4(1), pp.45–9.
Ayala, Y.M. et al., 2005. Human, Drosophila, and C.elegans TDP43: nucleic acid binding properties and splicing regulatory function. Journal of molecular biology, 348(3), pp.575–88.
Ayala, Y.M. et al., 2008. Structural determinants of the cellular localization and shuttling of TDP-43. Journal of cell science, 121(Pt 22), pp.3778–85.
Balls, M. & Horner, S.A., 1985. The FRAME interlaboratory programme on in vitro cytotoxicology. Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 23(2), pp.209–13.
Banks, G.T. et al., 2008. TDP-43 is a culprit in human neurodegeneration, and not just an innocent bystander. Mammalian genome : official journal of the International Mammalian Genome Society, 19(5), pp.299–305.
Banz, Y. et al., 2005. Locally targeted cytoprotection with dextran sulfate attenuates experimental porcine myocardial ischaemia/reperfusion injury. European heart journal, 26(21), pp.2334–43.
Barmada, S.J. & Finkbeiner, S., 2010. Pathogenic TARDBP mutations in amyotrophic lateral sclerosis and frontotemporal dementia: disease-associated pathways. Reviews in the neurosciences, 21(4), pp.251–72.
Berger, Z. et al., 2006. Rapamycin alleviates toxicity of different aggregate-prone proteins. Human molecular genetics, 15(3), pp.433–42.
Bernales, S., McDonald, K.L. & Walter, P., 2006. Autophagy counterbalances endoplasmic reticulum expansion during the unfolded protein response. PLoS biology, 4(12), p.e423.
Bjørkøy, G. et al., 2005. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. The Journal of cell biology, 171(4), pp.603–14.
Del Bo, R. et al., 2009. TARDBP (TDP-43) sequence analysis in patients with familial and sporadic ALS: identification of two novel mutations. European journal of neurology : the official journal of the European Federation of Neurological Societies, 16(6), pp.727–32.
Boland, B. et al., 2008. Autophagy induction and autophagosome clearance in neurons: relationship to autophagic pathology in Alzheimer’s disease. The Journal of neuroscience : the official journal of the Society for Neuroscience, 28(27), pp.6926–37.
122
Borroni, B. et al., 2009. Mutation within TARDBP leads to frontotemporal dementia without motor neuron disease. Human mutation, 30(11), pp.E974–83.
Boyault, C. et al., 2007. HDAC6, at the crossroads between cytoskeleton and cell signaling by acetylation and ubiquitination. Oncogene, 26(37), pp.5468–76.
Boyault, C. et al., 2006. HDAC6-p97/VCP controlled polyubiquitin chain turnover. The EMBO journal, 25(14), pp.3357–66.
Brady, O. a et al., 2011. Regulation of TDP-43 aggregation by phosphorylation and p62/SQSTM1. Journal of neurochemistry, 116(2), pp.248–59.
Brooks, B.R. et al., 2000. El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis. Amyotrophic lateral sclerosis and other motor neuron disorders : official publication of the World Federation of Neurology, Research Group on Motor Neuron Diseases, 1(5), pp.293–9.
Brooks, B.R., 1994. El Escorial World Federation of Neurology criteria for the diagnosis of amyotrophic lateral sclerosis. Subcommittee on Motor Neuron Diseases/Amyotrophic Lateral Sclerosis of the World Federation of Neurology Research Group on Neuromuscular Diseases and th. Journal of the neurological sciences, 124 Suppl, pp.96–107.
Bruijn, L.I. et al., 1998. Aggregation and Motor Neuron Toxicity of an ALS-Linked SOD1 Mutant Independent from Wild-Type SOD1. Science, 281(5384), pp.1851–4.
Bruijn, L.I., Miller, T.M. & Cleveland, D.W., 2004. Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annual review of neuroscience, 27, pp.723–49.
Budini, M. et al., 2012. Cellular model of TAR DNA-binding protein 43 (TDP-43) aggregation based on its C-terminal Gln/Asn-rich region. The Journal of biological chemistry, 287(10), pp.7512–25.
Buratti, E. et al., 2005. TDP-43 binds heterogeneous nuclear ribonucleoprotein A/B through its C-terminal tail: an important region for the inhibition of cystic fibrosis transmembrane conductance regulator exon 9 splicing. The Journal of biological chemistry, 280(45), pp.37572–84.
Buratti, E. & Baralle, F.E., 2001. Characterization and functional implications of the RNA binding properties of nuclear factor TDP-43, a novel splicing regulator of CFTR exon 9. The Journal of biological chemistry, 276(39), pp.36337–43.
Buratti, E. & Baralle, F.E., 2008. Multiple roles of TDP-43 in gene expression, splicing regulation, and human disease. Frontiers in bioscience : a journal and virtual library, 13, pp.867–78.
123
Caccamo, A. et al., 2010. Molecular interplay between mammalian target of rapamycin (mTOR), amyloid-beta, and Tau: effects on cognitive impairments. The Journal of biological chemistry, 285(17), pp.13107–20.
Caccamo, A. et al., 2009. Rapamycin rescues TDP-43 mislocalization and the associated low molecular mass neurofilament instability. The Journal of biological chemistry, 284(40), pp.27416–24.
Chen, Y. et al., 2011. Expression of human FUS protein in Drosophila leads to progressive neurodegeneration. Protein & cell, 2(6), pp.477–86.
Cheng, I.H. et al., 2007. Accelerating amyloid-beta fibrillization reduces oligomer levels and functional deficits in Alzheimer disease mouse models. The Journal of biological chemistry, 282(33), pp.23818–28.
Chen-Plotkin, A.S., Lee, V.M.-Y. & Trojanowski, J.Q., 2010. TAR DNA-binding protein 43 in neurodegenerative disease. Nature reviews. Neurology, 6(4), pp.211–20.
Chiang, H.L. et al., 1989. A role for a 70-kilodalton heat shock protein in lysosomal degradation of intracellular proteins. Science (New York, N.Y.), 246(4928), pp.382–5.
Chung, C.T., Niemela, S.L. & Miller, R.H., 1989. One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proceedings of the National Academy of Sciences, 86(7), pp.2172–2175.
Clausen, T.H. et al., 2010. p62/SQSTM1 and ALFY interact to facilitate the formation of p62 bodies/ALIS and their degradation by autophagy. Autophagy, 6(3), pp.330–44.
Cohen, E. et al., 2009. Reduced IGF-1 signaling delays age-associated proteotoxicity in mice. Cell, 139(6), pp.1157–69.
Corrado, L. et al., 2009. High frequency of TARDBP gene mutations in Italian patients with amyotrophic lateral sclerosis. Human mutation, 30(4), pp.688–94.
Coux, O., Tanaka, K. & Goldberg, A.L., 1996. Structure and functions of the 20S and 26S proteasomes. Annual review of biochemistry, 65, pp.801–47.
Cozzolino, M., Ferri, A. & Carrì, M.T., 2008. Amyotrophic lateral sclerosis: from current developments in the laboratory to clinical implications. Antioxidants & redox signaling, 10(3), pp.405–43.
Da Cruz, S. & Cleveland, D.W., 2011. Understanding the role of TDP-43 and FUS/TLS in ALS and beyond. Current opinion in neurobiology, 21(6), pp.904–19.
124
Cuervo, A.M. et al., 2005. Autophagy and Aging: The Importance of Maintaining “Clean” Cells. Autophagy, 1(3), pp.131–141.
Cuervo, A.M., 2010. Chaperone-mediated autophagy: selectivity pays off. Trends in endocrinology and metabolism: TEM, 21(3), pp.142–50.
Cuervo, A.M. & Dice, J.F., 1996. A receptor for the selective uptake and degradation of proteins by lysosomes. Science (New York, N.Y.), 273(5274), pp.501–3.
D’Ambrogio, A. et al., 2009. Functional mapping of the interaction between TDP-43 and hnRNP A2 in vivo. Nucleic acids research, 37(12), pp.4116–26.
Daoud, H. et al., 2009. Contribution of TARDBP mutations to sporadic amyotrophic lateral sclerosis. Journal of medical genetics, 46(2), pp.112–4.
Van Deerlin, V.M. et al., 2008. TARDBP mutations in amyotrophic lateral sclerosis with TDP-43 neuropathology: a genetic and histopathological analysis. Lancet neurology, 7(5), pp.409–16.
Degenhardt, K. et al., 2006. Autophagy promotes tumor cell survival and restricts necrosis, inflammation, and tumorigenesis. Cancer cell, 10(1), pp.51–64.
Dewey, C.M. et al., 2012. TDP-43 aggregation in neurodegeneration: are stress granules the key? Brain research, 1462(null), pp.16–25.
Díaz-Hernández, M. et al., 2003. Neuronal induction of the immunoproteasome in Huntington’s disease. The Journal of neuroscience : the official journal of the Society for Neuroscience, 23(37), pp.11653–61.
Ding, W.-X. et al., 2007. Linking of autophagy to ubiquitin-proteasome system is important for the regulation of endoplasmic reticulum stress and cell viability. The American journal of pathology, 171(2), pp.513–24.
Dobson, C.M., 2003. Protein folding and misfolding. Nature, 426(6968), pp.884–90.
Dreyfuss, G. et al., 1993. hnRNP proteins and the biogenesis of mRNA. Annual review of biochemistry, 62, pp.289–321.
Dubouloz, F. et al., 2005. The TOR and EGO protein complexes orchestrate microautophagy in yeast. Molecular cell, 19(1), pp.15–26.
Dunkel, P. et al., 2012. Clinical utility of neuroprotective agents in neurodegenerative diseases: current status of drug development for Alzheimer’s, Parkinson's and Huntington's diseases, and amyotrophic lateral sclerosis. Expert opinion on investigational drugs, 21(9), pp.1267–308.
Durham, H.D., Dahrouge, S. & Cashman, N.R., 1993. Evaluation of the spinal cord neuron X neuroblastoma hybrid cell line NSC-34 as a model for neurotoxicity testing. Neurotoxicology, 14(4), pp.387–95.
125
De Duve, C. & Wattiaux, R., 1966. Functions of lysosomes. Annual review of physiology, 28, pp.435–92.
De Duve Christian, 1965. the lysosome. Scientific American, (208), pp.64–78.
Essner E. & Novikoff, A.B., 1961. Localization of acid phosphatase activity in hepatic lysosomes by means of electron microscopy. The Journal of biophysical and biochemical cytology, 9, pp.773–84.
Estes, P.S. et al., 2011. Wild-type and A315T mutant TDP-43 exert differential neurotoxicity in a Drosophila model of ALS. Human molecular genetics, 20(12), pp.2308–21.
Fass, E. et al., 2006. Microtubules support production of starvation-induced autophagosomes but not their targeting and fusion with lysosomes. The Journal of biological chemistry, 281(47), pp.36303–16.
Feiguin, F. et al., 2009. Depletion of TDP-43 affects Drosophila motoneurons terminal synapsis and locomotive behavior. F EBS letters, 583(10), pp.1586–92.
Fengsrud, M. et al., 1995. Ultrastructural and immunocytochemical characterization of autophagic vacuoles in isolated hepatocytes: effects of vinblastine and asparagine on vacuole distributions. Experimental cell research, 221(2), pp.504–19.
Fiesel, F.C. et al., 2010. Knockdown of transactive response DNA-binding protein (TDP-43) downregulates histone deacetylase 6. The EMBO journal, 29(1), pp.209–21.
Finkbeiner, S. et al., 2006. -Disease modifying pathways in neurodegeneration. The Journal of neuroscience : the official journal of the Society for Neuroscience, 26(41), pp.10349–57.
Fornai, F., Longone, P., Ferrucci, M., et al., 2008. Autophagy and amyotrophic lateral sclerosis: The multiple roles of lithium. Autophagy, 4(4), pp.527–30.
Fornai, F., Longone, P., Cafaro, L., et al., 2008. Lithium delays progression of amyotrophic lateral sclerosis. Proceedings of the National Academy of Sciences of the United States of America, 105(6), pp.2052–7.
Fuentealba, R.A. et al., 2010. Interaction with polyglutamine aggregates reveals a Q/N-rich domain in TDP-43. The Journal of biological chemistry, 285(34), pp.26304–14.
Geng, J. & Klionsky, D.J., 2008. The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. “Protein modifications: beyond the usual suspects” review series. EMBO reports, 9(9), pp.859–64.
Geser, F. et al., 2009. Amyotrophic lateral sclerosis, frontotemporal dementia and beyond: the TDP-43 diseases. Journal of neurology, 256(8), pp.1205–14.
126
Gidalevitz, T. et al., 2009. Destabilizing protein polymorphisms in the genetic background direct phenotypic expression of mutant SOD1 toxicity. H. Orr, ed. PLoS genetics, 5(3), p.e1000399.
Giordana, M.T. et al., 2010. TDP-43 redistribution is an early event in sporadic amyotrophic lateral sclerosis. Brain pathology (Zurich, Switzerland), 20(2), pp.351–60.
Gitcho, M.A. et al., 2009. TARDBP 3’-UTR variant in autopsy-confirmed frontotemporal lobar degeneration with TDP-43 proteinopathy. Acta neuropathologica, 118(5), pp.633–45.
Glicksman, M.A., 2011. The preclinical discovery of amyotrophic lateral sclerosis drugs. Expert opinion on drug discovery, 6(11), pp.1127–38.
Gomes, C., Escrevente, C. & Costa, J., 2010. Mutant superoxide dismutase 1 overexpression in NSC-34 cells: effect of trehalose on aggregation, TDP-43 localization and levels of co-expressed glycoproteins. Neuroscience letters, 475(3), pp.145–9.
Gong, Y.H. et al., 2000. Restricted expression of G86R Cu/Zn superoxide dismutase in astrocytes results in astrocytosis but does not cause motoneuron degeneration. The Journal of neuroscience : the official journal of the Society for Neuroscience, 20(2), pp.660–5.
Gräßler, J. et al., 2013. Differential effects of lipoprotein apheresis by lipidfiltration or dextran sulfate adsorption on lipidomic profile. Atherosclerosis. Supplements, 14(1), pp.151–5.
Grune, T. et al., 2004. Decreased proteolysis caused by protein aggregates, inclusion bodies, plaques, lipofuscin, ceroid, and “aggresomes” during oxidative stress, aging, and disease. The international journal of biochemistry & cell biology, 36(12), pp.2519–30.
Gutierrez, M.G. et al., 2004. Rab7 is required for the normal progression of the autophagic pathway in mammalian cells. Journal of cell science, 117(Pt 13), pp.2687–97.
Habib, A.A. & Mitsumoto, H., 2011. Emerging drugs for amyotrophic lateral sclerosis. Expert opinion on emerging drugs, 16(3), pp.537–58.
Hahn, 1898. Das proteolytische Enzym des Hefepresssaftes. Berichte der Deutschen Chemischen Gesellschaft, 31, pp.200–201.
Hanson, K.A. et al., 2010. Ubiquilin modifies TDP-43 toxicity in a Drosophila model of amyotrophic lateral sclerosis (ALS). The Journal of biological chemistry, 285(15), pp.11068–72.
127
Hara, T. et al., 2008. FIP200, a ULK-interacting protein, is required for autophagosome formation in mammalian cells. The Journal of cell biology, 181(3), pp.497–510.
Hara, T. et al., 2006. Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature, 441(7095), pp.885–9.
Harding, T.M., 1995. Isolation and characterization of yeast mutants in the cytoplasm to vacuole protein targeting pathway. The Journal of Cell Biology, 131(3), pp.591–602.
Hars, E.S. et al., 2007. Autophagy regulates ageing in C. elegans. Autophagy, 3(2), pp.93–5.
Haverkamp, L.J., Appel, V. & Appel, S.H., 1995. Natural history of amyotrophic lateral sclerosis in a database population. Validation of a scoring system and a model for survival prediction. Brain : a journal of neurology, 118 ( Pt 3, pp.707–19.
Hayes-Punzo, A. et al., 2012. Gonadectomy and dehydroepiandrosterone (DHEA) do not modulate disease progression in the G93A mutant SOD1 rat model of amyotrophic lateral sclerosis. Amyotrophic lateral sclerosis : official publication of the World F ederation of Neurology Research Group on Motor Neuron Diseases, 13(3), pp.311–4.
Heinemeyer, W. et al., 1991. Proteinase yscE, the yeast proteasome/multicatalytic-multifunctional proteinase: mutants unravel its function in stress induced proteolysis and uncover its necessity for cell survival. The EMBO journal, 10(3), pp.555–62.
Herman, P.K. & Emr, S.D., 1990. Characterization of VPS34, a gene required for vacuolar protein sorting and vacuole segregation in Saccharomyces cerevisiae. Molecular and cellular biology, 10(12), pp.6742–54.
Hershko, A., Ciechanover, A. & Varshavsky, A., 2000. Basic Medical Research Award. The ubiquitin system. Nature medicine, 6(10), pp.1073–81.
Hilt, W. & Wolf, D.H., 1996. Proteasomes: destruction as a programme. Trends in Biochemical Sciences, 21(3), pp.96–102.
Hochstrasser, M., 1995. Ubiquitin, proteasomes, and the regulation of intracellular protein degradation. Current opinion in cell biology, 7(2), pp.215–23.
Hosokawa, N. et al., 2009. Nutrient-dependent mTORC1 association with the ULK1-Atg13-FIP200 complex required for autophagy. Molecular biology of the cell, 20(7), pp.1981–91.
Huang, C.-C. et al., 2014. Metabolism and mis-metabolism of the neuropathological signature protein TDP-43. Journal of cell science, p.jcs.136150–.
128
Hubbard, V.M. et al., 2012. Selective autophagy in the maintenance of cellular homeostasis in aging organisms. Biogerontology, 13(1), pp.21–35.
Ichimura, Y. et al., 2008. Selective turnover of p62/A170/SQSTM1 by autophagy. Autophagy, 4(8), pp.1063–6.
Igaz, L.M. et al., 2009. Expression of TDP-43 C-terminal Fragments in Vitro Recapitulates Pathological Features of TDP-43 Proteinopathies. The Journal of biological chemistry, 284(13), pp.8516–24.
Iwata, A. et al., 2005. HDAC6 and Microtubules Are Required for Autophagic Degradation of Aggregated Huntingtin * . , 280(48), pp.40282–40292.
Jaeger, P.A. & Wyss-Coray, T., 2009. All-you-can-eat: autophagy in neurodegeneration and neuroprotection. Molecular neurodegeneration, 4(1), p.16.
Jing, Y. et al., 2011. Dextran sulfate inhibits staurosporine-induced apoptosis in Chinese hamster ovary (CHO) cells: Involvement of the mitochondrial pathway. Process Biochemistry, 46(1), pp.427–432.
Johansen, T. & Lamark, T., 2011. Selective autophagy mediated by autophagic adapter proteins. Autophagy, 7(3), pp.279–96.
Johnson, B.S. et al., 2008. A yeast TDP-43 proteinopathy model: Exploring the molecular determinants of TDP-43 aggregation and cellular toxicity. Proceedings of the National Academy of Sciences of the United States of America, 105(17), pp.6439–44.
Johnson, B.S. et al., 2009. TDP-43 is intrinsically aggregation-prone, and amyotrophic lateral sclerosis-linked mutations accelerate aggregation and increase toxicity. The Journal of biological chemistry, 284(30), pp.20329–39.
Johnston, J.A. et al., 2000. Formation of high molecular weight complexes of mutant Cu, Zn-superoxide dismutase in a mouse model for familial amyotrophic lateral sclerosis. Proceedings of the National Academy of Sciences of the United States of America, 97(23), pp.12571–6.
Johnston, J.A., Ward, C.L. & Kopito, R.R., 1998. Aggresomes: a cellular response to misfolded proteins. The Journal of cell biology, 143(7), pp.1883–98.
Kabashi, E. et al., 2010. Gain and loss of function of ALS-related mutations of TARDBP (TDP-43) cause motor deficits in vivo. Human molecular genetics, 19(4), pp.671–83.
Kabashi, E. et al., 2008. TARDBP mutations in individuals with sporadic and familial amyotrophic lateral sclerosis. Nature genetics, 40(5), pp.572–4.
129
Kabeya, Y. et al., 2000. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. The EMBO journal, 19(21), pp.5720–8.
Kabuta, T., Suzuki, Y. & Wada, K., 2006. Degradation of amyotrophic lateral sclerosis-linked mutant Cu,Zn-superoxide dismutase proteins by macroautophagy and the proteasome. The Journal of biological chemistry, 281(41), pp.30524–33.
Kalmar, B. et al., 2008. Late stage treatment with arimoclomol delays disease progression and prevents protein aggregation in the SOD1 mouse model of ALS. Journal of neurochemistry, 107(2), pp.339–50.
Katsumata, K. et al., 2010. Dynein- and activity-dependent retrograde transport of autophagosomes in neuronal axons. Autophagy, 6(3), pp.378–85.
Kawaguchi, Y. et al., 2003. The deacetylase HDAC6 regulates aggresome formation and cell viability in response to misfolded protein stress. Cell, 115(6), pp.727–38.
Kayed, R. et al., 2003. Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis. Science (New York, N.Y.), 300(5618), pp.486–9.
Kim, D. et al., 2007. SIRT1 deacetylase protects against neurodegeneration in models for Alzheimer’s disease and amyotrophic lateral sclerosis. The EMBO journal, 26(13), pp.3169–79.
Kim, J. et al., 2013. Differential regulation of distinct Vps34 complexes by AMPK in nutrient stress and autophagy. Cell, 152(1-2), pp.290–303.
Kimura, S., Noda, T. & Yoshimori, T., 2007. Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent-tagged LC3. Autophagy, 3(5), pp.452–60.
King, A. et al., 2011. Ubiquitinated, p62 immunopositive cerebellar cortical neuronal inclusions are evident across the spectrum of TDP-43 proteinopathies but are only rarely additionally immunopositive for phosphorylation-dependent TDP-43. Neuropathology : official journal of the Japanese Society of Neuropathology, 31(3), pp.239–49.
Kirisako, T. et al., 1999. Formation process of autophagosome is traced with Apg8/Aut7p in yeast. The Journal of cell biology, 147(2), pp.435–46.
Kirkin, V. et al., 2009. A role for NBR1 in autophagosomal degradation of ubiquitinated substrates. Molecular cell, 33(4), pp.505–16.
Kitamura, A. et al., 2006. Cytosolic chaperonin prevents polyglutamine toxicity with altering the aggregation state. Nature cell biology, 8(10), pp.1163–70.
130
Klionsky, D.J. et al., 2007. How shall I eat thee? Autophagy, 3(5), pp.413–6.
Klionsky, D.J. & Emr, S.D., 2000. Autophagy as a Regulated Pathway of Cellular Degradation. Science, 290(5497), pp.1717–21.
Köchl, R. et al., 2006. Microtubules facilitate autophagosome formation and fusion of autophagosomes with endosomes. Traffic (Copenhagen, Denmark), 7(2), pp.129–45.
Komander, D., 2009. The emerging complexity of protein ubiquitination. Biochemical Society transactions, 37(Pt 5), pp.937–53.
Komatsu, M. et al., 2007. Homeostatic levels of p62 control cytoplasmic inclusion body formation in autophagy-deficient mice. Cell, 131(6), pp.1149–63.
Komatsu, M. et al., 2005. Impairment of starvation-induced and constitutive autophagy in Atg7-deficient mice. The Journal of cell biology, 169(3), pp.425–34.
Komatsu, M. et al., 2006. Loss of autophagy in the central nervous system causes neurodegeneration in mice. Nature, 441(7095), pp.880–4.
Kopito, R.R., 2000. Aggresomes, inclusion bodies and protein aggregation. Trends in cell biology, 10(12), pp.524–30.
Korolchuk, V.I., Mansilla, A., et al., 2009. Autophagy inhibition compromises degradation of ubiquitin-proteasome pathway substrates. Molecular cell, 33(4), pp.517–27.
Korolchuk, V.I., Menzies, F.M. & Rubinsztein, D.C., 2009. A novel link between autophagy and the ubiquitin-proteasome system. Autophagy, 5(6), pp.862–3.
Korolchuk, V.I., Menzies, F.M. & Rubinsztein, D.C., 2010. Mechanisms of cross-talk between the ubiquitin-proteasome and autophagy-lysosome systems. F EBS letters, 584(7), pp.1393–8.
Kraft, C., Peter, M. & Hofmann, K., 2010. Selective autophagy: ubiquitin-mediated recognition and beyond. Nature cell biology, 12(9), pp.836–41.
Kroemer, G., Mariño, G. & Levine, B., 2010. Autophagy and the integrated stress response. Molecular cell, 40(2), pp.280–93.
Kühnlein, P. et al., 2008. Two German kindreds with familial amyotrophic lateral sclerosis due to TARDBP mutations. Archives of neurology, 65(9), pp.1185–9.
Kuo, P.-H. et al., 2009. Structural insights into TDP-43 in nucleic-acid binding and domain interactions. Nucleic acids research, 37(6), pp.1799–808.
131
Kwiatkowski, T.J. et al., 2009. Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis. Science (New York, N.Y.), 323(5918), pp.1205–8.
Kwong, L.K. et al., 2007. TDP-43 proteinopathy: the neuropathology underlying major forms of sporadic and familial frontotemporal lobar degeneration and motor neuron disease. Acta neuropathologica, 114(1), pp.63–70.
Lagier-Tourenne, C., Polymenidou, M. & Cleveland, D.W., 2010. TDP-43 and FUS/TLS: emerging roles in RNA processing and neurodegeneration. Human molecular genetics, 19(R1), pp.R46–64.
Laird, A.S. et al., 2010. Progranulin is neurotrophic in vivo and protects against a mutant TDP-43 induced axonopathy. PloS one, 5(10), p.e13368.
Laird, F.M. et al., 2008. Motor neuron disease occurring in a mutant dynactin mouse model is characterized by defects in vesicular trafficking. The Journal of neuroscience : the official journal of the Society for Neuroscience, 28(9), pp.1997–2005.
Lamark, T. & Johansen, T., 2012. Aggrephagy: selective disposal of protein aggregates by macroautophagy. International journal of cell biology, 2012, p.736905.
Lashuel, H.A. & Lansbury, P.T., 2006. Are amyloid diseases caused by protein aggregates that mimic bacterial pore-forming toxins? Quarterly reviews of biophysics, 39(2), pp.167–201.
Lee, J.-Y. et al., 2010. HDAC6 controls autophagosome maturation essential for ubiquitin-selective quality-control autophagy. The EMBO journal, 29(5), pp.969–80.
Leigh, P.N., 2007. Chapter 13 Amyotrophic lateral sclerosis. Handbook of clinical neurology, 82, pp.249–78.
Lelouard, H. et al., 2002. Transient aggregation of ubiquitinated proteins during dendritic cell maturation. Nature, 417(6885), pp.177–82.
Leveugle, B. et al., 1998. Heparin oligosaccharides that pass the blood-brain barrier inhibit beta-amyloid precursor protein secretion and heparin binding to beta-amyloid peptide. Journal of neurochemistry, 70(2), pp.736–44.
Li, W., Li, J. & Bao, J., 2012. Microautophagy: lesser-known self-eating. Cellular and molecular life sciences : CMLS, 69(7), pp.1125–36.
Li, Y. et al., 2010. A Drosophila model for TDP-43 proteinopathy. Proceedings of the National Academy of Sciences of the United States of America, 107(7), pp.3169–74.
132
Li, Liang; Zhang, Xiaojie; Le, W., 2008. Altered macroautophagy in the spinal cord of SOD1 mutant mice. Autophagy, 4(3), pp.290–3.
Liang, C. et al., 2008. Beclin1-binding UVRAG targets the class C Vps complex to coordinate autophagosome maturation and endocytic trafficking. Nature cell biology, 10(7), pp.776–87.
Limpert, A.S., Mattmann, M.E. & Cosford, N.D.P., 2013. Recent progress in the discovery of small molecules for the treatment of amyotrophic lateral sclerosis (ALS). Beilstein journal of organic chemistry, 9, pp.717–32.
Logroscino, G. et al., 2010. Incidence of amyotrophic lateral sclerosis in Europe. Journal of neurology, neurosurgery, and psychiatry, 81(4), pp.385–90.
Long, J. et al., 2008. Ubiquitin recognition by the ubiquitin-associated domain of p62 involves a novel conformational switch. The Journal of biological chemistry, 283(9), pp.5427–40.
Lu, Y., Ferris, J. & Gao, F.-B., 2009. Frontotemporal dementia and amyotrophic lateral sclerosis-associated disease protein TDP-43 promotes dendritic branching. Molecular brain, 2, p.30.
Ma, Q. et al., 2007. Heparin oligosaccharides as potential therapeutic agents in senile dementia. Current pharmaceutical design, 13(15), pp.1607–16.
Ma, Q. et al., 2002. The blood-brain barrier accessibility of a heparin-derived oligosaccharides C3. Thrombosis research, 105(5), pp.447–53.
Mackenzie, I.R.A., 2007. The neuropathology of FTD associated With ALS. Alzheimer disease and associated disorders, 21(4), pp.S44–9.
Maday, S., Wallace, K.E. & Holzbaur, E.L.F., 2012. Autophagosomes initiate distally and mature during transport toward the cell soma in primary neurons. The Journal of cell biology, 196(4), pp.407–17.
Martinez-Vicente, M. et al., 2008. Dopamine-modified alpha-synuclein blocks chaperone-mediated autophagy. The Journal of clinical investigation, 118(2), pp.777–88.
McCord, J.M. & Fridovich, I., 1969. Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). The Journal of biological chemistry, 244(22), pp.6049–55.
McDonnell, M.E. et al., 2012. Riluzole prodrugs for melanoma and ALS: design, synthesis, and in vitro metabolic profiling. Bioorganic & medicinal chemistry, 20(18), pp.5642–8.
McEwan, D.G. & Dikic, I., 2011. The Three Musketeers of Autophagy: phosphorylation, ubiquitylation and acetylation. Trends in cell biology, 21(4), pp.195–201.
133
Menvielle, J.P. et al., 2013. Dual role of dextran sulfate 5000 Da as anti-apoptotic and pro-autophagy agent. Molecular biotechnology, 54(2), pp.711–20.
Merlini, G. et al., 2001. Protein aggregation. Clinical chemistry and laboratory medicine : CCLM / FESCC, 39(11), pp.1065–75.
Mijaljica, D., Prescott, M. & Devenish, R.J., 2011. Microautophagy in mammalian cells: revisiting a 40-year-old conundrum. Autophagy, 7(7), pp.673–82.
Miller, R.G. et al., 2007. Riluzole for amyotrophic lateral sclerosis (ALS)/motor neuron disease (MND). Cochrane database of systematic reviews (Online), (1), p.CD001447.
Miquel, E. et al., 2012. Modulation of astrocytic mitochondrial function by dichloroacetate improves survival and motor performance in inherited amyotrophic lateral sclerosis. S. T. Ferreira, ed. PloS one, 7(4), p.e34776.
Mitsumoto, H., 1997. Can we treat amyotrophic lateral sclerosis? Rinshō shinkeigaku = Clinical neurology, 37(12), p.1150.
Mitsumoto, H., 1997. Diagnosis and progression of ALS. Neurology, 48(Issue 4, Supplement 4), p.2S–8S.
Mizushima, N. et al., 1998. A protein conjugation system essential for autophagy. Nature, 395(6700), pp.395–8.
Mizushima, N. et al., 2008. Autophagy fights disease through cellular self-digestion. Nature, 451(7182), pp.1069–75.
Mizushima, N., 2004. Methods for monitoring autophagy. The international journal of biochemistry & cell biology, 36(12), pp.2491–502.
Mizushima, N., 2005. The pleiotropic role of autophagy: from protein metabolism to bactericide. Cell death and differentiation, 12 Suppl 2, pp.1535–1541.
Montie, H.L. et al., 2009. Cytoplasmic retention of polyglutamine-expanded androgen receptor ameliorates disease via autophagy in a mouse model of spinal and bulbar muscular atrophy. Human molecular genetics, 18(11), pp.1937–50.
Myeku, N. & Figueiredo-Pereira, M.E., 2011. Dynamics of the degradation of ubiquitinated proteins by proteasomes and autophagy: association with sequestosome 1/p62. The Journal of biological chemistry, 286(25), pp.22426–40.
Nakai, A. et al., 2007. The role of autophagy in cardiomyocytes in the basal state and in response to hemodynamic stress. Nature medicine, 13(5), pp.619–24.
Nandi, D. et al., 2006. The ubiquitin-proteasome system. Journal of biosciences, 31(1), pp.137–55.
134
Nedelsky, N.B., Todd, P.K. & Taylor, J.P., 2008. Autophagy and the ubiquitin-proteasome system: collaborators in neuroprotection. Biochimica et biophysica acta, 1782(12), pp.691–9.
Neumann, M. et al., 2009. Phosphorylation of S409/410 of TDP-43 is a consistent feature in all sporadic and familial forms of TDP-43 proteinopathies. Acta neuropathologica, 117(2), pp.137–49.
Neumann, M. et al., 2006. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science (New York, N.Y.), 314(5796), pp.130–3.
Nezis, I.P. et al., 2008. Ref(2)P, the Drosophila melanogaster homologue of mammalian p62, is required for the formation of protein aggregates in adult brain. The Journal of cell biology, 180(6), pp.1065–71.
Nixon, R.A., 2006. Autophagy in neurodegenerative disease: friend, foe or turncoat? Trends in neurosciences, 29(9), pp.528–35.
Nixon, R.A. et al., 2005. Extensive involvement of autophagy in Alzheimer disease: an immuno-electron microscopy study. Journal of neuropathology and experimental neurology, 64(2), pp.113–22.
Nonaka, T. et al., 2009. Truncation and pathogenic mutations facilitate the formation of intracellular aggregates of TDP-43. Human molecular genetics, 18(18), pp.3353–64.
Oeda, T. et al., 2001. Oxidative stress causes abnormal accumulation of familial amyotrophic lateral sclerosis-related mutant SOD1 in transgenic Caenorhabditis elegans. Human molecular genetics, 10(19), pp.2013–23.
Ogata, M. et al., 2006. Autophagy is activated for cell survival after endoplasmic reticulum stress. Molecular and cellular biology, 26(24), pp.9220–31.
Okamoto, K. et al., 1991. Reexamination of granulovacuolar degeneration. Acta Neuropathologica, 82(5), pp.340–345.
Olzmann, J.A. et al., 2007. Parkin-mediated K63-linked polyubiquitination targets misfolded DJ-1 to aggresomes via binding to HDAC6. The Journal of cell biology, 178(6), pp.1025–38.
Otomo, A., Pan, L. & Hadano, S., 2012. Dysregulation of the autophagy-endolysosomal system in amyotrophic lateral sclerosis and related motor neuron diseases. Neurology research international, 2012, p.498428.
Ou, S.H. et al., 1995. Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immunodeficiency virus type 1 TAR DNA sequence motifs. Journal of virology, 69(6), pp.3584–96.
135
Øverbye, A., Brinchmann, M.F. & Seglen, P.O., 2007. Proteomic Analysis of Membrane-Associated Proteins from Rat Liver Autophagosomes. Autophagy, 3(4), pp.300–322.
Pan, T. et al., 2008. Neuroprotection of rapamycin in lactacystin-induced neurodegeneration via autophagy enhancement. Neurobiology of disease, 32(1), pp.16–25.
Pandey, U.B. et al., 2007. HDAC6 rescues neurodegeneration and provides an essential link between autophagy and the UPS. Nature, 447(7146), pp.859–63.
Pankiv, S. et al., 2007. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. The Journal of biological chemistry, 282(33), pp.24131–45.
Pasquali, L. et al., 2009. Autophagy, lithium, and amyotrophic lateral sclerosis. Muscle & nerve, 40(2), pp.173–94.
Pérez, M. et al., 1998. Sulphated glycosaminoglycans prevent the neurotoxicity of a human prion protein fragment. The Biochemical journal, 335 ( Pt 2, pp.369–74.
Pesiridis, G.S., Lee, V.M.-Y. & Trojanowski, J.Q., 2009. Mutations in TDP-43 link glycine-rich domain functions to amyotrophic lateral sclerosis. Human molecular genetics, 18(R2), pp.R156–62.
Peters, J.-M., 1994. Proteasomes: protein degradation machines of the cell. Trends in Biochemical Sciences, 19(9), pp.377–382.
Phillips, J.P., 1989. Null Mutation of Copper/Zinc Superoxide Dismutase in Drosophila Confers Hypersensitivity to Paraquat and Reduced Longevity. Proceedings of the National Academy of Sciences, 86(8), pp.2761–2765.
Pickford, F. et al., 2008. The autophagy-related protein beclin 1 shows reduced expression in early Alzheimer disease and regulates amyloid beta accumulation in mice. The Journal of clinical investigation, 118(6), pp.2190–9.
Pietrocola, F. et al., 2012. Pro-autophagic polyphenols reduce the acetylation of cytoplasmic proteins. Cell cycle (Georgetown, Tex.), 11(20), pp.3851–60.
Polymenidou, M. et al., 2011. Long pre-mRNA depletion and RNA missplicing contribute to neuronal vulnerability from loss of TDP-43. Nature neuroscience, 14(4), pp.459–68.
Punnonen, E.L. & Reunanen, H., 1990. Effects of vinblastine, leucine, and histidine, and 3-methyladenine on autophagy in Ehrlich ascites cells. Experimental and molecular pathology, 52(1), pp.87–97.
Qin, Z.-H. et al., 2003. Autophagy regulates the processing of amino terminal huntingtin fragments. Human molecular genetics, 12(24), pp.3231–44.
136
Ravikumar, B., 2002. Aggregate-prone proteins with polyglutamine and polyalanine expansions are degraded by autophagy. Human Molecular Genetics, 11(9), pp.1107–1117.
Ravikumar, B. et al., 2005. Dynein mutations impair autophagic clearance of aggregate-prone proteins. Nature genetics, 37(7), pp.771–6.
Ravikumar, B. et al., 2004. Inhibition of mTOR induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease. Nature genetics, 36(6), pp.585–95.
Ritson, G.P. et al., 2010. TDP-43 mediates degeneration in a novel Drosophila model of disease caused by mutations in VCP/p97. The Journal of neuroscience : the official journal of the Society for Neuroscience, 30(22), pp.7729–39.
Rodriguez-Gonzalez, A. et al., 2008. Role of the aggresome pathway in cancer: targeting histone deacetylase 6-dependent protein degradation. Cancer research, 68(8), pp.2557–60.
Rohn, T.T., 2008. Caspase-cleaved TAR DNA-binding protein-43 is a major pathological finding in Alzheimer’s disease. Brain research, 1228, pp.189–98.
Rohn, T.T. & Kokoulina, P., 2009. Caspase-cleaved TAR DNA-binding protein-43 in Pick’s disease. International journal of physiology, pathophysiology and pharmacology, 1(1), pp.25–32.
Rosen, D.R. et al., 1993. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature, 362(6415), pp.59–62.
Rothstein, J.D., Martin, L.J. & Kuncl, R.W., 1992. Decreased glutamate transport by the brain and spinal cord in amyotrophic lateral sclerosis. The New England journal of medicine, 326(22), pp.1464–8.
Rowland, L.P., 1998. Diagnosis of amyotrophic lateral sclerosis. Journal of the neurological sciences, 160 Suppl , pp.S6–24.
Rowland, L.P., 2001. How amyotrophic lateral sclerosis got its name: the clinical-pathologic genius of Jean-Martin Charcot. Archives of neurology, 58(3), pp.512–5.
Rubin, D.M. & Finley, D., 1995. Proteolysis: The proteasome: a protein-degrading organelle? Current Biology, 5(8), pp.854–858.
Rubinsztein, D.C., 2006. The roles of intracellular protein-degradation pathways in neurodegeneration. Nature, 443(7113), pp.780–6.
Rutherford, N.J. et al., 2008. Novel mutations in TARDBP (TDP-43) in patients with familial amyotrophic lateral sclerosis. G. A. Cox, ed. PLoS genetics, 4(9), p.e1000193.
137
Ryu, H. et al., 2005. Sodium phenylbutyrate prolongs survival and regulates expression of anti-apoptotic genes in transgenic amyotrophic lateral sclerosis mice. Journal of neurochemistry, 93(5), pp.1087–98.
Sakai, Y. et al., 1998. Peroxisome degradation by microautophagy in Pichia pastoris: identification of specific steps and morphological intermediates. The Journal of cell biology, 141(3), pp.625–36.
Sarkar, S. et al., 2005. Lithium induces autophagy by inhibiting inositol monophosphatase. The Journal of cell biology, 170(7), pp.1101–11.
Sarkar, S. et al., 2007. Small molecules enhance autophagy and reduce toxicity in Huntington’s disease models. Nature chemical biology, 3(6), pp.331–8.
Sasaki, S., 2011. Autophagy in spinal cord motor neurons in sporadic amyotrophic lateral sclerosis. Journal of neuropathology and experimental neurology, 70(5), pp.349–59.
Saudou, F. et al., 1998. Huntingtin Acts in the Nucleus to Induce Apoptosis but Death Does Not Correlate with the Formation of Intranuclear Inclusions. Cell, 95(1), pp.55–66.
Schmid, B. et al., 2013. Loss of ALS-associated TDP-43 in zebrafish causes muscle degeneration, vascular dysfunction, and reduced motor neuron axon outgrowth. Proceedings of the National Academy of Sciences of the United States of America, 110(13), pp.4986–91.
Scotter, E.L. et al., 2014. Differential roles of the ubiquitin proteasome system (UPS) and autophagy in the clearance of soluble and aggregated TDP-43 species. Journal of cell science, p.jcs.140087–.
Seibenhener, M.L. et al., 2004. Sequestosome 1/p62 is a polyubiquitin chain binding protein involved in ubiquitin proteasome degradation. Molecular and cellular biology, 24(18), pp.8055–68.
Sephton, C.F. et al., 2010. TDP-43 is a developmentally regulated protein essential for early embryonic development. The Journal of biological chemistry, 285(9), pp.6826–34.
Shaw, C.E., Al-Chalabi, A. & Leigh, N., 2001. Progress in the pathogenesis of amyotrophic lateral sclerosis. Current Neurology and Neuroscience Reports, 1(1), pp.69–76.
Shaw, P.J., 2005. Molecular and cellular pathways of neurodegeneration in motor neurone disease. Journal of neurology, neurosurgery, and psychiatry, 76(8), pp.1046–57.
Shiina, Y. et al., 2010. TDP-43 dimerizes in human cells in culture. Cellular and molecular neurobiology, 30(4), pp.641–52.
138
Simonsen, A. et al., 2008. Promoting basal levels of autophagy in the nervous system enhances longevity and oxidant resistance in adult Drosophila. Autophagy, 4(2), pp.176–84.
Simonsen, A. & Tooze, S.A., 2009. Coordination of membrane events during autophagy by multiple class III PI3-kinase complexes. The Journal of cell biology, 186(6), pp.773–82.
Smith, R.E. & Farquhar, M.G., 1966. Lysosome function in the regulation of the secretory process in cells of the anterior pituitary gland. The Journal of cel l biology, 31(2), pp.319–47.
La Spada, A.R. et al., 1991. Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature, 352(6330), pp.77–9.
Spilman, P. et al., 2010. Inhibition of mTOR by rapamycin abolishes cognitive deficits and reduces amyloid-beta levels in a mouse model of Alzheimer’s disease. P. F. Ferrari, ed. PloS one, 5(4), p.e9979.
Staats, K.A. et al., 2013. Rapamycin increases survival in ALS mice lacking mature lymphocytes. Molecular neurodegeneration, 8(1), p.31.
Stefanis, L. et al., 2001. Expression of A53T mutant but not wild-type alpha-synuclein in PC12 cells induces alterations of the ubiquitin-dependent degradation system, loss of dopamine release, and autophagic cell death. The Journal of neuroscience : the official journal of the Society for Neuroscience, 21(24), pp.9549–60.
Stein, M.-P. et al., 2005. Interaction and functional analyses of human VPS34/p150 phosphatidylinositol 3-kinase complex with Rab7. Methods in enzymology, 403, pp.628–49.
Strong, M.J. et al., 2007. TDP43 is a human low molecular weight neurofilament (hNFL) mRNA-binding protein. Molecular and cellular neurosciences, 35(2), pp.320–7.
Stutzmann, J.-M. et al., 2002. Neuroprotective profile of enoxaparin, a low molecular weight heparin, in in vivo models of cerebral ischemia or traumatic brain injury in rats: a review. CNS drug reviews, 8(1), pp.1–30.
Szeto, J. et al., 2006. ALIS are stress-induced protein storage compartments for substrates of the proteasome and autophagy. Autophagy, 2(3), pp.189–99.
Takagi, T. et al., 2005. Dextran sulfate suppresses cell adhesion and cell cycle progression of melanoma cells. Anticancer research, 25(2A), pp.895–902.
Tan, J.M.M. et al., 2008. Lysine 63-linked ubiquitination promotes the formation and autophagic clearance of protein inclusions associated with neurodegenerative diseases. Human molecular genetics, 17(3), pp.431–9.
139
Tanaka, M. et al., 2004. Aggresomes formed by alpha-synuclein and synphilin-1 are cytoprotective. The Journal of biological chemistry, 279(6), pp.4625–31.
Tanji, K. et al., 2012. p62/sequestosome 1 binds to TDP-43 in brains with frontotemporal lobar degeneration with TDP-43 inclusions. Journal of neuroscience research, 90(10), pp.2034–42.
Tdp-, P. et al., 2011. Regulation of autophagy by neuropathological protein TDP-43. The Journal of biological chemistry, 286(52), pp.44441–8.
Thumm, M. et al., 1994. Isolation of autophagocytosis mutants of Saccharomyces cerevisiae. F EBS letters, 349(2), pp.275–80.
Tooze, J. et al., 1990. In exocrine pancreas, the basolateral endocytic pathway converges with the autophagic pathway immediately after the early endosome. The Journal of cell biology, 111(2), pp.329–45.
Tsubamoto, Y. et al., 1994. Dextran sulfate, a competitive inhibitor for scavenger receptor, prevents the progression of atherosclerosis in Watanabe heritable hyperlipidemic rabbits. Atherosclerosis, 106(1), pp.43–50.
Tsukada, M. & Ohsumi, Y., 1993. Isolation and characterization of autophagy-defective mutants of Saccharomyces cerevisiae. F EBS Letters, 333(1-2), pp.169–174.
Udan, M. & Baloh, R.H., 2011. Implications of the prion-related Q/N domains in TDP-43 and FUS. Prion, 5(1), pp.1–5.
Urushitani, M. et al., 2010. Synergistic effect between proteasome and autophagosome in the clearance of polyubiquitinated TDP-43. Journal of neuroscience research, 88(4), pp.784–97.
Vabulas, R.M. & Hartl, F.U., 2005. Protein synthesis upon acute nutrient restriction relies on proteasome function. Science (New York, N.Y.), 310(5756), pp.1960–3.
Valdmanis, P.N. & Rouleau, G.A., 2008. Genetics of familial amyotrophic lateral sclerosis. Neurology, 70(2), pp.144–52.
Vance, C. et al., 2009. Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. Science (New York, N.Y.), 323(5918), pp.1208–11.
Verdel, A. & Khochbin, S., 1999. Identification of a new family of higher eukaryotic histone deacetylases. Coordinate expression of differentiation-dependent chromatin modifiers. The Journal of biological chemistry, 274(4), pp.2440–5.
Verhoef, L.G.G.C. et al., 2002. Aggregate formation inhibits proteasomal degradation of polyglutamine proteins. Human molecular genetics, 11(22), pp.2689–700.
140
Voigt, A. et al., 2010. TDP-43-mediated neuron loss in vivo requires RNA-binding activity. M. B. Feany, ed. PloS one, 5(8), p.e12247.
Wang, H.-Y. et al., 2004. Structural diversity and functional implications of the eukaryotic TDP gene family. Genomics, 83(1), pp.130–9.
Wang, I.-F. et al., 2012. Autophagy activators rescue and alleviate pathogenesis of a mouse model with proteinopathies of the TAR DNA-binding protein 43. Proceedings of the National Academy of Sciences of the United States of America, 109(37), pp.15024–9.
Wang, I.-F., Wu, L.-S. & Shen, C.-K.J., 2008. TDP-43: an emerging new player in neurodegenerative diseases. Trends in molecular medicine, 14(11), pp.479–85.
Wang, X. et al., 2010. Degradation of TDP-43 and its pathogenic form by autophagy and the ubiquitin-proteasome system. Neuroscience letters, 469(1), pp.112–6.
Ward, W.F., 2002. Protein degradation in the aging organism. Progress in molecular and subcellular biology, 29, pp.35–42.
Warraich, S.T. et al., 2010. TDP-43: a DNA and RNA binding protein with roles in neurodegenerative diseases. The international journal of biochemistry & cel l biology, 42(10), pp.1606–9.
Watanabe, M. et al., 2001. Histological evidence of protein aggregation in mutant SOD1 transgenic mice and in amyotrophic lateral sclerosis neural tissues. Neurobiology of disease, 8(6), pp.933–41.
Watson, M.R. et al., 2008. A Drosophila Model for Amyotrophic Lateral Sclerosis Reveals Motor Neuron Damage by Human SOD1. Journal of Biological Chemistry, 283(36), pp.24972–24981.
Webb, J.L. et al., 2003. Alpha-Synuclein is degraded by both autophagy and the proteasome. The Journal of biological chemistry, 278(27), pp.25009–13.
Webb, J.L., Ravikumar, B. & Rubinsztein, D.C., 2004. Microtubule disruption inhibits autophagosome-lysosome fusion: implications for studying the roles of aggresomes in polyglutamine diseases. The international journal of biochemistry & cell biology, 36(12), pp.2541–50.
Welchman, R.L., Gordon, C. & Mayer, R.J., 2005. Ubiquitin and ubiquitin-like proteins as multifunctional signals. Nature reviews. Molecular cell biology, 6(8), pp.599–609.
Winton, M.J. et al., 2008. Disturbance of nuclear and cytoplasmic TAR DNA-binding protein (TDP-43) induces disease-like redistribution, sequestration, and aggregate formation. The Journal of biological chemistry, 283(19), pp.13302–9.
Wong, E. & Cuervo, A.M., 2010. Autophagy gone awry in neurodegenerative diseases. Nature neuroscience, 13(7), pp.805–11.
141
Wooten, M.W. et al., 2008. Essential Role of Sequestosome 1/p62 in Regulating Accumulation of Lys63-ubiquitinated Proteins. Journal of Biological Chemistry, 283(11), pp.6783–6789.
Worms, P.M., 2001. The epidemiology of motor neuron diseases: a review of recent studies. Journal of the neurological sciences, 191(1-2), pp.3–9.
Xilouri, M. & Stefanis, L., 2011. Autophagic pathways in Parkinson disease and related disorders. Expert reviews in molecular medicine, 13, p.e8.
Yim, M.B. et al., 1996. A gain-of-function of an amyotrophic lateral sclerosis-associated Cu,Zn-superoxide dismutase mutant: An enhancement of free radical formation due to a decrease in Km for hydrogen peroxide. Proceedings of the National Academy of Sciences of the United States of America, 93(12), pp.5709–14.
Yoo, Y.-E. & Ko, C.-P., 2012. Dihydrotestosterone ameliorates degeneration in muscle, axons and motoneurons and improves motor function in amyotrophic lateral sclerosis model mice. L. Mei, ed. PloS one, 7(5), p.e37258.
Yoo, Y.-E. & Ko, C.-P., 2011. Treatment with trichostatin A initiated after disease onset delays disease progression and increases survival in a mouse model of amyotrophic lateral sclerosis. Experimental neurology, 231(1), pp.147–59.
Yorimitsu, T. & Klionsky, D.J., 2005. Autophagy: molecular machinery for self-eating. Cell death and differentiation, 12 Suppl 2(S2), pp.1542–52.
Yu, W.H. et al., 2005. Macroautophagy--a novel Beta-amyloid peptide-generating pathway activated in Alzheimer’s disease. The Journal of cell biology, 171(1), pp.87–98.
Zhang, T. et al., 2012. Caenorhabditis elegans RNA-processing protein TDP-1 regulates protein homeostasis and life span. The Journal of biological chemistry, 287(11), pp.8371–82.
Zhang, X. et al., 2011. Rapamycin treatment augments motor neuron degeneration in SOD1 G93A mouse model of amyotrophic lateral sclerosis. Autophagy, 7(4), pp.412–425.
Zhang, Y. et al., 2003. HDAC-6 interacts with and deacetylates tubulin and microtubules in vivo. The EMBO journal, 22(5), pp.1168–79.
Zhang, Y. et al., 2007. Progranulin mediates caspase-dependent cleavage of TAR DNA binding protein-43. The Journal of neuroscience : the official journal of the Society for Neuroscience, 27(39), pp.10530–4.
Zhang, Y.-J. et al., 2009. Aberrant cleavage of TDP-43 enhances aggregation and cellular toxicity. Proceedings of the National Academy of Sciences of the United States of America, 106(18), pp.7607–12.