BioMed CentralVirology Journal

ss

Open AcceMethodologyUniversal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primersQingrun Zhang†1, Guanghua Wu†1, Elliott Richards2, Shan'gang Jia1 and Changqing Zeng*1

Address: 1Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 101300, China and 2Department of Biology, College of Biology and Agriculture, Brigham Young University, Provo UT 84602, USA

Email: Qingrun Zhang - zhangqr@big.ac.cn; Guanghua Wu - wugh@genomics.org.cn; Elliott Richards - elliott.richards@gmail.com; Shan'gang Jia - jsg200830@163.com; Changqing Zeng* - czeng@genomics.org.cn

* Corresponding author †Equal contributors

AbstractBackground: The highly heterogenic characteristic of viruses is the major obstacle to efficientDNA amplification. Taking advantage of the large number of virus DNA sequences in publicdatabases to select conserved sites for primer design is an optimal way to tackle the difficulties invirus genome amplification.

Results: Here we use hepatitis B virus as an example to introduce a simple and efficient way forvirus primer design. Based on the alignment of HBV sequences in public databases and a programBxB in Perl script, our method selected several optimal sites for HBV primer design. Polymerasechain reaction showed that compared with the success rate of the most popular primers for wholegenome amplification of HBV, one set of primers for full length genome amplification and four setsof walking primers showed significant improvement. These newly designed primers are suitable formost subtypes of HBV.

Conclusion: Researchers can extend the method described here to design universal or subtypespecific primers for various types of viruses. The BxB program based on multiple sequencealignment not only can be used as a separate tool but also can be integrated in any open sourceprimer design software to select conserved regions for primer design.

BackgroundChronic hepatitis B virus (HBV) infection is a majorhealth problem worldwide, affecting approximately 350million people, and 500,000 to 1.2 million deaths world-wide per year are attributed to HBV infection. Currentlythere are eight accepted genotypes (A to H) for HBV, basedon one of the following criteria: an inter-group divergenceof 8% or greater in the complete genome nucleotidesequence or a 4 ± 1% divergence of the surface antigen

gene [1,2]. It has been widely reported that it is possibleto have two HBV genotypes or recombinant types in oneinfected individual [3-5].

The HBV reverse transcriptase (RT) is an error-proneenzyme as a result of lacking 3'-5'-exonuclease proofread-ing capacity. HBV, like other viruses such as HIV, HCV andpoliovirus, has a high mutation rate of 2 × 10-5/site/year[6,7]and quasispecies distribution in infected individuals

Published: 24 September 2007

Virology Journal 2007, 4:92 doi:10.1186/1743-422X-4-92

Received: 28 June 2007Accepted: 24 September 2007

This article is available from: http://www.virologyj.com/content/4/1/92

© 2007 Zhang et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Page 1 of 7(page number not for citation purposes)

Virology Journal 2007, 4:92 http://www.virologyj.com/content/4/1/92

[8]. This means that HBV circulates as a complex mixtureof genetically distinct but closely related variants that arein equilibrium at a certain time point of infection in agiven circumstance. A mixture of HBV quasispecies is infact a mixture of HBV haplotypes, which is a more impor-tant concept to researchers, such as in drug resistantmutant studies-different haplotypes of HBV may repre-sent different types of drug resistance [9-12].

Because of the existence of quasispecies, the only way toobtain HBV haplotype sequences is through full lengthgenome amplification and clone-sequencing instead ofassembling the PCR sequences of several amplified frag-ments of the genome. However, the partially doublestranded characteristic of HBV DNA structure causes theinstability of exposed HBV DNA and the low efficiency ofwhole genome amplification. Günther et al. developed aset of primers for full length HBV genome amplification,with a restriction enzyme site for further cloning and func-tion study [13,14]. The success rate reported in this paperis one out of eight genomes (12%) amplified with Taqpolymerase, and seven out of seventeen genomes ampli-fied with Taq-Pwo polymerases (41%). Further studiesshowed similar success rate (40%). In our laboratory, 141of 420 genomes amplified with Takara-LA polymerases(34%) using this method. Tellier et al. developed twopairs of primers for nested PCR. Those primers canamplify nearly full length of HBV (3.12 kb), yet the wholeprocess is complicated, time consuming and may intro-duce risk of cross contamination [15,16]. So it is notwidely used and no success rate has been reported.

The considerable number of HBV isolates with ratherdivergent nucleotide sequences and the partially double-stranded characteristic of HBV impose the need forextreme care in the choice of primers for both full lengthand fragment amplification.

In order to identify optimal sites for primer design, we uti-lized 1020 whole genome sequences in public databases

(NCBI, EMBL and DDBJ) and 103 sequences in our labo-ratory, and developed a program BxB to select conservedregions as candidates for primer design. We testified thoseprimer designs in silico by e-PCR and real polymerasechain reactions. One set of primers for nearly full lengthHBV genome amplification (3181 bp, 40 bp shorter thanfull length) and four sets of walking primers for fragmentamplification were finally obtained. These primersequences are within areas that are highly conservedacross all genome sequences available in public databases,therefore the use of such primers makes it unlikely thatHBV strains are missed due to sequence variations andallows further search for quasispecies as well as unknownHBV genotypes and other subtypes.

ResultsIdentification of candidate regions for primer design by BxBWe analyzed 1123 sequences, 1020 from public databases(Additional file 1) and103 sequences identified in ourlaboratory, with the BxB program. 10 regions wereselected according to BxB analysis (Table 1). Candidateregions were defined as sites within the desired locationsthat had 17+ bases from the 3' end and with a frequencyof 0.90+ in the BxB. The output of BxB analysis was desig-nated as a FASTA format, which could be illuminated insequence analysis software interface such as ClustalX soft-ware to facilitate primer selection (Figure 1).

Primer selectionOne set of full length genome primers, four sets of walk-ing primers were designed with the aid of Primer 3 (Figure2, Table 2). Degenerate sites were also considered whenthere were sites yielding low BxB frequency in selectedprimers. All these primers gave negative result when theywere tested in UCSC in silico PCR to see whether primerswould amplify human DNA.

Table 1: Candidate regions selected by BxB for primer design

Candidate Regions* Sequence ORF located in

8~26 ACCTCTGCCTAATCATCTC X/preC40~68 ACTGTTCAAGCCTCCAAGCTGTGCCTTGG preC

591~616 GCCGCGTCGCAGAAGATCTCAATCTC Terminal Protein993~1018 GGGTCACCATATTCTTGGGAACAAGA Terminal Protein1450~1469 CCTGCTGGTGGCTCCAGTTC pre-S21571~1592 TCCTAGGACCCCTGCTCGTGTT S1657~1679 ACTTCTCTCAATTTTCTAGGGGG S2131~2159 TATATGGATGATGTGGTATTGGGGGCCAA S2491~2516 TTCTCGCCAACTTACAAGGCCTTTCT RT3199~3221 CACCAGCACCATGCAACTTTTT X/preC

*Here we select "CTTTTTC" of X ORF as the start point

Page 2 of 7(page number not for citation purposes)

Virology Journal 2007, 4:92 http://www.virologyj.com/content/4/1/92

Experiment verificationAll primers, including one set of primers for full length(3181 bp) amplification and four sets of primers for frag-ment amplification, demonstrated a good efficiency inreal polymerase chain reactions (Figure 3).

DiscussionUsing an alignment of 1123 complete genomes from pub-lic databases and our laboratory, we selected primers fromseveral highly conserved regions of HBV genomes. Theseprimers are situated in the sequences encoding X, preC,

Table 2: Primers for full length genome amplification and fragment amplification

Primers Sequence Location* Length GC % Tm(°C) Amplicon Size (bp)

WA-L ACTGTTCAAGCCTCCAAGCTGTGC 40 24 54.2 60.6 3181WA-R AGCAAAAAGTTGCATGGTGCTGGT 3221 24 45.8 60.7FA1-L TTTCACCTCTGCCTAATCATCTC 4 23 43.5 52.0 1014FA1-L' TTT ACCTCTGCCTAATCATCTC 4 22 40.9 47.5FA1-R TCTTGTTCCCAAGAATATGGTG 1018 22 40.9 51.0FA2-L GCGTCGCAGAAGATCTCAAT 593 20 50.0 51.9 1074FA2-R TTGAGAGAAGTCCACCACGAG 1667 21 52.4 51.7FA3-L CTGCTGGTGGCTCCAGTT 1451 18 61.1 50.6 1059FA3-R GCCTTGTAAGTTGGCGAGAA 2510 20 50.0 52.2FA4-L GTATTGGGGGCCAAGTCTGT 2416 20 55.0 52.8 1072FA4-L' GTATTGGGGGCCAAATCTGT 2416 20 50.0 52.8FA4-R AAAAAGTTGCATGGTGCTG 3218 19 42.1 48.5

*Here we select "CTTTTTC" of X ORF as the start point. FA1-L' and FA4-L' are degenerate primers

Output of BxB illiminated in ClustalX softwareFigure 1Output of BxB illiminated in ClustalX software. When the ratio of the most frequently presented nucleotide is larger than current cutoff value, the program outputs this nucleotide, otherwise outputs a '-'. The cutoff was set to (0.05, 1), and the step length is 0.05. The frequency is listed in the left box and the nucleotides are in the right box.

Page 3 of 7(page number not for citation purposes)

Virology Journal 2007, 4:92 http://www.virologyj.com/content/4/1/92

Page 4 of 7(page number not for citation purposes)

Diagram of HBV ORFs and designed primersFigure 2Diagram of HBV ORFs and designed primers. WA-L and WA-R in blue arrows represents the primers for full length genomic DNA amplification. FA1-L/FA1-L' and FA1-R (amplicon size: 1014 bp), FA2-L and FA2-R(amplicon size: 1074 bp), FA3-L and FA3-R (amplicon size: 1059 bp), FA4-L/FA4-L' and FA4-R (amplicon size: 1072 bp) in red arrows represent the four sets of walking primers for fragment amplification. FA2-L and FA2-R Here we select "CTTTTTC" of X ORF as the start point. FA1-L' and FA4-L' are degenerate primers.

Agarose gel analysis of HBV genomes amplified by the newly designed primersFigure 3Agarose gel analysis of HBV genomes amplified by the newly designed primers. Sample 1 and sample 2 are for frag-ment amplification primers testing. 1, 2, 3, 4 in the figure represent: FA3-L and FA3-R (amplicon size: 1059 bp), FA1-L/FA1-L' and FA1-R (amplicon size: 1014 bp), FA4-L/FA4-L' and FA4-R (amplicon size: 1072 bp), FA2-L and FA2-R (amplicon size: 1074 bp) primer pairs respectively. Sample 3~7 are for full length genome amplification primers (WA-L and WA-R) testing (amplicon size: 3181 bp).

Virology Journal 2007, 4:92 http://www.virologyj.com/content/4/1/92

terminal protein, pre-S2, S and reverse transcriptaseregions. Sequences of the primers are sufficiently con-served in all HBV genotypes and are believed to be con-served in quasispecies. All these primers were shown to bevery efficient in real polymerase reaction. The advantageof such approach is that it utilized all HBV sequencesavailable and a simple Perl program to precisely selectoptimal regions in HBV genome for amplification. Suchapproach is unlikely to produce significant bias towardsany one genotype when there is no bias in the multiplesequences alignment which the approach was based on.These primer designs make it possible to efficientlyamplify quasispecies and allow further search forunknown HBV genotypes/subtypes.

We used two methods to estimate HBV genotype distribu-tion in the public databases were: counting the genotypedsequences with a simple Perl program and calculating thepercentages; or using BLAST[17] to align eight HBV geno-type reference sequences from NCBI with those from pub-lic databases to get all sequences of different HBVgenotypes and then to calculate the percentage. Bothmethods yielded similar results: Genotype C counts most(about 1/3 in the databases); Genotype B, A, D indescending order. These four genotypes represent about80~90% in the databases and the rest are E, F, G and H.Besides, there are also a few CD and GC recombinants.

The primer design described in this study is based onsequences from the public databases and our laboratorywhich are genotype B and C. Therefore, it would only givebias when the genotype distribution in the databases doesnot reflect the actual HBV genotype distribution in reality.Since this method is based on multiple sequences, it canbe much more reliable when target amplifications arewithin one genotype or within a certain group. In suchoccasions, sequences of one genotype or a given groupshould be used and analyzed with the BxB program toobtain genotype-specific or group-specific candidateregions and primer sequences. Recently, based on fulllength sequences in our laboratory most of which arefrom Beijing, we successfully selected optimal primers forHBV in Beijing regions using this approach. Furtherresearch of this approach should be done on other geno-types like A, D, E, F etc. to testify its specificity, eitherthrough sequences of one genotype or sequences of mix-tures.

The amplified full length genome with our method is3181 bp which is only 40 bp shorter than the full lengthof HBV genome. It is not applicable in functional studybut much valuable in genomic study. The set of primerswere proved to have a good PCR efficiency. The four setsof fragment primers are also based on the most conservedregions from public sequences. These primers are walking

primers covering the whole HBV genome. They should bevery useful in amplifying certain regions of the genome. Infuture research on this method, both full length amplifi-cation primers and fragment amplification ones shouldbe testified in samples with different viral titers to checkits sensitivity.

The BxB program we utilized in this study was a simplePerl script, which can be easily integrated in any primerdesign software and online tools. What BxB demands isjust a multiple sequences alignment of the targetsequences FASTA format, and outputs a description ofconserved sites for primer design in FASTA format. It notonly can be used as a separate tool but also can be inte-grated in any open source primer design software[18] toselect conserved sites based on the alignments.

The highly heterogenic characteristic of viruses is themajor obstacle to efficient DNA amplification. Takingadvantage of the large number of virus DNA sequences inpublic databases to select conserved sites for primerdesigning should be an optimal way to tackle the difficul-ties in virus genome amplification. DNA sequences inpublic databases are on the increase. Take HIV and Hepa-titis viruses for example, up to March 2007, the number offull length genome DNA sequences in public databases(Additional file 1) are ranges from about 40 to more than2000: HIV is 2005; HCV is 183; HBV is 1020; HEV is 78;HAV is 35 and HDV is 83. This amount of data makes itpossible to easily select conserved sites for primer designin different scale, genome regions, subtypes and groups.

ConclusionUtilizing the HBV sequence in public databases and ourlaboratory, and a Perl program, we selected optimalregions for primer design. Those primers designed wereverified in silico by e-PCR and polymerase chain reactions.One set of primers for full length HBV genome amplifica-tion and four sets of walking primers for fragment ampli-fication were proved to be efficient. The use of suchprimers makes it unlikely that HBV strains are missed dueto sequence variations and allows furthermore search forquiasispecies as well as genotype-unknown HBV strains.Our approach of primer design is simple, efficient and istotally applicable to other viruses, such as HIV, HCV etc.when multiple sequences alignments are available andefficient amplification in a heterogeneous mixture isneeded.

MethodsHBV sequence dataInitially in the study all complete genome sequences ofHBV available in March 2007 from GenBank, EMBL, andDDBJ were downloaded. 1020 public sequences togetherwith 103 sequences from our laboratory were aligned in

Page 5 of 7(page number not for citation purposes)

Virology Journal 2007, 4:92 http://www.virologyj.com/content/4/1/92

ClustalW. The alignment was manually corrected by shift-ing sequences in places, for some sequences possessedlarge spans of unique deletions or insertions which threwoff the alignment algorithm. Finally, as the start point ofthe sequences in databases were different, most of whichwere the EcoR I restriction enzyme cutting site, a unani-mous start point was selected and the alignment was cor-rected to begin at the same location. Here we select"CTTTTTC" of X ORF as the start point.

Selection of highly conserved genome regions for primer designThe term "conserved genome regions" used here isdefined as genome regions that have most frequently pre-sented nucleotide sequences. To identify the highly con-served regions for primer design in HBV genome, Perlscript[19] was used to write a program BxB (Base by Base)to scan through the alignment of the 1123 sequences baseby base. BxB demands a multiple sequences alignment ofthe target sequences in FASTA[20] format. It is to detectthe most frequently presented base in the same coordinatefor all sequences of the alignment. Different cutoff valueswere tested to identify a best one for the alignment scan.If the ratio of the most frequently presented nucleotide islarger than current cutoff value, the program outputs thisnucleotide, otherwise outputs a '-'. Finally, the cutoff wasset to (0.05, 1), and the step length is 0.05. The output isa FASTA file which could be easily illuminated insequence analysis software such as ClustalX[21], withwhich conserved region selection and primer design couldbe much facilitated in a user friendly interface.

Primer designWith the aid of the BxB, candidate regions were selectedfor primer design. Candidate regions were defined as siteswithin the desired locations that had 17+ bases from the3' end and with a frequency of 0.90+ in the BxB. UsingPrimer 3 [22], primers were selected within the candidateregions, taking target regions, primer length andsequence, GC content and Tm etc. into consideration.

In silico primer testingAll primers were tested in University of California SantaCruz (UCSC) in silico PCR to see whether primers wouldamplify human DNA.

Experiment verificationClinical materialSerum samples were collected from seven patients withhepatitis B surface antigen (HBsAg)-positive chronic hep-atitis (serum HBsAg positive for at least 6 months). Five ofthem were genotype C and two were genotype B. Allpatients were seronegative for hepatitis C virus. The serumsamples were stored at -20°C until analysis.

Extraction of serum HBV DNASerum viral DNA was extracted by using commerciallyavailable kits (QIAamp DNA Blood Mini Kit, QIAGEN,Inc., Valencia, CA).

Polymerase chain reactionFull length amplificationThe PCR was performed in a 96-well cycler (GeneAmpPCR System 9700; Applied Biosystems) and in a 10 μlreaction volume containing 0.5 U LA Taq (TaKaRa). Theprimers were WA-R and WA-L (Table 2). The cycling con-ditions were initial denaturation at 95°C for 2 min 30 s,followed by 35 cycles of denaturation at 94°C for 1 min,annealing at 58°C for 1 min 30 s and extension at 72°Cfor 3 min, finally extension at 72°C for 10 min. Ampli-cons (1 μl) were analyzed by electrophoresis on 1.5% aga-rose gel, stained with ethidium bromide and observedunder UV light.

Fragment amplificationFor fragment amplification, the primers were FA1-R, FA1-L/FA1-L', FA2-R, FA2-L, FA3-R, FA3-L, FA4-R, FA4-L/FA4-L' (Table 2). The cycling conditions were initial denatura-tion at 95°C for 2 min 30 s, followed by 35 cycles of dena-turation at 94°C for 1 min, annealing at 55°C for 1 minand extension at 72°C for 2 min, finally extension at72°C for 10 min. Amplicons (1 μl) were analyzed by elec-trophoresis on 1.5% agarose gel, stained with ethidiumbromide and observed under UV light.

Competing interestsThe author(s) declare that they have no competing inter-ests.

Authors' contributionsQRZ conceived of the study, designed the experiment,performed the multiple sequence alignment and selectedthe primers. GHW did the experiments and wrote themanuscript. ER corrected the multiple sequence align-ment, wrote the Perl scripts and performed in silico testingSGJ did some of the experiments. CZ supervised the wholeresearch.

Additional material

Additional file 1Sequence IDs of HBV full length genome entries in GenBank, EMBL and DDBJ (March 2007). The data provided represent all available HBV genome sequences when the study was conducted.Click here for file[http://www.biomedcentral.com/content/supplementary/1743-422X-4-92-S1.doc]

Page 6 of 7(page number not for citation purposes)

Virology Journal 2007, 4:92 http://www.virologyj.com/content/4/1/92

Publish with BioMed Central and every scientist can read your work free of charge

"BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime."

Sir Paul Nurse, Cancer Research UK

Your research papers will be:

available free of charge to the entire biomedical community

peer reviewed and published immediately upon acceptance

cited in PubMed and archived on PubMed Central

yours — you keep the copyright

Submit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.asp

BioMedcentral

AcknowledgementsThis study was supported by CAS National Knowledge Innovation Program (KIP) (KSCX2-SW-207), Beijing Municipal Education Commission Funds Program (KM20070025024) and Beijing Integrated Traditional and West-ern Medicine Key Disciplines.

References1. Norder H, Courouce AM, Magnius LO: Complete genomes, phy-

logenetic relatedness, and structural proteins of six strains ofthe hepatitis B virus, four of which represent two new geno-types. Virology 1994, 198:489-503.

2. Okamoto H, Tsuda F, Sakugawa H, Sastrosoewignjo RI, Imai M, Miya-kawa Y, Mayumi M: Typing hepatitis B virus by homology innucleotide sequence: comparison of surface antigen sub-types. J Gen Virol 1988, 69(Pt 10):2575-2583.

3. Chen BF, Kao JH, Liu CJ, Chen DS, Chen PJ: Genotypic dominanceand novel recombinations in HBV genotype B and C co-infected intravenous drug users. J Med Virol 2004, 73:13-22.

4. Chen BF, Liu CJ, Jow GM, Chen PJ, Kao JH, Chen DS: Evolution ofHepatitis B virus in an acute hepatitis B patient co-infectedwith genotypes B and C. J Gen Virol 2006, 87:39-49.

5. Wang Z, Liu Z, Zeng G, Wen S, Qi Y, Ma S, Naoumov NV, Hou J: Anew intertype recombinant between genotypes C and D ofhepatitis B virus identified in China. J Gen Virol 2005,86:985-990.

6. Okamoto H, Imai M, Kametani M, Nakamura T, Mayumi M:Genomic heterogeneity of hepatitis B virus in a 54-year-oldwoman who contracted the infection through materno-fetaltransmission. Jpn J Exp Med 1987, 57:231-236.

7. Orito E, Mizokami M, Ina Y, Moriyama EN, Kameshima N, YamamotoM, Gojobori T: Host-independent evolution and a genetic clas-sification of the hepadnavirus family based on nucleotidesequences. Proc Natl Acad Sci USA 1989, 86:7059-7062.

8. Blum HE: Hepatitis B virus: significance of naturally occurringmutants. Intervirology 1993, 35:40-50.

9. Alexopoulou A, Dourakis SP: Genetic heterogeneity of hepatitisviruses and its clinical significance. Curr Drug Targets InflammAllergy 2005, 4:47-55.

10. Ngui SL, Teo CG: Hepatitis B virus genomic heterogeneity:variation between quasispecies may confound molecular epi-demiological analyses of transmission incidents. J Viral Hepat1997, 4:309-315.

11. Ohishi W, Chayama K: Rare quasispecies in the YMDD motif ofhepatitis B virus detected by polymerase chain reaction withpeptide nucleic acid clamping. Intervirology 2003, 46:355-361.

12. Yim HJ, Hussain M, Liu Y, Wong SN, Fung SK, Lok AS: Evolution ofmulti-drug resistant hepatitis B virus during sequential ther-apy. Hepatology 2006, 44:703-712.

13. Gunther S, Li BC, Miska S, Kruger DH, Meisel H, Will H: A novelmethod for efficient amplification of whole hepatitis B virusgenomes permits rapid functional analysis and reveals dele-tion mutants in immunosuppressed patients. J Virol 1995,69:5437-5444.

14. Gunther S, Sommer G, Von Breunig F, Iwanska A, Kalinina T, SterneckM, Will H: Amplification of full-length hepatitis B virusgenomes from samples from patients with low levels ofviremia: frequency and functional consequences of PCR-introduced mutations. J Clin Microbiol 1998, 36:531-538.

15. Tellier R, Bukh J, Emerson SU, Miller RH, Purcell RH: Long PCR andits application to hepatitis viruses: amplification of hepatitisA, hepatitis B, and hepatitis C virus genomes. J Clin Microbiol1996, 34:3085-3091.

16. Tellier R, Bukh J, Emerson SU, Purcell RH: Amplification of thefull-length hepatitis A virus genome by long reverse tran-scription-PCR and transcription of infectious RNA directlyfrom the amplicon. Proc Natl Acad Sci USA 1996, 93:4370-4373.

17. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic localalignment search tool. J Mol Biol 1990, 215:403-410.

18. [http://primer3.sourceforge.net/].19. [http://www.perl.org/].20. [http://www.ncbi.nlm.nih.gov/blast/fasta.shtml].21. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The

CLUSTAL_X windows interface: flexible strategies for mul-tiple sequence alignment aided by quality analysis tools.Nucleic Acids Res 1997, 25:4876-4882.

22. Rozen S, Skaletsky H: Primer3 on the WWW for general usersand for biologist programmers. Methods Mol Biol 2000,132:365-386.

Page 7 of 7(page number not for citation purposes)