An Integrated Approach to Characterize the Structure, Dynamics and Kinetics of

Prions

Theme Area: Protein folding and misfolding: Applying tools of structural biology, biophysics, biochemistry, molecular biology and bio-computing to an understanding of the mechanisms of BSE, TSE and other diseases of protein misfolding.

Project Leader: Dr. David WishartProfessor, Depts. Biological Science & Computing ScienceUniversity of Alberta2-21 Athabasca HallUniversity of AlbertaEdmonton, AB T6G 2E8

Phone: 780-492-0383Fax: 780-492-1071Email: david.wishart@ualberta.ca

Funding Administrator : University of Alberta

1

Project SummaryThis project focuses on the specific APRI theme of protein folding and misfolding (APRI Theme 1). Specifically, we plan to employ a combination of novel experimental and computational techniques to gain a deeper understanding of the structure and dynamics of three different but biologically important forms of the prion protein: 1) native PrP c, 2) denatured, monomeric PrP* and 3) aggregated PrPsc. The “wet lab” experimental results will be used to motivate and modify “dry lab” computational experiments and vice versa. Using recombinant Syrian hamster prions as a model system (and later recombinant bovine samples) we will prepare a variety of native, chemically modified and selectively mutated prion samples (PrPc, PrP* and PrPsc). These constructs will be exposed to different physico-chemical conditions. Their structure, dynamics and kinetics will be rapidly characterized using several novel techniques in NMR, CD, TEM, MS and dynamic light scattering. In parallel, computer simulations and modeling studies will be performed, mimicking the same experimental conditions used in the wet-lab experiments. These cutting-edge modeling studies will be run on newly acquired supercomputers using many novel computational techniques. The results from both sets of studies will be used to facilitate the interpretation of each other’s data. The wet-lab team (Wishart, Forman-Kay and Li) will work closely with the dry-lab team (Wishart, Kovalenko, Lin and Lu) to coordinate the exchange and interpretation of data. The dry-lab team will also develop software that will be critical to the operation of many of the wet-lab’s experimental protocols. A central theme to this project is integration and so each team member was selected to bring some unique skills and world-class expertise that complements the skills and knowledge of other members. We believe a comprehensive, integrated and systematic study of this kind has long been needed, but never been done before. The knowledge gained from such a tightly integrated project will be used not only to improve our fundamental understanding of the etiology of BSE and TSE (APRI Theme 2), but also to help develop improved diagnostic tools and therapeutic products (APRI Theme 3).

2

Research PlanPrions (PrP) are endogenous proteins that can cause a variety of fatal neurodegenerative diseases in both animals and humans. These include scrapie in sheep, bovine spongiform encephalopathy (BSE) in cattle, chronic wasting disease (CWD) in deer and elk, as well as Kuru, Creutzfeld Jacob Disease (CJD) and Fatal Familial Insomnia (FFI) in humans [1,2]. Collectively these diseases are called Transmissable Spongiform Encephalopathies or TSE’s. TSE’s are relatively rare, species-specific disorders that, until recently, have attracted little attention or concern. However, evidence now suggests that prion diseases can jump the species barrier (i.e. CWD and variant CJD or vCJD) and that prions have the potential to become almost unstoppable and uniformly fatal infectious agents [3-6]. Public fear and government concern over BSE and its pandemic potential to transmit to humans (as vCJD) has cost livestock producers in Europe, Japan and North America >$20 billion over the past 15 years [6,7]. Prions cause disease by spontaneously converting from a soluble, helix-rich form (PrPc) to an infectious beta-rich form (PrPsc) that is both insoluble and highly pathogenic [1]. The process by which this happens is still poorly understood but several hypotheses exist (Fig. 1). The underlying assumption is that the presence of one or more PrPsc molecules leads to the directed recruitment and one-way conversion of soluble PrPc molecules into insoluble PrPsc. The conversion, propagation and self-assembly of prions is quite remarkable and has led to many fundamental questions such as: 1) What chemical or physical event triggers the initial conversion from PrPc to PrPsc? 2) How does the unusual motion and flexibility of PrPc contribute to its propensity to unfold? 3) What are the first steps in PrP c unfolding? 4) Is there a metastable, trigger-like form of PrP and what does it look like? 5) What are the “recognition” templates on PrPsc or PrP* that induce PrPc recruitment? 6) Why are TSE’s so species-specific and what are the species-specific recognition sites in PrP sc? 7) What is the molecular structure of PrPsc? 8) Where do certain small molecules bind to PrPc and PrPsc and why? The answers to these questions have a direct bearing on the understanding of TSE’s, their detection, their prevention and ultimately their treatment [8]. This proposal is aimed at answering these questions by focusing on the specific APRI theme of protein folding and misfolding (APRI Theme 1). We plan to employ a combination of novel experimental and computational techniques to gain a deeper understanding of the structure and dynamics of three different but biologically important forms of the prion protein: 1) native, monomeric PrPc, 2) denatured, monomeric PrP* and 3) aggregated PrPsc. These three states of the PrP protein represent the progression that PrP goes through in converting from a monomeric helical protein to an aggregated beta sheet (i.e. the misfolding process). We will use a combination of several newly developed techniques – invented by members of our research team -- to study these states and to seek answers to the above questions. The methods involve NMR spectroscopy, mass spectrometry (MS), electron microscopy (TEM) as well as computational and theoretical approaches. It is expected the power of these new techniques, in combination with the integrated approach to analyzing them will reveal important new insights into prion structure, dynamics and assembly kinetics. The key innovations in this project are: 1) the use of at least 5 new and potentially very powerful experimental and computational techniques that have not previously been applied to prion proteins; 2) the focus on systematically characterizing the structure and dynamics all three states involved in prion structure conversion or misfolding; and 3) the integration of multiple techniques and multiple experts in generating and analyzing prion misfolding.

3

Preparation of Prion ConstructsKey to the success of the “wet-bench” portion of this project will be the availability of prion proteins in a variety of states (PrPc, PrP*, PrPsc) and conditions. For the first 2 years of this core project we will be working with Syrian hamster prions. As our staff gains experience and our labs acquire appropriate biohazard certification we intend to begin working with bovine prions in year 3. As seen in Fig. 2, hamster prion sequence (esp. 90-231) is >85% identical to bovine and human forms and so many key insights learned with the hamster model will be applicable to both bovine and human systems [9,10]. We have already designed and prepared a synthetic gene to express the full length hamster prion sequence (29-231) and have placed the construct into a pBAD/HisA vector construct for expression in E. coli (Fig. 3). The synthetic gene was designed using codon biases found in highly expressed E. coli genes. We have also arranged for Dr. Avi Chakrabartty (U of T) to provide us with his expertise and his latest hamster prion construct, which should arrive in early December. Additionally we have agreed to work with Dr. Mike Belosevic (APRI - Prion Inactivation and Environment) to share our constructs (hamster, bovine), protein expression and protein conversion (PrPc to PrPsc) expertise with each other. The site-directed mutagenesis, expression, labeling and subsequent distribution of all prion constructs will be done in Dr. Wishart’s lab, with assistance and frequent interaction with the above-mentioned collaborators using the requested travel and training funds. Prions will be prepared and refolded from inclusion bodies using previously established protocols [10-12].

Systematic Characterization of the Dynamics and Early Unfolding Events of PrP c Variants For this component of the project we intend to use both NMR spectroscopy (wet-bench work) and computational simulations (dry-bench work) to systematically characterize the motions and structural changes of native or near-native PrPc in different conditions using different PrPc mutants. This will be the first time such a comprehensive and systematic study has been done and it is expected to yield some important insights into the early unfolding events (and structural changes) that trigger PrPsc polymerization. The wet-bench (NMR) work will be undertaken by Wishart, Forman-Kay, Lin and our collaborator, Lewis Kay (U of T). NMR spectroscopy has already proven to be the most effective tool for characterizing the atomic structure of native PrP [12-14]. To date, the wild-type PrP structures of more than 12 highly divergent species have been solved by NMR [12-15], each showing a remarkably similar helical fold. While these structural studies have given us some important insights into the mechanisms underlying native PrPc stability, they do not provide the necessary “dynamic” picture of how prions bend and flex or what happens in the early stages of prion folding/misfolding. In fact, only 3 NMR studies on the dynamics of prions have been performed [10,16,17], all on the same protein (WT hamster) at the same temperature and pH. Likewise only a few NMR structural studies (and no detailed dynamic studies) have been done on disease-causing mutants [13,18,19]. Only one NMR study has been reported looking at the pH induced changes in prion structure ([20] Fig. 4). While many interesting, lower-resolution CD and FTIR studies have been done on prions in different salt, temperature and solvent conditions [21,22], we are aware of no similar NMR studies. This dearth of data clearly identifies a niche in prion biology that we must explore. Our plan, for the first 2 years of the project is to express and purify at least 10 variants of hamster PrPc (90-231) using standard cloning and site directed mutagenesis methods. These variants will include WT and mutants

4

(single and double) localized to disease associated regions of the molecule (primarily helix B and C – See Fig. 2). Unlabeled samples will be placed in a variety of different solvent conditions (pH=3,4,5,6,7,8; NaCl=0.01, 0.1, 0.5, 1M; temp=5,10,20,30,40 oC, TFE=2%, 4%, 6%; TMAO=5%, 10%, 15%) in 96 well plates and screened for stability and suitability for NMR studies using CD analyses and the “button” test [23]. We expect that more than 10,000 combinations of conditions and mutants will be screened over the course of 2 years, with about 50 of these being selected for isotopic labeling ( 13C, 15N) and further study. These biophysical perturbations are expected to lead to interesting changes to both the dynamics and structure of the native PrPc which may reveal newly stabilized structures (TFE or TMAO), early unfolding events (high temperatures), or changes in structure content and motion (low pH). The use of TMAO is particularly interesting as this endogenous metabolite has recently been shown to stabilize PrPc and prevent prion misfolding [24]. Using previously published assignments, standard NMR experiments (HNCO, HNCACB, CBCACONH, HCCH-TOCSY) as well as our own newly developed automated assignment and automated structure generation tools [25-28] we will determine the assignments (and in selected cases, the structures) of these perturbed or near-native forms. These automated methods allow assignments and structures of well-behaved proteins to be generated in a few hours after data collection. This is an important point as we wish to take advantage of our team’s unique ability to very rapidly assign and characterize proteins. We anticipate generating a set of nearly 50 different chemical shift assignments (9 days data collection + 1 day assignment x 50 = 500 days) and approximately two dozen hamster PrPc structures over the course of 3 years. A smaller set of assignments and structures will be generated for bovine prions during year 3 (in anticipation of extending this core project to Phase 2). In addition, using new NMR techniques [29,30] pioneered by our collaborator, Lewis Kay, we will also look to characterize the “excited” state structures of the disordered regions of PrPc (namely residues 90-120 and 210-231) under several different solvent/mutant-state conditions. This is inherently more difficult work and so we may only characterize these disordered regions in perhaps 2 or 3 PrPc variants over the next 3 years. Nevertheless, the wealth of chemical shift assignment data (50+ sets of assignments) will allow us to employ a new technique (the RCI method) developed in Dr. Wishart’s lab to rapidly characterize the dynamics these PrPc variants under all these conditions. The RCI method allows accurate (r=0.82) estimates of RMSD, RMSF and order parameters directly from 13C, 15N and 1H assignments [31]. This “chemical shift dynamic” data will also be used to regenerate previously determined PrPc structural ensembles using a modified version of XPLOR-NIH (being developed in collaboration with the NIH). We have already employed the RCI method to analyze the dynamics of more than a dozen different PrP species (Fig. 4) and two human PrP’s at different pH values (Fig. 5). Even with this limited set, the results are quite fascinating and a paper is now under preparation. Conventional NMR relaxation measurements (T1, T2, NOE) will be used to characterize the fast (pico to nanosecond) while relaxation exchange or CPMG methods [16,32] and hydrogen/deuterium exchange will be used to monitor intermediate (mico-millisecond) dynamics for a small set (<5) of the more interesting mutant forms. This wet-bench work will be complemented by detailed (and extended) molecular dynamic studies performed in collaboration with Drs. Kovalenko, Forman-Kay, Wishart and Lu. These simulations will be designed to mimic the experimental biophysical conditions for which NMR data was collected. While there are numerous published

5

studies of prion MD simulations, many are somewhat dated, few were run under comparable or reproducible conditions and essentially none were validated or compared to experimental data [33-35]. Our intent is to perform MD simulations in the same consistent and systematic way that we collected and analyzed our NMR data. Identical simulation software (GROMACS) will be used, the same annealing protocols will be employed and the same energy functions will be applied. A key strength for our group is the expertise we have in performing large-scale distributed processor MD simulations [36-38]. This will allow us to perform extended MD simulations and to explore the results of mutant and/or solvent perturbations in ways that have not been previously done over time frames not previously accessible. In addition, the equipment to be purchased through the FISCI CFI grant (see matching funds) as well as existing WestGrid supercomputer infrastructure will allow tremendous computational resources to be brought to the project. It is hoped that these combined computational and spectroscopic studies will facilitate interpretation of both sets of data and reveal some critical information about the inherent instabilities, the key conformational triggers and the earliest events in PrPc unfolding.

Characterization of Molten Globule or Partially Denatured PrP* VariantsThe study of molten globules or partially unfolded proteins is another technique best suited to NMR. For this aspect of the project we want to look at the intermediate stage of prion misfolding – sometimes called PrP* [39-41]. PrP* is thought to be the state that PrP exists in before it refolds to either an aggregate or native form. It may be a structural “missing link’ that could offer some key insights into how to prevent PrP sc formation. PrP* has been studied by CD and other low-resolution spectroscopic methods [21,22,41] but it has not been studied by NMR or by computational MD simulations. PrP* (or variants thereof) will be generated from WT hamster PrPc (90-231) through several established routes including solvent perturbation (pH 4.5, 3 M urea), disulfide bond reduction/alkylation of native PrPc, progressive C-terminal truncation and site-directed mutation. The latter 3 routes will allow the creation of metastable forms that are mostly unfolded in PBS buffer – which may better mimic the physiological state of PrP* [41]. All PrP* variants will be screened via CD (for rapid structure monitoring) and dynamic light scattering (to look for aggregates). If time and circumstance permits, we also hope to analyze the structural stabilization or conformational bias induced by the binding of anti-PrPsc single chain antibody (unlabeled) to at least one of the truncated forms of PrP* (labeled). It is hoped that this complex may reveal some aspects concerning the structure or nascent structure of PrPsc [42,43]. Denatured or partially unfolded proteins are difficult to study, but it is still relatively to routine to obtain their chemical shift assignments. We will first use our newly developed automated assignment methods (see above) to rapidly obtain spectral assignments for a number of these PrP* variants. Then, using several techniques developed and implemented by Dr. Forman-Kay and Dr. Lewis Kay, including ENSEMBLE and “excited-state” trapping [44,29] in combination with the novel chemical shift-based structure determination methods developed by Wishart’s and Lin’s groups [25-28], we intend to determine the low resolution structures (or structural ensembles) of these denatured proteins. If required, we may also employ paramagnetic relaxation enhancement (PRE) methods to obtain approximate distance measures [45,46]. PRE studies will require the preparation of selected Cys mutants which must be subsequently spin-labeled. Recall that denatured proteins are essentially refractory to

6

structure determination via conventional NOE measurements [47]. Therefore it is critical that we employ these novel chemical shift and PRE methods to generate approximate structures of PrP*. Given our expertise in chemical shift analysis along with the computational tools available to us, we are definitely in a unique position to be able to do this kind of structural characterization – and to do it quickly. Our goal is to have an approximate 3D structure of at least 2 hamster PrP* variants by the end of year 3 In addition to these structural studies of PrP*, we will also perform dynamic analyses of these molecules using the RCI (chemical shift) approach described earlier [31]. Again, we will exploit our advantages in being able to analyze and interpret chemical shifts in ways that no other groups can -- at a speed that no other groups can match. Figure 6 demonstrates the utility of RCI methods in identifying periodic flexibility differences in the octa-repeats of the N-terminal domains of human and ovine prions. These are not detectable via conventional relaxation measurements. The experimental results from these denatured structure studies will be integrated and complemented with distributed computing MD simulations [38, 48], generalized ensemble sampling techniques [49], constrained annealing [50] and replica exchange (or parallel tempering) methods [50,51] performed by our dry-lab team (Kovalenko, Lu, Lin, Wishart) and collaborators (Tieleman, Hirata). These methods have frequently been used in protein unfolding simulations [48-52] although only one application to prions has been published [64]. These computational efforts will be used to investigate the unfolding of PrPc and to identify any potential meta-stable intermediates that may be similar to those identified by NMR or which exhibit characteristics of PrPsc. Interestingly, some of these simulations have already begun to bear fruit (see Fig. 7). This work will be complemented by Kovalenko’s newly developed techniques that incorporate principal component analysis of MD trajectories. This permits the identification of the major trends or forces found in an MD simulation, which may then be used to conduct “steered” dynamic simulations. These atomic resolution MD methods will be complemented by coarser grain simulations to permit longer time scale events to be modeled. We will use lattice-based low resolution conformational sampling (MONSSTER – 52), multiscale sampling [50] and 3D reference interaction site models (3D-RISM) methods [53] to conduct these lower-resolution unfolding or molten globule simulations. As before, these computational studies will be used to assist in the comparison and interpretation of the experimental results. Likewise the NMR results may be used to test a variety of hypotheses using the computer simulations. Given the long time scales required for these kinds of simulations, GRID or clustered computing will be essential for these calculations. The establishment of FISCI (through our CFI application) and the existence of WestGrid will be critical to our success. It is hoped that these computational and spectroscopic studies will reveal some critical information about the structure of PrP* in the intermediate stages of folding or misfolding. This information could be of potential use in developing novel diagnostic or therapeutic agents.

Characterization of Aggregrated and Aggregating PrPsc

Perhaps the most interesting and novel aspect of the research proposed here involves the characterization of the aggregating and aggregated PrPsc (the infective form of PrP). Rather than using NMR or crystallography, our intent is to use the power of mass spectrometry (MS) to characterize prion plaques and fibrils at an atomic scale. Recently several groups have described the use of MS to determine residue-specific hydrogen

7

exchange, secondary structure, surface residue location, cysteine placement and residue-residue proximity [54-56]. In fact, Dr. Wishart’s group recently described a similar approach to determining the 3D structure of BPTI using mass spectrometry [57]. This kind of crude structural constraint data is actually ideal for many kinds of structure determination and structure prediction algorithms like Rosetta and Robetta [58]. Therefore it is possible, both in principle and practice to determine approximate 3D structures of proteins via mass spectrometry. Our plan, therefore, is to prepare hamster PrPsc samples using one of several in vitro methods [59,60]. Then, using the targeted chemical modification techniques and hydrogen exchange methods that Dr. Liang Li (and others) have developed, we will proceed to modify the PrPsc aggregates, proteolyze them, separate them (via organic solvent dissolution) and then analyze the resulting peptide fragments through tandem mass spectrometry. Some of the “mild” chemical modification methods will include nitrosylation of tyrosines (via tetranitromethane), the oxidation of methionines and tryptophans with NBS, the alkylation of cysteines and the cross-linking of lysines with various set-length bivalent suberic acid cross-linkers [55-57]. Samples will also be subject to deuteration and selective proteolysis (trypsin, proteinase K, chymotrypsin). Looking for and identifying chemically modified (or deuterated) peptide fragments will allow us to identify which inter-reside and intra-residue contacts are being made in the aggregated form of PrPsc. This work will also permit the identification of specific surface and buried residues. It is expected that some of this data may also reveal the proximity and orientation of inter and intra-protein beta strands. The MS-derived constraint data will be input into the MS23D (mass spec to 3D structure) program that Dr. Wishart’s group has developed and will then be used to generate a low resolution model of the PrPsc protomers. Given the complexity of the problem, this work will require at least a year of refinement and technique development – both in terms of MS and computational efforts. Nevertheless, we are confident that important and useful structural data will emerge and that a near-atomic resolution model of PrPsc will be available at the end of year 3. In addition to these MS studies, we will also take advantage of the state-of-the-art electron (EM) and atomic force microscopy (AFM) resources that are now being set up in the NRC’s National Institute for Nanotechnology (NINT). These facilities are almost unmatched anywhere else in the world and include a Nanoscope Multimode AFM (AFM in contactless mode and STM mode in air) with a resolution of 1 nm and a JEOL 2200FS TEM with a CR40 cryomicrosopy freezer unit with a 0.27 nm point resolution and a 0.15 nm information limit. Our intention is to exploit the structural data obtained from the MS work and to complement it with EM (electron microscopy) work to be done at NINT (by Wishart, Lin and Kovalenko). We believe that the combination of EM with MS structure data may allow an unprecedented analysis and of PrPsc structure giving a clear understanding of the species-specific contacts, the exposed epitopes, the topology of the PrPsc monomers and the relative orientation of the PrPsc monomers in prion fibrils [61] This work will also be complemented by the work of Dr. Kovalenko who will use our experimental models of PrPc, PrP* and the PrPsc monomers to model the aggregation process. Using his 3D RISM (reference interaction site model) and by solving integral equations for the three-dimensional distribution functions of the surrounding solvent, it is possible to determine the solvation structure around proteins [53] and calculate potentials of mean force mediated by the solvent [62]. This approach has recently been used in the modelling of the self-assembly of organic rosette nanotubes in solution [63] (Fig.8). This 3D RISM simulation reveals the mechanisms of nanotube self-assembly via nanotube

8

stacking which is mediated by water molecules that bridge the nanotube rings. One can expect that formation of prion oligomers and protofibrils, which have a similar symmetry as the rosette rings [64], can be handled efficiently by this new integral equation theory of solvation. We intend to use this novel integral equation theory of molecular liquids to model the solvent-mediated PrP unfolding and interaction between PrP molecules in water. These studies will help guide our MS/EM modeling exercises but will also provide a detailed picture of the mesoscale dynamics (and kinetics) of PrPsc aggregation. This kind of simulation will require considerable computational resources, but we believe such a simulation should be quite manageable through our collaborations with Dr. Paul Lu and our interactions with our potential industrial IT sponsors (IBM). We believe this work on PrPsc assembly and structure will eventually give new insights into the small molecules that may bind prions leading to inhibition or activation of prion assembly and new insights into potential epitopes for better antibody-based surveillance and detection

Summary and Deliverables:This project is targeted to produce a number of tangible deliverables which will have a significant impact in the field of prion structural biology as well a positive, practical impact on the understanding, diagnosis and treatment of prion diseases. These include:

1) World-class expertise in prion cloning, manipulation and expression2) An atomic picture of the dynamics and early unfolding events of PrPc and PrPc mutants3) Robust computational methods to rapidly assign and characterize proteins by NMR4) An atomic resolution model of PrP* (the PrP in a molten globule) and or an atomic resolution structure of one of PrP’s excited states5) A near atomic resolution model of PrPsc as found in prion fibrils with a clear understanding of the species-specific contacts, the exposed epitopes, the topology of the PrPsc monomers and the relative orientation of the PrPsc monomers in prion fibrils6) A new, potentially commercializable method to determine 3D structures via MS7) Robust computational methods designed to model protein aggregation, self-assembly and intermolecular recognition8) A clearer understanding of prion assembly kinetics9) Generally applicable spectroscopic and computational methods that can be used to do similar studies on most other amyloid-like systems 10) New insights into small molecules that may bind prions leading to inhibition or activation of prion assembly.11) New insights into potential epitopes for better antibody-based surveillance and detection

Overall, we believe this proposal, as outlined here, supports excellent research by bright, hard-working and innovative young researchers. It draws across multiple departments and institutes that are either based at or affiliated with the University of Alberta. It also brings in an outstanding researcher from the University of Toronto (Forman-Kay) who is well-known for her work on protein folding/unfolding. Additionally we have arranged collaborations with a number of other outstanding researchers across Canada and Japan (Kay, Tieleman, Chakrabartty, Belosevic, Hirata) to ensure we hit the ground running and that we will meet our milestones on time or ahead of schedule.

9

References

1) DeArmond SJ, Prusiner SB. Perspectives on prion biology, prion disease pathogenesis, and pharmacologic approaches to treatment. Clin Lab Med. 2003 Mar;23(1):1-41.

2) Weissmann C, Aguzzi A. Approaches to therapy of prion diseases. Annu Rev Med. 2005;56:321-44.

3) Ricketts MN. Public health and the BSE epidemic. Curr Top Microbiol Immunol. 2004;284:99-119.

4) Ironside JW. The spectrum of safety: variant Creutzfeldt-Jakob disease in the United Kingdom. Semin Hematol. 2003 Jul;40(3 Suppl 3):16-22.

5) Glatzel M, Ott PM, Linder T, Gebbers JO, Gmur A, Wust W, Huber G, Moch H, Podvinec M, Stamm B, Aguzzi A. Human prion diseases: epidemiology and integrated risk assessment. Lancet Neurol. 2003 Dec;2(12):757-63.

6) http://www.cnn.com/2003/US/12/25/mad.cow.ap/

7) http://organicconsumers.org/madcow.htm

8) Dobson CM. Structural biology: prying into prions Nature.2005 Jun 9;435(7043):747-9.

9) Jackson GS, Clarke AR. Mammalian prion proteins. Curr Opin Struct Biol. 2000 Feb;10(1):69-74.

10) Liu H, Farr-Jones S, Ulyanov NB, Llinas M, Marqusee S, Groth D, Cohen FE, Prusiner SB, James TL. Solution structure of Syrian hamster prion protein rPrP(90-231). Biochemistry. 1999 Apr 27;38(17):5362-77.

11) Alvarez-Martinez MT, Torrent J, Lange R, Verdier JM, Balny C, Liautard JP. Optimized overproduction, purification, characterization and high-pressure sensitivity of the prion protein in the native (PrP(C)-like) or amyloid (PrP(Sc)-like) conformation.Biochim Biophys Acta. 2003 Feb 21;1645(2):228-40.

12) James TL, Liu H, Ulyanov NB, Farr-Jones S, Zhang H, Donne DG, Kaneko K, Groth D, Mehlhorn I, Prusiner SB, Cohen FE. Solution structure of a 142-residue recombinant prion protein corresponding to the infectious fragment of the scrapie isoform. Proc Natl Acad Sci U S A. 1997 Sep 16;94(19):10086-91.

13) Zhang Y, Swietnicki W, Zagorski MG, Surewicz WK, Sonnichsen FD. Solution structure of the E200K variant of human prion protein. Implications for the mechanism of pathogenesis in familial prion diseases. J Biol Chem. 2000 Oct 27;275(43):33650-4.

10

14) Calzolai L, Lysek DA, Perez DR, Guntert P, Wuthrich K. Prion protein NMR structures of chickens, turtles, and frogs. Proc Natl Acad Sci U S A. 2005 Jan 18;102(3):651-5.

15) Lysek DA, Schorn C, Nivon LG, Esteve-Moya V, Christen B, Calzolai L, von Schroetter C, Fiorito F, Herrmann T, Guntert P, Wuthrich K. Prion protein NMR structures of cats, dogs, pigs, and sheep.Proc Natl Acad Sci U S A. 2005 Jan 18;102(3):640-5.

16) Kuwata K, Kamatari YO, Akasaka K, James TL. Slow conformational dynamics in the hamster prion protein. Biochemistry. 2004 Apr 20;43(15):4439-46.

17) Viles JH, Donne D, Kroon G, Prusiner SB, Cohen FE, Dyson HJ, Wright PE. Local structural plasticity of the prion protein. Analysis of NMR relaxation dynamics. Biochemistry. 2001 Mar 6;40(9):2743-53.

18) Zahn R, Guntert P, von Schroetter C, Wuthrich K. NMR structure of a variant human prion protein with two disulfide bridges. J Mol Biol. 2003 Feb 7;326(1):225-34.

19) Calzolai L, Lysek DA, Guntert P, von Schroetter C, Riek R, Zahn R, Wuthrich K.NMR structures of three single-residue variants of the human prion protein. Proc Natl Acad Sci U S A. 2000 Jul 18;97(15):8340-5.

20) Zahn R, Liu A, Luhrs T, Riek R, von Schroetter C, Lopez Garcia F, Billeter M, Calzolai L, Wider G, Wuthrich K. NMR solution structure of the human prion protein. Proc Natl Acad Sci U S A. 2000 Jan 4;97(1):145-50.

21) Matsunaga Y, Peretz D, Williamson A, Burton D, Mehlhorn I, Groth D, Cohen FE, Prusiner SB, Baldwin MA. Cryptic epitopes in N-terminally truncated prion protein are exposed in the full-length molecule: dependence of conformation on pH. Proteins. 2001 Aug 1;44(2):110-8.

22) Zhang H, Stockel J, Mehlhorn I, Groth D, Baldwin MA, Prusiner SB, James TL, Cohen FE. Physical studies of conformational plasticity in a recombinant prion protein. Biochemistry. 1997 Mar 25;36(12):3543-53.

23) Bagby S, Tong KI, Liu D, Alattia JR, Ikura M. The button test: a small scale method using microdialysis cells for assessing protein solubility at concentrations suitable for NMR.J Biomol NMR. 1997 Oct;10(3):279-82.

24) Bennion BJ, DeMarco ML, Daggett V. Preventing misfolding of the prion protein by trimethylamine N-oxide. Biochemistry. 2004 Oct 19;43(41):12955-63.

25) Wan, X., Xu, D., Slupsky, C.M., Lin, G. Automated Protein NMR Resonance Assignments. IEEE - Computer Society Bioinformatics Conference Proceedings 2003: 197-208.

26) Neal, S., Zhang, H., Nip, A.M. & Wishart, D.S. “Rapid and Accurate Calculation of Protein Chemical Shifts” J. Biomol. NMR. 26, 215-240 (2003).

11

27) Wishart, D.S. & Case, D.A. “Use of Chemical Shifts in Macromolecular Structure Determination” Methods Enzymol. 338, 3-34 (2001).

28) http://redpoll.pharmacy.ualberta.ca/ssass/cgi-bin/ssass.cgi

29) Korzhnev DM, Salvatella X, Vendruscolo M, Di Nardo AA, Davidson AR, Dobson CM, Kay LE. Low-populated folding intermediates of Fyn SH3 characterized by relaxation dispersion NMR. Nature. 2004 Jul 29;430(6999):586-90.

30) Mulder FA, Mittermaier A, Hon B, Dahlquist FW, Kay LE. Studying excited states of proteins by NMR spectroscopy. Nat Struct Biol. 2001 Nov;8(11):932-5.

31) Berjanskii MV, Wishart DS. A simple method to predict protein flexibility using secondary chemical shifts. J Am Chem Soc. 2005 Nov 2;127(43):14970-1.

32) Palmer AG 3rd, Kroenke CD, Loria JP. Nuclear magnetic resonance methods for quantifying microsecond-to-millisecond motions in biological macromolecules.Methods Enzymol. 2001;339:204-38

33) Gsponer J, Ferrara P, Caflisch A. Flexibility of the murine prion protein and its Asp178Asn mutant investigated by molecular dynamics simulations. J Mol Graph Model. 2001;20(2):169-82.

34) el-Bastawissy E, Knaggs MH, Gilbert IH. Molecular dynamics simulations of wild-type and point mutation human prion protein at normal and elevated temperature. J Mol Graph Model. 2001;20(2):145-54.

35) Parchment OG, Essex JW. Molecular dynamics of mouse and Syrian hamster PrP: implications for activity. Proteins. 2000 Feb 15;38(3):327-40.

36) Yunjie Xu, Aiko Huckauf, Wolfgang Jäger, Paul Lu, Jonathan Schaeffer, and Christopher Pinchak. The CISS-1 Experiment: ab initio Study of Chiral Interactions, 39th International Union of Pure and Applied Chemistry (IUPAC) Congress and 86th Conference of The Canadian Society for Chemistry, Ottawa, Ontario, Canada, August 10--15, 2003.

37) http://www.cs.ualberta.ca/~ciss/

38) http://www.cs.ualberta.ca/~paullu/Trellis/

39) Apetri AC, Surewicz WK. Kinetic intermediate in the folding of human prion protein. J Biol Chem. 2002 Nov 22;277(47):44589-92.

40) Hornemann S, Glockshuber R. A scrapie-like unfolding intermediate of the prion protein domain PrP(121-231) induced by acidic pH. Proc Natl Acad Sci U S A. 1998 May 26;95(11):6010-4.

12

41) Kuwata K, Li H, Yamada H, Legname G, Prusiner SB, Akasaka K, James TL. Locally disordered conformer of the hamster prion protein: a crucial intermediate to PrPSc? Biochemistry. 2002 Oct 15;41(41):12277-83.

42) Ascione A, Flego M, Zamboni S, De Cinti E, Dupuis ML, Cianfriglia M. Application of a synthetic phage antibody library (ETH-2) for the isolation of single chain fragment variable (scFv) human antibodies to the pathogenic isoform of the hamster prion protein (HaPrPsc). Hybridoma (Larchmt). 2005 Jun;24(3):127-32.

43) Paramithiotis E, Pinard M, Lawton T, LaBoissiere S, Leathers VL, Zou WQ, Estey LA, Lamontagne J, Lehto MT, Kondejewski LH, Francoeur GP, Papadopoulos M, Haghighat A, Spatz SJ, Head M, Will R, Ironside J, O'Rourke K, Tonelli Q, Ledebur HC, Chakrabartty A, Cashman NR. A prion protein epitope selective for the pathologically misfolded conformation. Nat Med. 2003 Jul;9(7):893-9.

44) Choy WY, Forman-Kay JD. Calculation of ensembles of structures representing the unfolded state of an SH3 domain. J Mol Biol. 2001 May 18;308(5):1011-32.

45) Kristjansdottir S, Lindorff-Larsen K, Fieber W, Dobson CM, Vendruscolo M, Poulsen FM. Formation of native and non-native interactions in ensembles of denatured ACBP molecules from paramagnetic relaxation enhancement studies.J Mol Biol. 2005 Apr 15;347(5):1053-62.

46) Teilum K, Kragelund BB, Poulsen FM. Transient structure formation in unfolded acyl-coenzyme A-binding protein observed by site-directed spin labelling. J Mol Biol. 2002 Nov 22;324(2):349-57.

47) Dyson HJ, Wright PE. Unfolded proteins and protein folding studied by NMR.Chem Rev. 2004 Aug;104(8):3607-22.

48) Pande VS, Baker I, Chapman J, Elmer SP, Khaliq S, Larson SM, Rhee YM, Shirts MR, Snow CD, Sorin EJ, Zagrovic B. Atomistic protein folding simulations on the submillisecond time scale using worldwide distributed computing. Biopolymers. 2003 Jan;68(1):91-109.

49) Day R, Daggett V. Ensemble versus single-molecule protein unfolding. Proc Natl Acad Sci U S A. 2005 Sep 20;102(38):13445-50.

50) Feig M, Karanicolas J, Brooks CL 3rd. MMTSB Tool Set: enhanced sampling and multiscale modeling methods for applications in structural biology. J Mol Graph Model. 2004 May;22(5):377-95.

51) Rhee YM, Pande VS. Multiplexed-replica exchange molecular dynamics method for protein folding simulation. Biophys J. 2003 Feb;84(2 Pt 1):775-86.

13

52) Skolnick J, Kolinski A, Ortiz AR. MONSSTER: a method for folding globular proteins with a small number of distance restraints. J Mol Biol. 1997 Jan 17;265(2):217-41.

53) Imai T, Takekiyo T, Kovalenko A, Hirata F, Kato M, Taniguchi Y. Theoretical study of volume changes associated with the helix-coil transition of an alanine-rich peptide in aqueous solution. Biopolymers. 2005 Oct 5;79(2):97-105.

54) Onisko B, Fernandez EG, Freire ML, Schwarz A, Baier M, Camina F, Garcia JR, Rodriguez-Segade Villamarin S, Requena JR. Probing PrPSc structure using chemical cross-linking and mass spectrometry: evidence of the proximity of Gly90 amino termini in the PrP 27-30 aggregate. Biochemistry. 2005 Aug 2;44(30):10100-9.

55) Giron-Monzon L, Manelyte L, Ahrends R, Kirsch D, Spengler B, Friedhoff P. Mapping protein-protein interactions between MutL and MutH by cross-linking. J Biol Chem. 2004 Nov 19;279(47):49338-45.

56) Huang BX, Kim HY, Dass C. Probing three-dimensional structure of bovine serum albumin by chemical cross-linking and mass spectrometry. J Am Soc Mass Spectrom. 2004 Aug;15(8):1237-47.

57) Sundararaj, S., Andrew, L.C., & Wishart, D.S. “3-D Protein Structure Determination by Mass Spectrometry” Abstract presented at the 3rd Annual Canadian Proteomics Initiative Conference, Vancouver, BC. May 23-25, 2003.

58) Kim DE, Chivian D, Baker D. Protein structure prediction and analysis using the Robetta server.Nucleic Acids Res. 2004 Jul 1;32(Web Server issue):W526-31.

59) Zou WQ, Cashman NR. Acidic pH and detergents enhance in vitro conversion of human brain PrPC to a PrPSc-like form. J Biol Chem. 2002 Nov 15;277(46):43942-7.

60) Castilla J, Saa P, Hetz C, Soto C. In vitro generation of infectious scrapie prions. Cell. 2005 Apr 22;121(2):195-206.

61) Wille H, Michelitsch MD, Guenebaut V, Supattapone S, Serban A, Cohen FE, Agard DA, Prusiner SB. Structural studies of the scrapie prion protein by electron crystallography. Proc Natl Acad Sci U S A. 2002 Mar 19;99(6):3563-8

62) Kovalenko, A Three-dimensional RISM theory for molecular liquids and solid-liquid interfaces, in: Molecular Theory of Solvation, Fumio Hirata (Ed.) vol.24, (Kluwer Academic Publishers, Dordrecht, 2003, 360 p.) pp.196-275.

63) Moralez JG, Raez J, Yamazaki T, Motkuri RK, Kovalenko A, Fenniri H. Helical rosette nanotubes with tunable stability and hierarchy. J Am Chem Soc. 2005 Jun 15;127(23):8307-9.

64) DeMarco ML, Daggett V. From conversion to aggregation: protofibril formation of the prion protein. Proc Natl Acad Sci U S A. 2004 Feb 24;101(8):2293-8.

14

Figure 1. Two models of PrPsc initiation and assembly. One of the aims of this project is to clarify the molecular details of this process and to identify which model is most likely correct. This has important implications in the design of therapeutics and the development of diagnostic reagents.

15

Figure 2. Multiple sequence alignment (generated using T-coffee) of Syrian hamster, bovine and human prion proteins. The sequence identity (from residue 90 onwards) between any two pairs of proteins is nearly 90%. The alignment shows the consensus location of helices A, B and C as well as the positions of strands S1 and S2. Human disease-causing mutations are highlighted (notice how they locate principally in helices B and C). Residues coloured in red are mutated to amino acids of equal or greater hydrophobicity, while those coloured in cyan are mutated to amino acids of equal or greater hydrophilicity.

16

Synthetic gene Xho I –SHPrPc (29-231)-EcoR I to use with pBAD/His ACATGGCCTCGAGGGTGGCTGGAACACCGGCGGTTCTCGCTACCCGGGCCAGGGTAGCCCGGGCGGTAACCGCTATCCGCCGCAGGGCGGTGGCACTTGGGGCCAGCCGCACGGTGGTGGCTGGGGCCAGCCGCATGGCGGTGGCTGGGGCCAGCCGCATGGTGGTGGCTGGGGCCAGCCGCACGGCGGCGGTTGGGGTCAGGGTGGCGGTACCCACAATCAGTGGAACAAACCGAGCAAACCGAAAACCAACATGAAACACATGGCTGGCGCGGCGGCTGCGGGTGCGGTTGTTGGCGGCCTGGGTGGCTACATGCTGGGCTCCGCTATGAGCCGCCCGATGATGCATTTCGGCAACGATTGGGAGGATCGTTATTACCGCGAGAACATGAACCGTTATCCGAACCAGGTGTATTACCGCCCGGTGGATCAGTATAACAACCAGAACAACTTTGTTCATGATTGCGTGAACATCACTATCAAGCAGCATACCGTTACCACCACCACTAAGGGTGAAAACTTCACGGAAACCGACATCAAGATCATGGAGCGCGTGGTTGAGCAGATGTGTACCACCCAGTACCAGAAAGAATCTCAGGCGTACTACGACGGTCGCCGTTCTAGCTAATAGGAATTCCATGGC

Figure 3. DNA sequence (with annotations) of the synthetic hamster PrP gene designed by our expression group for optimal expression in E. coli. Xho I and EcoR I restriction sites were added to the gene for its insertion into the multiple cloning site of the pBAD/HisA expression vector. The gene was synthesized by DNA2.0 Inc. and arrived in late November. Cloning and expression efforts are now underway.

17

Figure 4. Interspecies comparison of the backbone flexibility differences between bovine, dog, chicken, elk, cat, human, sheep, pig, hamster and frog. These curves were determined via the RCI method using the published backbone chemical shifts of these proteins. The following BMRB accession codes were used in the RCI calculations: 4563 (Bovine prion), 6378 (Canine prion), 6269 (Chicken prion), 6383 (Elk prion), 6377 (Feline prion), 4379 (Human prion), 6381 (Ovine prion), 6380 (Pig prion), 4307 (Syrian Hamster prion), 6382 (Xenopus prion). Note the tremendous variation in the flexibility of the loop between helix B and C (loop 190-205) between different species.

18

Figure 5. Comparison of RCI of human prion proteins collected at 2 different pH’s. One at pH 4.5 (solid) and pH 7 (dashed). The loop from residues 189-199 is seen to become stabilized at pH 7. At low pH, which has been shown more conducive to PrP sc formation, the loop is much more flexible. These data suggest that this loop may be an initiator of PrPc to PrPsc conversion. One of the goals of this project is to systematically explore pH effects on the structure and dynamics of hamster PrP to see if these changes are mirrored across species. The following BMRB accession codes were used in the RCI calculations: 5713 (pH=7.0) and 4379 (pH=4.5).

19

Figure 6. The Random Coil Index (RCI) allows identification and comparative analysis of residual structure in the unfolded N-terminal region of prion proteins. Chemical shift datasets with the following BMRB accession codes were used in RCI calculations: 4564 (Bovine prion) and 4402 (Human prion).

20

Figure 7. Molecular dynamics simulations allow characterization of effects of mutations on prion stability. The MD simulation (GROMACS) was performed by our modeling group on the 90-231 fragment of human PrPc. The M166V mutant of the human prion shows increased per-residue RMSD (lower stability) compared to the wild-type protein (WT) during MD simulations. The following PDB IDs were used: 1QM3 (WT) and 1E1G (M166V). More detailed analyses show that the largest changes in the mutant are found near the N-terminus while the region around 166 in the mutant seems to be stabilized relative to the wild-type. This is a good example of the potential of MD simulations to provide testable (via NMR) hypotheses and to provide structural insights into the prion unfolding process.

21

Figure 8. Self-assembly of rosette rings and nanotubes in solution and the hydration shell around the rosette nanotube and in its channel as generated using 3D-RISM. A notable resemblance to PrPsc aggregation and self-assembly is obvious.

22

Deliverables, Milestones and SchedulesThe proposed research plan, PI project associations and milestones are summarized by the GANTT chart given below: DW=David Wishart; JFK=Julie Forman-Kay; PL=Paul Lu; GL=Guohui Lin; LL=Liang Li; AK=Andriy Kovalenko

Milestones

Groups Year 1Q1-Q4

Year 2Q1-Q4

Year 3Q1-Q4

1. Hire new staff, train, transfer existing staff

All

2. Expression and mutagenesis of Hamster PrP

DW

3. Expression and mutagnesis of bovine PrP

DW

4. NMR assignments/structure/dynamics of WT and mutated hamster PrP in different conditions

DW, JFKGL, PL

5. NMR assignments/structure/dynamics of WT and mutated bovine PrP in different conditions

DW, GL, JFK

6. NMR assignments/structure/dynamics of truncated, solvent perturbed or partially denatured hamster PrP*

JFK, DW, GL

7. Extended MD, replica exchange and MONSSTER simulations of mutated or perturbed PrPc and PrP*

PL, AK, DW, GL

8. Simulation studies of PrPsc aggregation, kinetics and assembly using 3D RISM and integral equation methods

AK, PL

9. Preparation of aggregated PrPsc (using PCAM or other in vitro methods)

DW, LL

10. Development and testing of MS and chemical modification methods

LL, DW

11. Characterization of PrPsc via MS23D methods, determination of atomic structure

LL, DW, GL

12. Collect high resolution TEM and AFM images of PrPsc

DW, AK

13. Characterize PrPsc via molecular image reconstruction, modeling & threading

LL, GL, DW

Deliverables: 1) world-class expertise in prion cloning, manipulation and expression; 2) a detailed atomic picture of the dynamics & early unfolding events of PrP c and PrPc

mutants; 3) robust computational methods to rapidly assign and characterize proteins (folded and unfolded) by NMR; 4) an atomic resolution model of PrP*; 5) a near atomic resolution model of PrPsc as found in prion fibrils with a clear understanding of the species-specific contacts, exposed epitopes, monomer topology and relative orientation of the PrPsc monomers; 6) a general method to determine protein 3D structures via MS; 7) robust computational methods to model protein aggregation, self-assembly and intermolecular recognition; 8) a clearer understanding of prion assembly kinetics; 9) general methods that can be applied most other amyloid-like systems; 10) new insights into small molecules that may bind prions leading to inhibition or activation of prion assembly; 11) new insights into potential epitopes for better antibody-based surveillance and detection

23

Project TeamWe have assembled an excellent team of 6 bright, young and accomplished researchers (David Wishart, Liang Li, Guohui Lin, Paul Lu, Andriy Kovalenko and Julie Forman-Kay). Dr. Wishart will serve as the project leader. He has had considerable experience and success in building and leading research teams over the past 10 years. In particular, he has served or is serving as a project leader on 2 multi-investigator PENCE projects, 1 multi-investigator Genome Canada project, 3 core facility projects and is currently a co-director of NINT’s nanobiology program. Each of these involves coordinating with multiple PI’s (>4) and large numbers of staff (>10) in different locations. Dr. Wishart also brings the necessary scientific breadth to coordinate and lead this kind of research project. Specifically, Wishart has published in all areas that will be covered by this grant, including NMR spectroscopy, protein folding/unfolding, molecular biology, mass spectrometry, computational biology, molecular simulation, electron microscopy and chemical modification. This know-how will allow Dr. Wishart to work closely with all members of the research team and ensure that the group functions efficiently and coherently. Collectively, the project team has published more than 400 papers, received more than $40 million in grants and started 3 spin-off companies. Team members were chosen based on the skills they brought to the table, their record of past accomplishment, their interest in relevant biological questions and the fact that many of these individuals have previously worked together on other collaborative grants. The team is quite “trans-disciplinary” as it consists of 2 NMR spectroscopists (Wishart, Forman-Kay), 1 MS specialist (Li), 2 computational biologists (Lin, Lu) and 1 theoretician (Kovalenko). The team is further strengthened by several collaborators who have agreed to contribute their expertise including: Lewis Kay (NMR, U of T), Avi Chakrabartty (prion clones, U of T), Peter Tieleman (MD, U of C), Mike Belosevic (prion samples, U of A) and F. Hirata (modeling, Japan). Several team members and many project collaborators are internationally recognized for their work in protein structure/folding, their expertise in proteomics or their development of “revolutionary” new methods that have had a profound and lasting impact in macromolecular simulation, NMR or MS. The overall structure of the project requires that all team members work closely and collaboratively. Specifically the “wet-lab” team (Forman-Kay, Wishart and Li) will continually provide data to the “dry-lab” team (Lin, Kovalenko, Lu) and vice versa. This interplay between theory and experiment will be critical to advancing the project and interpreting both experimental data (in light of computer results) and computational data (in light of experimental results). Obviously the 2 NMR specialists (Wishart & Forman-Kay) will work closely together given their shared expertise and common interests. Likewise, it is expected that Kovalenko, Lin and Wishart will work closely with Lu to plan and conduct a number of large scale computational studies. Li, Lin and Wishart will also work closely together on the MS project. To facilitate coordination and reduce redundancy, all prion samples and constructs will be prepared and distributed through a single lab (Wishart). To further enhance collaboration and cooperation, we will have weekly lab meetings (with rotating short-subject seminars) to ensure that each team member is current with what other project members are doing. A web-based laboratory information management system (LIMS) with a web-based “wiki”, scheduler and milestone planner will be employed to ensure all staff and PI’s can stay in touch. A part-time admin. assistant (paid thru other grants) will also be brought in to facilitate reporting, data exchange, meeting arrangements, budget control and human resource issues.

24

Training Component DetailsAs seen in the attached budget pages, this project depends heavily on recruiting and developing trainees to do a significant portion of the research. In fact, more than 80% of the proposed budget is allocated to trainee salaries and only a small portion to equipment and consumables. Specifically a total of 6 PDFs, 8 graduate students (GS), 2 research associates (RA) and 1 technician are expected to be employed on this project. Wishart will employ 2 PDFs, 1 GS and 1 RA, Li will hire 2 GS and 1 PDF, Forman-Kay will employ 1 PDF and 1 GS, Lu will bring in 1 PDF, Lin will employ 2 GS and Kovalenko will hire 1 PDF and 1 GS. In-kind contributions from other sources will bring 1 technician plus 1 GS (Wishart) and 1 RA (Kovalenko) to the total project staff. It is anticipated that the ramp-up period to recruit these staff will be very short, with most hires being on board within 3 months after the funds are released. This is because many proposed trainees are already in their designated labs and all have expressed a keen interest to join this project (if approved). We believe the trainees brought in for this project will acquire cutting-edge wet-lab and dry-lab skills that will be in great demand wherever they choose to go. Several staff members (1 technician, 1 GS) will gain considerable expertise in cloning, mutating and purifying “made-to-order” prion proteins. Other members (2 PDFs) will become experts in PMCA (protein misfolding cyclic amplification) as well as other in vitro methods to prepare PrPsc samples. They will also gain important expertise in TEM and SPM. We anticipate that 4 individuals (2 PDFs and 2 GS) will become quite skilled in prion NMR and many aspects of prion structural biology. These same individuals will also become experts on many of the latest tools and technologies in NMR (relaxation dispersion measurements, paramagnetic enhanced relaxation, automated assignment and structure determination). At least 3 individuals (2 GS and 1 PDF) will gain considerable expertise in using many of the latest MS instruments (FT-MS, ion-trap MS and MALDI ToF-ToF) and will develop invaluable skills in structure-by-MS methods. The dry-lab staff (6 total) will learn a number of computational techniques ranging from new approaches to NMR assignments, new methods to accelerate MD simulations, new approaches to image reconstruction, new methods to model protein unfolding and new techniques to model protein aggregation and solvent interactions. All of the trainees will have opportunities to work in other labs – not only among the labs of the project team PIs (4 at the U of A, 1 at NINT, 1 at U of T), but also among the labs of our international collaborators. We have set aside a significant travel budget ($30K/year) to support 1-2 week training visits by at least 10 individuals/year. Training travel requests will be reviewed by the training committee (Wishart, Forman-Kay, Lu) on a bi-monthly basis. Our collaborators currently include: Lewis Kay (U of T), Avi Chakrabartty (U of T), Peter Tieleman (U of C), Mike Belosevic (U of A) and F. Hirata (Ritsumeikan, Japan). Each of these individuals is a recognized expert in protein NMR (Kay), protein folding (Chakrabartty), modeling (Tieleman), simulations (Hirata) and prion/protein expression (Belosevic). The training, access to facilities and the skills our staff could get from these interactions will be superb. Not only do we plan to send our trainees abroad, we also want to bring experts here. We are working with the Canadian Proteomics Initiative (Wishart is co-chair) to develop satellite meetings and 2-day training workshops on the subject of prion bioinformatics and prion proteomics. The CPI will be held in Edmonton in May 2006 and Vancouver in May 2007. We also plan to organize a small annual conference on prion biology that brings in 2-3 invited speakers to Edmonton and which would serve as a forum for our project to present its findings to the Alberta community.

25

Knowledge Translation PlansThis project is a basic research project. As such the knowledge obtained and technologies developed will largely be disseminated through standard scientific communication channels, including peer-reviewed journals, peer-reviewed or refereed conferences, text-books or book-chapters, white papers, conference abstracts and invited oral presentations. Many of the project PIs have excellent publication records and have published in many top-flight journals. Our collaborators have equally outstanding records. Our consensus publication goal is that 3 papers will be published or submitted in the first year, 6 in year 2, 9 in year 3. This target also includes conference proceedings (a common forum for computing publications). While these kinds of communication strategies are effective for knowledge transfer among scientists, we recognize there is also an important need to communicate to the public and to public policy makers. In order to do this more effectively, a once-a-year project conference (The Biology of Prions) will be held in Sept in Edmonton, with the intent of bringing in 2-3 internationally prominent scientists to give public lectures in the area of prion biology, prion detection or medical and socio-economic issues surrounding BSE and TSE. This conference will also allow our team to present some of our findings to the Alberta community – especially to the general public, to government or policy makers (Fish and Wildlife, Dept. of Agriculture, Capital Health), to the Agri-food industry and to the biotechnology community. Such a forum may also be combined with other funded APRI projects to give it a greater impact and higher profile. It is hoped that this will lead to new partnerships with the private or public sector and to further collaborations with other scientists (i.e. the invited speakers). Another key aspect to public outreach (or knowledge translation) will be the establishment of a lively, interesting and up-to-date web site containing descriptions of our project and current updates of our progress or accomplishments. A well designed website can create a powerful public presence. Our “dry-lab” team has had plenty of experience in generating high quality websites with interesting flash movies and colourful dynamic displays. Their expertise will be employed on a part-time basis along with that of the Genome Canada Bioinformatics Platform to help maintain and update the website.

26

Commercialization PlansAs a publicly funded basic research project we believe it will be important to disseminate the findings we make as quickly as possible to publicly accessible journals and databases. However, we are also aware that many of the tools and techniques we are developing or “testing” will have potentially broad applications elsewhere. Likewise some of the findings we make may lead to trivially obvious inventions. We expect that the most likely commercial products will pertain to software developed to facilitate experimental data analysis (NMR assignment, NMR structure determination, MS structure determination) as well as the software used to model prion aggregation/salvation kinetics (RISM). This software may be licensable to NMR instrument vendors (Bruker, Varian) or informatics/computing companies (Accelrys, IBM, SGI). Other potentially patentable technologies may include MS techniques developed by Dr. Li pertaining to PrPsc structure characterization as well as potentially new techniques developed by the prion expression lab to enhance prion yields. The most commercially important outcome would be a near atomic resolution structure of the PrPsc structure. This could provide key insights into the ways of arresting PrPsc aggregation or developing better antibodies for PrPsc detection. Should such a model be developed, the inventors would likely seek quick IP protection through their parent institution’s RSO and follow on by seeking a willing pharmaceutical company with which to partner. As required by our institutional agreements, we will adhere to the rules and regulations of each of the PI’s parent institutions (U of T for Forman-Kay; NINT for Wishart + Kovalenko; U of A for the others) regarding the reporting of inventions, the ownership of inventions and copyrights and the process for licensing and patenting. For inventions and IP shared among different individuals from different institutions we will refer to existing inter-university or inter-institutional agreements as a guide. IP disputes will be settled through discussion among the PIs and/or trainees (if possible) and failing that, these issues will be referred to the respective RSO legal departments. Currently we have no plans to create a “holding” company to house this project’s IP. However, some of the PI’s are seeking partnerships/sponsorships with several large multinational corporations who may be interested in co-funding this work.

27

Socioeconomic BenefitOf the 11 deliverables identified earlier (see Deliverables and Milestones) this project has 7 that could have clear socioeconomic benefit to Albertans and Canadians. These include 1) world-class expertise in prion cloning, manipulation and expression; 2) potentially commercializable software to rapidly assign and characterize proteins (folded and unfolded) by NMR; 3) a new, potentially commercializable method to determine 3D structures via MS; 4) potentially commercializable software designed to model protein aggregation, self-assembly and intermolecular recognition; 5) generally applicable tools and methods that can be used to perform structure/function studies on most other amyloid-like systems; 6) new insights into small molecules that may bind prions leading to inhibition or activation of prion assembly; and 7) new insights into potential epitopes for better antibody-based surveillance and detection. Should any or all of these 7 objectives be met, they may allow the creation of either marketable technologies (software, expertise, products) or service/consulting companies that would be highly sought after by instrument manufacturers (NMR, MS), commercial diagnostic labs, and pharmaceutical companies. Successful commercialization of these deliverables would help to diversify the Alberta economy and build on Alberta’s emerging knowledge industries. These products/services may also attract the attention and investment dollars from multinational pharmaceutical, nanotech, biotech and agri-food companies. Beyond these milestone-specific benefits, this project also brings other less tangible socioeconomic benefits. Specifically during the first 3-year phase of this project we will be training ~17 highly qualified personnel (HQP) to perform cutting-edge biomedical research. Many of these people will choose to stay in Alberta. Others will have been attracted from top-flight universities to come to Alberta. This attraction and retention of HQP will clearly enhance Alberta’s knowledge economy and should build on its growing international reputation as a centre of research excellence. Some of these HQP may even stay on to become academic staff in Alberta or other Canadian universities. Successful biomedical and animal health researchers can bring in between $10-15 million in grants (each) during the course of their careers. This direct funding has a multiplier effect that benefits the local economy by at least twofold. Likewise many biomedical researchers start companies, generate new technologies, build international linkages and offer up new ideas – all of which have important socio-economic benefits. We believe this project, with its strong emphasis on basic research, will generate more than its share of potentially top-flight research prospects who may become academic or entrepreneurial stars of the future. Unlike most other projects under consideration, the project focuses on prion structural biology. This specific topic has attracted the attention of 3 Nobel laureates (Wurthrich, Prusiner and Gajdusek) and some of the best structural biology labs in the world. Certainly this reminds us that this research area is very competitive, but it also highlights a tremendous opportunity for Canadian (and Alberta) structural biologists to become part of a very select international group. We believe the talent exists in Alberta (and the rest of Canada) to be competitive with these elite labs. If we are successful in our research objectives, this success will bring international attention and awareness of Alberta’s scientific capabilities. It will also help put Alberta on the map in terms of prion research and establish important external linkages – nationally and internationally. These successes will also help raise the public profile of prion research in Alberta, making the public aware that scientists are responsive to the public’s needs. This heightened public awareness of science has an important, but intangible socio-economic benefit too.

28

Budget (Explanation and Justification)Staff salaries: (Total = $480K/yr) More than 80% of the budget is allocated to the salary support of 17 HQP who will be involved in this project. The success of the project critically depends on the work ethic and specialized skills of these individuals. Wishart will employ 2 PDFs, 1 GS and 1 RA, Li will hire 2 GS and 1 PDF, Forman-Kay will employ 1 PDF and 1 GS, Lu will bring in 1 PDF, Lin will employ 2 GS and Kovalenko will hire 1 PDF and 1 GS. In-kind contributions from other sources will bring on 3 other staff. Details of the hiring schedule, staff roles and co-funding are on the attached page.Consumables, materials & supplies: (Total = $55K/yr). These include several items:1) Molecular biology reagents, DNA sequencing charges, oligo primer synthesis, protein purification equipment (HPLC columns), glassware, plasticware and media ($26,000/yr). 2) NMR supplies for 2 labs including cryogens ($5000/yr), NMR tubes ($1000/yr), 13C and 15N labeled reagents for cell growth and protein labeling ($10,000/yr)3) MS supplies including vacuum pump repairs ($3000/yr), cross-linking reagents ($3000/yr) and general consumables including nano-spray tips, proteases, plasticware, solvents, MALDI target plates, etc. ($2000/yr)4) Computers and storage media -- replacements and upgrades for staff ($5K/yr).Travel and publication charges: (Total = $35K/yr). A total of $30,000/yr is requested to support the training of our HQP in different labs around the world (Edmonton, Calgary, Toronto, Japan). $2000/yr is requested to support page charges and reprint costs. $3000/yr is requested for support travel costs of visiting speakers for our proposed annual Prion Biology Conference to be held in Edmonton.Co-Funding: More than $2.4 million in new co-funding is being used, sought, negotiated or applied for to support this grant from several agencies or companies (CFI, NRC/NINT, PENCE, NSERC, IBM, Chenomx). Kovalenko and Wishart are participating in 2 prion related CFI initiatives which are to be submitted in early December. The Federated Institute for the Simulation of Complex Interactions (FISCI) is requesting $15 million from CFI to support computational and visualization infrastructure for biological simulations. Wishart and Kovalenko are both major co-applicants. This request includes nearly $10 million in state-of-the-art shared memory super-computers and visualization systems, plus $5 million in offices, general infrastructure and support staff. The application has a very high probability (>75%) of being fully funded. We anticipate that 10% of FISCI’s resources will be used for prion work ($1.5 million). Wishart is also a major co-applicant for a $5 million CFI application CFI application being prepared through the Dept. of Biological Sciences for upgrades to its Molecular Biology Service Unit (MBSU). This includes DNA sequencers, MS instruments for protein chemistry, fermentors, etc. Approximately 5% of the MBSU resources will be used by this prion project ($250K). Beyond this infrastructure support, additional funds (Wishart) have already been diverted from existing PENCE grants ($30K this year) to assist in gathering preliminary data. Kovalenko (through existing and future NRC grants) will contribute $50K/yr for a programmer analyst. A proposal for a second “in-kind” part-time staff member is being submitted to the NRC ($25K/yr). Wishart (through existing and future NRC/NINT grants) will contribute $40K/yr for a research technician. An NSERC graduate student (Steve Neal) will also be working full time on this project ($25,000/yr). In addition to these funds we are beginning discussion for $25K/yr support through IBM’s Alberta Centre for Advanced Studies (CAS). We have also begun discussions with Chenomx and BioTools (two small biotech companies in Edmonton) to obtain some in-kind support.

29

Detailed Project Budget – All Figures in $1000’s. Total 3 year request from APRI = $1,705,800.PI/Category/ Q1. Q2. Q3. Q4. Q5. Q6. Q7. Q8. Q9. Q10 Q11 Q12Lu – PDF (to design, optimize and conduct MD & MONSSTER studies)

0 12.5 12.5 12.5 12.5 12.5 12.5 12.5 12.5 12.5 12.5 12.5

Lu – Equipment & Supplies

2.5 2.5

Lin – GS (to design & refine NMR, EM and MS software)

6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3

Lin – GS (to design & refine coarse grain unfolding software)

0 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3

Lin – Equipment & Supplies

2.5 2.5

Kovalenko – PDF (to optimize RISM software for modeling prion aggregation)

11 11 11 11 11 11 11 11 11 11 11 11

Kovalenko – GS (to develop PCA methods for modeling prion dynamics & kinetics)

0 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3

Kovalenko – Equipment & Supplies

2.5 2.5

Li – GS (to develop and optimize methods for chemical cross-linking to PrPsc & other proteins)

6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3

Li- PDF (to characterize the structure of PrPsc via MS)

0 10 10 10 10 10 10 10 10 10 10 10

Li – GS (to develop and use in vitro methods such as PCAM to make PrPsc)

0 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3

Li – Equipment & Supplies 3 3 3 3 3 3 3 3 3 3 3 3Forman-Kay – GS (to use NMR to characterize PrP* and unfolded PrP)

6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3

Forman-Kay – PDF (to use NMR to characterize “excited” states of PrP)

0 11 11 11 11 11 11 11 11 11 11 11

Forman-Kay – Equipment & Supplies

3 3 3 3 3 3 3 3 3 3 3 3

Wishart – GS (to prepare & characterize mutants of PrP)

6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3 6.3

Wishart – PDF (to use NMR to characterize dynamics of PrP mutants)

10 10 10 10 10 10 10 10 10 10 10 10

Wishart – PDF (to develop, test and perform novel coarse-grid simulations of PrP/PrP*)

10 10 10 10 10 10 10 10 10 10 10 10

Wishart – RA (to assist with NMR studies, PrPsc preparation and EM characterization/modeling)

14 14 14 14 14 14 14 14 14 14 14 14

Wishart – Equipment & Supplies

7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5 7.5

Travel for training and invited speakers

0 10 10 10 10 10 10 10 10 10 10 10

Total (APRI Request) 91.2 146.1 146.1 146.1 146.1 153.6 146.1 146.1 146.1 146.1 146.1 146.1

Yearly Summary Year1 529.5 Year2 591.9 Year3 584.4In Kind – NRC(Kovalenko, 2 programming staff)

19 19 19 19 19 19 19 19 19 19 19 19

In Kind – NRC(Wishart 1 technician, protein prod)

10 10 10 10 10 10 10 10 10 10 10 10

In Kind –PENCE (Wishart) 30 0 0 0 0 0 0 0 0 0 0 0In Kind – IBM CAS 0 0 0 0 6 6 6 6 6 6 6 6In Kind – CFI (FISCI) 1500In Kind – CFI (MBSU) 500In Kind Total 59 29 29 29 2035 35 35 35 35 35 35 35Grand Total 150.2 175.1 175.1 175.1 2181 188.6 181.1 181.1 181.1 181.1 181.1 181.1

30

31