tutorial 11 rna structure prediction. rfam – rna structures database rnafold – rna secondary...
Post on 18-Dec-2015
222 views
TRANSCRIPT
Tutorial 11
RNA Structure Prediction
RNA Structure Prediction
• Rfam – RNA structures database
• RNAfold – RNA secondary structure prediction
• tRNAscan – tRNA prediction
• TargetScan – microRNA prediction
RNA secondary structure types
Rfam
• The Rfam database is a collection of RNA families, each represented by multiple sequence alignments and consensus secondary structures.
http://rfam.sanger.ac.uk/
Rfam
Different search modes
http://rfam.sanger.ac.uk/
Search Rfam
The secondary structure
:::::: free extremes((())) Stem<<<>>> Internal Stem______ Loop,,,,,, Internal loop
Structure representations
RNA secondary structure prediction
GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA
RNA structure prediction by Vienna RNA package
RNAfold server minimum free energy structures and base pair probabilities from single RNA or DNA sequences.
RNAalifold server consensus secondary structures from an alignment of several related RNA or DNA sequences. You need to upload an alignment.
RNAinverse server design RNA sequences for any desired target secondary structure.
RNAfold
• Gives best stabilized structure (structure with minimal free energy (MFE))
• uses a dynamic programming algorithm that exploits base pairing and thermodynamic probabilities in order to predict the most likely structures of an RNA molecule (partition function algorithm).
RNAfold - input
RNA sequence
Minimal free energy structure
Frequency of the structure
RNAfold - output
Sequence-Structure alignment
Best “average” structure
Graphic representation
Coloring options
Minimal free energy
Folding Probabiliy
Mountain Plot
• A mountain plot represents a secondary structure in a plot of height versus position.
• The height m(k) is given by the number of base pairs enclosing the base at position k.
• Loops correspond to plateaus and stems correspond to slopes.
• The closer the two curves, the better defined the structure.
centroid
Entropy
RNAfold structure representations
RNAalifold - input
Alignment
RNAalifold - output
RNAinverse - input
RNAinverse - output
tRNAscan
• Detection of tRNA genes in raw genomic sequence orother types of sequence inputs.
http://lowelab.ucsc.edu/tRNAscan-SE/
Sequence
tRNAscan - input
tRNAscan - results
http://trna.nagahama-i-bio.ac.jp/
MicroRNA - reminder
• Search for predicted microRNA targets in mammals (/worm/fly) 3’ UTRs.• Find conserved 8mer and 7mer sites that match the seed region of each miRNA. • Predictions are ranked based on the predicted efficacy of targeting as calculated using the context+ scores of the sites
Mir 31 - broadly conserved* microRNA
* conserved across most vertebrates, usually to zebrafish
Mir 136 - conserved* microRNA
* conserved across most mammals, but usually not beyond placental mammals