Ref. code: 25605612040039JID

CONSTRUCTION OF MOUSE ANTIBODY LIBRARY BY

PHAGE DISPLAY TECHNOLOGY AND PRODUCTION

OF SCFV MONOCLONAL ANTIBODIES AGAINST

VIBRIO PARAHAEMOLYTICUS AND

VIBRIO ALGINOLYTICUS

BY

MISS PHATCHARAPORN CHIAWWIT

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF

THE REQUIREMENTS FOR THE DEGREE OF THE

MASTER OF SCIENCE (BIOMEDICAL SCIENCES)

GRADUATE PROGRAM IN BIOMEDICAL SCIENCES

FACULTY OF ALLIED HEALTH SCIENCES

THAMMASAT UNIVERSITY

ACADEMIC YEAR 2017

COPYRIGHT OF THAMMASAT UNIVERSITY

Ref. code: 25605612040039JID

CONSTRUCTION OF MOUSE ANTIBODY LIBRARY BY

PHAGE DISPLAY TECHNOLOGY AND PRODUCTION

OF SCFV MONOCLONAL ANTIBODIES AGAINST

VIBRIO PARAHAEMOLYTICUS AND

VIBRIO ALGINOLYTICUS

BY

MISS PHATCHARAPORN CHIAWWIT

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF

THE REQUIREMENTS FOR THE DEGREE OF THE

MASTER OF SCIENCE (BIOMEDICAL SCIENCES)

GRADUATE PROGRAM IN BIOMEDICAL SCIENCES

FACULTY OF ALLIED HEALTH SCIENCES

THAMMASAT UNIVERSITY

ACADEMIC YEAR 2017

COPYRIGHT OF THAMMASAT UNIVERSITY

Ref. code: 25605612040039JID

(1)

Thesis Title CONSTRUCTION OF MOUSE ANTIBODY LIBRARY

BY PHAGE DISPLAY TECHNOLOGY AND

PRODUCTION OF SCFV MONOCLONAL

ANTIBODIES AGAINST VIBRIO

PARAHAEMOLYTICUS AND

VIBRIO ALGINOLYTICUS

Author Miss Phatcharaporn Chiawwit

Degree The Master of Science (Biomedical Sciences)

Major

Field/Faculty/University

Graduate Program in Biomedical Sciences

Faculty of Allied Health Sciences

Thammasat University

Thesis Advisor

Thesis Co-Advisor

Assistant Professor Pongsri Tongtawe, Ph. D.

Assistant Professor Potjanee Srimanote, Ph. D.

Assistant Professor Jeeraphong Thanongsaksrikul, Ph. D.

Professor Wanpen Chaicumpa, D. V. M. (Hons.) Ph. D.

Academic Years 2017

ABSTRACT

Vibrio genus is the Gram-negative bacteria that ubiquitous in halophilic marine

environments. Several Vibrio species are pathogenic causing foodborne diseases

worldwide. Identification of the species using conventional culture method is often

imprecise since they are genetically closely related especially Vibrio parahaemolyticus

and Vibrio alginolyticus. This study aimed to produce the scFv monoclonal antibody

specific to V. parahaemolyticus and V. alginolyticus. The stepwise experiment was

performed to obtain these antibodies. Firstly, construction of a murine scFv antibody

displayed phage library. Secondly, searching for target proteins which were unique to

each species by genome comparison and then produced the recombinant proteins of those

targets. Thirdly, selection of the scFv phage clones specific to the target protein of

V. parahaemolyticus and V. alginolyticus. Finally, expression and purification of the

particular scFv monoclonal antibodies.

Ref. code: 25605612040039JID

(2)

In this study, naïve mouse scFv antibody phage library was successfully

constructed. This library contained 8.75×109 cfu of phages of which 82.9% was carrying

scfv with 90.3% diversity. The scFv phages library was screened for phages binding to the

peptide sequence of the ToxR target protein. Subsequently, the scfv of the bound phages

were extracted and cloned into pOPE101 expression vector. Then, the scFv antibodies

were produced, and eight scFv antibodies were obtained in this study. They were VP20.7,

VP59.7, VP61.3 and VP62.13 which were specific to V. parahaemolyticus and VA34.1,

VA74.1, VA87.1 and VA120.1 which were specific to V. alginolyticus. The binding

activity of these scFv monoclonal antibodies was tested using Western blot analysis. The

result revealed that each antibody could react and produce the reaction band with the

correct size of its corresponding recombinant ToxR protein. Therefore, these antibodies

could be further used to develop the immunoassay for detecting V. parahaemolyticus and

V. alginolyticus.

Keywords: V. parahaemolyticus, V. alginolyticus, scFv, Phage, Antibody engineering,

Ref. code: 25605612040039JID

(3)

ACKNOWLEDGEMENTS

I would like to express my sincere thanks to my principal advisor, Assistant

Professor Dr. Pongsri Tongtawe for her invaluable help and constant encouragement

throughout this research. The door to my advisor office was always open whenever I ran

into a trouble spot or had a question about my research or writing. I am most grateful for

her teaching and advice, not only the research methodologies but also many other

methodologies in life. I would not have achieved this far, and this thesis would not have

been completed without all the support that I have always received from her.

I would like to express my gratitude to my all co-advisor, Assistant Professor Dr.

Potjanee Srimanote, Assistant Professor Dr. Jeeraphong Thanongsaksrikul and Professor

Dr. Wanpen Chaicumpa for their numerous help, suggestion supports, and kindness. This

thesis has finished under their proposals.

My sincere thanks also go to all of the members in Molecular Immunology and

Microbiology Laboratory, Graduate Program in Biomedical Sciences, Faculty of Allied

Health Sciences, Thammasat University who give me a friendship, kind of help since I am

here.

Special thanks for funding supported from the Office of the National Research

Council of Thailand (NRCT), Health System Research Institute (HSRI) and Teaching

Assistantship Scholarship from Research Administration Division, Thammasat

University. Thanks are due to the Faculty of Allied Health Science, Thammasat

University for providing the laboratory facilities.

Finally, I most gratefully acknowledge my parents for all their support throughout

this research.

Miss Phatcharaporn Chiawwit

Ref. code: 25605612040039JID

(4)

TABLE OF CONTENTS

Page

ABSTRACT (1)

ACKNOWLEDGEMENTS (3)

LIST OF TABLES (9)

LIST OF FIGURES (10)

LIST OF ABBREVIATIONS (12)

CHAPTER 1 INTRODUCTION 1

CHAPTER 2 OBJECTIVES 3

CHAPTER 3 REVIEW OF LITERATURE 4

3.1 Antibody (Ab) 4

3.1.1 Antibody structure 4

3.1.2 Antibody repertoire and diversities 6

3.2 Monoclonal antibody 8

3.3 Single-chain variable fragment (scFv) 11

3.3.1 Diversity of scFv 11

3.3.2 scFv library 12

3.3.3 Advantage of scFv 13

3.4 Phage display technology 14

3.4.1 Filamentous phage 15

3.4.2 Filamentous phages used for phage display 16

3.5 Generation of scFv phage display library 20

3.5.1 Construction of scFv library 20

3.5.2 Bio-panning 21

3.5.3 Selection and screening of scFv 23

Ref. code: 25605612040039JID

(5)

TABLE OF CONTENTS (Cont.)

Page

3.6 V. parahaemolyticus and V. alginolyticus 24

3.6.1 Virulence factors of V. parahaemolyticus

and V. alginolyticus

24

3.6.2 Detection of Vibrio species 26

CHAPTER 4 MATERIALS AND METHODS 30

4.1 Construction of mouse scFv phage display library 30

4.1.1 Preparation of cDNA from spleen cells of mice 30

4.1.2 Preparation of VH and VL flanking with enzyme

restriction site

34

4.1.3 Preparation of plasmin DNA 36

4.1.4 Cloning of amplified VH into phagemid vectors 37

4.1.5 Cloning of amplified VL into pSEX81 carrying VH 40

4.2 Characterization of mouse scFv phage display library 42

4.2.1 Verification of scFv phage clones 42

4.2.2 Determination of mouse scFv phage display library

diversity

43

4.2.3 Identification of complementarity determining regions

(CDRs) of mouse scFv

44

4.3 Searching proteins unique to V. parahaemolyticus

and V. alginolyticus

44

4.3.1 Verification of the unique protein of by PCR

amplification

44

4.3.2 Identification of amino acid sequence unique

to V. parahaemolyticus and V. alginolyticus

45

4.4 Production of recombinant ToxR of V. parahaemolyticus

(rVP-ToxR) and V. alginolyticus (rVA-ToxR)

46

Ref. code: 25605612040039JID

(6)

TABLE OF CONTENTS (Cont.)

Page

4.4.1 Cloning ToxR gene of V. parahaemolyticus

(VP-toxR) and V. alginolyticus (VA-toxR) into cloning

vector

46

4.4.2 Sub-cloning of VP-toxR and VA-toxR into protein

expression vector

49

4.4.3 Expression of the recombinant protein 50

4.4.4 Purification of the recombinant protein 50

4.5 Protein analysis 51

4.5.1 SDS-PAGE 51

4.5.2 Western blot analysis 52

4.5.3 Quantification of protein by Bradford’s assay 52

4.6 Selection of VP and VA specific scFv phage from scFv phage

display library

52

4.6.1 Bio-panning 52

4.6.2 phage rescue 54

4.6.3 Examination of scFv phage binding by ELISA 55

4.7 Production of recombinant scFv antibody 56

4.7.1 Sub-cloning of scFv into pOPE101 expression vector 56

4.7.2 Expression and purification of the recombinant scFv

antibodies

56

4.7.3 Characterization of recombinant scFv antibody 56

CHAPTER 5 RESULTS 58

5.1 construction of mouse scFv phage display library 58

5.1.1 Mouse spleen cell preparation 58

5.1.2 RNA extraction and cDNA synthesis 58

5.1.3 Amplification of VH and VL flanking with restriction

sites

59

Ref. code: 25605612040039JID

(7)

TABLE OF CONTENTS (Cont.)

Page

5.1.4 Molecular cloning of VH-VL (scFv) fragments into

phagemid vector

62

5.1.5 Characterization of scFv phage display library 63

5.2 Searching proteins unique to V. parahaemolyticus

and V. alginolyticus

67

5.2.1 Verification of the unique protein by PCR

amplification

68

5.2.2 Identification of amino acid sequence unique

to V. parahaemolyticus and V. alginolyticus

69

5.3 Production of rVP-ToxR and rVA-ToxR 70

5.3.1 Construction of toxR-encoded rVP-ToxR and rVA-

ToxR

70

5.3.2 Expression and purification of rVP-ToxR and rVA-

ToxR

74

5.4 Selection of VP and VA specific scFv phages from scFv

phage antibody library

77

5.5 Production of recombinant scFv antibodies 79

5.5.1 Expression of recombinant scFv antibodies 79

5.5.2 Characterization of recombinant scFv antibody 81

CHAPTER 6 DISSCUSSION 84

6.1 Production of scFv phage library 84

6.2 Genome comparison for searching target antigen

of V. parahaemolyticus and V. alginolyticus

85

6.3 Selection of scFv phage antibody specific

to V. parahaemolyticus and V. alginolyticus

86

6.4 Binding and specificity of scFv antibody against

V. parahaemolyticus and V. alginolyticus

88

Ref. code: 25605612040039JID

(8)

TABLE OF CONTENTS (Cont.)

Page

CHAPTER 7 CONCLUSIONS 89

REFERENCES 90

APPENDICES 102

APPENDIX A 103

APPENDIX B 108

APPENDIX C 119

BIOGRAPHY 125

Ref. code: 25605612040039JID

(9)

LIST OF TABLES

Tables Page

3.1 Combinatorial antibody diversity in mice 7

3.2 Biochemical characteristics of human pathogenic Vibrionaceae

commonly encountered in seafood

29

5.1 Total spleen cells and cell viability 58

5.2 Result of Chromosome 2 comparison between

V. parahaemolyticus and V. alginolyticus

68

5.3 PCR amplification of VPA1327 gene of V. parahaemolyticus

and other Vibrio species

69

5.4 Summary of the number of positive scFv phage clones

obtained from Bio-panning,

78

Ref. code: 25605612040039JID

(10)

LIST OF FIGURES

Figures Page

3.1 Schematic diagram of structure of immunoglobulin 5

3.2 Schematic diagram of production of monoclonal antibody 10

3.3 Antibody model 12

3.4 Schematic diagram of filamentous phage displaying single

chain variable fragment (scFv) molecules

16

3.5 The concept of hyper phage 19

3.6 Schematic overview of the selection of antibodies (“panning”)

by phage display

22

5.1 Agarose gel electrophoresis of extracted RNA 59

5.2 PCR amplification of GAPDH from the synthesized cDNA 60

5.3 VH and VL fragments of mouse IgG amplified using primer

set 1

61

5.4 Schematic diagram of VH and VL fragments franked with the

recognition sites of restriction endonuclease enzyme

61

5.5 purified VH and VL incorporated with the corresponding

endonuclease restriction sites using primer set 2

62

5.6 Recombinant plasmid DNA, pSEX81::VH 63

5.7 The representative PCR amplicons of scFv amplified from the

pSEX81-scFv transformed XL-1 Blue E. coli

64

5.8 The representative RFLP patterns of scFv antibody phages

library

65

5.9 The deduced amino acid sequencing of representative scFv

phage clone analyzed via the IMGT server

65

5.10 Immunoglobulin frameworks (FRs) and complementarity

determining regions (CDRs) of 5 scFv clones

66

5.11 Multiple alignments of amino acid sequences of

V. parahaemolyticus and V. alginolyticus ToxR protein

71

5.12 Purified VP-toxR and pGEX4T-1 cut with restriction enzymes,

BamH I and Sal I

72

Ref. code: 25605612040039JID

(11)

LIST OF FIGURES (Cont.)

Figures Page

5.13 Purified VA-toxR and pET32a+ cut with restriction enzymes,

BamH I and Hind III

72

5.14 Screening of VP-toxR in transformed BL21 E. coli 73

5.15 Screening of VA-toxR in transformed BL21 (DE3) E. coli 74

5.16 SDS-PAGE and western blot analysis of the expressed

rVP-ToxR-GST fusion protein

75

5.17 SDS-PAGE and Western blot analysis of rVA-ToxR protein

purification profiles

76

5.18 Binding activity of the representative scFv phage clones 78

5.19 Recombinant scFv antibodies probed with anti-c-Myc Tag

monoclonal antibody

80

5.20 Dot-ELISA showing binding of the scFv antibodies to the

rToxR protein of Vibrio spp.

82

5.21 Western blot analysis showed the reaction bands of

V. alginolyticus scFv antibodies reacted to the rToxR

protein of Vibrio spp. Separated by SDS-PAGE

83

Ref. code: 25605612040039JID

(12)

LIST OF ABBREVIATIONS

Symbols/Abbreviations Terms

% Percent

× g Gravitational acceleration οC Degree (s) Celsius

µg Microgram (s)

µl Microliter (s)

µM Micromolar (s)

Ab Antibody (s)

ABTS 2,2’-azino-di (3-ethylbenzthiazoline-6-

sulfonate)

bp Base pair (s)

cDNA Complementary deoxyribonucleic acid

cfu Colony forming units

DNA Deoxyribonucleic acid

DW Distilled water

ELISA Enzyme-linked immunosorbant assay

e.g. Example gratia (for example)

et al. et alli

etc et cetera

i.e. Id est (that is, or in other words)

Ig Immunoglobulin (s)

kDa Kilodalton

mA Milli-Amperes

MAb Monoclonal antibody (-ies)

min Minute (s)

ml Mililiter (s)

mM Millimolar (s)

MOI Multiplicity of infection

mRNA Messenger ribonucleic acid

ng Nanogram (s)

Ref. code: 25605612040039JID

(13)

LIST OF ABBREVIATIONS (Cont.)

Symbols/Abbreviations Terms

nM Nanomolar (s)

NCM Nitrocellulose membrane

OD Optical density

PBS Phosphate buffered saline

PBS-T Phosphate buffered saline with Tween-20

PCR Polymerase chain reaction

RFLP Restriction fragment length polymorphism

rpm Round per minute

scFv Single chain variable fragment

sec Second (s)

SDS-PAGE Sodium dodecyl sulfate-polyacrylamide gel

electrophoresis

UDW Ultrapure distilled water

VH Variable heavy chain

VL Variable light chain

w/v Weight per volume

X–gal 5-bromo-4-chloro-3-indolyl-β-D-

galactopyranoside

Ref. code: 25605612040039JID

1

CHAPTER 1

INTRODUCTION

Vibrio species are Gram-negative bacteria which widely distributes in marine

and estuarine environments. Most of them are foodborne pathogens particularly

V. parahaemolyticus which is the most common cause of food-associated

gastroenteritis, and also implicated in extra-intestinal infections including septicemia

and wound infections.1 V. alginolyticus is another bacteria usually found in the same

environment as V. parahaemolyticus. This bacterium has been involved as a causative

agent of infection in extraintestinal sites of which the most common diseases are

cellulitis, otitis media, otitis externa, and conjunctivitis, and bacteremia in

immunocompromised hosts. It has been reported that most of the infections caused by

V. alginolyticus are a result from exposure to seawater.2 In addition, gastroenteritis

caused by V. alginolyticus also has been reported.3 The transmission of gastroenteritis

is transmitted by consumption of raw, undercooked or mishandled seafood, especially

contaminated shellfish. The standard method used for detection of these two species

in clinical and seafood samples is a conventional culture method which is often

imprecise leading to misidentification. From the previous study, it was shown that

V. parahaemolyticus and V. alginolyticus were mostly detected in seafood and usually

found in the same sample.4 Although they showed a different color on TCBS agar,

atypical colonies of V. parahaemolyticus are difficult to visually differentiate since

they can be covered by yellow color produced by outnumbers of V. alginolyticus.19,20

Since these two species are very closely related, at both genotypic and phenotypic

levels, V. alginolyticus was previously designated as V. parahaemolyticus biotype

2.12,22 This relation may be the cause of variation of the result of biochemical tests

used for species identification leading to inaccurate interpretation. Therefore, the

alternative method which is more accurate and rapid should be developed to replace

the conventional culture method.

There are several alternative methods that have been developed for the detection

and identification of V. parahaemolyticus, and V. alginolyticus. The PCR-based

methods are widely employed to differentiate the Vibrio species in clinical, food and

environmental samples. Species-specific toxR and collagenase genes have been used

Ref. code: 25605612040039JID

2

to identify V. parahaemolyticus and V. alginolyticus, respectively.23,24 Virulence

genes such as tdh, trh, and tlh also have been used for identification of

V. parahaemolyticus.10 However, it has been reported that tdh and tlh could be found

in V. alginolyticus isolates26,27, therefore, it necessary to find another alternative

means or targets to specify these two Vibrio. The immunoassay using monoclonal

antibody-based method is an approach of interesting.

The monoclonal antibodies are advantageous and have been generated a broad

application for therapeutic and diagnostic approaches. Since the molecular structure

of antibody has been extensively studied and the advanced biotechnologies have been

wildly developed. The antibody engineering was introduced to generate antibodies in

vitro in several formats, and a single chain variable fragment (scFv) is one of those

formats. The scFv is a small fragment of antibody molecule but still remains the

antigen binding activity.13 The scFv antibody library can be served as B cell repertoire

in our body generated by phage display technology, and used to produce varieties

specific scFv monoclonal antibodies. In this study, murine scFv antibody phage

library was constructed. The scFv phage displaying monoclonal antibodies (MAb)

specific to V. parahaemolyticus and V. alginolyticus were selected and subsequently

produced the scFv MAbs specific to those Vibrio species.

Ref. code: 25605612040039JID

3

CHAPTER 2

OBJECTIVES

PRIMARY OBJECTIVES

1. To construct mouse antibody library by using phage display technology

2. To produce scFv monoclonal antibodies specific to V. parahaemolyticus and

V. alginolyticus

SPECIFIC OBJECTIVES

1. Construction of phage displayed mouse scFv antibody library

2. Production of recombinant protein, targets of V. parahaemolyticus and

V. alginolyticus specific monoclonal antibodies

3. Selection of scFv display phages that bind to recombinant proteins/peptides of

V. parahaemolyticus and V. alginolyticus by bio-panning

4. Production of scFv monoclonal antibodies specific to V. parahaemolyticus and

V. alginolyticus

5. Specificity testing of the so produced monoclonal antibodies

Ref. code: 25605612040039JID

4

CHAPTER 3

REVIEW OF LITERATURE

3.1 Antibody (Ab)

Antibodies are proteins known as Immunoglobulins (Igs) produced in

vertebrates in response to the invasion of foreign molecules known as antigens.

Antibodies are extremely diverse and specific in their ability to recognize foreign

molecular structures and are the primary mediators of humoral immunity against all

classes of microbes.14 They can recognize non self-molecules or pathogens leading to

destruction/removal of the invader, e.g., binding of antibody inactivates viruses and

microbial toxins (neutralization) by blocking their abilities to bind to receptors on host

cells; marks invading pathogens for destruction (opsonization) mainly by making it

easier for phagocytic cells of the innate immune system to ingest the pathogens.15

Beside naturally produced in the body, specific antibodies to the desired antigens can

be produced in vitro. Examples is specific monoclonal antibodies produced by

hybridoma technique developed by Köhler and Milstein in 1975.16 The monoclonal

antibodies are very useful which have been generated a vast application for

therapeutic and diagnostic approaches.

Since the molecular structure of antibody has been extensively studied and

advanced biotechnologies have been wildly developed, antibody engineering was

introduced to generate antibodies in vitro in several formats. A single chain variable

fragment (scFv) is a very small fragment of antibody molecule but still remains the

antigen binding activity. The scFv antibody library can be generated by phage display

technology. This library can be served as B cell repertoire in our body and can be

used to generate varieties of specific scFv monoclonal antibodies.

3.1.1 Antibody structure

Antibodies or immunoglobulins are members of immunoglobulin

superfamily. All antibodies share the same basic structure of four polypeptide chains,

two identical light (L) chains and two identical heavy (H) chains. Each light chain

consists of about 220 amino acids with molecular weight about 25 kDa. Each heavy

chain consists of either 330 (γ, δ or α chains) or 440 (µ or ε chain) amino acids with

Ref. code: 25605612040039JID

5

molecular mass of approximately 50 kDa or more. These four polypeptide chains are

holding together by combination of disulfide and non-covalent bonds to form a

closely associated heavy and light chains (H-L) heterodimer (Figure 3.1).28,29 Both

heavy and light chains contain a series of repeating, homologous units of 110 amino

acid residues in length containing an intra-chain disulfide bond, that fold

independently into globular motifs called Ig domains.1,28 Therefore, light chain

comprises of two Ig domains, one variable domain (VH) and one constant domain

(CL) whereas heavy chain composes of four to five Ig domains, one variable domain

(VH) and three or four constant domains (CH1, CH2, CH3, and CH4)14 VL and VH

domains of each dimer form the determinant for binding to the antigen. CL domain

pairs with CH1 domain and the remaining constant domains of the heavy chains form

the Fc region, which determines the other biological properties of the antibody.15

Figure 3.1 Schematic diagram of structure of immunoglobulins.14

Ref. code: 25605612040039JID

6

Each VH and VL domain contains the highest level of variability of the

sequence called hypervariable regions known as complementarity determining regions

(CDR). There are three CDRs namely CDR1, CDR2 and CDR3. The CDR3 of both

VH and VL segments are the most variable of the CDR. Between each CDR, it is

flanked with four relatively more conserve sequences known as framework regions

(FR1-FR4). These regions function for maintaining three-dimensional structure of the

V-domains. The three CDRs of each VH and VL chains form loops like fingers

protruding from each variable domain. Three fingers from the heavy chain and three

fingers from the light chain come closing together to form an antigen-binding site.

Sequence differences among the CDRs of different antibody molecules contribute to

distinct interaction surface and therefore to specificities of individual antibodies.14

3.1.2 Antibody repertoire and diversities

Humans are daily exposed to a wide variety of antigens or organisms

which may be cause of diseases. Successful recognition and eradication of many

different types of microbes requires diversity among antibodies. It has been estimated

that humans generate about 109 different antibodies, each capable of binding a distinct

epitope of an antigen.18 The vast diversity of antibody repertoire can be generated by

two steps, before and after antigen stimulation. These two steps involved several

mechanisms including:

(1) Multiple germ-line gene segments and combinatorial V-(D)-J

joining: In germ-line, there are multiple copies of variable (V), diversity (D) and

joining (J) gene segments encoded for immunoglobulin protein called V, D and J

segments, respectively. In human, there are 134 VH, 13 DH, 4 JH, 85 Vκ, 4 Jκ , 2 Vλ,

and 3 Jλ gene segments.17 The diversity of antibody variable domains is initially

generated by randomly rearrange of V, D, and J segments for heavy chains and of V

and J segments for light chains. Therefore, the possible number of combinations

between heavy and light chains is about 2.41 × 106 as calculation shown in Table 3.1.

Ref. code: 25605612040039JID

7

Table 3.1 Combinatorial antibody diversity in mice18

Nature of segment Number of heavy-

chain segments

(estimated)

Number of kappa-

chain segments

(estimated)

Number of lambda-

chain segments

(estimated)

V 134 85 2

D 13 0 0

J 4 4 3

Possible number of

combinations

134 x 13 x 4 = 6,968 85 x 4 = 340 2 x 3 = 6

Possible number of heavy-light chain combinations in the human = 6,968 ×(340+6) = 2.41 × 106

(2) Junction flexibility or junctional diversity: During the joining

of different gene segments, a variable number of nucleotides are often lost from the

end of the recombining gene segments and one or more nucleotides are randomly

inserted. This mechanism extremely increases the diversity of V region, especially in

CDR3.15

(3) P-nucleotide addition: DNA hairpin forming at the coding

joint is asymmetrically cleaved and is subsequently repaired by recombination

activation gene 1 and 2 (RAG1/2) recombinase filling a palindromic sequence or P-

nucleotides.29,31

(4) Excision of nucleotides by exonuclease: Exonuclease

trimming is commonly occurs at the V-D and D-J junctions of a heavy chain, causing

unexpected loss of coding joint nucleotides.

(5) Non-templated (N)-nucleotide addition: At the coding joint

loosing nucleotides, the N-nucleotides are added by terminal deoxynucleotidyl

transferase (TdT) activity. The heavy chain diversity generated by N-nucleotide

addition is quite large because the adding sequences are solely random. Since this

diversity occurs at V-D-J coding joints, it is localized in CDR3 of the heavy-chain

genes.29,31

(6) Combinatorial association of heavy and light chain: In the

same cell, one heavy chain can combine with different light chains and vice versa.

Ref. code: 25605612040039JID

8

(7) Somatic hypermutation: This process occurs in germinal

center after mature B cell exposed to antigens. During cell proliferation responding to

the antigen stimulation, the genes encoding the variable domains of the heavy and

light chains undergo a high rate of point mutation. The somatic hypermutation results

in increasing diversity of the variable domains of antibody chains and also altering the

antigen-binding affinity. Only B cells expressing high affinity for the antigen are

selected for survival. The process of generating antibodies with increased binding

affinities is called affinity maturation.29,31

In theory, by two means of antibody diversity generation i.e.,

combinatorial diversity and junctional diversity of the V-(D)-J gene segments, it is

estimated that at least 1011 diverse sequences could make up the repertoire of

antibodies expressed by naïve B cells. The numbers of diversity could be greater by

several orders of magnitude, depending on variety processes of junctional diversity.

Finally, somatic hypermutation is also creating further antibody diversity and

subsequent affinity maturation. However, in practical, combinatorial diversity is likely

to be less than one might expect from the calculations above. One reason is that not

all V gene segments are used at the same frequency; some are common in antibodies,

while others are rarely found. Also, not every heavy chain can pair with every light

chain: certain combinations of VH and VL regions will not form a stable molecule.

Failure of pairing between heavy and light chains within cells may undergo further

light-chain gene rearrangement until a suitable chain is produced otherwise they will

be eliminated. Nevertheless, it is thought that most heavy and light chains can pair

with each other, and that this type of combinatorial diversity has a major role in

forming an immunoglobulin repertoire with a wide range of specificities.19

3.2 Monoclonal antibody

In 1975, Köhler and Milstein16 developed a hybridoma technique to produce

monoclonal antibody. The production includes several steps as shown in Figure 3.2.

Briefly, mouse is immunized and subsequently boosted with antigen which its specific

antibody is desired and allow the mouse naturally produces antibodies against that

antigen. Then, spleen of the immunized mouse is removed and single spleen cells

Ref. code: 25605612040039JID

9

including B-cells are isolated. The spleen cells are chemically fused to immortal

mouse myeloma (tumor-derived) cells. After fusion, they are cultured in selective

medium containing hypoxanthine, aminopterin and thymidine. The selective medium

promotes the survival and proliferation of only hybrid cells but eliminates non-hybrid

and non-fused cells. The growing hybrid cells are screened for production of antibody

against the antigen used for injection by using an immunoassay. The cells giving

secreting antibodies positive reactions are further cloned and hybridoma clones

producing antigen specific monoclonal antibodies are selected.16 The selected

hybridoma clones can be kept for long time and unlimited production of specific

monoclonal antibodies.

Since their specificities, monoclonal antibodies become extremely versatile

tools in medicine, clinical laboratory and biological research. They have been used as

diagnostic tools to detect the presence of substances/antigens, identify the cells that

contain the desired gene, purify protein, analyze cell subpopulations in peripheral

blood or tissue and etc. The monoclonal antibodies are also used as therapeutic tool in

clinical medicine. For example, they can be applied for delivery of radioisotope,

toxin, cytokine, or other active conjugated form for diagnosis or destroying the target

cancer. Moreover, monoclonal antibodies have been used as an effective treatment for

autoimmune diseases.32,33

Ref. code: 25605612040039JID

10

Figure 3.2 Schematic diagram of production of monoclonal antibody22

Ref. code: 25605612040039JID

11

3.3 Single-chain variable fragment (scFv) antibody

Since 1975, Köhler and Milstein have introduced the hybridoma technique

allowing a defined specific monoclonal antibody be produced in large quantity with

consistent quality. Monoclonal antibodies have been used as tools in a number of

therapeutic applications because they can be easily standardized. However, unwanted

effect called human anti-mouse antibody (HAMA) may arise from the species non-

compatibility.35,36 The recombinant DNA technology and antibody engineering have

been implemented to solve this solution.25 The antibody genes were successfully

cloned and expressed as fragments including Fab fragment26 and Fv fragment25 in

several host such as bacteria, yeast and mammalian cell.37,39 Furthermore, the variable

domains of each heavy chain and light chain were linked together by a peptide linker

to become a single-chain variable fragment (scFv).13

The scFv consists of variable heavy (VH) and variable light (VL) chains linked

together by a flexible peptide linker (Figure 3.3). The length of peptide linker is about

3.5 nm with either orientation of VH-linker-VL or VL-linker-VH.28 In order to avoid

interaction of peptide through the protein folding, the linker must contain hydrophilic

residues. The amino acids which are widely used in the linker sequences are glycine

and serine, facilitating the flexibility and/or together with glutamine and lysine to

enhance the solubility of the scFv.42,43

3.3.1 Diversity of scFv

The diversity of scFv repertoire is due to the antibody B cell repertoire

and the primers used to generate scFv library. The VH and VL repertoires could be

separately reverse transcribed and amplified from immunoglobulin mRNA extracted

from the B cell repertoire. Randomly joining the VH and VL gene repertoires with

DNA encoding amino acid linker sequence also increases the diversity of scFv

repertoire. About 107 to 1011 scFv different binding site can be generated in vitro.31–33

However, the magnitude of diversity is depending on the source of library sequences

(Immune, naïve, semisynthetic and synthetic library).

Ref. code: 25605612040039JID

12

Figure 3.3 Antibody model shows a flexible joining the variable heavy (VH) and

variable light (VL) chains of the antibody to generate the scFv. CDR,

complementarity determining region; CH, constant domain of heavy chain; CL,

constant domain of light chain; FW, framework regions; SS indicate disulfide bond.34

3.3.2 scFv library

The scFv libraries can be divided into 3 categories based on the source

of Igs sequence including

3.3.2.1 Immune library

This library is obtained from the Igs genes of B-cells or spleen B

cells of immunized sufficient with specific antigens, or from hybridoma secreted

specific monoclonal antibody.35 An immune antibody scFv library has two main

characteristics: Firstly, it is enriched in antigen-specific antibodies and secondly,

some of these antibodies have undergone affinity maturation by the immune system.

Immune libraries have been used to produce antibodies against several antigens such

as carcino-embryonic antigen (CEA), T-cell receptor-V and major histocompatibility

complex/peptide complexes.31 The disadvantage of the immune library is that it is not

suitable for generation of scFv antibodies against a large panel of antigens, especially

self-antigens. However, the construction of immune libraries from various species

including mouse39,50,51, human52,53, rabbit40, chicken55,56, and camel43 has been

reported.

Ref. code: 25605612040039JID

13

3.3.2.2 Naïve library or single pot repertoires

Naïve library is derived from primary B cells isolated either from

peripheral blood, spleen, bone marrow or tonsil of non-immunized donors or similar

sources from animal. V-genes are amplified from cDNA of B cells using family-based

oligonucleotides, and then VH and VL chains are randomly combined and a

combinatorial scFv library is cloned into an appropriate expression host. A single

naïve library can be used for generating antibodies specific to wide variety of

antigens, including toxins and self-antigens. The affinity of the antibodies selected

from this single library is relative to the size of the library. The affinity for small size

library containing approximately 3×107 antibody clones and large size library (with

1010 clones) are ranging from 106 – 107 M-1 and 108 – 1010 M-1, respectively.46,48

3.3.2.3 Synthetic library

Synthetic library is built artificially by in vitro assembly of V-

gene segments introducing a synthetic random amino acid sequences and variable

length of CDR3 sequences into the library of VH genes. In synthetic libraries, the

antibody diversity is in silico designed and then synthesized in a controlled fashion.

The majority of synthesizing library is focused on randomizing of the CDR3 region

which is usually most diverse and essential for antigen binding.13 A synthetic library

could be exploited to generate scFvs specific for a range of antigens including self-

intracellular, secreted and cell surface proteins and foreign antigen.24 An advantage of

synthetic diversification is that the composition of the CDRs can be exactly defined

and controlled.33

3.3.3 Advantages of scFv

The scFv antibodies provide several advantages over monoclonal

antibodies. The scFvs are very small size and thus have lower retention times in non-

target tissues, more rapid blood clearance and better tumor penetration that useful for

treatment of cancer, autoimmune, respiratory, and many other diseases. They are also

less immunogenic. Their sequences are possible to be inserted with additional amino

acid residues for subsequent conjugation with other molecules such as His-tag which

significantly simplify antibody purification. Furthermore, the scFv could be produced

easily by bacterial expression system.40,57,58

Ref. code: 25605612040039JID

14

Due to small size of scFv antibodies, they are very useful in medical

application especially in cancer treatment that they are used as delivery vehicles of

agents used for radioimmunoimaging and radioimmunotherapy.13 Antigen detection is

another important application of scFv antibodies. Several detection methods using

scFv have been reported. For example, detection of Fusarium pathogens that uses the

fusion of single-chain variable fragment (scFv) and alkaline phosphatase (AP)46,

diagnosis of Aspergillus contamination in field and stored food/feed commodities by

using chicken scFv-AP fusion47, engineered nano-yeast–scFv to detect cognant

Entamoeba histolytica cyst antigens in a biological matrix derived from humans

stools48, scFv antibody against 3B region of 3ABC poly-protein of foot and mouth

disease (FMD) virus to differentiate FMD infected among the vaccinated population

by ELISA49, scFv antibodies specific to tuberculosis biomarker 85B for tuberculosis

antigen detection50 etc.

3.4 Phage display technology

Phage display was first established by G. Smith in 1985.51 This technique is

very effective for producing large number of diverse peptides and proteins based on

the use of filamentous bacteriophage, a phage infecting Gram negative bacteria, e.g.,

E. coli. A phage display library is obtained by cloning genes encoding millions of

variants of certain ligands into vector fused to filamentous phage coat protein (pIII)

genes. The cloned genes are expressed in bacteria as fusion proteins which are

assembled into progeny phages and displayed on their surface. Therefore, the phage

library contains filamentous phages displaying diverse proteins on their surface. This

technology is also applied to generate antibody phage library presenting Fab or scFv

antibody fragments. Phage particles carrying protein binding to the certain ligands can

be selected by bio-panning. The bound phages are eluted from their immobilized

ligand and used to infect bacteria for amplification. The amplified phages can be used

for next round of panning or analysis in further step.35

Ref. code: 25605612040039JID

15

3.4.1 Filamentous phage

Filamentous bacteriophages are flexible rod which has a single-stranded

DNA genome enclosed in a long cylinder approximately 7 nm wide by 900-2,000 nm

in length. The entire genome of the phage consists of 11 genes. A viable phage

expresses about 2,700 copies of gene 8 protein (g8p or pVIII), which is major capsid

protein composed of 50 amino acid residues that helically arrange as a tube. At one tip

of phage particle, there are 3 to 5 copies of the minor coat protein gene III (g3p or

pIII), a 406 amino acid protein that is the one of three minor proteins.31,35 The best

characterized of these phages are M13, f1, and fd. These three phages are sharing

some properties; they have 98% sequence homology, they can infect E. coli

containing F conjugative plasmid, so they are collectively referred to as the Ff

phage.52 The schematic diagram of a filamentous phage displayed scFv antibody is

shown in Figure 3.4.

For the life cycle of the filamentous phage, it does not produce a lytic

infection. The infection is initiated by the specific interaction between pIII proteins on

tip of phage with the tip of F pilus of E. coli. The capsid protein of phage integrated

into the bacterium membrane and only the circular phage single-stranded DNA enters

the cytoplasm of bacterium. The phage is converted by the host DNA replication

machinery into the double-stranded plasmid like replicative form (RF). The RF

undergoes replication to make progeny RFs and also serves as a template for

expression of the phage proteins gIII and gVIII. Phage progeny are assembled by

packaging of single-stranded DNA into protein coats and extruded through the

bacterial membrane into the medium without killing a host cell.31,35

Ref. code: 25605612040039JID

16

Figure 3.4 Schematic diagram of a filamentous phage displaying single chain

variable fragment (scFv) molecules.31

3.4.2 Filamentous phages used for phage display

There are two groups of phages used for phage display: phagemid and

helper phage.53 Phagemids are used to construct recombinant displayed protein but

they cannot produce phage particles. Helper phages are essential for phagemid

systems as they supply all other proteins required to produce phage progenies.

3.4.2.1 Phagemids

Phagemids are Ff-phage-derived vectors that are hybrid of phage

and plasmid vectors. They are designed to contain the origin of replication for M13

phage and E. coli, gene III, appropriate multiple cloning sites and an antibiotic-

resistance gene used as a selectable marker. However, phagemids lack all other

structural and nonstructural gene products required for generating complete phage

particles. Moreover, phagemid vectors also allowed to add other fragments for

specific purposes such as molecular tags, selective markers and signal peptide

sequence for facilitating the subsequent processes, i.e., gene manipulation, protein

purification and secretion of the fusion protein into the periplasmic space.54 To date,

Ref. code: 25605612040039JID

17

many phagemids have been developed for carry scFv antibody-pIII fusion protein in

phage display technique such as pCOMB338, pHEN155, pHAL156 and etc. Phagemid

pSEX81 from PROGEN Biotechnik (Germany) is one type of phagemid vector

designed for insertion of the recombinant scFv antibody-pIII fusion protein libraries

on the surface of M13 filamentous phage.57 The amplified gene fragments encoding

the VH or VL chain domain are cloned in-frame between a signal peptide sequence of

bacterial pectate lyase (pelB) for the secretion of the fusion protein into the

periplasmic space, and the pIII gene of M13 bacteriophage. The vector backbone

further provides a strong promoter (IPTG inducible), the T7 terminator, the ColE1

origin of replication, the intergenic region of phage F1 and an ampicillin resistance

marker for selection. In addition to other phagemid, pSEX81 provided a DNA-

fragment coding for a flexible 18 amino acid residue linker containing the first six

amino acids of the CH1 constant region domain and the hydrophilic pig brain alpha-

tubulin peptide sequence EEGEFSEAR. By this linker the VH and VL genes can be

subsequently inserted into phagemid and joined together without additional joining

step. In pSEX81, the recognition sites of the restriction endonucleases Nco I and

Hind III allow the insertion of a VH gene fragment. And the sites of the restriction

endonucleases Mlu I and Not I for insertion of a VL gene fragment.57 The structure of

pSEX81 phagemid showing the insertion regions for VH and VL fragments is shown

in Appendix C

3.4.2.2 Helper phages Helper phages are normal Ff phages with a number of

modifications, they contain genes of phage proteins missing in a phagemid including

the structural gene provide for assembly of phage particle, each helper phage also

contains an origin of replication but it is imperfect, and they usually carry antibiotic

resistance genes.53 The helper phages are necessary for “phage rescue” process that

they provide all phage proteins used for phages assembly. The resulting phage

particles may incorporate either wild type pIII protein (g3p) derived from the helper

phages or the polypeptide-pIII fusion protein, encoded by the phagemid.31 Thus, there

are two copies of gene III which encode the phage coat protein pIII. Since wild type

pIII protein (g3p) is favored during assembly of the phage particle, resulting in very

less phage population carrying polypeptide-pIII fusion protein.58 To overcome this

Ref. code: 25605612040039JID

18

problem Rondot and coworker59 had constructed a hyperphage, filamentous phage

mutants with deleted pIII, for use as helper phage in phagemid-base system.

Hyperphage (M13KO7∆pIII) was constructed by deleting the pIII ORF from codon 8-

406, leaving the promoter and signal peptide DNA intact. This phage cannot be

amplified conventionally because they lack pIII, which is required for infection. To

supply pIII during the packaging of M13KO7∆pIII, a pIII supplementing plasmid was

reported. However, were impeded by packaging of the pIII supplementing plasmid

into helper phage particles, while the plasmid lacks signals for the phage assembly

machinery. These wrongly packaged plasmids then contaminate the phage with

significant amounts of wild type pIII genes and protein, and rick decreasing the

quality of the phage antibodies.58 To produce hyperphage without a supporting of

plasmid can be contaminated with wide type pIII in hyperphage product, the

researcher had constructed an E. coli packaging cell line (DH5α/pIII) that supplies

pIII for the phage assembly from a copy of gene III integrated into the bacterial

genome under the control of the promoter P/A1/04/03 taken from pSEX40. By using

hyperphage in step of phage rescue, the source of pIII will come from phagemid

carrying gene encoding polypeptide only. These results in both a dramatic increase of

the fraction of phages carrying polypeptides and the number of polypeptides

displayed per phage.59 The concept of hyperphage is shown in Figure 3.5.

Ref. code: 25605612040039JID

19

Figure 3.5 The concept of hyperphage: a gene pIII-deleted helper phage with wild

type infection phenotype.58

Ref. code: 25605612040039JID

20

3.5 Generation of scFv phage display library

The scFv library can be generated by using phage display technique developed

by G. Smith in 1985.51 Phage display technique allow foreign DNA fragments can be

fused to the gene encoded for pIII coat protein of a nonlytic filamentous phage and

expressed as a fusion protein on the virion surface without disturbing the infectivity of

the phage. In 1990, McCafferty and coworker60 had successfully demonstrated that a

scFv fragment can be displayed on the phage surfaces as a functional protein which

retains an active antigen-binding domain capability.13

3.5.1 Construction of scFv library

To construct scFv library using phage display technology described by

Hust and Dübel32 involves two-step cloning strategy. Total RNA isolated from B-

lymphocytes is reverse transcribed into cDNA. Genes of VH and VL of antibody

molecules are amplified by using a set of antibody gene oligonucleotide primers. The

amplified VH and VL are then flanked with restriction endonucleases for cloning into

phagemid. The scFv cloning procedure is divided into two steps, VL cloning first and

followed by VH cloning or vice versa. After cloning, phagemids carrying scFv are

transformed into E. coli host. At this step phages are rescued by infection of E. coli

with helper phages or hyperphages to yield recombinant phages displaying scFv

antibody fused to the pIII phage coat protein.

The quality of the phage library is important for its performance that can

be attained by determining the following parameters: (i) number of clones of the scFv

inserted phagemids, (ii) number of clones expressing phages carrying scFv, and (iii)

number of clones expressing soluble scFv. These parameters can be evaluated by

several methods including PCR for screening of individual clones possessing the

inserted scFv, and dot blot analysis for detection of both phages displaying scFv and

soluble scFv produced by the screened clones. The scFv antibody positive clones can

be further characterized by Restriction fragment length polymorphism (RFLP), PCR

amplification of inserted scFv followed by restriction enzyme digestion and DNA

sequencing.31

Ref. code: 25605612040039JID

21

3.5.2 Bio-panning

Bio-panning is a technique used for screening and enrichment of phage

clone displaying antigen-specific scFv antibody from phage library. The antigen of

interest is immobilized on a solid surface such as polystyrene dishes, impermeable

plastic beads, nitrocellulose membranes, paramagnetic beads, and permeable bead

agarose gels.61 The phages of scFv phage library are incubated with the immobilized

antigen under the control of physical, chemical, and biological parameter.62 Antibody

phages that able to bind with antigen under defined conditions are selected. The

phages that bound weakly to antigen and unbound phages are removed by washing

step. The phages displaying scFv that specifically bind are eluted by changing the

binding condition. The phages are amplified by infection of E. coli and subsequently

infected with helper phage for producing new phages that can be used in next panning

round. Usually, 2-4 rounds of panning selection are required to select specifically

binding antibody fragments.44,75 The selection cycle is illustrated in Figure 3.6. There

are several strategies of bio-panning31 including;

3.5.2.1 Bio-panning using immobilized antigens

Bio-panning using immobilized antigens can be performed on an

affinity column, immunotubes, ELISA plate63,64, or on chip of BIAcore (Label-free

surface plasmon resonance (SPR) based technology)65. It should be note that this

selection method has to consider about the conformational integrity of the

immobilized antigen. scFv phage specific to immobilized antigen can be eluted with

acidic solutions such as HCl or glycine buffer79,80, with basic solutions such as

trimethylamine56, by protease cleaving a site constructed between the antibody and

g3p67, or by competition with excess antigen.37

3.5.2.2 Bio-panning using antigens in solution

The labeled soluble antigens are used to solve the problem about

conformational changes happening when coating antigens on solid surfaces. The

antigen can be labeled with a ligand such as biotin. After incubation of antibody

phages with biotinylated antigen, phages bound to the labeled antigen are recovered

using avidin or streptavidin-coated paramagnetic beads. One disadvantages of this

technique is that anti-streptavidin antibodies will also be isolated. However, this

problem can be resolved by a depletion step using streptavidin-coated beads.31

Ref. code: 25605612040039JID

22

Figure 3.6 Schematic overview of the selection of antibodies (“panning“) by phage

display.62

3.5.2.3 Bio-panning using antigens on cells

The scFv phage antibodies against marker on cell surfaces can be

isolated from library by using monolayers of adherent cells, on cells in suspension, or

on tissue sections as well as whole tissues. Subtractive selection (see Section 3.5.3.4)

can be used to enhance the isolation of antigen specific binder. The target cells

binding to specific scFv phage antibodies can be isolated by using Fluorescence-

activated cell sorting (FACS).68

3.5.2.4 In vivo selection

The scFv phage repertoires are directly injected into animals and

then tissues are collected and examined for phage bound to tissue-specific cell

Ref. code: 25605612040039JID

23

markers. Pasqualini and Ruoslahti were the first to isolate phage-displayed peptides

that specific to organ-selective address molecules on endothelial surfaces by using in

vivo selection.69 This type of bio-panning may be useful for the functional analysis of

new receptors and identification of novel drug target candidates.

3.5.3 Selection and screening of scFv

After several rounds of bio-panning, the outcome of the panning is a

mixture of scFv phages which have different binding properties. These scFv phages

need to be individually screened. The screening assays should be fast, robust,

amenable to automation (e.g., 96-well format or 384-well format), and use unpurified

scFv phage or soluble scFv fragments equipped with tags for detection and

purification.70 Normally for the first screening of scFv phage antibody, ELISA-base

assays and restriction fingerprints of the scFv-DNA are used to identify different scFv

clones. In addition, specificity of scFv antibodies can be tested by using

immunoprecipitation or immunocyto- or histochemistry.35

3.5.3.1 Screening for affinity of binding

After selection of scFv phage bound to specific antigen, the

affinity of individual scFv phage has to be determined. ELISA-base methods and

BIAcore have been described for affinity screening.86,87

3.5.3.2 Screening for function

Selections can be performed under conditions that mediate the

selection of phage antibodies with a special characteristic, for example, under

reducing conditions to retrieve antibodies with disulfide free yet stable73, or selection

for well-folded molecules in the presence of proteases condition.74 Antibodies are also

selected with or for a particular functional activity such as for receptor crosslinking,

signaling, gene transfer or catalysis and neutralizing activity.

3.5.3.3 Selection based on phage infectivity

The idea of this selection is that only phage antibodies that bind

to the antigen would provide the phage with the necessary elements (e.g., a functional

minor coat protein) to restore infectivity of the phage particle.75

3.5.3.4 Subtractive selection

Subtractive selection can be used for selection of novel antigen or

marker on tumor cell with subtraction on normal cells. Phage antibodies recognizing

Ref. code: 25605612040039JID

24

common epitopes are first removed by a subtractive selection on the comparable

normal cells and subsequently remaining phages are selected on epitopes that are

specifically present in the cell of interest. A major advantage of subtractive phage

display technology is the simultaneous generation of recombinant monoclonal

antibodies recognizing potential disease markers. Such antigen-antibody pairs could

be directly applicable in therapeutics or diagnostics.76

3.6 V. parahaemolyticus and V. alginolyticus

The genus Vibrio represents a group of Gram-negative bacteria, which widely

distributes in marine and estuarine environments. Some of these bacteria are

pathogenic to human and marine animals. It has been reported that the Vibrio spp.

detected in seafood mostly are V. parahaemolyticus and V. alginolyticus.4

V. parahaemolyticus is a major food-borne pathogen. Consumption of raw,

undercooked or mishandled seafood and marine products that contaminated with

V. parahaemolyticus can cause acute gastroenteritis, of which the symptoms include

diarrhea with abdominal cramps, nausea, vomiting, headache, chills and low-grade

fever. V. parahaemolyticus also causes two additional major clinical pathologies

wound infections and septicemia.90,91

V. alginolyticus is an important opportunistic bacterial pathogen. Of most

reports, V. alginolyticus tends to cause superficial wound and ear infections (otitis

media and otitis externa). It had been report that V. alginolyticus wound infections are

result from exposure of cuts or abrasions to contaminated seawater.11,94

V. alginolyticus infection also can cause severe mortality in finfish, shrimp and

shellfish.80

3.6.1 Virulence factors of V. parahaemolyticus and V. alginolyticus

In V. parahaemolyticus pathogenic strains, toxins and Type Three

Secretion system (T3SS) have been report to be a virulence factors.81 The known

toxin genes of V. parahaemolyticus are thermostable direct hemolysin (tdh) and its

homolog TDH related hemolysin (trh). Both code for proteins that aggregate and

insert into cell membrane resulting in nonspecific efflux of divalent cations and influx

Ref. code: 25605612040039JID

25

of water. These also result in lysis of erythrocytes, as demonstrated by beta-hemolysis

or the Kanakawa phenomenon (KP) on saline blood agar.

The TTSS is a well-conserved apparatus used by gram negative bacteria

to secrete and translocate virulence factor proteins into the cytosol of eukaryotic cells.

Genes encoding TTSS components are generally clustered in pathogenicity islands or

on virulence plasmids. There are two sets of TTSS present in V. parahaemolyticus,

TTSS1 and TTSS2.82

TTSS1 is located on chromosome 1 of the bacteria and present in all

V. parahaemolyticus strains. The regulation of T3SS1 is just now being elucidated,

the characterization of three T3SS1 effectors, VopQ, VopS and VPA0450, support an

infection model that involves the induction of autophagy, followed by membrane

blebbing, cell rounding, and then cell lysis. Rapid induction of autophagy by VopQ

causes the target cell to digest itself and prevents phagocytosis of the infecting

bacteria. Detachment of the plasma membrane from the actin cytoskeleton by

VPA0450 destabilizes the cell. The collapse of the actin cytoskeleton by VopS leads

to cell rounding and shrinkage. Finally, cells lyse and release their contents.81

TTSS2, which located on chromosome 2, was present only in KP

positive strains.97,98 Park and coworkers (2004)84 reported decreased cytotoxic activity

of mutant strains having a deletion in one of the TTSS genes and decreased intestinal

fluid accumulation was found in an enterotoxicity assay. There are also two different

T3SS2 variants. Okada et al. (2009)85 and Noriea et al. (2010)86 reported a correlation

among T3SS2α, tdh, and enterotoxicity while T3SS2β was correlated with trh. Klein

and colleagues (2014)11 found no correlation between T3SS2α and tdh.87 Seven

T3SS2 have been identified and functionally characterized.88 VopA/P was first

identified as an effector that is secreted specifically via T3SS2.84 VopA/P belongs to

the family of YopJ-like proteins. VopA/P inhibits MAPK signaling pathways by

acetylating the catalytic loop of MAPKs but not the NF-κB signaling pathway.

Secondly, VopZ, which was identified as a T3SS2 effector using a proteomic

approach, inhibits the activation of both the MAPK and the NF-κB signaling

pathways by preventing the activation of TAK1.89 Next, VopZ is necessary for

intestinal colonization, the induction of diarrhoea and intestinal pathology. VopT or

VPA1327 has a functional domain that is similar to the ADP-ribosyltransferase

Ref. code: 25605612040039JID

26

(ADPRT) domain of the Pseudomonas aeruginosa T3SS effectors, ExoS and ExoT.

The ADPRT activity of VopT is needed for T3SS2-dependent cytotoxicity and for

yeast growth inhibition activity, which is a non-mammalian model system that is used

to evaluate the biological activity of virulence factors.90 VPA1380 is a newly

identified and characterized effector that shares high similarity with the inositol

hexaphosphate (IP6)-activated cysteine protease domain of multifunctional

autoprocessing RTX from V. cholerae and clostridial glucosylating toxins, so

suggesting that VPA1380 has an IP6-activated cysteine protease activity.91 The last

three of seven T3SS2 effectors, i.e. VopC, VopL and VopV, target the actin

cytoskeleton directly or indirectly. Tissue culture analyses have shown that T3SS2 in

V. parahaemolyticus causes three dramatic changes in the actin cytoskeleton, i.e. the

accumulation of F-actin beneath bacterial microcolonies, the induction of actin stress

fibres and membrane ruffle formation at the site of bacterial entry.88

For V. alginolyticus, several virulence factors, including an alkaline

serine protease, hemolysins, siderophores, and type III secretion system, have been

described.92 Recently, a putative T3SS island was identified in V. alginolyticus strain

ZJO and this island was similar in synteny and predicted protein composition to

T3SS1 characterized in V. parahaemolyticus. Further studies revealed that the T3SS

effectors Val1686 and Val1680 of V. alginolyticus were responsible for in vitro death

of fish epithelial cell by mediate apoptosis, cell rounding and osmotic lysis.93

Comparative genome analysis of the T3SS gene cluster from V. alginolyticus

suggested that Val1686 and Val1680 are orthologues of VopS and VopQ in

V. parahaemolyticus respectively.94

3.6.2 Detection of Vibrio species

The standard method used for detection of V. parahaemolyticus and

V. alginolyticus in seafood and clinical samples is conventional culture method using

thiosulfate citrate bile and sucrose (TCBS) agar plate and others biochemical tests.

The characteristics and tests used for identification of Vibrio species are shown in

Table 3.2.95–97 However, this method is labor intensive and time consuming (5-6

days). In particular, V. alginolyticus could not be distinguished from other Vibrio spp.

in the environment and seafood samples by commercially available kits because it is a

Ref. code: 25605612040039JID

27

close relative of V. parahaemolyticus, and atypical isolates of these two species are

difficult to differentiate.6

Several methods have been reported to characterize different Vibrio

species especially V. parahaemolyticus and V. alginolyticus. They are:

(1) PCR : Amplification of the R72H sequence and the gyrB gene

was used to differentiate V. parahaemolyticus from V. alginolyticus.7,98,99 However, it

has been reported that the amplicon used to identify V. parahaemolyticus was also

present in V. alginolyticus strains.9 The toxR gene was initially described as the

regulatory gene of the cholera toxin operon and of other virulence determinants of

V. cholerae. This gene was subsequently found in V. parahaemolyticus.100 Two toxR

gene-targeted PCR protocols were established for the specific detection of

V. parahaemolyticus, but non-specific amplicons were generated by some strains of

V. vulnificus and V. alginolyticus.7 Yin and coworkers (2018) was developed a novel

multiple touchdown polymerase chain reaction method (MT-PCR). This method used

for detection of the presence of V. vulnificus, V. alginolyticus, and V. parahaemolyticus

from the enriched clinical and environmental samples by using target genes including

vhhA for V. vulnificus, collagenase for V. parahaemolyticus and toxR for V. alginolyticus.

The method showed a sensitivity of 104 cfu/ml for V. vulnificus, 103 cfu/ml for

V. parahaemolyticus and V. alginolyticus, and a specificity of 100% for all the three

Vibrio species.101

(2) Real-time PCR: TaqMan® Fluorescent Probes102, SYBR

Green-based103,104 and also multiplex real-time PCR105 were used for detection of

V. parahaemolyticus and V. alginolyticus by using several target gene such as rpoX,

tlh, and ORF8.

(3) Loop-mediated isothermal amplification assay (LAMP): A

LAMP assay allows one-step detection of gene amplification by simple turbidity

analysis and requires only a simple incubator, such as a heat block or a water bath

providing a constant temperature.106 The tdh, trh1, trh2 and toxR genes were used for

detection of V. parahaemolyticus107 and gryB gene was used as a target for detection

of V. alginolyticus.108

(4) Monoclonal antibody: Monoclonal antibody109 and scFv

antibody77 specific to thermolabile hemolysin (TLH) were reported for detection

Ref. code: 25605612040039JID

28

V. parahaemolyticus by ELISA platform. However, the monoclonal antibodies have

some cross reaction with other species such as V. mimicus, Plesiomonas shigelloides,

Shigella sonnei, V. cholerae and V. vulnificus109. The scFv antibody specific to

VP1694, needle protein of T3SS system of V. parahaemolyticus, was successfully

isolated from a phage scFv library named scFv-FA7. ELISA analysis showed that the

scFv-FA7 was specific to VP1694 antigen, and its affinity constant was 1.07 × 108

L/mol. These results offer a molecular basis to prevent and cure diseases by scFv, and

also provide a new strategy for further research on virulence mechanism of T3SS in

V. parahaemolyticus by scFv.110

Ref. code: 25605612040039JID

29

Table 3.2 Biochemical characteristics of human pathogenic Vibrionaceae commonly encountered in seafood95–97

TCBS

aga

r

Oxi

dase

AD

H

OD

C

MIL TSI Growth in NaCl

Prod

uctio

n of

gas

in g

luco

se

Lact

ose

Sucr

ose

ON

PG

Vog

es-

Pros

kaue

r te

st

Mot

ile

Indo

le

LDC

Slan

t

(L+S

) Bu

tt (G

)

H2S

Gas

0%

3%

6%

8%

10%

V. alginolyticus Y + - v + + + A A - - - + + + + - - (+) - +

V. carchariae Y + - + - + + A A - - - + + + - - ND + - -

V. cholerae Y + - + + + + K(A) A - - + + - - - - - + + +

V. cincinatiensis Y + - - + - (+) A A - - - + + + v - - + + d

V. damsela G (+) + - v - v K A - - - + + v - d - (-) - +

V. fluvialis Y + + - + (+) - A A - - v + + (+) (+) - - + (+) -

V. furnissii Y + + - + (-) - A A - + d + + + + + - + + -

V. hollisae Y + - - - + - K A - - - + + + (-) - ND - - -

V. metschnikovii Y - d - ND (-) v ND ND ND ND d + (+) (+) (-) - v + (+) (+)

V. mimicus G + d + + + + K A - - + + d - - - - - + (-)

V. parahaemolyticus G + - + + + + K A - - - + + + - - - - - -

V. vulnificus G + - + + + + K A - - - + d - - - v (-) + -

A. hydrophilia Y + + - ND ND v ND ND ND ND + + + - - ND v v + +

P. shigelloides G + + + ND (+) + ND ND ND ND + + - - - (-) - - d -

ND, No data; d, discrepancies; +, positive for ≥ 90%; (+), positive for 75-89%; -, negative for ≤ 10%; (-), negative for 25-11%; v, variable for 26-74%. Percentages indicate positive

results

Ref. code: 25605612040039JID

30

CHAPTER 4

MATERIALS AND METHODS

4.1 Construction of mouse scFv phage display library

4.1.1 Preparation of cDNA from spleen cells of mice

4.1.1.1 Animals

Each of ICR, BALB/c, and C57BL/6 mice were purchased from the

National Laboratory Animal Center, Mahidol University, Salaya Campus, Nakon-Pathom,

Thailand. The use of these mice was approved by the Ethical committee of Thammasat

University, Rangsit Center, Pathumthani, Thailand. The mice were housed and cared

according to the Standard Operating Procedure (SOP) of the Laboratory Animal Center,

Thammasat University (LACTU).

4.1.1.2 Mouse spleen cells preparation

The mice were euthanized by cervical dislocation and their spleens

were aseptically removed, transferred to a Petri dish containing sterile 10 mM PBS, pH

7.4 (Appendix B). The spleens were washed and individually perfused by injecting with

10 ml of sterile 10 mM PBS, pH 7.4 by using 10 ml syringe with a 26-gauge needle. The

cell suspension from each mouse was collected into 15 ml centrifuge tube. Ten microliters

of cell suspension was provided for cell viability counting using hemocytometer, and

another 2.4 ml was provided for RNA extraction. The rest of cell suspension was

centrifuged at 800 × g at room temperature for 10 min. After the supernatant was

discarded, one ml of RNAlater® (Ambion, Life Technologies, USA) was added into the

cell pellets and kept at -20°C.

4.1.1.3 Cell viability

Viable cells were enumerated by using trypan blue dye exclusion

assay. Ten µl of cell suspension was mixed with 90 µl of 0.2% trypan blue and filled into

the hemocytometer chambers. The cells were viewed under a microscope at 400X

magnification. The live cells appeared colorless while the dead cells stained blue. The

dead cells were counted against the total number (live cells + dead cells). The percent of

cell viability and total viable cells were calculated by using the following formula.

Ref. code: 25605612040039JID

31

Percent cell viability =

Viable Cells/ml = Average number of viable cells per square × 105

4.1.1.4 RNA extraction

Each aliquot of cell suspension prepared in Section 4.1.1.2 was

centrifuged at 8,000 × g for 5 min. The cell pellets were extracted for RNA by using

RNeasy Mini Kit (QIAGEN, Germany). Briefly, 600 µl of RLT lysis buffer was added

into each tube and homogenized the lysate by gently pipetting up and down three to four

times. Then 600 µl of 70% ethanol was added and mixed well by pipetting. The mixture

was transferred into an RNeasy spin column and centrifuged at 8,000 × g, for 15 sec and

discarded a flow-through. This step was repeated once. The spin column was washed three

times by first adding 700 µl of buffer RW1 (washing buffer 1) then centrifuged at

8,000 × g for 15 sec and washed 2 times of 500 µl of buffer RPE (washing buffer 2),

centrifuged at 8,000 × g for 15 sec and 2 min for the second and last washing,

respectively. The RNA was eluted by adding 30 µl of RNase-free water directly onto the

column membrane. The eluate was collected into the new 1.5 ml centrifuge tube by

centrifuge the column at 8,000 × g for 1 min. The elution step was repeated once and the

eluate was separately collect. Kept RNA from two elutions in a separate tube. The RNA

concentration was determined by using spectrophotometer (NanoDropTM 2000, Thermo

Scientific, USA) at A260nm and A280nm. The quality of RNA was verified by agarose gel

electrophoresis. The RNA preparation contaminated with genomic DNA, the genomic

DNA was removed by treated with RNase-free DNase I (Thermo Scientific, USA). The

reaction mixture was prepared as follow:

Ingredients Volume (µl)

DEPC-treated water

10X reaction buffer with MgCl2

DNase I, RNase free (1U/µl)

RNA (1.5 µg/reaction)

12-X

1.5

1.5

X

Total 15

No. of total cells (No. of total cells – No. of dead cells) × 100

Ref. code: 25605612040039JID

32

4.1.1.5 Agarose gel electrophoresis for RNA

The buffer tank and gel casting apparatus were treated with 0.1 M

NaOH for 30 min before use. To prepare 1% (w/v) agarose gel, the agarose powder

(Axygen, Fisher Scientific, USA) was dissolved in 1X TAE buffer (Appendix B). The

melted agarose was allowed to cool to approximately 60°C before pouring into a gel

casting apparatus (Wide Mini-Sub Cell GT, BIO-RAD, USA). Place the gel into the

electrophoresis chamber and poured 1X TAE buffer to cover the surface of the gel. The

10 µl of RNA was mixed with 2 µl of RNA loading dye and then slowly load the sample

mixture into the slots of the submerged gel. GeneRulerTM 1 kb DNA ladder (Fermentas,

Thermo Scientific, USA) was using as a marker. The gel was run by applying electricity at

100 Volts for 75 min. The gel was stained with ethidium bromide and visualized by using

ultraviolet (UV) transilluminator (GENE FLASH, Syngene, UK).

4.1.1.6 First-strand cDNA synthesis

The RNA was reverse transcribed to cDNA by using AccuPower®

RT PreMix (Bioneer, South Korea). For 20 µl reaction, one µg of RNA template was

mixed with 1 µl of 100 µM Oligo dT18 primer in a sterile tube. A mixture was incubated at

70°C for 5 min and placed it on ice. The mixture was transferred into an AccuPower® RT

PreMix tube and filled up to 20 µl with DEPC-treated water (Appendix B). The

lyophilized blue pellet (lyophilized mix of M-MLV Reverse Transcriptase, RNase

inhibitor, dNTPs, reaction buffer, tracking dye, and patented stabilizer) provided in the

tube was dissolved by vortex and briefly spin down. The cDNA synthesis reaction was

performed at 42°C for 60 min and followed by RTase inactivation at 94°C for 5 min.

Quality of cDNA was determined by PCR amplification of GAPDH gene (Section 4.1.7).

The concentration of cDNA was determined by measuring OD260 and OD280 using a

spectrophotometer (NanoDropTM 2000, Thermo Scientific, USA). The approximately

equal amount of cDNA from the three mice was pooled together. The pooled cDNA was

used as a template for PCR amplification of mouse VH and VL fragments. The remaining

cDNA was kept at -20°C.

4.1.1.7 PCR Amplification of GAPDH

To determine the quality of cDNA, PCR amplification of GAPDH

was performed by using cDNA prepared in Section 4.1.1.6 as a template, forward primer;

5′-CAAGGTCATCCATGACAACTTTG-3′, and reverse primer; 5′-GTCCACCACCCT

Ref. code: 25605612040039JID

33

GTTGCTGTAG-3′. The size of GAPDH amplicon was 496 base pairs (bp). For 25 µl

PCR reaction, the mixture of the following was prepared:

Ingredients Volume (µl)

Sterile ultrapure deionized water (UDW)

Reaction buffer + KCl (10X)

MgCl2 (25 mM)

dNTP mix (10 mM, each)

Forward primer (10 µM)

Reverse primer (10 µM)

Taq DNA polymerase enzyme (Bioneer, South Korea)

cDNA (diluted 1:100)

18.75

2.5

1.5

0.25

0.4

0.4

0.1

1.0

Total 25.0

The thermal cycler program was set as the following:

1. Initial denaturation

2. Thirty cycles of :

Denaturation

Annealing

Extension

3. Final extension

at 94°C for 3 min

at 94°C for 30 sec

at 58°C for 30 sec

at 72°C for 45 sec

at 72°C for 5 min

4.1.1.8 Agarose gel electrophoresis for DNA

The 1% (w/v) agarose gel was prepared as described in Section

4.1.1.5 but using 0.5X TBE buffer instead of TAE buffer. The DNA sample was mixed

with 10X loading dye (Appendix B) and then slowly load the sample mixture into the

slots of the submerged gel. The GeneRulerTM 100 bp plus DNA ladder (Fermentas,

Thermo Scientific, USA) was used as a marker for estimating the sizes of the DNA

product. The DNA was run in 0.5X TBE electrode buffer by applying electricity at 100

volts for 75 min. The gel was stained with ethidium bromide and visualized by UV-

transilluminator (GENE FLASH, Syngene, UK).

Ref. code: 25605612040039JID

34

4.1.2 Preparation of VH and VL flanking with enzyme restriction site

The gene fragments encoding variable regions of mouse immunoglobulin

heavy chain (VH) and light chain (VL) were amplified using the pooled cDNA prepared in

Section 4.1.1.6 as a template. The primer set of mouse IgG library purchased from

PROGEN (PROGEN Biotechnik, Germany). The list of the primer set was shown in

Appendix C. This mouse IgG library primer set allows the amplification of rearranged

mouse immunoglobulin genes of B cell repertoire for the construction of mouse scFv

antibody libraries.

4.1.2.1 Amplification of VH and VL

The PCR reaction mixture for VH amplification was prepared as

follows:

Ingredients Volume (µl)

UDW

Reaction buffer (10X)

dNTP mix (2.5 mM, each)

*Forward primer: 1A-1L (10 pmol/µl)

Reverse primer: 1M (10 pmol/µl)

ProFi Taq DNA polymerase enzyme

(Bioneer, South Korea)

cDNA (25 ng/µl)

14.8

2.5

3.0

1.25

1.25

0.2

2.0

Total 25.0

* There are 11 primers for 11 reactions. The duplicate reactions were done for a pair of the forward and reverse primer.

The ingredient for VL amplification was the same as for the

amplification of VH except using different primers. There are 11 primers for 11 reactions,

the forward primers 1N-1W and 1Y as well as the reverse primers 1X and 1Z (Appendix

C). Reverse 1X corresponded to individual forward 1N-1W whereas reverse 1Z paired

with the forward 1Y. The duplicate reactions were done for a pair of the forward and

reverse primers.

Ref. code: 25605612040039JID

35

The thermal cycles were set up as follows:

1. Initial denaturation

2. Thirty cycles of :

Denaturation

Annealing

Extension

3. Final extension

at 94°C for 1 min

at 94°C for 1 min

at 55°C for 1 min

at 72°C for 2 min

at 72°C for 10 min

The PCR amplicons of the duplicate reactions were pooled together

and run through 1.5% agarose gel electrophoresis. The expected bands with the size of

approximately 380-400 bp were observed by UV-transilluminator.

4.1.2.2 Agarose gel extraction

The DNA fragments with the expected size (380-400 bp) were

excised, placed individual fragment into a new microcentrifuge tube and determined the

weight of the gel slice. The DNA was extracted from the gel using AccuPrep® Gel

Purification Kit (Bioneer, South Korea). The extraction was done according to the

protocol provided in the kit. Briefly, buffer 1 (gel binding buffer) was added into the gel

slice using 600 µl of buffer 1 for 200 mg of gel slice. The gel was dissolved at 60°C for 10

min and vortex the tube every 2-3 min. After the gel completely dissolved, the mixture

was transferred to binding column tube and centrifuged at 14,000 × g for 1 min. Flow

through was discarded and wash the DNA binding column twice with 500 µl of buffer 2

(washing buffer), centrifuge at 14,000 × g for 1 min. The column was dried by additional

centrifugation at 14,000 × g for 1 min. The DNA was eluted from the filter column into a

new 1.5 ml microcentrifuge tube by adding 30 µl of UDW onto the center of the filter and

centrifuge at 14,000 × g for 1 min. Quality of eluted DNA was verified by 1.5% agarose

gel electrophoresis (Section 4.1.1.8).

4.1.2.3 Incorporation of enzyme restriction sites flanking to the

amplified VH and VL

The VH and VL fragments were extracted from the gel and used to be

templates of the PCR reactions. The primers used for the PCR reactions were mouse IgG

library primer set 2 from PROGEN (PROGEN BioTechnik, Germany) (Appendix C).

Ref. code: 25605612040039JID

36

The enzyme restriction sites for Mul I and Hind III were linked to the forward and reverse

primers of the VH, respectively whereas those for Nco I and Not I were linked to the

forward and reverse primers of VL, respectively. The PCR reactions were performed

according to the procedure used for amplification of VH and VL (Section 4.1.2.1) but

using different primers. The 2A-2L forward primers and 2M reverse primer (Appendix C)

were used for amplification of VH. For VL, 2N-2W forward primers and 2X reverse

primer were used for amplification of kappa VL while 2Y and 2Z were forward and

reverse primers respectively used for amplification of the lambda VL.

The PCR amplicons with an expected size of approximately 380-400

bp were verified by 1.5% agarose gel electrophoresis and ethidium bromide staining

(Section 4.1.1.8). Each PCR amplicon was purified by using AccuPrep® Gel Purification

Kit (Bioneer, South Korea) (Section 4.1.2.2) and the DNA concentration of each VH and

VL was estimated from the agarose gel image. Then, the equal amount of total 11

fragments of enzyme restricted VH and VL were pooled together.

4.1.3 Preparation of plasmid DNA

Phagemid DNA vector pSEX81 was purchased from PROGEN (PROGEN

BioTechnik, Germany). The plasmid DNA was transformed into JM109 E. coli and kept

at -80°C as a bacterial glycerol stock. To extract pSEX81, the colony of E. coli

JM109:pSEX81 was inoculated into 5 ml of LB broth supplemented with 100 µg/ml

ampicillin (LB-A) and incubated at 37°C for 16-18 hours. This culture was used as a

starting material for extracting plasmid DNA using AccuPrep® Nano-Plus Plasmid Mini

Extraction Kit (Bioneer, South Korea). The assay was performed according to the

enclosed instruction manual. Briefly, the E. coli cultured cells were harvested by

centrifugation at 8,000 × g for 2 min and the culture medium was discarded by pipetting.

The 250 µl of Buffer 1 was added and completely resuspended by vortex or pipetting and

followed by adding 250 µl of Buffer 2 into the cells suspension and mixed gently by

inverting the tube 3-4 times. Then, 350 µl of Buffer 3 was added into the mixture and

immediately mixed gently by inverting the tube 3-4 times. The mixture tube was

centrifuged at 14,000 × g for 1 min. The clear lysate was transferred to DNA binding

column tube and centrifuged at 14,000 × g for 1 min. The flow-through was discarded

from collection tube and the binding column was re-assembled to the collection tube.

Seven hundred µl of Buffer 3 was added into DNA binding column and centrifuged at

Ref. code: 25605612040039JID

37

14,000 × g for 1 min. The column was dried by additional centrifuged at 14,000 × g for 1

min. The binding column was transferred to a new 1.5 ml centrifugation tube. The

phagemid DNA was eluted with 50 µl of UDW. The quality of phagemid DNA was

verified by 1% agarose gel electrophoresis and ethidium bromide staining (Section

4.1.1.8). The concentration of DNA was determined by using spectrometry (NanoDropTM

2000, Thermo Scientific, USA).

4.1.4 Cloning of amplified VH into phagemid vectors

4.1.4.1 Double digestion

The double digestion reaction of pSEX81 and VH fragments was prepared as follows:

The mixtures were incubated at 37°C for 16-18 hours. The complete

digestion was checked by agarose gel electrophoresis (Section 4.1.1.8). After complete

digestion, the enzyme activity was inactivated by incubation of the mixture at 65°C for 10

min and then added 0.25 µl of FastAP Thermosensitive Alkaline Phosphatase (1 U/µl)

(Fermentas, Thermo Scientific, USA) and incubated at 37°C for 30 min. This step was

repeated once. Finally, the enzyme was heat inactivated at 75°C for 5 min.

The Hind III/Nco I-digested pSEX81 and VH were purified using

PCR cleanup kit (Bioneer, South Korea). One volume of digested DNA was mixed with

5 volume of the binding buffer provided in the kit and loaded into DNA binding column.

The column was centrifuged at 14,000 × g for 1 min to discard the flow through and

washed twice respectively with 500 µl of washing buffer and centrifugation. The washed

column was dried by an additional centrifuge for 2 min. The DNA was eluted with 30 µl

Ingredients Volume (µl)

UDW

Buffer R

Hind III endonuclease (Fermentas, Thermo Scientific, USA)

Nco I endonuclease (Fermentas, Thermo Scientific, USA)

pSEX81 or pooled VH (1,000 ng)

42.0-X

5.0

1.0

2.0

X

Total 50

Ref. code: 25605612040039JID

38

of UDW. The quality of DNA was verified by 1% agarose gel electrophoresis and

ethidium bromide staining (Section 4.1.1.8).

4.1.4.2 Ligation of digested VH and pSEX81

The ligation reaction mixture was prepared as follows:

Ingredient Volume (µl)

Digested pSEX81 (~1,000 ng)

Digested VH (~250 ng)

T4 ligase buffer

T4 ligase (Fermentas, Thermo Scientific, USA)

UDW

X

Y

2.0

1.0

20-X-Y

Total 20

The ligation mixture was incubated at 4°C for 16-18 hours. One µl of

T4 ligase was added additionally to the reaction tube and further incubated at 4°C for 2

hours. The ligation reaction was inactivated by heating at 65°C for 10 min and then

precipitated by adding 0.1 volume of 2.8 M sodium acetate, 2.5 volume of absolute

ethanol. The mixture was chilled at -20°C for 16-18 hours and centrifuged at 14,000 × g

for 20 min and discarded supernatant. The DNA pellet was washed with 750 µl of 70%

ethanol and centrifuged as above. The pellet was resuspended with 50 µl of 10% glycerol

in 1 mM HEPES.

4.1.4.3 Preparation of electrocompetent XL1-Blue E. coli

The starter culture of XL1-Blue E. coli was prepared by inoculating a

single colony into 5 ml of LB broth supplemented with tetracycline (20 µg/ml) and

incubated at 37°C with shaking at 250 rpm for 16-18 hours. Five ml of the starter was

added into 500 ml of LB broth containing tetracycline (20 µg/ml) and incubated at 37°C

with shaking at 250 rpm until an OD600 reached 0.4-0.5. The culture was quickly chilled

on ice for 30 min and harvested by centrifugation at 5,000 × g, 4°C for 5 min. The

supernatant was removed as much as possible by leaving the bottle upside down for 15-30

sec on a clean paper towel. The pellets were rinsed once with ice-cold distilled water and

were washed twice by ice-cold distilled water in the first washing and with 10% glycerol

in the second wash. After resuspended the pellet with washing solution, the cell

Ref. code: 25605612040039JID

39

suspension was incubated in ice-bath for 10 min and then centrifuged at 5,000 × g, 4°C for

10 min and 15 min for the first and the second wash, respectively. The cell pellet of a final

wash was resuspended with 1 ml of 10% glycerol in 1 mM HEPES. The competent cells

were either freshly used in the electroporation or suspended in 20% sterile glycerol,

aliquot in 100 µl and kept at -80°C for further use. To determine the transformation

efficiency and checking quality of electrocompetent cells, 1 µg of pUC19 control plasmids

were electroporated into 40 µl of electrocompetent cells by using the method described

below.

4.1.4.4 Transformation of pSEX81 carrying VH (pSEX81::VH) into XL1-

Blue E. coli

To introduce recombinant pSEX81-VH phagemids into competent

cells, 5 µl of the recombinant DNA was added into 50 µl of competent XL1-Blue E. coli

cells and transferred into pre-chilled 0.2 cm gap electrocompetent cuvette (BIO-RAD,

USA). The cuvette was incubated on ice for 1 min and placed into the chamber of

electroporator (MicroPulserTM, BIO-RAD, USA) at a setting of 2.5 kV and 3.3 kohm.

After electroporation, nine hundred and forty five µl of 37°C pre-warmed 2X YT medium

was added immediately, transferred to a 1.5 microcentrifuge tube (500 µl per tube) and

incubated at 37°C with shaking at 600 rpm for 1 hour. The culture was plated on 2X YT-

GAT agar (Appendix B) and the plate was incubated at 37°C for 16-18 hours. To

determine the number of transformants, the 10-fold serial dilution was performed starting

from 10-2 to 10-6 dilutions. One hundred µl of the 10-4 to 10-6 dilutions were plated out on

2X YT-GAT agar plates. The remaining 900 µl was plated on (16×27.5×0.7 cm) 2X YT-

GAT agar and the plate was incubated at 37°C for 16-18 hours.

4.1.4.5 Extraction and purification of pSEX81::VH

Colonies on agar plate were washed off with 40 ml 2X YT medium.

The bacterial solution was centrifuged at 20,000 × g, 4°C for 30 min and discarded the

supernatant. Plasmid DNA was extracted from the bacterial cell pellet by alkaline lysis

method.111 In Brief, the bacterial cell pellet was resuspended in 120 ml of alkaline lysis

solution I (Appendix B) and divided equally into three 250 ml centrifuge bottles. The

87 ml of freshly prepared alkaline lysis solution II (Appendix B) was added into each

bottle and mixed gently by inverting. The suspension was incubated at room temperature

Ref. code: 25605612040039JID

40

for 10 min. The 43.5 ml of ice-cold alkaline lysis solution III (Appendix B) was added,

mixed gently by swirling the bottle and incubated on ice for 10 min. The extracted cells

were centrifuged at 20,000 × g, 4°C, for 30 min and allowed the rotor to stop without

breaking. The clear supernatant was decanted to the new 50 ml centrifuge tubes (25 ml

/tube), added 0.6 volume of isopropanol into the supernatant, and mixed well. The mixture

was stored in the tube at room temperature and centrifuged at 20,000 × g, 4°C, for 30 min.

The supernatant was discarded carefully and inverted the open tube on a paper towel to

allow the last drops of supernatant to drain away. The pellet and the tube’s wall were

rinsed with 40 ml of 70% ethanol. The ethanol was drained off and dried the pellet at

60°C for 15 min. Two ml of TE buffer (Appendix B) was added into the dried pellet to

dissolve the plasmid DNA. The quality of plasmid DNA was verified by 0.8 % agarose

gel electrophoresis and ethidium bromide staining (Section 4.1.1.8). Five hundred µg of

plasmid DNA was purified by using QIAGEN plasmid purification kit (QIAGEN,

Germany). The quality of plasmid DNA was verified by 0.8 % agarose gel electrophoresis

and ethidium bromide staining (Section 4.1.1.8).

4.1.5 Cloning of amplified VL into pSEX81 carrying VH

4.1.5.1 Double digestion

The double digestion reaction of pSEX81-VH and VL fragments was

prepared as follows:

Ingredients Volume (µl)

UDW

Buffer O

Not I endonuclease (Fermentas, Thermo Scientific USA)

Mlu I endonuclease (Fermentas, Thermo Scientific , USA)

pSEX81-VH or VL fragment (1,000 ng)

42-X

5.0

1.0

2.0

X

Total 50

The reaction mixtures were incubated, inactivated the enzyme

activity and purified the digested DNA by the same procedure described in Section

4.1.4.1.

Ref. code: 25605612040039JID

41

4.1.5.2 Ligation

The ligation reaction mixture was prepared as follows:

Ingredient Volume (µl)

Digested pSEX81-VH fragment (~ 720 ng)

Digested VL fragments (~ 168 ng)

T4 ligase buffer

T4 ligase (Fermentas, Thermo Scientific, USA)

UDW

X

Y

2.0

1.0

20-X-Y

Total 20

The reaction mixture was incubated, inactivated and precipitated the

DNA by following the procedure described in Section 4.1.4.2.

4.1.5.3 Transformation of pSEX81::VH-VL into XL1-Blue E. coli

For one reaction, 1 µl aliquot of ice-cold recombinant pSEX81::VH-

VL was added into 50 µl of ice-cold competent XL1-Blue E. coli cells prepared in Section

4.1.4.3 and followed the electroporation transformation procedure as described in Section

4.1.4.4. The electroporation transformation was repeated until the ligation mixture was

used up.

The transformants were pooled together and provided 100 µl for

determining the transformation efficiency. The transformation efficiency was performed

by making a 10 fold serial dilution from 10-1 to 10-10 and spread 100 µl of each dilution of

10-4 to 10-10 on LB-A agar plate. The spreaded plates were incubated at 37°C for 18 hours,

counted the number of colonies and calculated the transformation efficiency.

The rest of the pooled transformants were transferred to a 1 L flask,

added warmed 2X YT-GA to a final volume of 350 ml and incubated at 37°C with

shaking at 250 rpm until the OD600 reached 0.4-0.5. Three hundred and fifty microliters of

hyperphage (PROGEN Biotechnik, Germany) was added into the flask and continued

incubated at 37°C without shaking for 30 min and followed by shaking at 250 rpm for 30

min to allow the hyperphage infected the transformed bacteria. Then the media was

changed to 350 ml of 2X YT-AK by centrifugation and continued incubated at 37°C with

shaking at 250 rpm for 18 hours. The scFv phage library in the culture medium was

Ref. code: 25605612040039JID

42

harvested by centrifugation at 12,000 × g for 20 min at 4°C. The supernatant containing

scFv phage library was filtered through the 0.2 µ membrane.

To determine the scFv phage titer, 200 µl of the filtered scFv phage

library was taken out for titration (Section 4.1.5.4). The total progeny phages were

calculated to be the library size. The rest of the solution containing scFv phages (350 ml)

were precipitated by adding 87.5 ml of PEG/NaCl (1 part of PEG/NaCl/4 part of

supernatant), incubated at 4°C for 18 hours. The precipitated phages were harvested by

centrifugation at 10,000 × g for 30 min at 4°C and resuspened in 3.5 ml of LB broth.

Finally, the equal volume of sterile glycerol was added, made 1 ml aliquots and kept at

-80°C.

4.1.5.4 Phage titration by culture method

One colony of XL-1 Blue E. coli was inoculated into 1 ml of LB

broth supplemented with 20 µg/ml of tetracycline (LB-T broth) and incubated at 37°C

with shaking at 250 rpm for 18 hours for used as a starter culture. Then the 50 µl of the

starter culture was added into 5 ml of LB broth, incubated at 37°C with shaking at 250

rpm until OD600 was in the range of 0.3-0.4. Meanwhile culturing the E. coli, the ten-fold

serial dilution of scFv phages was perform starting from 10-1 to 10-7 in 20 µl of the LB

broth. Then added 100 µl of XL-1 Blue E. coli preparation into each dilution of scFv

phages and incubated at 37°C without shaking for 1 hour. The phage-infected bacteria

from each of dilution 10-3 to 10-7 were dropped onto LB-A agar plate using 10 µl/dot and

5 dot/dilution. The cultured plate was incubated at 37°C for 18 hours. The colonies on the

plate were counted and the scFv phage titer was calculated.

4.2 Characterization of mouse scFv phage display library

4.2.1 Verification of scFv phage clones

The transformed colonies growing on the culture plate performed according

to the Section 4.1.4.3 were randomly selected and screened by the PCR amplification of

mouse scfv using forward primer pelB; 5′-ATACCTATTGCCTACGGCAGC-3′ and

reverse primer gIII; 5′-TAGCATTCCACAGACAGCCC-3′. For a 25 µl reaction the PCR

mixture was prepared as follows:

Ref. code: 25605612040039JID

43

Ingredients Volume (µl)

UDW

Reaction buffer + KCl (10X)

MgCl2 (20 mM)

dNTP mix (10 mM, each)

Forward primer pelB (10 µM)

Reverse primer gIII (10 µM)

Taq DNA polymerase enzyme

(Fermentas, Thermo Scientific, USA)

DNA template

16.9

2.5

2.0

0.5

1.0

1.0

0.1

1.0

Total 25.0

The PCR thermal cycles were set as follows: initial denaturation at 94°C for

5 min followed by 30 cycles of denaturation at 94°C for 30 sec, annealing at 58°C for 30

sec and extension at 72°C for 1 min. The final extension was 72°C for 10 min. The PCR

amplicon with an expected size of ≥ 900 bp was verified by 1.0% agarose gel

electrophoresis and ethidium bromide staining (Section 4.1.1.8).

4.2.2 Determination of mouse scFv phage display library diversity

Diversities of the DNA sequences coding for mouse scFv was determined by

restriction fragment length polymorphism (RFLP) technique. The PCR amplicons

amplified in Section 4.2.1 showing the correct size of scFv (approximately 1,000 bps)

were purified and digested with Mva I restriction endonuclease and run through

polyacrylamide gel containing glycerol. The DNA bands were stained with ethidium

bromide and visualized under the UV illuminator. The pattern of DNA bands of each

clone was analyzed for the diversity of the scFv library.

Ref. code: 25605612040039JID

44

4.2.3 Identification of complementarity determining regions (CDRs) of mouse

scFv

The same PCR products used for RFLP were sequenced. The sequencing

results of all clones expressing sequence of mouse scfv were deduced to amino acid

sequence and aligned with mouse scFv sequences in the Immunogenetic (IMGT) database.

The immunoglobulin frameworks (FR) and complementarity determining regions (CDRs)

of mouse scFv were predicted using the IMGT tool (http://www.imgt.org).

4.3 Searching proteins unique to V. parahaemolyticus and V. alginolyticus

To find out the target proteins specific to V. parahaemolyticus and V. alginolyticus,

the genome comparison between these two species were performed using BLAST tool

program version 2.2.31 (http://blast.ncbi. nlm.nih.gov/Blast.cgi). The DNA sequences of

the chromosome 2 of V. parahaemolyticus (Accession number NC_004605.1) and

V. alginolyticus (Accession number NC_022349.1) were compared to each other by using

Mega BLAST. The output showed DNA sequence similarity between these two organisms

which were excluded. The regions of DNA sequence of V. parahaemolyticus which are

different from V. alginolyticus and vice versa were recorded (Appendix A). The

corresponding coding sequences (CDSs) of these regions were obtained from the database

(https://www.ncbi.nlm.nih.gov/nuccore). These CDSs were individually aligned against

non-redundant protein sequence (nr) using BLASTX with the exclusion of

V. parahaemolyticus/V. alginolyticus sequences. The CDSs showing no or low identity to

proteins of other Vibrionaceae or of other genus were considered as unique genes of

V. parahaemolyticus or V. alginolyticus.

4.3.1 Verification of the unique protein by PCR amplification To verify whether vpa1327 is specific to V. parahaemolyticus, the primers

were designed. The primer sequences were:

VPA1327-F: 5′-ACATACGGAAAATATAGGTAGTG-3′

VPA1327-R: 5′-AAATCTAGCGCATCAAGT-3′

The vpa1327 was screened in clinical and seafood isolates of

V. parahaemolyticus as well as in other Vibrionaceae. Besides VPA1327 primer,

Ref. code: 25605612040039JID

45

16SrRNA112 and ToxR9 primers were also used as positive control for Vibrio species and

V. parahaemolyticus, respectively. These bacterial strains were cultured overnight (16-18

hours) on the suitable agar plates. The DNA of each strain was extracted by picking a

colony of the bacterial strains suspended individually in one ml of sterile distilled water

(DW) and adjusted the OD600 to one. The adjusted bacterial cell was boiled and

centrifuged at 8,100 × g for 5 min. The supernatant containing DNA was transferred to a

new tube and kept at 4°C for use as a template for PCR amplification. The total 20 µl

PCR reaction mixture was prepared as follows:

Ingredients Volume (µl)

UDW Reaction buffer + KCl (10X) MgCl2 (25 mM) dNTP mix (2.5 mM, each) Forward primer (10 µM) Reverse primer (10 µM) Taq DNA polymerase enzyme (Fermentas, Thermo Scientific, USA) DNA Template

15.4 2.5 2.0 2.0 1.0 1.0 0.1

1.0

Total 25.0

The PCR cycling conditions were one cycle of 5 min at 95°C followed by 30

cycles of 30 sec at 95°C, 30 sec at 58°C and 30 ses at 72°C followed by a final extension

time of 5 min at 72°C. The PCR products were electrophoresed in 1.5% agarose gel,

stained with ethidium bromide, and then UV visualized by a gel documentation system

(Syngene, UK).

4.3.2 Identification of amino acid sequence unique to V. parahaemolyticus and

V. alginolyticus

Several previous studies had used the ToxR gene as a target gene for specific

detection of V. parahaemolyticus.24,123,124 In this study, therefore, ToxR protein was an

alternative target for differential detection of V. parahaemolyticus and V. alginolyticus.

ToxR amino acid sequences of several strains of these two species were retrieved from

Ref. code: 25605612040039JID

46

GeneBank database. These sequences were aligned using DNAMAN (Lynnon BioSoft,

Canada). The regions of difference were identified and used for epitope prediction using

Antibody Epitope Prediction tool (https://www.iedb.org/). The predicted epitopes were

verified using BLASTP (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins). The

designed peptides were synthesized as biotin conjugate/unconjugated peptides. These

peptides were used for bio-panning.

4.4 Production of recombinant ToxR of V. parahaemolyticus (rVP-ToxR) and

V. alginolyticus (rVA-ToxR)

4.4.1 Cloning ToxR gene of V. parahaemolyticus (VP-toxR) and

V. alginolyticus (VA-toxR) into cloning vector

4.4.1.1 PCR amplification of VP- and VA-toxR

The DNA templates of V. parahaemolyticus O3:K6 and

V. alginolyticus ATCC17749 were prepared as described in Section 4.4. The ToxR

primers of V. parahaemolyticus strain RIMD2210633 (Accession number NC_004605.1)

and V. alginolyticus strain ATCC17749 (Accession number NC_022359.1) were designed.

The sequences of the primers were:

VPTR-F: 5′-GGATCCATGACTAACATCGGCACC-3′

VPTR-R: 5′-CTGCAGCCTCC TTTATTTGCAGATGT-3′.

VATR-F: 5′-CTGGGATCCAACACTGACGTTGAAGAAACC-3′

VATR-R: 5′-ATCAAGCTTATACGCAGTGTTACGTTCTCG-3′

Ref. code: 25605612040039JID

47

The PCR reaction mixture was prepared as follow:

Ingredients Volume (µl)

UDW

Reaction buffer + KCl (10X)

MgCl2 (25 mM)

dNTP mix (2.5 mM, each)

Forward primer (10 µM)

Reverse primer (10 µM)

ProFi Taq DNA polymerase enzyme (Bioneer, South Korea)

DNA Template

10.9

2.0

2.0

2.0

1.0

1.0

0.1

1.0

Total 20.0

The PCR cycles were performed using with initial denaturation at

95°C for 5 min, followed by 30 cycles of 95°C for 30 sec, 56°C (VP-toxR)/54°C (VA-

toxR) for 30 sec and 68°C for 45 sec, and a final extension at 68°C for 5 min. The PCR

amplicons were run in agarose gel electrophoresis and then the target DNA bands were

extracted from the agarose gel and purified as described in Section 4.1.2.2.

4.4.1.2 Ligation of VP-toxR and VA-toxR to the cloning vectors

The purified VP-toxR (897 bp) and VA-toxR (494 bp) were ligated

individually into pGEM–T Easy vector (Promega, USA) using a molar ratio of 3:1

(insert:vector). The amount of inserted DNA was calculated according to the following

formula.111

Insert DNA (ng) = Vector (ng) × insert (kb) × (insert/vector ratio)

Vector (kb)

Ref. code: 25605612040039JID

48

The 10 µl of the ligation mixture was prepared as follows:

Ingredient Volume (µl)

2X ligation buffer

pGEM-T Easy Vector (50 ng)

T4 DNA Ligase (3 Weiss units/µl)

PCR product

UDW

5.0

1.0

1.0

X

Y

Total 10

The preparation was incubated at 4°C for 16-18 hours.

4.4.1.3 Preparation of competent E. coli 114

A starter culture of DH5α E. coli was prepared by inoculated one

colony of DH5α E. coli into 5 ml of LB broth and incubated at 37°C with shaking at 250

rpm for 16 hours. The 200 µl of the starter culture was added into 20 ml of LB broth and

incubated at 37°C with shaking at 250 rpm until an OD600 = 0.4-0.5. The culture was

quickly chilled on ice for 30 min and harvested by centrifugation at 4,000 × g for 10 min

at 4°C. After discard supernatant, the pellet was washed once with 10 ml of ice-cold 0.1 M

CaCl2 by centrifugation. The pellet was resuspended in 2 ml of ice-cold 0.1 M MgCl2 and

kept on ice for 1 hour. The competent cells were either used freshly for transformation or

were added sterile glycerol to a final concentration of 20% (v/v) and kept in small aliquots

(100 µl) at -80°C for further use.

4.4.1.4 Transformation of the ToxR gene into competent E. coli

The bacterial transformation was performed using heat-shock

method.115 The 10 µl of ligation mixture prepared in Section 4.4.1.2 was mixed with 100

µl of the competent E. coli prepared in Section 4.4.1.3 and kept on ice for 30 min. The

tube was transferred to incubate in 42°C water bath for 2 min, and then moved to incubate

in ice-bath for 30 min. One ml of warmed LB broth was added into the mixture and

further incubated at 37°C with shaking at 250 rpm for 1 hour. Then, 100 µl of the mixture

was spread on LB-A agar previously spreaded with 100 µl of Isopropyl-β-D-

thiogalactoside (IPTG, 100 mM), and 20 µl of X-gal (50 mg/ml). The plate was incubated

at 37°C for 16 hours. The E. coli transformants carrying toxR inserted pGEM-T appeared

Ref. code: 25605612040039JID

49

as white colonies were selected and checked for the presence the ToxR gene by PCR

using specific primers and PCR condition as previously done in Section 4.4.1.1 with

exception for using Taq DNA polymerase enzyme (Fermentas, Thermo Scientific, USA)

and the extension temperature at 72°C.

4.4.2 Sub-cloning of VP-toxR and VA-toxR into protein expression vector

4.4.2.1 Extraction and purification of recombinant plasmid DNA

The selected transformed E. coli clones harboring recombinant

plasmid DNA (pGEM-T-VP-toxR and pGEM-T-VA-toxR) were cultured for plasmid

preparation. The cultured cells were harvested and the plasmids were extracted according

to the procedure described in Section 4.1.3.

4.4.2.2 Digestion of recombinant DNA and expression vector

The extracted pGEM-T-VP-toxR and pGEM-T-VA-toxR prepared in

the previous section were subjected to digest by the restricted endonuclease enzymes. The

pGEX4T-1 and pET32a+ vectors were used as the protein expression vector for expression

of recombinant VP-ToxR and VA-ToxR protein, respectively. The purified pGEM-T-VP-

toxR and pGEX4T-1 vector were separately doubly digested with BamH I and Sal I using

procedure described in Section 4.1.4.1. Likewise, the purified pGEM-T-VP-toxR and

pET32a+ vector were separately doubly digested with BamH I and Hind III. After

complete digestion, the digested recombinant DNAs and expression vectors were run in

agarose gel electrophoresis. The separated VP- and VA-toxR as well as their

corresponding vectors were extracted from the gel by using AccuPrep® Gel Purification

Kit (Section 4.1.2.2).

4.4.2.3 Transformation of recombinant DNA into the expression vectors

The digested VP-toxR and VA-toxR was further ligated into digested

pGEX4T-1 and pET32b+, respectively. The ligation mixture was prepared and incubated

at 4°C for 16 hours. After incubation, the ligation mixture was introduced into the

competent BL21 and BL21 (DE3) E. coli cells prepared previously using the same method

as described in Section 4.4.1.3. The transformation was performed using the same heat

shock method described in Section 4.4.1.4 without adding IPTG and X-gal. After the

transformed E. coli clones carrying the VP- and VA-toxR gene were selected, their

plasmid were extracted and submitted to verify by DNA sequencing (Bioneer, South

Korea). The DNA sequences were aligned to the database sequences using BLAST

Ref. code: 25605612040039JID

50

program (http://blast.ncbi.nlm.nih.gov/). Also, the verified E. coli clones were kept as

stock culture in 30% glycerol at -80°C for further use.

4.4.3 Expression of the recombinant protein

To prepare the start culture, a single colony of the selected BL21 E. coli clones

carrying recombinant DNA, pGEX4T-1-VP-toxR or BL21 (DE3) E. coli carrying

recombinant DNA, pET32a+-VA-toxR was inoculated into LB-A broth and incubated at

37°C with shaking at 250 rpm for 16 hours. For small scale expression, 100 µl of the

starter culture was inoculated into 10 ml of LB-AK broth and incubated at 37°C with

shaking at 250 rpm until an OD600 was approximately 0.4-0.5. The recombinant protein

expression was induced by adding IPTG to a final concentration of 1 mM and incubated

continually for 3 hours. Parallel to the IPTG induction, non-induction culture was also

performed to be used as a negative control. To check whether the protein was expressed,

one ml of cell suspension from the culture of both conditions were pelleted and run in

SDS-PAGE (Section 4.5.1).

After the recombinant protein-expressing clones were indicated, one ml of the

cell culture adjusted OD600 to 1 was pelleted, washed once with 10 mM PBS pH 7.4, and

resuspended with one ml 10 mM PBS pH 7.4. The cell suspension was homogenized by

using ultra sonication at 30% amplitude, pulse on 0.5 sec and pulse off 0.5 sec for 1 min

or until the cell suspension became clear. The cell was pellet by centrifugation at 10,000 ×

g, 4°C for 20 min and the lysate containing soluble protein was transferred to a new tube.

The pellet or insoluble part was dissolved in 100 µl of SDS-PAGE sample buffer

(Appendix B) and then subjected to run on SDS-PAGE (Section 4.5.1) in parallel with

the soluble portion.

4.4.4 Purification of the recombinant protein

The hexahistidine-tagged ToxR fusion protein was purified from the

bacterial cells homogenate by metal-ligand affinity chromatography under denaturing

condition. According to the cell preparation procedure for protein expression previously,

the larger scale of the cell culture (200 ml) was prepared. The IPTG-induced bacterial

cells were harvested by centrifugation at 5,000 × g for 10 min and resuspended in binding

buffer pH 6.3 (Appendix B) at a ratio of one gram of bacterial cells per 8 ml of binding

buffer. The bacterial cells were sonicated at 30% amplitude, pulse on 0.5 sec and pulse off

0.5 sec for one min or until the cell suspension was clear in appearance. The bacterial cells

Ref. code: 25605612040039JID

51

homogenate was centrifugation at 3,000 × g for 15 min. The cell lysate was transferred to

a new plastic tube containing Ni-NTATM agarose beads (Invitrogen, Thermo Fisher

Scientific, USA). The preparation was gently mixed by inverting and using roller mixer

for 30 min. The protein binding-agarose beads were packed into a 10 ml polystyrene

column. The unbound protein or flow-through fraction was collected from column. The

column was extensively washed using 4 ml of washing buffer pH 8.0 and followed by 4

ml of washing buffer pH 6.3 (containing 10 mM of imidazole). The washing cycles were

repeated once. After complete washing, the recombinant protein was eluted by stepwise

elution using binding buffer pH 6.3 containing gradually increasing concentration of

imidazole from 50 to 500 mM. The eluent fractions, three ml per fraction, were collected.

All fractions were analyzed by SDS-PAGE and Western blot analysis for the presence of

the recombinant ToxR. Protein refolding was performed by dialysis against binding buffer

pH 6.3 with gradually decrease concentration of urea from 8 to 2 M urea. Then, the

dialysate was centrifuged at 10,000 × g, 4°C for 15 min and the supernatant containing

recombinant ToxR was collected. Finally, the recombinant protein was verified by SDS-

PAGE (Section 4.5.1) and Western blot analysis (Section 4.5.2). The concentration of the

recombinant protein was also determined by Bradford’s assay.

4.5 Protein analysis

4.5.1 SDS-PAGE

SDS-PAGE was performed in Laemmli’s discontinuous buffer system.116

The polyacrylamide gel was performed by using SE260 mini vertical electrophoresis unit

(Hoefer, USA). According to the manufacturer manual, a 4% stacking gel was prepared in

0.5 M Tris-HCl, pH 6.8 and 12% resolving gel was prepared in 1.5 M Tris-HCl, pH 8.8.

The protein sample was prepared in SDS-gel reducing loading buffer and boiled for 5 min

for denature the protein. The denatured proteins as well as pre-stained SDS-PAGE

standards, broad range (Bio-Rad, USA) were individually loaded into slots made on the

stacking gel. The electrophoresis was carried out in Tris-glycine running buffer

(Appendix B) by applying electricity 10 mA per one gel. When the dye front had reached

to the resolving gel, the electricity was increased to 20 mA per gel and electrophoresis was

continued until the dye front reached to the lower edge of the resolving gel. After finish

Ref. code: 25605612040039JID

52

the electrophoresis, the protein separate gel was removed from the glass plate and either

stained with Coomassie Brilliant Blue G-250 (Appendix B) or transferred onto

nitrocellulose membrane (NCM) for Western blot analysis.

4.5.2 Western blot analysis

The protein separated by SDS-PAGE was transferred from polyacrylamide gel

onto NCM by using Mini Trans-Blot® Electrophoretic Cell apparatus (Bio-Rad, USA)

according to the manufacturer’s protocol. The electrotransblotting was performed in

transfer buffer (Appendix B) by apply 100 volts electric power for 90 min. Then, the

blotted membrane was removed and place on filter paper for drying. The membrane could

be kept at -20°C or continued to detection step. For the detection step, the empty area on

NCM was block with 5% FBS in PBS for 1 hour. The NCM was washed with PBS-T (10

mM PBS pH 7.4 + 0.05% Tween20) and probe with primary antibody specific to the

protein or epitope tag for 1 hour. After incubation the NCM was washed with PBS-T. The

immune complex was detected with sary antibody against primary antibody conjugated-

enzyme follow by chromogenic substrate, respectively.

4.5.3 Quantification of protein by Bradford’s assay

Protein quantification was followed protocol of Bio-Rad Protein Assay. BSA

was used as a standard protein. The optical density (OD) of the colored content was

measured at OD595. A protein standard curve was plotted the BSA concentrations against

the respective OD read-outs. The protein content of the unknown was calculated from the

standard curve.

4.6 Selection of VP and VA specific scFv phages from scFv phage display library

4.6.1 Bio-panning

4.6.1.1 Preparation of peptide/protein-coating magnetic bead

Peptides specific to ToxR protein of V. parahaemolyticus (PTRVpar)

and V. alginolyticus (PTRValg) were designed (Section 4.3.2) and synthesized

(ChinaPeptides, China). The peptides, PTRVpar and PTRValg as well as Bovine serum

albumin (BSA) were coupling to the Dynabeads® M-280 Tosylactivated (Invitrogen,

USA) according to instruction manual. Briefly, 165 µl of the beads (equivalent to 5 mg

beads) was transferred to the 1.5 ml micro-centrifuge tube and placed the tube in the

Ref. code: 25605612040039JID

53

DynaMag-Spin magnet (Invitrogen, USA) for 1 min and discard supernatant. To wash the

beads, one ml of buffer A (0.1M PB pH 7.4, Appendix B) was added, resuspended,

placed the tube in magnet for 1 min, and discarded the supernatant. The beads were

resuspended in 150 µl of buffer A containing 100 μg of peptide/BSA and mixed

thoroughly by vortex. Then, 100 µl of buffer B (3 M (NH4)2SO4 in buffer A, was added

into the mixture to make a total volume of 250 µl. The mixture tubes were mixed by

vortex and incubated on a roller at 37°C for 18 hours.

After incubation, the supernatant was discarded and replaced with 1

ml of buffer C (0.01M PBS + 0.5% Tween 20). The tube was incubated at 37°C for 1 hour

on a roller. The supernatant was discarded and 1 mL of buffer D (0.01M PBS + 0.1%

Tween 20) was added to wash the beads. The tube was mixed thoroughly by vortex for 5–

10 sec and the supernatant was discarded by placing the tube on magnet for 2 min. The

washing was repeated once and then resuspended the coated bead to the original volume

with buffer D and transferred the beads to a new tube.

4.6.1.2 Binding of scFv phages to the coated beads

For panning, 100 µl of scFv antibody phage library (2.5× 108 cfu)

was added into BSA coated beads after removal of buffer D. The volume of the mixture

was brought up to 250 µl by adding 150 µl of buffer B and incubated at 37°C on roller for

1 hour. The depleted BSA or unbound scFv phages were harvested and added into the new

tube containing PTRVpar coated bead. The tube was incubated at 37°C on roller for 1

hour to allow the depleted BSA scFv phages bound to the bead. Similar to the previous

step, the unbound scFv phages were harvested and simultaneously added into the new tube

containing PTRValg coated bead and incubated further for one hour. For the scFv phages

already bound to the peptide coated beads, they were eluted from the beads according to

the method described in the next section.

4.6.1.3 Elution

After unbound scFv phages were removed, the beads were

resuspended in 1 ml buffer C, washed 2 times with this buffer, and 3 times with buffer D.

Then, the beads suspension were transferred to a new tube and washed once with 0.01 M

PBS pH 7.4. The packed beads were resuspended in 200 µl of elution buffer (1X trypsin

in 0.01 M PBS pH 7.4) and incubated at 37°C for 30 min. The eluted scFv phages in the

solution part were collected and transferred to a new tube.

Ref. code: 25605612040039JID

54

XL-1 Blue E. coli previously grown to the OD600 of approximately

0.4-0.5 was added, 200 µl into the eluted scFv phages tube, and incubated at 37°C for 1

hour to allow scFv phage infected the bacteria. The 20 µl and 100 µl of scFv phages

infected E. coli were then spread onto LB agar supplemented with 100 µg/ml of ampicillin

and 20 µg/ml of tetracycline (LB-AT), and incubated at 37°C for 18 hours. The remaining

of infected bacteria was kept at 4°C.

The bacterial colonies growing on LB-AT plates were counted for

estimating the number of eluted scFv phages. Besides counting, the colonies were

randomly picked, subcultured on the replica plate, and also suspended in distilled water

for detection of the scFv gene by PCR. The gIII and pelB primers were used for

amplification of gene encoding scFv antibodies. The reaction mixture and PCR cycling

condition were the same as in Section 4.2.1. The scFv phage infected E. coli clones giving

PCR positive results with the correct size were further performed a phage rescue, and also

kept as glycerol stock at -80°C.

4.6.2 Phage rescue

The replica colonies of PCR positive scFv phage clones were inoculated into

1 ml of LB broth supplemented with 100 µg/ml of ampicillin (LB-A broth) and incubated

at 37°C with shaking at 250 rpm for 18 hours for used as a starter culture. A hundred of

the starter culture was added into 10 ml of LB-A broth and incubated at 37°C with

shaking at 250 rpm until OD600 reached 0.3–0.4. M13KO7 phage was added into log

phase of the bacterial clones with multiplicity of infection (MOI) of 20 and continued

incubated the culture at 37°C without shaking for 1 hour. The culture media was changed

to the same volume of LB broth supplemented with 100 µg/ml of ampicillin and 25 µg/ml

of kanamycin (LB-AK broth). The infected bacteria were continue incubated at 37°C with

shaking at 250 rpm for 18 hours. The overnight culture was centrifuged at 4,000 × g, 4°C

for 10 min. The supernatant, LB broth containing scFv phage progenies was collected,

transfer to a new tube and kept at 4°C for further analysis.

4.6.2.1 Phage titration by ELISA

To estimate the number of scFv phage particles rescued from each

E. coli clone, the phage ELISA were performed. The batch of M13KO7 phages with

known cfu was used to construct a standard curve. Briefly, the standard M13KO7 phages

were 10-fold serially diluted from 10-1 to 10-6 in LB broth. Fifty microliter of each phage

Ref. code: 25605612040039JID

55

dilution as well as each rescued scFv phage clones were added into well of ELISA plate

previously added 50 µl of coating buffer (Appendix B) and mixed well. The wells added

LB broth only were used as a negative control. The ELISA plate was dried in 37°C

incubator. Then, the coated plate was washed 2 times with PBS + 0.05% Tween-20

(PBST), blocked with 300 µl of 3% BSA in 0.01 M PBS pH 7.4 and incubated in moisture

chamber at 37°C for 1 hour. After discarded blocking agent, the plate was washed again

for 3 times with PBST. Mouse anti-M13 diluted 1:10,000 in diluent (0.2% BSA in PBST)

100 µl was added into each well and incubated at 37°C for 1 hour. Following washing 4

times with PBST, 100 µl of Goat anti-mouse HRP (GAM-HRP) diluted 1:3,000 in diluent

was added and continued incubated at 37°C, 1 hour. After washing 4 times, 100 µl of

ABTS substrate was added into each well, and measured the OD405 at 5, 10, 15, and 20

min, sequentially.

4.6.3 Examination of scFv phage binding by ELISA

To test binding capability of the rescued scFv phages clones to their target

peptides, an indirect ELISA was performed. The biotin-conjugated ToxR peptide of

V. parahaemolyticus (PTRVpar-B) and V. alginolyticus (PTRValg-B) as well as BSA

(BSA-B) were used as antigen coated on wells of an ELISA plate. The coating antigens

were diluted in coating buffer to the concentration of 10 µg/ml and added 100 µl into each

well (1 µg/well). The plate was incubated at 37°C for 1 hour, 4°C for 18 hours and

followed by washing 3 times with PBST. The micro-wells plate was blocked using 300 µl

of 3% BSA and incubated at 37°C for 1 hour. After washing 3 times with PBST, 100 µl of

scFv phages 1×109 cfu diluted in diluent were added to the corresponding wells and

incubated at 37°C for 1 hour. The plate was washed 4 times with PBS + 0.5% Tween-20

and 4 times with PBST. Afterward, adding mouse anti-M13, GAM-HRP and ABTS

substrate were followed the procedure described in the previous section. Subsequent

adding substrate, the OD405 was measured at 30 min, 1 hour and 18 hours, sequentially.

The scFv phage clones that showed the ratio of OD405 between peptide and BSA ≥ 2 were

further test their specificity with other synthetic peptide antigens i.e., PTRVspp,

PTRVcho, PTRVhar, PTRVvul and an irrelevant peptide using the same procedure as

described above.

Ref. code: 25605612040039JID

56

4.7 Production of recombinant scFv antibodies

4.7.1 Sub-cloning of scFv into pOPE101 expression vector

The scFv phage clones giving high binding ratio and high specificity were

subjected to sub-cloning into pOPE101 expression vector and further transformed into Xl-

1 Blue E. coli for production of soluble scFv antibody. A colony of the selected clones

was individually inoculated into 5 ml of LB-AT broth and incubated at 37°C with shaking

at 250 rpm for 18 hours. The bacterial cells were harvested by centrifugation and plasmid

extraction was performed following the protocol described in Section 4.1.3. The

concentration of the recombinant plasmid (pSEX81-scfv) was determined. The quality of

plasmid DNA was verified by 0.8 % agarose gel electrophoresis and ethidium bromide

staining as in Section 4.1.1.8.

The pSEX81-scfv as well as pOPE101 plasmid vector were doubly digested

with Not I and Nco I restricted enzyme using an appropriate buffer followed the method in

Section 4.1.4.1. The digested scfv and pOPE101 were ligated together using the same

procedure as described in Section 4.1.4.2. Subsequently, the recombinant plasmid DNA,

pOPE101-scFv, was transformed into XL-1 Blue E. coli as described in Section 4.4.2.3.

The transformed colonies were randomly picked for examining the presence of scfv by

PCR amplification using primer pelB and reverse primer pOPE101. The reaction mixture

and PCR cycles was fallowed Section 4.2.1. The PCR positive clones were further

induced expression of the recombinant scFv antibodies.

4.7.2 Expression and purification of the recombinant scFv antibodies

The scFv antibody clones were cultured and induced the expression of scFv

antibody according to method described in Section 4.4.3. The expression was induced

with 0.2 mM IPTG and the culture was incubated further for 3 hours, and centrifuged at

5,000 × g for 10 min. The bacterial cells were lysed and the recombinant scFv antibody

was purified by Ni-NTATM affinity chromatography under denaturing condition as

described in Section 4.4.4.

4.7.3 Characterization of recombinant scFv antibody

4.7.3.1 Indirect ELISA

The purified scFv antibodies were tested for their specific binding by

indirect ELISA as previously done for testing scFv phage clones in Section 4.6.3. The

Ref. code: 25605612040039JID

57

ELISA procedure was the same except using the coating antigen only 0.2 µg/well and

detecting the binding with anti-c-Myc-Tag (dilution 1:3,000) instead of anti-M13.

4.7.3.2 Dot-ELISA The specificity of scFv antibody was also tested by using Dot-ELISA.

The 0.2 µg of recombinant protein of ToxR protein from 5 Vibrio species including,

V. parahaemolyticus, V. alginolyticus, V. cholerae, V. vulnificus and V. harveyi were

dotted onto each pieces nitrocellulose membrane (NCM) strips (PALL, USA) and dried at

room temperature. The empty sites on NCM were block with 3% BSA in 0.01 M PBS pH

7.4 for 1 hour and washed with PBS-T for 3 times. The NCM strips were individually

incubated for 1 hour with 50 µg/ml of each scFv antibody (diluted in 2 M urea diluent) as

well as the diluent using as a negative control strip. All NCM strips then were washed

with PBS-T for 3 times, added mouse anti-c-Myc tag diluted 1:3,000 and incubated at

room temperature for 30 min. After washing with PBS-T, alkaline phosphatase conjugated

Goat anti-Mouse Immunoglobulin (GAM-AP) diluted 1:3,000 was added and incubated

for 30 min. The NCM strips were washed four times in PBS-T followed by equilibrated in

0.15 M Tris-HCl pH 9.6 for 5-10 min. Afterward, the NCM strips were developed using

BCIP/NBT substrate (KPL, USA) and stopped the reaction by washing in tap water for

several times and air dried.

4.7.3.3 Western blot analysis

Each recombinant ToxR protein were separated in SDS-PAGE (30

µg/gel and transferred onto the NCM as describe in Sections 4.5.1 and 4.5.2, respectively.

The transferred NCM were cut vertically into 0.3 mm strips. The set of 5 strips including a

strip of each recombinant ToxR were probed with 50 µg/ml of scFv antibody for 2 hours.

After washing with PBS-T, all strips were incubated in mouse anti-c-Myc tag diluted

1:3,000 for 1 hour, in GAM-AP dilution 1:3,000 for 1 hour and finally developed the color

using BCIP/NBT substrate (see Sections 4.5.2 for the detail of the procedure).

Ref. code: 25605612040039JID

58

CHAPTER 5

RESULTS

5.1 Construction of mouse scFv phage display library

5.1.1 Mouse spleen cell preparation

Spleen of each ICR, BALB/c and C67/BL6 mouse was removed and spleen

cells were harvested counted and checked viability. The total spleen cells of each mouse

were shown in Table 5.1.

Table 5.1 Total spleen cells and cell viability

Mouse strain Number of viable cell

(cells/ml)

% cell viability Total cells

ICR

BALB/c

C57BL6

6.2 × 106

6.0 × 106

3.5 × 106

98.7

96.4

95.2

8.06 × 107

9.0 × 107

4.55 × 107

5.1.2 RNA extraction and cDNA synthesis

Spleen cells of each mouse (7.2 × 106 cells) were extracted for RNA and

then reverse transcribed to cDNA. Each preparation of extracted RNA was treated with

DNase I (Section 4.1.1.4) to remove the contaminated genomic DNA. The integrity of

treated RNA preparations were run electrophoresis of which the result was showed in

Figure 5.1. The concentration of DNase I treated RNA was estimated, it was

approximately 50 ng/µl.

Ref. code: 25605612040039JID

59

Figure 5.1 Agarose gel electrophoresis of extracted RNA.

Lane M, GeneRulerTM 100 bp plus DNA ladder

Lanes 1-4, Untreated and DNase I treated RNA of elution 1 and 2 of ICR mouse,

respectively

Lanes 5-8, Untreated and DNase I treated RNA of elution 1 and 2 of BALB/c

mouse, respectively

Lanes 9-12, Untreated and DNase I treated RNA of elution 1 and 2 of C57BL6

mouse, respectively

Thereafter the cDNA was synthesized by reverse transcription of DNase I

treated RNA, the cDNA was further examined by amplification of GAPDH. Figure 5.2

showed GAPDH amplicons with the correct size of ~496 bp in all cDNA samples. These

results indicated that the obtained cDNA had good quality and could be used as the

templates for further amplification of VH and VL genes.

5.1.3 Amplification of VH and VL flanking with restriction sites

The cDNA of three mice were pooled and used as template for amplified VH

and VL using 2 separate primer sets of mouse IgG library (Appendix C). This mouse IgG

library primer set 1 allows the amplification of rearranged mouse immunoglobulin genes

of B cell repertoire, whereas the 2nd set of primer was used to incorporated recognition site

of restriction endonuclease to the amplified VH and VL. First primer set amplified VH and

VL of all families of mouse Ig genes. The PCR results were showed that all 11 VH and 11

28S rRNA

16S rRNA

Contaminated DNA

Ref. code: 25605612040039JID

60

VL fragments with the approximate size of 380-400 bp were successfully amplified

(Figure 5.3). The bands of PCR products obtained from each primer pair were

individually excised and purified from the agarose gel. The extracted VH and VL

fragments were further used as the templates for second amplification using the second

primer set. The PCR reaction incorporated the corresponding enzyme restriction sites

flanking to the amplified VH and VL. The recognition sequences of Nco I and Hind III

were incorporated into the 5′- and 3′- ends of the amplified VH fragments respectively.

Whereas Mlu I and Not I were incorporated into the 5′- and 3′- ends of the amplified VL

fragments (Figure 5.4 and Figure 5.5).

Figure 5.2 PCR amplicons of GAPDH amplified from the synthesized cDNA

Lane M, GeneRulerTM 100 bp plus DNA ladder

Lanes 1-2, cDNA of ICR mouse

Lanes 3-4, cDNA of BALB/c mouse

Lanes 5-6, cDNA of C57BL6 mouse

Lane N, No template control

Ref. code: 25605612040039JID

61

Figure 5.3 VH and VL fragments of mouse IgG amplified using primer set 1.

Lane M, GeneRulerTM 100 bp DNA ladder

Lanes 1A-1L, VH fragments

Lanes 1N-1Y, VL fragments

The arrow indicated the size of amplified VH and VL fragments

Figure 5.4 The schematic diagram of VH and VL fragments flanked with the

recognition sites of restriction endonuclease enzyme.

Ref. code: 25605612040039JID

62

Figure 5.5 Purified VH and VL incorporated with the corresponding endonuclease

restriction sites using primer set 2.

Lane M, GeneRulerTM 100 bp plus DNA ladder

Lanes 2A-2L, VH fragments

Lanes 2N-2Y, VL fragments

The arrow indicated the size of VH and VL fragments

5.1.4 Molecular cloning of VH-VL (scFv) fragments into specialized phagemid

vectors

5.1.4.1 Construction of VH sublibrary

To insert VH fragment into pSEX81 phagemid vectors, both VH and

pSEX81 were doubly digested by Hind III and Nco I. Before VH digestion, equal amounts

of total 11 VH fragments from the second PCR amplification were pooled and was used

for digestion. Then, the digested VH and pSEX81 were ligated together to construct the

recombinant plasmid DNA, pSEX81::VH (Figure 5.6). This recombinant plasmid was

further electroporated into the electrocompetent XL1-Blue E. coli (Section 4.1.4.3)

The efficiency of the electrocompetent XL1-Blue E. coli was

examined using pUC19 plasmid control. The transformation efficiency of control plasmid

was 4.2 × 1011 cfu/ 1 µg DNA. Subsequently, the recombinant pSEX81::VH was

electroporated into previously prepared electrocompetent cell. The transformed colonies

growing on selective agar plate were counted and the transformation efficiency was

calculated. The transformation efficiency of the VH sub-library was 1.8 × 1011 cfu/ 1 µg

DNA.

Ref. code: 25605612040039JID

63

Figure 5.6 Recombinant plasmid DNA, pSEX81::VH

Lane M, GeneRulerTM 1 kb DNA ladder

Lane 1, pSEX81::VH

The pooled VL fragments and pSEX81-VH were digested and ligated. After

ligation, each ligation reaction was transformed into the competent XL1-Blue E. coli cells

of which the transformation efficiency was 5.2 × 109 cfu / 1 µg DNA. All volume of 35

electroporation reactions (1 ml each) were pooled together. After a brief incubation for 1

hour, 100 µl of the pooled transformant were provided for determining transformation

efficiency. Unfortunately, this test was fail because there was no colony could be observed

in any dilution plate. However, phage rescue of all transformed cells was performed

simultaneously, and number of phage progenies were determined by phage titration. The

number of total phages indicated the size of scFv phages library was calculated. In this

study, the scFv phages library titer is 8.75 × 109 cfu.

5.1.5 Characterization of scFv phages display library

5.1.5.1 Verification of scFv phage clones

The E. coli clones growing on the phage titration plate were randomly

picked and examined for the presence of scFv genes by PCR. The forward and reverse

primers used for PCR amplification were pelB and gIII, respectively. From a total of 35

clones, only 29 clones (82.9%) were positive for amplicon size of ≥ 900 bp (Figure 5.7).

Ref. code: 25605612040039JID

64

Figure 5.7 The representative PCR amplicon of scfv amplified from the pSEX81-scFv

transformed XL1-Blue E. coli clones.

Lane M, GeneRulerTM 100 bp plus DNA ladder

Lanes 1-12, Colonies number 1-12, respectively

Lane N, No template control

Lane P, Positive control

5.1.5.2 Determination of scFv diversity

The PCR product of the full length scFv positive clones were

determined for their diversity using restriction fragment length polymorphism (RFLP)

assay. Of 31 clones, 28 different RFLP patterns were obtained (Figure 5.8). The

calculated diversity was equal to 90.3%.

5.1.5.3 Identification of CDRs of mouse scFv

The deduced amino acid sequences of the scfv were predicted for

immunoglobulin frameworks (FRs) and CDRs using ImMunoGeneTics (IMGT) tools

(http://imgt.cines.fr). The deduced amino acid sequences of scFv were contained complete

antigen binding domains of scFv antibody including 4 FRs and 3 CDRs of VH and VL

linked together by 18 amino acid residues linker containing first six amino acids of CH1

constant region domain and the hydrophilic pig brain alpha tubulin peptide sequence as

show in Figure 5.9. Moreover, the scFv sequences were 73-100% identity to the sequence

of mouse immunoglobulin from database. Several deduced scFv sequences were aligned

scfv

Ref. code: 25605612040039JID

65

together to compare the CDRs among the scFv phages clones (Figure 5.10). The multiple

alignments showed high diversity all of treated scFv difference pattern

Figure 5.8 The representative RFLP patterns of scFv antibody phages library.

Lane M, Quick-load® Low Molecular Weight DNA Ladder (New England

Biolab®)

Lanes 1-9, clones No. 21–29, respectively

Figure 5.9 The deduced amino acid sequencing of representative scFv phage clone

analyzed via the IMGT server. The deduced amino acid sequence showed complete of

scFv domain which are VH region (blue box), Linker (yellow box) and VL region (pink

box).

Ref. code: 25605612040039JID

66

Figure 5.10 Immunoglobulin frameworks (FRs) and complementarity determining

regions (CDRs) of 5 scFv clones were determined from the deduced amino acid

sequencing the IMGT server.

*, Identical amino acid

Ref. code: 25605612040039JID

67

5.2 Searching for proteins unique to V. parahaemolyticus and V. alginolyticus

To search a unique protein of V. parahaemolyticus and V. alginolyticus, DNA

sequence of their chromosome 2 sequences were compared using BLAST tool programs.

The output showed DNA sequence similarity between these two organisms. The map of

gene sequences showing the regions of similarity and different were sketched out

(Appendix A). The regions of difference with the size greater than 1 kb were selected,

identified and searched for their CDSs/ORFs. After each CDS was aligned against non-

redundant protein sequence (nr) using BLASTX, the CDSs showing no or low identity to

proteins of other Vibrionaceae or of other genus were considered as unique genes of

V. parahaemolyticus or V. alginolyticus. The results of this searching were shown in

Table 5.2.

5.2.1 Verification of the unique protein by PCR amplification

From the BLASTx results (Table 5.2), VPA1327, VPA1331 and VPA1262

were found unique to V. parahaemolyticus but not homologous to any CDS of

V. alginolyticus. Among three genes unique to V. parahaemolyticus, VPA1327 was

selected to further study. The VPA1327 encode for an exoenzyme T revealed amino acid

90-100% identity among V. parahaemolyticus strains. Moreover 63-68%, identity to

exoenzyme T of Providencia alcalifaciens, and 45% identity to ADP-ribosyltransferase of

Pseudomonas aeruginosa. In addition, VPA1327 homologous was absence in

V. alginolyticus and other Vibrio species. Therefore, VPA1327 specific primer pair was

designed and used to confirm whether this gene was specific for V. parahaemolyticus

strains.

The presence of vpa1327 was examined in several bacterial strains using

PCR. The PCR results (Table 5.3) showed that vpa1327 could be exclusively detected in

V. parahaemolyticus clinical isolates.

Ref. code: 25605612040039JID

68

Table 5.2 Result of chromosome 2 comparison between V. parahaemolyticus and

V. alginolyticus

Region of difference (bp)

Size (bp) Locus_tag/Gene ID No. of CDS

Unique CDS

V. parahaemolyticus

1,387,440 - 1,453,994 66,554 VPA1310 - VPA 1380 71 VPA1327

VPA1331

1,326,051 - 1,358,208 32,157 VPA1253 - VPA1278 26 VPA1262

740,908 - 767,244 26,336 VPA0713 - VPA0736 24 not found

V. alginolyticus

928,087 -1,026,046 97,960 N646_3955 - N646_4019 62 not found

310,510 -332,280 21,771 N646_3361 - N646_3378 18 not found

1,661,472 - 1,695,444 33,973 N646_4598 - N646_4612 13 not found

1,495,914-1,528,846 32,933 N646_4451 - N646_4473 23 not found

1,589,650-1,609,660 20,011 N646_4530 - N646_4549 19 not found

1791589 - 1812170 20,582 N646_4704 - N646_4722 18 not found

792477 - 806771 14,295 N646_3827 - N646_3837 11 not found

1576073 - 1588282 12,210 N646_4518 - N646_4527 10 not found

1542284 - 1554911 12,628 N646_4489 - N646_4498 10 not found

1326110 - 1338510 12,401 N646_4286 - N646_4301 17 not found

1122075 - 1135679 13,605 N646_4107 - N646_4110 4 not found

65501 - 76216 10,716 N646_3143 - N646_3150 8 not found

21373 - 31108 9,736 N646_3104- N646_3109 6 not found

1078297 - 1088085 9,789 N646_4067 - N646_4076 8 not found

837233 - 846102 8,870 N646_3868 - N646_3875 7 not found

760064 - 767937 7,874 N646_3797 - N646_3802 6 not found

1734905-1742793 7,889 N646_4656 - N646_4664 10 not found

362442 - 370015 7,574 N646_3402 - N646_3408 8 not found

1039957 - 1046654 6,698 N646_4031 - N646_4036 7 not found

58019 - 64044 6,026 N646_3136 - N646_3140 4 not found

221025 - 226538 5,514 N646_3284 - N646_3289 6 not found

593444 - 597502 4,059 N646_3626 - N646_3628 3 not found

112591 - 117010 4,420 N646_3182 - N646_3184 3 not found

185757 - 190444 4,688 N646_3245- N646_3250 5 not found

Ref. code: 25605612040039JID

69

Table 5.2 Result of chromosome 2 comparison between V. parahaemolyticus and

V. alginolyticus (Cont.)

Region of difference (bp)

Size (bp) Locus_tag/Gene ID No. of CDS

Unique CDS

1763704 - 1767029 3,326 N646_4681- N646_4683 3 not found

1186466 - 1189707 3,242 N646_4152 - N646_4155 4 not found

89138 - 92404 3,267 N646_3162 - N646_3163 2 not found

1367380 - 1370516 3,137 N646_4334 - N646_4337 4 not found

259432 - 263388 3,957 N646_3322 - N646_3326 5 not found

572658 - 575152 2,495 N646_3608 - N646_3610 3 not found

Table 5.3 PCR amplification of VPA1327 gene of V. parahaemolyticus and other Vibrio species

Type of sample No. of sample

PCR result

16SrRNA112 ToxR9 vpa1327

V. parahaemolyticus

clinical isolate

39 39 39 25

V. parahaemolyticus

Seafood isolate

35 35 35 0

Other Vibrionaceae 34 34 0 0

5.2.2 Identification of amino acid sequence unique to V. parahaemolyticus and

V. alginolyticus

Since unique protein, VPA1327, identified by chromosomal comparison was

not present in all strains of V. parahaemolyticus, new target protein was examined.

Several previous studies detected this organism by targeting the ToxR gene. Thus, amino

acid sequences of ToxR of several strains of V. parahaemolyticus and V. alginolyticus

were compared by multiple alignment. Multiple alignment revealed 91.4% identity

between these two organism and the region of different was show in a region of amino

acid residue number 117 to 240 (Figure 5.11). This region was used for searching specific

Ref. code: 25605612040039JID

70

epitopes of both Vibrio spp. and subsequently in silico designed the peptides for those

epitopes (Section 4.3.2). The specific peptides designed for V. parahaemolyticus and

V. alginolyticus were “SIEVEEPASDNNDAS” and “SDTPPTEIVTDTTAD”,

respectively.

5.3 Production of rVP-ToxR and rVA-ToxR

5.3.1 Construction of toxR-encoded rVP-ToxR and rVA-ToxR

According to methods described in Section 4.4.1, ToxR gene of

V. parahaemolyticus (VP-toxR) and V. alginolyticus (VA-toxR) were amplified. Their

amplification size were 897 and 494 bp, respectively. Both genes were cloned into pGEM-

T vector to construct recombinant plasmid DNA, pGEM-T-VP-toxR and pGEM-T-VA-

toxR, respectively. Subsequent extraction from the gel and purification, both recombinant

plasmids and their corresponding expression vector were digested according to the

Section 4.4.2.2. The purified digested VP-toxR and pGEX4T-1 as well as was digested

VA-toxR and pET32a+ were shown in Figures 5.12 and 5.13, respectively.

Ref. code: 25605612040039JID

71

Figure 5.11 Multiple alignments of amino acid sequences of V. parahaemolyticus and

V. alginolyticus ToxR protein. The region of different was in a region of amino acid

residue number 117 to 240 showed in the blue color –shaded box and the designed

specific peptide was indicated in the squared boxes. (*, identical amino acid)

Ref. code: 25605612040039JID

72

Figure 5.12 Purified VP-toxR (A) and pGEX4T-1 (B) cut with restriction enzymes,

BamH I and Sal I

Lane M, GeneRulerTM 100 bp plus DNA ladder

Lane 1, Purified BamH I and Sal I digested VP-toxR (A) and pGEX4T-1 (B)

Numbers on the left represent DNA size markers in bp

Figure 5.13 Purified VA-toxR (A) and pET32a+ (B) cut with restriction enzymes, BamH

I and Hind III

Lane M, GeneRulerTM 100 bp plus DNA ladder

Lane 1, Purified BamH I and Hind III digested VA-toxR (A) and pET32a+ (B)

Numbers on the left represent DNA size markers in bp

Ref. code: 25605612040039JID

73

The digested VP-toxR was ligated into digested pGEX4T-1 whereas VA-toxR

was ligated into digested pET32a+, respectively. The DNA ligated plasmid was

transformed into the competent BL21 (DE3) E. coli cells. The E. coli clones carrying toxR

genes were screened by colony PCR. For screening of pGEX4T-1::VP-toxR transformed

E. coli clones were screened, 12 of 13 clones were positive (Figure 5.14). Similarly, all

six colonies of the screened pET32a+::VA-toxR transformed E. coli clones were positive

(Figure 5.15). Several positive clones from each gene construction were selected for

evaluating whether they were inducible rVP-ToxR and rVA-ToxR protein expression

clones.

Figure 5.14 Screening of VP-toxR in transformed BL21 E. coli clones

Lane M, GeneRulerTM 100 bp plus DNA ladder

Lanes 1 - 13, Colonies No. 1-13

Lanes N and P, No template control and positive control, respectively

Numbers on the left represent DNA size markers in bp

VP-toxR (∼897 bp)

Ref. code: 25605612040039JID

74

Figure 5.15 Screening of VA-toxR in transformed BL21 (DE3) E. coli clones

Lane M, GeneRulerTM 100 bp plus DNA ladder

Lanes 1-6, Colonies No. 1-6

Lane N, No template control

Lane P, Positive control, respectively

Numbers on the left represent DNA size markers in bp

5.3.2 Expression and purification of rVP-ToxR and rVA-ToxR

To explore the rVP-ToxR and rVA-ToxR expressible clones, the PCR

positive clones selected in the previous section were induced in small scale induction with

optimal IPTG concentration and culturing condition as described in Section 4.4.3.

Afterward, the protein expression was verified by SDS-PAGE and Western blot analysis.

Figure 5.16 showed an example of SDS-PAGE and Western blot analysis of rVP-ToxR

protein induced expression with 1 mM IPTG, and incubated 37°C for 3 hours. The same

expression condition was used for rVP-ToxR expression. The purification profile of rVA-

ToxR shown in Figure 5.17 was representative SDS-PAGE and Western blot analysis

demonstrating protein purification profiles. Both recombinant proteins were insoluble

protein which were used denaturing condition for purification. Finally, the purified

denaturing rVP-ToxR and rVA-ToxR were refolded in 2 M urea.

VA-toxR (∼494 bp)

Ref. code: 25605612040039JID

75

Figure 5.16 SDS-PAGE (A) and western blot analysis (B) of the expressed rVP-ToxR-

GST fusion protein

Lane M, Standard protein marker showed the relative size in kDa on the left

Lane 1, Purified GST protein

Lanes 2-3, Un-induce and IPTG induced E. coli lysate, respectively

Lane 4, Soluble fragments of the expressed protein

Lane 5, insoluble fragments of the expressed protein

Arrow indicated the expected size of rVP-ToxR-GST fusion protein (~58 kDa)

rVP-ToxR-GST

GST

Ref. code: 25605612040039JID

76

Figure 5.17 SDS-PAGE (A) and Western blot analysis (B) of rVA-ToxR protein

purification profiles. The protein was purified using Ni-NTA agarose affinity

chromatography and stepwise elution with various concentration of imidazole.

Lane M, Standard protein marker showed the relative size in kDa on the left

Lane 1, Crude lysate of BL21 (DE3) E. coli containing recombinant rVA-ToxR

Lane 2, Flow through/unbound fraction

Lanes 3-4, Washed fractions

Lanes 5-9, Protein fractions eluted with 50, 100, 150, 200 and 300 mM imidazole,

respectively.

Arrow indicated the expected size of rVA-ToxR protein (~37.5 kDa)

Ref. code: 25605612040039JID

77

5.4 Selection of VP and VA specific scFv phages from scFv phage antibody library

Bio-panning (Section 4.6.1) is a method used for selecting phages bound to the

target protein fixed on the solid phage. In this study, the synthesized peptides/biotin

conjugated peptides were coated on the magnetic beads or wells of high-binding ELISA

plate. Blocking the coated surface with BSA. The BSA/BSA-biotin bound phages were

firstly depleted from the scFv phages library and the BSA-depleted phages were

subsequently bound to the peptide coated beads or BSA-biotin coated wells. The peptide

bound scFv phages were eluted by cleaving of trypsin and suddenly infected XL-1 Blue

E. coli. The E. coli infected scFv phage clones were individually rescued (Section 4.6.2),

verified the presence of scfv, and tested their capability of binding to the autologous

peptide compared to that of binding to BSA (Section 4.6.3). The scFv phage clones that

showed the ratio of OD405 between peptide and BSA ≥ 2 were considered as positive

binding. Figure 5.18 showed the representative scFv phage clones of which binding

activities (measuring OD405) were compared between binding to their corresponding

peptide and to BSA. Since few positive scFv phage clones were obtained, several bio-

panning were performed. The number of rescued phage clones and number of positive

clones obtained from each bio-panning was summarized in Table 5.4.

Ref. code: 25605612040039JID

78

Table 5.4 Summary of the number of positive scFv phage clones obtained from bio-

panning,

Bio-panning No.

Number of scFv phage clones which were

scfv verified

clones

rescued

phage clones

positive binding

phage clones

V. parahaemolyticus

1st Bio-panning 233 140 37

2nd Bio-panning 98 98 8

3rd Bio-panning 80 80 8

V. alginolyticus

1st Bio-panning 183 134 23

2nd Bio-panning 12 12 5

3rd Bio-panning 27 27 1

4th Bio-panning 20 120 3

Figure 5.18 Binding activity of the representative scFv phage clones

Ref. code: 25605612040039JID

79

The positive scFv phage clones were examined peptide specific binding using their

own peptide used for bio-panning and also ToxR peptides of other Vibrio spp. as well as

an irrelevant peptide. The positive clones giving binding activity ratio to other peptides

≥ 2 were selected for producing recombinant scFv protein.

5.5 Production of recombinant scFv antibodies

5.5.1 Expression of recombinant scFv antibodies

The positive binding scFv phage clones selected from the previous section

were subjected to produce the recombinant scFv antibodies according to the methods

described in Section 4.7. Finally, only 8 scFv antibody clones were expressed. Four of

them namely VA34.1, VA74.1, VA87.1 and VA120.1 are antibodies specific to

V. alginolyticus, while, another four clones specific to V. parahaemolyticus including scFv

clone named VP20.7, VP59.7, VP61.3 and VP62.13. These scFv antibodies were verified

by SDS-PAGE and Western blot analysis probed with anti-c-Myc tag. The result of the

Western blot analysis showed the size of all tested scFv antibodies were approximately

30-33 kDa and most of them were insoluble protein (Figure 5.19).

Ref. code: 25605612040039JID

80

Figure 5.19 Recombinant scFv antibodies probed with anti-c-Myc Tag monoclonal

antibody.

Lane M, Pre-stained standard protein ladder, the size in kDa were shown on the

left

Lanes 1-2, Non-induced and IPTG induced expression, respectively

Lanes 3-4, Soluble and insoluble fractions of IPTG induced expression,

respectively

Ref. code: 25605612040039JID

81

5.5.2 Characterization of recombinant scFv antibody

To test the specific binding of the eight scFv antibodies, indirect ELISA,

Dot-ELISA and/or Western blot analysis were performed. Firstly, the binding activity

against the peptide were re-tested by an indirect ELISA as previously done for the scFv

phage binding described in Section 4.6.3. Unfortunately, the specific peptide binding of

these scFv antibodies could not be demonstrated.

Dot-ELISA was an alternative method testing binding ability of scFv

antibody to the recombinant ToxR protein. The recombinant ToxR protein of Vibrio

species i.e., V. parahaemolyticus, V. alginolyticus, V. cholerae, V. vulnificus and

V. harveyi were used as antigens dotted onto NCM. The results of Dot-ELISA shown in

Figure 5.20 revealed that all of eight scFv antibodies could bind to rVP-ToxR. Three of

four scFv antibodies V. parahaemolyticus i.e., VP20.7, VP59.7, and VP62.13 were reacted

exclusively to VP-ToxR. For the four of scFv antibodies to V. alginolyticus, two of them,

VA74.1 and VA34.1, reacted to all tested rToxR while another two, VA87.1 and

VA120.1, reacted to VP-ToxR instead of binding to the rVA-ToxR

Ref. code: 25605612040039JID

82

Figure 5.20 Dot-ELISA showing binding of the scFv antibodies to the rToxR protein of

Vibrio spp.

Strip 1, Negative control

Strips 2-9, Protein dotted strips reacted with scFv antibodies, VP61.3, VP20.7,

VP59.7, VP62.13, VA74.1, VA34.1, VA87.1 and VA120.1,

respectively

Antigens: rVC-ToxR, rVV-ToxR, rVH-ToxR are the recombinant ToxR proteins

of V. cholerae, V. vulnificus and V. harveyi, respectively

Since V. alginolyticus scFv antibodies did not reacted with rVA-ToxR by

Dot-ELISA, the Western blot analysis was used as an alternative method. The result

shown in Figure 5.21 revealed that all 4 V. alginolyticus scFv antibodies could react and

produced positive band at the correct size of rVA-ToxR

Ref. code: 25605612040039JID

83

Figure 5.21 Western blot analysis showed the reaction bands of V. alginolyticus scFv

antibodies reacted to the rToxR protein of Vibrio spp. separated by SDS-PAGE

Lane M, Standard protein ladder, No. on the left indicated the size in kDa

Lane P, Positve control showed expected bands of rToxR probed with rabbit

anti-GST for rVP-ToxR and with mouse anti-His tag for the others

Lane N, Negative control, a strip reacted with diluent

Lanes 1-4, Strips reacted with scFv antibodies, VA74.1, VA34.1, VA87.1, and

VA120.1, respectively.

Arrow indicated the expected bands of rToxR protein of each Vibrio spp.

Ref. code: 25605612040039JID

84

CHAPTER 6

DISCUSSION

6.1 Production of scFv phage library

In this study, a mouse scFv antibody library was constructed. This library is a naïve

or single pot scFv library that derived from primary B cells isolated from non-immunized

mice.31,35 To obtain the high diversity of B cell repertoire, the spleen cells of 3 strains of

mice, i.e., ICR, BALB/C and C57BL/6 were used for RNA preparation. The mouse IgG

library primer set was purchased from PROGEN Biotechnik (Germany). The primers were

designed to cover all families of Ig-coding sequences collection from Kabat

Database.117,118 The primers were divided into two sets, the first set allows the

amplification of rearranged mouse Ig genes of individual B cell populations while the

second set of the homologous primers containing restriction endonuclease sites for the

propose of cloning the amplified Ig gene into the expression vector. For the amplification

of VH and VL with the primers set 1, the results were shown that all pairs of primer could

produce the VH and VL amplicons. This result implied that the cDNA pooled from three

mouse strains contained all classes of Ig genes.

The constructed scFv phage library contained 8.75 × 109 cfu of mouse scFv phage

clone which is large enough for representation of a murine antibody repertoire supported

by the two previous studies reported by Okamoto et al. (2004)119 and Imai et al. (2006).120

The naïve or non-immune mouse scFv library generated by them are the size of 5 × 108

and 2.4 × 109 individual clones, respectively. The obtaining of those two libraries was

similar to this study. They used the set of primers designed from the Kabat database118 and

also used of 3 different mouse strains to prepare the cDNA for amplification of all Ig

genes. In addition, to evaluate the usefulness of the library, they performed bio-panning

against many antigens. The scFv antibody could be isolated from their libraries revealed

the high specificity and diversity of the scFv antibody.119,120

Thus, the scFv antibody phage library prepared in this study could also be used to

produce specific scFv antibodies specific to V. parahaemolyticus and V. alginolyticus.

However, the appropriate antigen or target antigen for each species should be identified

firstly.

Ref. code: 25605612040039JID

85

6.2 Searching proteins unique to V. parahaemolyticus and V. alginolyticus

As mention earlier, the target antigen which is unique to each species should be

identified. The genome comparison is an appropriate method for this purpose. It is

generally used to indicate the genome regions or organization that is either share or

specific to individual strain or species of organism.121 The chromosome 2 of

V. parahaemolyticus and V. alginolyticus was choosing for comparison because it contains

mostly the accessory genes or unnecessary parts, which associated with genome

exchanging between organism (horizontal gene transfer) and the genes that related to

adaptation to the environmental change. In contrast, the chromosome 1 contains core

genome or necessary genes essential for growth and viability.121-123 Thus, the chromosome

2 has more possibility to found the unique gene or protein more than that of chromosome

1. More than 400 ORF in different region of V. parahaemolyticus and V. alginolyticus

were performed BALSTX against non-redundant database (nr). VPA1327 exoenzyme T,

VPA1331 OspC2, and VPA1262 hypothetical protein were found only in

V. parahaemolyticus. Finally, the VPA1327 was selected to be the target antigen for

selection of scFv phage antibody from the constructed library.

The vpa1327 (vopT) locates on the pathogenicity island of V. parahaemolyticus

chromosome 2. This gene encodes VopT which is homologous to an Exoenzyme T of

Pseudomonas aeruginosa.83,90 The primers for amplification of vpa1327 were designed

and verified the specificity using PCR. The specificity test of vpa1327 was revealed that

this gene is specific to V. parahaemolyticus strains isolated from merely clinical sample.

Subsequently, this marker was more evaluated, and it was found that vpa1327 coexist with

tdh.124 From the vpa1327 PCR screening in V. parahaemolyticus and other Vibrio species

(Table 5.3), it was found that vpa1327 could be a new target marker for detection and

identification of the pathogenic V. parahaemolyticus strains.124 Therefore, this gene was

not appropriate to use as a marker for detecting V. parahaemolyticus. This failure leads to

searching for a new specific target for differentiation of V. parahaemolyticus and

V. alginolyticus.

To date, toxR is widely used for specific detection of V. parahaemolyticus. 125–128

Thus, toxR was selected for a new target antigen. The toxR firstly identified in V. cholerae

encodes for the transcription regulator.129 This gene was shown to play a pivotal role in

Ref. code: 25605612040039JID

86

the coordinate regulation of ctx and many other virulence genes, including the tcp gene

encoding toxin-coregulated pili, the ompU and ompT genes encoding major outer

membrane proteins.130 In contrast to VPA1327, ToxR can be found in many Vibrio

species, and more than 80% of the sequences are similar to all of Vibrio species. The

multiple alignments of Vibrio ToxR amino acid sequences revealed that the high variation

of the ToxR sequences among Vibrio species occur at the region of ToxR membrane

tethering.131,132 Therefore, this region is appropriate for using as a target marker for

differentiation of the Vibrio species.9 This study focus on the ToxR of only two species,

V. parahaemolyticus, and V. alginolyticus. The ToxR sequences of both species were

aligned together to reveal the difference region and predict the linear epitope of this region

specific to each species. The designed peptide sequences were used as antigens in bio-

panning for selection of phage displaying particular scFv antibody.

6.3 Selection of scFv phage antibody specific to V. parahaemolyticus and

V. alginolyticus

The bio-panning is a process of selection of the phage clones which are specific to

the desired targets. The selection is based principally on the affinity of scFv phage binding

to the target. Bio-panning can be performed in several ways. The most common method is

directly immobilization of target antigen on the surface of the solid supports. The

supportive materials could be an whole cells, tissue section or nanobead (for in solution

panning).34,133

Several studies reported previously demonstrated the use of short peptide for

isolating the specific antibodies from the scFv phage library, such as scFv phage specific

to 1-IBB receptor134, and to the conserved regions of VecA toxin of Helicobactor piroli.135

The present study is the first one using in silico designs the peptide sequences containing

an epitope specific to the ToxR of V. parahaemolyticus and V. alginolyticus. The panning

was carried out in soluble phase as described elsewhere.47,138 The target peptides were

allowed to immobilized on the surface of magnetic beads which coupling with covalent

bond to enhance the strong immobilization and present its own conformational epitope

without structural alteration34 resulting in enhanced accessibility of target association

ligand binding sites.133 In order to reduce non-specific binder scFv phage, the phage

Ref. code: 25605612040039JID

87

library was incubated with BSA to absorb the non-specific binder scFv phages, therefore

the possibility to get specific antibody was increased.59,136 Moreover, in each step of bio-

panning, i.e., binding, washing, and elution, the immobilized magnetic beads were

transferred to a new plastic tube to decrease non-specific phages binding to plastic wall of

the tube.137 The phage infected E. coli clones obtained subsequently from the bio-panning

possessed high proportion of the clones (nearly 100%) carrying scfv. This result

demonstrated that the size of the so constructed library is big enough for success

separation of the antibody specific to any target protein or even a small peptide.

The PCR scFv positive colonies obtained from bio-panning were grown and rescued

with helper phage M13KO7 to increase the yield of scFv phages for the binding activity

test using phage ELISA. The binding activity of any phage clone giving OD405 of Peptide-

Biotin/BSA-Biotin ratio ≥ 2 was selected for specificity testing. Also, any phage clone

without cross binding to the ToxR peptide from other species was chosen for production

of scFv monoclonal antibody. From the phage ELISA result, it was shown that the binding

activity of scFv phage clones to the target peptide was lower than BSA control. The

possible reasons for this result could be: Firstly, the immobilization of the target antigen

on surface of microtiter wells plate instead of using an insoluble phase. The target antigen

may be denatured or changed the appearance configuration resulting from coating agent

and pH of immobilization condition. Changing of antigen form may be resulting in losing

binding activity of some phage clones.137 Secondly, the peptide antigens used in phage

ELISA was conjugated with biotin. The molecule of biotin which is great bigger than the

peptide could be interfered the binding affinity of scFv phage clones. Moreover, some

phage clones have inserted scFv sequence that impedes the phage assembly process

resulting in slow replicated and have genetic instability. These phage clones tend to delete

the unnecessary inserted DNA or tend to display only its p3 for its propagation advantage.

Therefore, the phage clone may loss of binding affinity after phage rescued process.136,138

Ref. code: 25605612040039JID

88

6.4 Binding and specificity of scFv antibody against V. parahaemolyticus and

V. alginolyticus

The eight scFv phage clones with the binding activity ratio of Peptide-biotin/BSA-

biotin ≥ 2, as well as low binding activity against BSA (OD405 of BSA < 0.1) were

choosen for subcloning and expression of scFv antibody. Total eight clones were choosen,

i.e., scFv clones namely VA34.1, VA74.1, VA87.1, VA120.1, VP20.7, VP59.7, VP61.3

and VP62.13.

The so produced scFv monoclonal antibodies were initially characterized using an

indirect ELISA. Several attempts were put to achieve the optimal binding condition.

However, the binding activity could not be demonstrated by this method. The cause of the

failure may be using recombinant scFv solubilized in 2 M urea which may be effect to the

antibody binding site or changing the conformation of scFv molecule or coating antigen

interfering their binding properties. To avoid this problem, therefore, the soluble antibody

should be used in the assay. More attempts in adjusting the expression condition or

completely refold the inclusion protein for the correct conformation. Consequently, the

alternative methods, which are Dot-ELISA and Western blot analysis were performed.

The results of Dot-ELISA were shown that all eight scFv antibodies could bind to rVP-

ToxR indicated that these antibodies bound to the common epitope of the Vibrio spp.

present in rVP-ToxR. Similarly, all clones of V. alginolyticus scFv mAb showed a weak

binding signal to the recombinant VA-ToxR but they bind strongly to recombinant ToxR

from V. parahaemolyticus. This result could be explained by the same reason as just

described previously. Furthermore, the Western blot analysis revealed that all

V. alginolyticus scFv antibodies could bind to the right site of the rVA-ToxR. However,

the scFv antibodies of V. parahaemolyticus and V. alginolyticus produced in the present

study need more characterization and validation to ensure that they are high potential

antibodies for the immunoassay application.

Ref. code: 25605612040039JID

89

CHAPTER 7

CONCLUSIONS

This study which has an ultimate aim of producing scFv monoclonal antibody

specific to V. parahaemolyticus and V. alginolyticus. In order to achieve the objective,

several intermediate results or products need to be prepared. These products are also be

counted as the outputs of this study which are the following:

1. The murine scFv phage library generated from 3 strains of non-immunized

mice, i.e., ICR, BALB/c and C57BL/6 by antibody phage display technology. This library

contained 8.75 × 109 individual scFv phage clone. There are 82.9% of these phage clones

carrying full length of scfv of which diversity was 90.3% determined by using RFLP.

2. The VPA1327 (vopT) encoding for an exoenzyme T of V. parahaemolyticus

obtained from the comparison between the chromosome 2 of V. parahaemolyticus and

V. alginolyticus. This gene is unique to the V. parahaemolyticus and was proposed as a

novel genetic marker for identification of the pathogenic V. parahaemolyticus.

3. Exclusive peptide sequences containing specific epitope of ToxR protein of

V. parahaemolyticus and of V. alginolyticus.

4. The fusion protein GST-VP-ToxR is ~58 kDa in size whereas the size of

TRX-VA-ToxR-6-His-tag fusion protein is ~ 32.8 kDa.

5. Finally, the total of eight scFv monoclonal antibodies were produced. The

four of them namely VA34.1, VA74.1, VA87.1, and VA120.1 are specific to

V. alginolyticus, and the other four called as VP20.7, VP59.7, VP61.3, and VP62.13 are

specific to V. parahaemolyticus. All scFv antibodies are approximately 30 - 33 kDa in size

and most of them were insoluble protein. The binding activity was tested against their

corresponding recombinant ToxR proteins demonstrated by the Western blot analysis and

Dot-ELISA. The Dot-ELISA revealed that all of eight scFv antibodies could bind to rVP-

ToxR. Three of the V. parahaemolyticus scFv antibodies, i.e., VP20.7, VP59.7, and

VP62.13 were reacted exclusively to VP-ToxR. The Western blot analysis was shown that

all 4 V. alginolyticus scFv antibodies bind to their target appearing as reactive band at the

correct size of rVA-ToxR.

Ref. code: 25605612040039JID

90

REFERANCES

1. Gauthier DT. Bacterial zoonoses of fishes: a review and appraisal of evidence for

linkages between fish and human infections. Vet J Lond Engl 1997. 2015;203:27–35.

2. Reilly GD, Reilly CA, Smith EG, Baker-Austin C. Vibrio alginolyticus-associated

wound infection acquired in British waters, Guernsey. Euro Surveill Bull Eur Sur Mal

Transm Eur Commun Dis Bull. 2011;16.

3. Mustapha S, Ennaji MM, Cohen N. Vibrio alginolyticus: An emerging pathogen of

foodborne diseases. Maejo Int J Sci Technol. 2013;2:302–9.

4. Monchanok Boonyahong. Detection of Vibrio parahaemolyticus in seafood by dot-

ELISA and characterization of their pathogenic potential [master’s thesis]. [Pathumthani,

Thailand]: Thammasat University; 2012.

5. Hara-Kudo Y, Nishina T, Nakagawa H, Konuma H, Hasegawa J, Kumagai S.

Improved method for detection of Vibrio parahaemolyticus in seafood. Appl Environ

Microbiol. 2001;67:5819–23.

6. Bauer A, Rørvik LM. A novel multiplex PCR for the identification of Vibrio

parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. Lett Appl Microbiol.

2007;45:371–5.

7. Robert-Pillot A, Guenole A, Fournier JM. Usefulness of R72H PCR assay for

differentiation between Vibrio parahaemolyticus and Vibrio alginolyticus species:

validation by DNA-DNA hybridization. FEMS Microbiol Lett. 2002;215:1–6.

8. Pinto AD, Ciccarese G, Fontanarosa M, Terio V, Tantillo G. Detection of Vibrio

alginolyticus and Vibrio parahaemolyticus in shellfish samples using collagenase-targeted

multiplex-PCR. J Food Saf. 26:150–9.

9. Kim YB, Okuda J, Matsumoto C, Takahashi N, Hashimoto S, Nishibuchi M.

Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to

the toxR gene. J Clin Microbiol. 1999;37:1173–7.

10. Bej AK, Patterson DP, Brasher CW, Vickery MCL, Jones DD, Kaysner CA.

Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using

multiplex PCR amplification of tl, tdh and trh. J Microbiol Methods. 1999;36:215–25.

Ref. code: 25605612040039JID

91

11. Klein SL, Gutierrez West CK, Mejia DM, Lovell CR. Genes similar to the Vibrio

parahaemolyticus virulence-related genes tdh, tlh, and vscC2 occur in other Vibrionaceae

species isolated from a pristine estuary. Appl Environ Microbiol. 2014;80:595–602.

12. Xie Z-Y, Hu C-Q, Chen C, Zhang L-P, Ren C-H. Investigation of seven Vibrio

virulence genes among Vibrio alginolyticus and Vibrio parahaemolyticus strains from the

coastal mariculture systems in Guangdong, China. Lett Appl Microbiol. 2005;41:202–7.

13. Ahmad ZA, Yeap SK, Ali AM, Ho WY, Alitheen NBM, Hamid M. scFv antibody:

principles and clinical application. Clin Dev Immunol. 2012.

14. Abbas AK, Lichtman AHH, Pillai S. Cellular and molecular immunology. 7th ed.

Philadelphia:Elsevier Health Sciences;2011.

15. Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. Molecular Biology of

the Cell. 5th ed. NY:Garland Science;2007.

16. Köhler G, Milstein C. Continuous cultures of fused cells secreting antibody of

predefined specificity. Nature;1975:495–7.

17. Owen JA, Punt J. Kuby Immunology. 7th ed. NY:W.H. Freeman and company;2013.

18. Goldsby RA, Kuby J, Thomas J. Kindt, Barbara A. Osborne. Kuby Immunology. 5th

ed. NY:W. H. Freeman;2007.

19. Murphy KM. Janeway’s Immunobiology. 8th ed. NY:Garland Science;2011.

20. Edwards PA. Some properties and applications of monoclonal antibodies. Biochem

J. 1981;200:1–10.

21. Ansar W, Ghosh S. Monoclonal antibodies: a tool in clinical research. Indian J Clin

Med. 2013;2013:9–20.

22. classes.midlandstech.edu/. monoclonal antibodies [Internet]. Specific defenses of the

host: the immune response. [Cited 2014 Nov 24]. Available at:http://classes.midlandstech.

edu/carterp/Courses/bio225/chap17/ss4.htm.

23. Klimka A, Matthey B, Roovers RC, Barth S, Arends JW, Engert A, et al. Human

anti-CD30 recombinant antibodies by guided phage antibody selection using cell panning.

Br J Cancer. 2000;83:252–60.

24. Watkins NA, Ouwehand WH. Introduction to antibody engineering and phage

display. Vox Sang. 2000;78:72–9.

Ref. code: 25605612040039JID

92

25. Skerra A, Plückthun A. Assembly of a functional immunoglobulin Fv fragment in

Escherichia coli. Science. 1988;240:1038–41.

26. Better M, Chang CP, Robinson RR, Horwitz AH. Escherichia coli secretion of an

active chimeric antibody fragment. Science. 1988;240:1041–3.

27. Ho M, Nagata S, Pastan I. Isolation of anti-CD22 Fv with high affinity by Fv

display on human cells. Proc Natl Acad Sci USA. 2006;103:9637–42.

28. Huston JS, Levinson D, Mudgett-Hunter M, Tai MS, Novotný J, Margolies MN,

et al. Protein engineering of antibody binding sites: recovery of specific activity in an anti-

digoxin single-chain Fv analogue produced in Escherichia coli. Proc Natl Acad Sci USA.

1988;85:5879–83.

29. Alfthan K, Takkinen K, Sizmann D, Söderlund H, Teeri TT. Properties of a single-

chain antibody containing different linker peptides. Protein Eng. 1995;8:725–31.

30. Whitlow M, Bell BA, Feng S-L, Filpula D, Hardman KD, Hubert SL, et al. An

improved linker for single-chain Fv with reduced aggregation and enhanced proteolytic

stability. Protein Eng. 1993;6:989–95.

31. Hassan M. E. Azzazy, W. Edward Highsmit. Phage display:clinical applications and

recent innovations. Clin Biochem. 2002:425–45.

32. Hust M, Dübel S. chapter 5 Human Antibody Gene Libraries. In: Kontermann RE,

Dubel S, Editors. Antibody Engeneering. 2nd ed. Berlin: Springer Science & Business

Media. 2010:p. 65-84.

33. Ponsel D, Neugebauer J, Ladetzki-Baehs K, Tissot K. High affinity, develop ability

and functional size: the holy grail of combinatorial antibody library generation. Mol Basel

Switz. 2011;16:3675–700.

34. Haque A, Tonks NK. Use of phage display to generate conformation-sensor

recombinant antibodies. Nat Protoc. 2012;7:2127–43.

35. Hoogenboom HR, de Bruı̈ne AP, Hufton SE, Hoet RM, Arends J-W, Roovers RC.

Antibody phage display technology and its applications. Immunotechnology. 1998;4:1–

20.

36. Chester KA, Begent RHJ, Robson L, Keep PA, Pedley RB, Boden LIBiol JA, et al.

Phage libraries for generation of clinically useful antibodies. The Lancet. 1994;343:455–6.

37. Clackson T, Hoogenboom HR, Griffiths AD, Winter G. Making antibody fragments

using phage display libraries. Nature. 1991;352:624–8.

Ref. code: 25605612040039JID

93

38. Barbas III CF, Kang AS, Lerner RA, Benkovic SJ. Assembly of combinatorial

antibody libraries on phage surfaces: the gene-III site. Natl Acad Sci USA. 1991;88:7978–

82.

39. Cai X, Garen A. Anti-melanoma antibodies from melanoma patients immunized

with genetically modified autologous tumor cells: selection of specific antibodies from

single-chain Fv fusion phage libraries. Proc Natl Acad Sci. 1995;92:6537–41.

40. Lang IM, Barbas III CF, Schleef RR. Recombinant rabbit Fab with binding activity

to type-1 plasminogen activator inhibitor derived from a phage-display library against

human α-granules. Gene. 1996;172:295–8.

41. Davies EL, Smith JS, Birkett CR, Manser JM, Anderson-Dear DV, Young JR.

Selection of specific phage-display antibodies using libraries derived from chicken

immunoglobulin genes. J Immunol Methods. 1995;186:125–35.

42. Yamanaka HI, Inoue T, Ikeda-Tanaka O. Chicken monoclonal antibody isolated by

a phage display system. J Immunol Baltim Md 1950. 1996;157:1156–62.

43. Arbabi Ghahroudi M, Desmyter A, Wyns L, Hamers R, Muyldermans S. Selection

and identification of single domain antibody fragments from camel heavy-chain

antibodies. FEBS Lett. 1997;414:521–6.

44. Altshuler EP, Serebryanaya DV, Katrukha AG. Generation of recombinant

antibodies and means for increasing their affinity. Biochem Biokhimiia. 2010;75:1584–

605.

45. Little M, Kipriyanov SM, Le Gall F, Moldenhauer G. Of mice and men: hybridoma

and recombinant antibodies. Immunol Today. 2000;21:364–70.

46. Hu Z-Q, Li H-P, Zhang J-B, Huang T, Liu J-L, Xue S, et al. A phage-displayed

chicken single-chain antibody fused to alkaline phosphatase detects Fusarium pathogens

and their presence in cereal grains. Anal Chim Acta. 2013;764:84–92.

47. Xue S, Li H-P, Zhang J-B, Liu J-L, Hu Z-Q, Gong A-D, et al. Chicken single-chain

antibody fused to alkaline phosphatase detects Aspergillus pathogens and their presence in

natural samples by direct sandwich enzyme-linked immunosorbent assay. Anal Chem.

2013;85:10992–9.

48. Grewal YS, Shiddiky MJA, Spadafora LJ, Cangelosi GA, Trau M. Nano-yeast-scFv

probes on screen-printed gold electrodes for detection of Entamoeba histolytica antigens

in a biological matrix. Biosens Bioelectron. 2014;55:417–22.

Ref. code: 25605612040039JID

94

49. Sharma GK, Mahajan S, Matura R, Subramaniam S, Mohapatra JK, Pattnaik B.

Production and characterization of single-chain antibody (scFv) against 3ABC non-

structural protein in Escherichia coli for sero-diagnosis of Foot and Mouth Disease virus.

Biol J Int Assoc Biol Stand. 2014;42:339–45.

50. Fuchs M, Kämpfer S, Helmsing S, Spallek R, Oehlmann W, Prilop W, et al. Novel

human recombinant antibodies against Mycobacterium tuberculosis antigen 85B. BMC

Biotechnol. 2014;14:68.

51. Smith GP. Filamentous fusion phage: novel expression vectors that display cloned

antigens on the virion surface. Science. 1985;228:1315–7.

52. Webster RE. Chapter 1 Biology of the filamentous bacteriophage. In: Kay BK,

Winter J, McCafferty J, Editors. Phage Display of Peptides and Proteins: a Laboratory

Manual. San Diego: Academic Press; 1996. p.1–20.

53. Chasteen L, Ayriss J, Pavlik P, Bradbury ARM. Eliminating helper phage from

phage display. Nucleic Acids Res. 2006;34:145.

54. Qi H, Lu H, Qiu H-J, Petrenko V, Liu A. Phagemid vectors for phage display:

properties, characteristics and construction. J Mol Biol. 2012;417:129–43.

55. Hoogenboom HR, Griffiths AD, Johnson KS, Chiswell DJ, Hudson P, Winter G.

Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying

antibody (Fab) heavy and light chains. Nucleic Acids Res. 1991;19:4133–7.

56. Kirsch,M., Zaman,M., Meier,D., Dubel S, Hust M. Parameters affecting the display

of antibodies on phage. J Immunol Methods. 2005;137–85.

57. Surface Expression Phagemid Vector pSEX81 [Internet]. Progen Biotechnik. [Cited

2014 Dec 26]. Available at:http://www.progen.de/en/psex81-surface-expression-phagemid

-vector.html?___from_store=de

58. Breitling F, Broders O, Helmsing S, Hust M, Du¨bel S. Chapter 14 Improving phage

display throughput by using hyperphage, miniaturized titration and pVIII (g8p) ELISA.

In: Konterman, Dubel S, Editors. Antibody Engineering. 2nd ed. Berlin:Springer Science &

Business Media. 2010:p. 197–206.

59. Rondot S, Koch J, Breitling F, Dübel S. A helper phage to improve single-chain

antibody presentation in phage display. Nat Biotechnol. 2001;19:75–8.

60. McCafferty J, Griffiths AD, Winter G, Chiswell DJ. Phage antibodies: filamentous

phage displaying antibody variable domains. Nature. 1990;348:552–4.

Ref. code: 25605612040039JID

95

61. Smith GP, Petrenko VA. Phage Display. Chem Rev. 1997;97:391–410.

62. Schirrmann T, Meyer T, Schütte M, Frenzel A, Hust M. Phage display for the

generation of antibodies for proteome research, diagnostics and therapy. Mol Basel Switz.

2011;16:412–26.

63. Kang AS, Barbas CF, Janda KD, Benkovic SJ, Lerner RA. Linkage of recognition

and replication functions by assembling combinatorial antibody Fab libraries along phage

surfaces. Proc Natl Acad Sci USA. 1991;88:4363–6.

64. Marks JD, Hoogenboom HR, Bonnert TP, McCafferty J, Griffiths AD, Winter G.

By-passing immunization: human antibodies from V-gene libraries displayed on phage. J

Mol Biol. 1991;222:581–97.

65. Malmborg AC, Dueñas M, Ohlin M, Söderlind E, Borrebaeck CA. Selection of

binders from phage displayed antibody libraries using the BIAcore biosensor. J Immunol

Methods. 1996;198:51–7.

66. Roberts BL, Markland W, Siranosian K, Saxena MJ, Guterman SK, Ladner RC.

Protease inhibitor display M13 phage: selection of high-affinity neutrophil elastase

inhibitors. Gene. 1992;121:9–15.

67. Ward RL, Clark MA, Lees J, Hawkins NJ. Retrieval of human antibodies from

phage-display libraries using enzymatic cleavage. J Immunol Methods. 1996;189:73–82.

68. Kupsch JM, Tidman NH, Kang NV, Truman H, Hamilton S, Patel N, et al. Isolation

of human tumor-specific antibodies by selection of an antibody phage library on

melanoma cells. Clin Cancer Res Off J Am Assoc Cancer Res. 1999;5:925–31.

69. Pasqualini R, Ruoslahti E. Organ targeting in vivo using phage display peptide

libraries. Nature. 1996;380:364–6.

70. Hoogenboom HR. Selecting and screening recombinant antibody libraries. Nat

Biotechnol. 2005;23:1105–16.

71. Schier R, McCall A, Adams GP, Marshall KW, Merritt H, Yim M, et al. Isolation of

picomolar affinity anti-c-erbB-2 single-chain Fv by molecular evolution of the comple-

mentarity determining regions in the center of the antibody binding site. J Mol Biol.

1996;263:551–67.

72. Yang W-P, Green K, Pinz-Sweeney S, Briones AT, Burton DR, Barbas III CF. CDR

walking mutagenesis for the affinity maturation of a potent human anti-hiv-1 antibody into

the picomolar range. J Mol Biol. 1995;254:392–403.

Ref. code: 25605612040039JID

96

73. Proba K, Wörn A, Honegger A, Plückthun A. Antibody scFv fragments without

disulfide bonds made by molecular evolution. J Mol Biol. 1998;275:245–53.

74. Kristensen P, Winter G. Proteolytic selection for protein folding using filamentous

bacteriophages. Fold Des. 1998;3:321–8.

75. Hoogenboom HR, Chames P. Natural and designer binding sites made by phage

display technology. Immunol Today. 2000;21:371–8.

76. Hof D, Cheung K, Roossien HE, Pruijn GJM, Raats JMH. A novel subtractive

antibody phage display method to discover disease markers. Mol Cell Proteomics MCP.

2006;5:245–55.

77. Wang R, Fang S, Wu D, Lian J, Fan J, Zhang Y, et al. Screening for a single-chain

variable-fragment antibody that can effectively neutralize the cytotoxicity of the Vibrio

parahaemolyticus thermolabile hemolysin. Appl Environ Microbiol. 2012;78:4967–75.

78. Velazquez-Roman J, León-Sicairos N, de Jesus Hernández-Díaz L, Canizalez-

Roman A. Pandemic Vibrio parahaemolyticus O3:K6 on the American continent. Front

Cell Infect Microbiol. 2014

79. Zanetti S, Deriu A, Duprè I, Sanguinetti M, Fadda G, Sechi LA. Differentiation of

Vibrio alginolyticus strains isolated from Sardinian waters by ribotyping and a new rapid

PCR fingerprinting method. Appl Environ Microbiol. 1999;65:1871–5.

80. Austin B. Vibrios as causal agents of zoonoses. Vet Microbiol. 2010;140:310–7.

81. Broberg CA, Calder TJ, Orth K. Vibrio parahaemolyticus cell biology and

pathogenicity determinants. Microbes Infect. 2011;13:992–1001.

82. Ruwandeepika HAD, Jayaweera TSP, Bhowmick PP, Karunasagar I, Bossier P,

Defoirdt T. Pathogenesis, virulence factors and virulence regulation of Vibrios belonging

to the Harveyi clade. Rev Aquac. 2012;4:59–74.

83. Makino K, Oshima K, Kurokawa K, Yokoyama K, Uda T, Tagomori K, et al.

Genome sequence of Vibrio parahaemolyticus: a pathogenic mechanism distinct from that

of V. cholerae. Lancet Lond Engl. 2003;361:743–9.

84. Park K-S, Ono T, Rokuda M, Jang M-H, Okada K, Iida T, et al. Functional

characterization of two type III secretion systems of Vibrio parahaemolyticus. Infect

Immun. 2004;72:6659–65.

85. Okada N, Iida T, Park K-S, Goto N, Yasunaga T, Hiyoshi H, et al. Identification and

characterization of a novel type III secretion system in trh-positive Vibrio

Ref. code: 25605612040039JID

97

parahaemolyticus strain TH3996 reveal genetic lineage and diversity of pathogenic

machinery beyond the species level. Infect Immun. 2009;77:904–13.

86. Noriea NF, Johnson CN, Griffitt KJ, Grimes DJ. Distribution of type III secretion

systems in Vibrio parahaemolyticus from the northern Gulf of Mexico. J Appl Microbiol.

2010;109:953–62.

87. Lovell CR. Ecological fitness and virulence features of Vibrio parahaemolyticus in

estuarine environments. Appl Microbiol Biotechnol. 2017;101:1781–94.

88. Kodama T, Hiyoshi H, Okada R, Matsuda S, Gotoh K, Iida T. Regulation of Vibrio

parahaemolyticus T3SS2 gene expression and function of T3SS2 effectors that modulate

actin cytoskeleton. Cell Microbiol. 2015;17:183–90.

89. Zhou X, Gewurz BE, Ritchie JM, Takasaki K, Greenfeld H, Kieff E, et al. A Vibrio

parahaemolyticus T3SS effector mediates pathogenesis by independently enabling

intestinal colonization and inhibiting TAK1 activation. Cell Rep. 2013;3:1690–702.

90. Kodama T, Rokuda M, Park K-S, Cantarelli VV, Matsuda S, Iida T, et al.

Identification and characterization of VopT, a novel ADP-ribosyltransferase effector

protein secreted via the Vibrio parahaemolyticus type III secretion system 2. Cell

Microbiol. 2007;9:2598–609.

91. Calder T, Kinch LN, Fernandez J, Salomon D, Grishin NV, Orth K. Vibrio Type III

effector VPA1380 is related to the cysteine protease domain of large bacterial toxins.

PLOS ONE. 2014;9.

92. Mima T, Gotoh K, Yamamoto Y, Maeda K, Shirakawa T, Matsui S et al. Expression

of collagenase is regulated by the VarS/VarA two-component regulatory system in Vibrio

alginolyticus. J Membr Biol. 2018;251:51–63.

93. Zhao Z, Chen C, Hu C-Q, Ren C-H, Zhao J-J, Zhang L-P, et al. The type III

secretion system of Vibrio alginolyticus induces rapid apoptosis, cell rounding and

osmotic lysis of fish cells. Microbiol Read Engl. 2010;156:2864–72.

94. Zhao Z, Liu J, Deng Y, Huang W, Ren C, Call DR, et al. The Vibrio alginolyticus

T3SS effectors, Val1686 and Val1680, induce cell rounding, apoptosis and lysis of fish

epithelial cells. Virulence. 2018;9:318–30.

95. ISO/TS 21872-1:2007(en), Microbiology of food and animal feeding stuffs-

Horizontal method for the detection of potentially enteropathogenic Vibrio spp. Part 1:

Ref. code: 25605612040039JID

98

detection of Vibrio parahaemolyticus and Vibrio cholerae [Internet]. [Cited 2014 Nov 23].

Available at: https://www.iso.org/obp/ui/#iso:std:iso:ts:21872:-1:ed-1:v1:en

96. Levin RE. Vibrio parahaemolyticus, a notably lethal human pathogen derived from

seafood: a review of its pathogenicity, characteristics, subspecies characterization, and

molecular methods of detection. Food Biotechnol. 2006;20:93–128.

97. Noguerola I, Blanch AR. Identification of Vibrio spp. with a set of dichotomous

keys. J Appl Microbiol. 2008;105:175–85.

98. Bunpa S, Nishibuchi M, Thawonsuwan J, Sermwittayawong N. Genetic

heterogeneity among Vibrio alginolyticus strains, and design of a PCR-based

identification method using gyrB gene sequence. Can J Microbiol. 2018;64:1–10.

99. Venkateswaran K, Dohmoto N, Harayama S. Cloning and nucleotide sequence of

the gyrB gene of Vibrio parahaemolyticus and its application in detection of this pathogen

in shrimp. Appl Environ Microbiol. 1998;64:681–7.

100. Lin Z, Kumagai K, Baba K, Mekalanos JJ, Nishibuchi M. Vibrio parahaemolyticus

has a homolog of the Vibrio cholerae toxRS operon that mediates environmentally

induced regulation of the thermostable direct hemolysin gene. J Bacteriol.

1993;175:3844–55.

101. Yin J-F, Wang M-Y, Chen Y-J, Yin H-Q, Wang Y, Lin M-Q, ed al. direct detection

of Vibrio vulnificus, Vibrio parahaemolyticus, and Vibrio alginolyticus from clinical and

environmental samples by a multiplex touchdown polymerase chain reaction assay. Surg

Infect. 2018;19:48–53.

102. Ward LN, Bej AK. Detection of Vibrio parahaemolyticus in shellfish by use of

multiplexed real-time PCR with TaqMan fluorescent probes. Appl Environ Microbiol.

2006;72:2031–42.

103. Jing-jing Z, Chang C, Peng L, Chun-hua R, Xiao J, Zhe Z, ed al. SYBR Green I-

based real-time PCR targeting the rpoX gene for sensitive and rapid detection of Vibrio

alginolyticus. Mol Cell Probes. 2011;25:137–41.

104. Tall A, Teillon A, Boisset C, Delesmont R, Touron-Bodilis A, Hervio-Heath D.

Real-time PCR optimization to identify environmental Vibrio spp. strains. J Appl

Microbiol. 2012;113:361–72.

Ref. code: 25605612040039JID

99

105. Niu PH, Zhang C, Wang J, Tan WJ, Ma XJ. Detection and identification of six

foodborne bacteria by two-tube multiplex real time PCR and melting curve analysis.

Biomed Environ Sci BES. 2014;27:770–8.

106. Yamazaki W, Ishibashi M, Kawahara R, Inoue K. Development of a loop-mediated

Isothermal amplification assay for sensitive and rapid detection of Vibrio

parahaemolyticus. BMC Microbiol. 2008;8:163.

107. Chen S, Ge B. Development of a toxR-based loop-mediated isothermal amplification

assay for detecting Vibrio parahaemolyticus. BMC Microbiol. 2010;10:41.

108. Cai SH, Lu YS, Wu Z-H, Jian JC, Wang B, Huang YC. Loop-mediated isothermal

amplification method for rapid detection of Vibrio alginolyticus, the causative agent of

vibriosis in mariculture fish. Lett Appl Microbiol. 50:480–5.

109. Sakata J, Kawatsu K, Kawahara R, Kanki M, Iwasaki T, Kumeda Y, et al.

Production and characterization of a monoclonal antibody against recombinant

thermolabile hemolysin and its application to screen for Vibrio parahaemolyticus

contamination in raw seafood. Food Control. 2012;23:171–6.

110. Wang R, Fang S, Xiang S, Ling S, Yuan J, Wang S. Generation and characterization

of a scFv antibody against T3SS needle of Vibrio parahaemolyticus. Indian J Microbiol.

2014;54:143–50.

111. Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. CSHL

Press;2001. 1365 p.

112. Tarr CL, Patel JS, Puhr ND, Sowers EG, Bopp CA, Strockbine NA. Identification of

Vibrio isolates by a multiplex PCR assay and rpoB sequence determination. J Clin

Microbiol. 2007;45:134–40.

113. Lee N, Kwon KY, Oh SK, Chang H-J, Chun HS, Choi S-W. A multiplex PCR assay

for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio

parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus

in Korean ready-to-eat food. Foodborne Pathog Dis. 2014;11:574–80.

114. Hanahan D. Studies on transformation of Escherichia coli with plasmids. J Mol

Biol. 1983;166:557–80.

115. Cohen SN, Chang ACY, Hsu L. Nonchromosomal antibiotic resistance in bacteria:

genetic transformation of Escherichia coli by R-Factor DNA. Proc Natl Acad Sci USA.

1972;69:2110–4.

Ref. code: 25605612040039JID

100

116. Laemmli UK. Cleavage of structural proteins during the assembly of the head of

bacteriophage T4. Nature. 1970;227:680–5.

117. Zhou H, Fisher RJ, Papas TS. Optimization of primer sequences for mouse scFv

repertoire display library construction. Nucleic Acids Res. 1994;22:888–9.

118. Johnson G, Wu TT. Kabat Database and its applications: 30 years after the first

variability plot. Nucleic Acids Res. 2000;28:214–8.

119. Okamoto T, Mukai Y, Yoshioka Y, Shibata H, Kawamura M, Yamamoto Y, et al.

Optimal construction of non-immune scFv phage display libraries from mouse bone

marrow and spleen established to select specific scFvs efficiently binding to antigen.

Biochem Biophys Res Commun. 2004;323:583–91.

120. Imai S, Mukai Y, Nagano K, Shibata H, Sugita T, Abe Y, et al. Quality

enhancement of the non-immune phage scFv library to isolate effective antibodies. Biol

Pharm Bull. 2006;29:1325–30.

121. Mancheron A, Uricaru R, Rivals E. An alternative approach to multiple genome

comparison. Nucleic Acids Res. 2011;39:101.

122. Snyder L, Champness W. Molecular Genetics of Bacteria. ASM Press. 2003:590 p.

123. Lilburn TG, Gu J, Cai H, Wang Y. Comparative genomics of the family

Vibrionaceae reveals the wide distribution of genes encoding virulence-associated

proteins. BMC Genomics. 2010;11:369.

124. Chiawwit P, Boonyahong M, Thawornwan U, Srimanote P, Tongtawe P.

Identification of VPA1327 (vopT) as a Novel Genetic Marker for Detecting Pathogenic

Vibrio parahaemolyticus. J Pure Appl Microbiol. 2018;12:429–38.

125. Caburlotto G, Gennari M, Ghidini V, Tafi M, Lleo MM. Presence of T3SS2 and

other virulence-related genes in tdh-negative Vibrio parahaemolyticus environmental

strains isolated from marine samples in the area of the Venetian Lagoon, Italy. FEMS

Microbiol Ecol. 2009;70:506–14.

126. Croci L, Suffredini E, Cozzi L, Toti L, Ottaviani D, Pruzzo C, et al. Comparison of

different biochemical and molecular methods for the identification of Vibrio

parahaemolyticus. J Appl Microbiol. 102:229–37.

127. Jiang Y, He L, Wu P, Shi X, Jiang M, Li Y, et al. Simultaneous identification of ten

bacterial pathogens using the multiplex ligation reaction based on the probe melting curve

analysis. Sci Rep. 2017;7:5902.

Ref. code: 25605612040039JID

101

128. Li R, Chiou J, Chan EW-C, Chen S. A novel PCR-based approach for accurate

identification of Vibrio parahaemolyticus. Front Microbiol. 2016;7:44.

129. Miller VL, Mekalanos JJ. Synthesis of cholera toxin is positively regulated at the

transcriptional level by toxR. Proc Natl Acad Sci USA. 1984;81:3471–5.

130. Pang L, Zhang X-H, Zhong Y, Chen J, Li Y, Austin B. Identification of Vibrio

harveyi using PCR amplification of the toxR gene. Lett Appl Microbiol. 43:249–55.

131. Conejero MJU, Hedreyda CT. Isolation of partial toxR gene of Vibrio harveyi and

design of toxR-targeted PCR primers for species detection. J Appl Microbiol.

2003;95:602–11.

132. Franco PF, Hedreyda CT. Amplification and sequence analysis of the full length

toxR gene in Vibrio harveyi. J Gen Appl Microbiol. 2006;52:281–7.

133. Aghebati-Maleki L, Bakhshinejad B, Baradaran B, Motallebnezhad M, Aghebati-

Maleki A, Nickho H, et al. Phage display as a promising approach for vaccine

development. J Biomed Sci. 2016;23:66.

134. Bagheri S, Yousefi M, Safaie Qamsari E, Riazi-Rad F, Abolhassani M, Younesi V,

et al. Selection of single chain antibody fragments binding to the extracellular domain of

4-1BB receptor by phage display technology. Tumour Biol J Int Soc Oncodevelopmental

Biol Med. 2017;39.

135. Fahimi F, Sarhaddi S, Fouladi M, Samadi N, Sadeghi J, Golchin A, et al. Phage

display-derived antibody fragments against conserved regions of VacA toxin of

Helicobacter pylori. Appl Microbiol Biotechnol. 2018.

136. Bratkovic T. Progress in phage display: evolution of the technique and its

application. Cell Mol Life Sci CMLS. 2010;67:749–67.

137. Vodnik M, Zager U, Strukelj B, Lunder M. Phage display: selecting straws instead

of a needle from a haystack. Mol Basel Switz. 2011;16:790–817.

138. Thomas WD, Golomb M, Smith GP. Corruption of phage display libraries by target-

unrelated clones: diagnosis and countermeasures. Anal Biochem. 2010;407:237–40.

139. Neuhoff V, Arold N, Taube D, Ehrhardt W. Improved staining of proteins in

polyacrylamide gels including isoelectric focusing gels with clear background at

nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electrophoresis.

1988;9:255–62.

Ref. code: 25605612040039JID

102

APPENDICES

Ref. code: 25605612040039JID

103

APPENDIX A

V. PARAHAEMOLYTICUS AND V. ALGINOLYTICUS GENOME COMPARISON RESULT

1. Figure of V. parahaemolyticus Chromosome 2 nucleotide diagram show the similar (red line) and differences sequences (green line)

from V. alginolyticus chromosome 2 extracted from BLASTN result

Ref. code: 25605612040039JID

104

Ref. code: 25605612040039JID

105

Ref. code: 25605612040039JID

106

2. Figure of The V. alginolyticus Chromosome 2 nucleotide diagram show the similar (Red line) and differences sequences(Green

line) from V.parahaemolyticus chromosome 2 extracted from BLASTN result

Ref. code: 25605612040039JID

107

Ref. code: 25605612040039JID

108

APPENDIX B

CHEMICAL AND MEDIA PREPARATION

1. Bacterial culture media

1.1 Luria-Bertani (LB) broth

For 1 L of LB broth is composed of the following ingredients:

Tryptone (HIMEDIA, India) 10.0 g

Yeast extract (HIMEDIA, India) 5.0 g

NaCl (Merck, Germany) 5.0 g

After dissolving completely all of these components in DW by stirring, it

was sterilized by autoclaving and kept at 4 ºC.

1.2. LB agar

LB agar is composed of the following ingredients:

Tryptone (HIMEDIA, India) 10.0 g

Yeast extract (HIMEDIA, India) 5.0 g

NaCl (Merck, Germany) 5.0 g

Bacteriological agar No.2 (HIMEDIA, India) 15.0 g

The ingredients were dissolved in 1 L of DW and sterile by autoclave.

After autoclaving and cooling down to 55−60ºC, this medium was poured ~25 ml into

each 90 mm petri dish. LB agar plates were stored at 4ºC.

1.3 2X YT broth

2X YT broth was prepared by dissolved ingredients shown below in 1 L

of DW:

Tryptone (HIMEDIA, India) 17.0 g

Yeast extract (HIMEDIA, India) 10.0 g

NaCl (Merck, Germany) 5.0 g

After dissolving completely, the media was sterilized by autoclaving.

Ref. code: 25605612040039JID

109

1.4 2X YT Agar

2X YT agar is composed of the following ingredients:

Tryptone (HIMEDIA, India) 17.0 g

Yeast extract (HIMEDIA, India) 10.0 g

NaCl (Merck, Germany) 5.0 g

Bacteriological agar No.2 (HIMEDIA, India) 15.0 g

The ingredients were dissolved in 1 L of DW and sterile by autoclave.

After autoclaving and cooling down to 55−60ºC, this medium was poured ~25 ml into

each 90 mm petri dish. After the agar turn solid, the plates were stored at 4ºC.

1.5 2X YT-GAT Agar

2X TY basal agar was perapred as Section 1.4 After autoclaving and

cooling down to 55−60ºC, the basal agar was added with 55.6 ml of 2 M glucose and

ampicillin to a final concentration 100 µg/ml. the complete agar was poured ~25 ml

into each 90 mm petri dish. After the agar turn solid, the plates were stored at 4ºC.

1.6 Bacterial storage medium

Peptone 2.0 g

Yeast extract 2.0 g

Glycerol 30.0 ml

DW 70.0 ml

1.7 Antibiotics

LB or 2X YT broth and LB or 2X YT agar with antibiotics was prepared

as described above. Antibiotics were added to broth and solid media at the following

concentrations: 100 μg/ml of ampicililin (General Drug House, Bangkok, Thailand),

25 μg/ml of kanamycin (General Drug House), 20 μg/ml of tetracycline (Bio

Basic,Canada), unless otherwise specified.

Ref. code: 25605612040039JID

110

2. Reagents for plasmid preparation by alkaline lysis method

2.1. Alkaline lysis solution I (25 mM Tris-HCl, pH 8.0; 50 mM glucose; 10

mM EDTA)

Glucose 0.90 g

Tris base (Hydroxymethyl aminomethane) 0.33 g

(Ameresco, Ohio, USA)

EDTA (Ethylenediaminetetraacetic acid 0.37 g

Disodium salt dihydrate) (Mecrk, Germany)

DW 80.0 ml

After dissolving completely, the pH was adjusted to 8.0 with 1 N HCl or

1 N NaOH and the volume was brought to 100 ml with UDW before autoclaving. The

solution was stored at room temperature. One hundred ug/ml of RNase A was added

in this solution before using.

2.2 Alkaline lysis solution (0.2 N NaOH, 1% (w/v) of SDS)

The solution was freshly prepared by mixing the ingredients together that

composed of:

1 N NaOH (Merck, Geramany) 1.0 ml

10% SDS (USB, Ohio, USA) 0.5 ml

Sterile UDW 3.5 ml

2.3 Alkaline lysis solution III (2.8 M potassium acetate, pH 4.8)

Potassium acetate 2.44 g

(Univar, New South Wales, Australia)

UDW 50.0 ml

The pH of the solution was adjusted to 4.8 with glacial acetic acid (Merck,

Germany). The volume was brought to 100 ml with UDW before autoclaving. The

solution was stored at room temperature.

Ref. code: 25605612040039JID

111

3. Reagents for DNA and RNA manipulation

3.1 10X DNA loading dye

10X DNA loading dye included with:

Bromophenol blue (Bio-Rad, USA) 5.0 mg

Xylene cyanol FF (USB) 5.0 mg

Glycerol (Merck, Germany) 5.0 ml

1X TE buffer, pH 8 5.0 ml

One milliliter aliquot was kept at −20ºC. The final concentration of this

dye is 1X when mixing with DNA sample prior to loading onto an agarose gel.

3.2 Ethidium bromide solution

The stock solution was prepared by dissolving 100 mg of ethidium

bromide (Sigma) in 10 ml of UDW (Final concentration 10 mg/ml). This solution was

kept at 4 ºC and protected from light. For working solution, 50 μl of the stock solution

was then added to 100 ml of DW to make 0.5 μg/ml working concentration.

3.3 50X TAE buffer pH 8.3

50× TAE buffer was prepared by dissolving ingredients below in 700 ml

of UDW:

Tris base 242.0 g

Glacial acetic acid 57.1 ml

EDTA 18.16 g

The pH of this solution was adjusted to 8.3 with concentrate HCl (Merck,

Germany) and next adjusted the volume to 1 L with UDW. It was sterilized by

autoclaving. For working solution, 50× TAE buffer was diluted to 1X by DW.

3.4 5X TBE buffer, pH 8.3

5X TBE buffer was prepared by dissolving ingredients below in 700 ml of

UDW:

Tris (Ameresco, Ohio, USA) 52.0 g

Boric acid (Amresco, Ohio, USA) 27.5 g

EDTA∙2H2O (Merck, Germany) 4.65 g

Ref. code: 25605612040039JID

112

The pH of this solution was adjusted to 8.3 with concentrate HCl (Merck,

Germany) and next adjusted the volume to 1 L with UDW. It was sterilized by

autoclaving. For working solution, 5X TBE buffer was adjusted to 0.5X by DW and it

can be reused three times.

3.5 GeneRulerTM DNA Ladder

83 ng/μl of each 1 kb DNA ladder and 100 bp plus DNA ladder (Thermo

Scientific, USA) was prepared by diluting 33 μl of 0.5 μg/μl GeneRulerTM DNA

Ladder stock solutions in 167 μl of 6X loading dye. It was kept at 4 ºC.

3.6 Diethyl pyrocarbonate (DEPC)–Treated water

One milliliter of DEPC (Amresco, Ohio, USA) was added into 1 L of

UDW. The mixture bottle was kept in a chemical hood with loosen cap for 24 hours

and autoclaving before use.

Ref. code: 25605612040039JID

113

4. Reagents for recombinant protein purification using Ni-NTA™ bead under

denaturation purification condition

4.1 Binding buffer (100 mM NaH2PO4, 10 mM Tris-HCl, 8M Urea, pH

6.3)

All components below were dissolved in 700 ml of UDW by stirring.

NaH2PO4∙H2O 13.8 g

Tris base 1.2 g

Urea 480.5 g

After dissolving completely, the pH was adjusted to 6.3 with HCl. The

volume was broth up to 1 L and filtered through Whatman® filter paper No.1

(Whatmam International Ltd., England).

4.2 Washing buffer (100 mM NaH2PO4, 10 mM Tris-HCl, 8M Urea, pH

8.0, 10 mM Imidazole)

The washing buffer was prepared same as Lysis/Binding Buffer but the

pH was adjusted to 8.0 with NaOH and add 1M imidazole to final concentration 10

mM before used.

4.3 1M Imidazole solution

Imidazole (Univar) 20.4 g

Binding Buffer pH 6.3 100.0 ml

After the imidazole was dissolved completely, the solution was filtered

through Whatman® filter paper No.1 (Whatmam International Ltd., England).

Ref. code: 25605612040039JID

114

5. Reagents for SDS-PAGE and Western Blot

5.1 6X Reducing sample buffer for SDS-PAGE

0.5 M Tris-HCl pH 6.8 3.75 ml

SDS (USB, Ohio, USA) 0.6 g

Bromphenol blue 1.5 mg

Glycerol 4.75 ml

β-mercaptoethanol 1.5 ml

The solution was aliquot 1 ml/tube and kept at -20°C until use. For SDS-

PAGE, the sample was prepared by mixing 5 part of sample with 1 part of 6X sample

buffer.

5.2 1.5 M Tris-Hcl pH 8.8 for resolving gel preparation

The solution was prepared by dissolved 181.5 g of Tris base in to 700 ml

of DW .The pH was adjusted to 8.8 with concentrated HCl. Add UDW to a final

volume of 1,000 ml and filtered through 0.45µ cellulose acetate filter (Sartorious

Stedim Biotech, Germany). The solution was stored at 4°C.

5.3 0.5 M Tris-Hcl pH 6.8 for stacking gel preparation

The solution was prepared by dissolved 60.5 g of Tris base in to 500 ml of

DW .The pH was adjusted to 6.8 with concentrated HCl. Add UDW to a final volume

of 1,000 ml and filtered through 0.45 µ cellulose acetate filter (Sartorious Stedim

Biotech, Germany). The solution was stored at 4°C.

5.4 10% sodium dodecyl sulfate solution (10% SDS, w/v)

SDS 10.0 g

UDW 100.0 ml

After the SDS powder dissolved completely, filter the solution through

0.45 µ cellulose acetate filter (Sartorious Stedim Biotech, Germany)

Ref. code: 25605612040039JID

115

5.5. 10% Ammonium persulfate solution (10% APS, w/v)

Ammonium persulfate 50.0 mg

UDW 0.5 ml

5.6 10X Electrode buffer

Tris base 30.3 g

Glycine 142.9 g

SDS 10.0 g

UDW 1.0 L

For working solution, 10X Electrode buffer was diluted to 1X with UDW.

5.7 Colloidal Coomasie Billiant Blue G250 Staining139

5.7.1 Fixing solution

The fixation solution was freshly prepared by mixed the

following ingredients together

o-phospharic acid (Merck, Geramany) 0.5 ml

Methanol 10.0 ml

DW 39.5 ml

5.7.2 Staining solution

(1) Staining stock solution A

o-phospharic acid 0.95 ml

Amonium sulfate 4.0 g

(Univar, Ajax Finechem, Australia)

DW 45.05 ml

(2) Staining stock solution B

Coomasie Billiant Blue G-250 50.0 mg

DW 1.0 ml

Working staining solution was freshly prepared by combined the

stock solution A and B and added 10 ml of methanol into the mixture solution.

Ref. code: 25605612040039JID

116

5.7.3 Neutralization Solution

Dissolving 6.0 g of Tris base in 300 ml of DW. The pH was

adjusted to 6.5 by using o-phospharic acid and then fill up the volume to 500 ml with

DW.

5.7.4 Stabilization solution

Amonium sulfate 100.0 g

DW 500.0 ml

5.8 Transfer buffer

Tris base 6.06 g

Glycine (Amresco, USA) 28.8 g

Methanol 200.0 ml

UDW 1.8 L

6. Reagent for ELISA and bio-panning

6.1 Coating buffer (Carbonate – bicarbonate buffer, pH 9.6)

The buffer was prepared by dissolving 1.26 g of NaHCO3 in 300 ml of

DW, and 0.053 g of Na2CO3 in 100 ml of DW. Then the pH was adjusted to 9.6 by

added the Na2CO3 solution into NaHCO3 solution. The buffer was keeping at 4ºC.

6.2 Phosphate buffer (1 M PB, pH 7.4)

Solution A

Na2HPO4∙2H2O 177.9 g

DW 1.0 L

Solution B

NaH2PO4∙2H2O 156.01 g

DW 1.0 L

The solution B was slowly added to solution A for adjusting the pH to 7.4

and sterilized by autoclaving.

Ref. code: 25605612040039JID

117

6.3 3M sodium chloride (NaCl) Solution

Sodium chloride (NaCl) 175.32 g

DW 1.0 L

6.4 0.01 M PBS pH 7.4

1 M PB, pH 7.4 10.0 ml

3 M NaCl 50.0 ml

DW 940.0 ml

6.5 Washing solution (PBS-T)

Tween-20 0.5 ml

0.01 M PBS pH 7.4 999.5 ml

6.6 Blocking solution (3% BSA)

BSA 3.0 g

0.01 M PBS pH 7.4 100.0 ml

6.7 Diluent solution (0.2% BSA in PBS-T)

BSA 0.2 g

PBS-T 100.0 ml

6.8 Enzyme conjugate (Goat anti-mouse Immounoglobulin (Ig) -

Horseradish peroxidase, GAM-HRP) for ELISA

The goat anti-mouse Ig- Horseradish peroxidase (KPL, USA) was diluted

in duluent solution to final dilution of 1:3,000

6.9 Enzyme conjugate (Goat anti-mouse Ig-Alkaline phosphatase, GAM-

AP) for Dot-ELISA and Western blot analysis

The Goat anti-mouse Ig-Alkaline phosphatase (KPL, USA) was diluted in

duluent solution to final dilution of 1:3,000

Ref. code: 25605612040039JID

118

6.10 Substrate buffer (0.15 M Tris-HCl, pH 9.6)

The solution was prepared by dissolved 18.17 g of Tris base in to 700 ml

of DW .The pH was adjusted to 9.6 with Concentrated HCl. Add DW to a final

volume of 1,000 ml.

6.11 Substrate solution for Dot-ELISA and Western blot analysis

0.15 M Tris-HCl, pH 9.6 6.0 ml

BCIP (5-bromo, 4-chloro, 3-indolrylphosphase) 0.5 ml

NBT (Nitroblue tetrazolium) 0.5 ml

Tris buffer 5.0 ml

Ref. code: 25605612040039JID

119

APPENDIX C

LIST of PRIMERS and PLASMIND USED for

MOUSE scFv ANTIBODY LIBRARY PRODUCTION

1. List of Mouse IgG Library Primer set 1 and 2 (Progen Biotecnik, Germany)

Table 1 The primer sequences of mouse IgG library set 1 which were used for

amplification of VH and VL fragments

Primer name Sequence

Heavy chain variable primer 1A

(MHV.B1)

5’-GATGTGAAGCTTCAGGAGTC-3’

Heavy chain variable primer 1B

(MHV.B2)

5’-CAGGTGCAGCTGAAGGAGTC-3’

Heavy chain variable primer 1C

(MHV.B3)

5’-CAGGTGCAGCTGAAGCAGTC-3’

Heavy chain variable primer 1D

(MHV.B4)

5’-CAGGTTACTCTGAAAGAGTC-3’

Heavy chain variable primer 1E

(MHV.B5)

5’-GAGGTCCAGCTGCAACAATCT-3’

Heavy chain variable primer 1F

(MHV.B6)

5’-GAGGTCCAGCTGCAGCAGTC-3’

Heavy chain variable primer 1G

(MHV.B7)

5’-CAGGTCCAACTGCAGCAGCCT-3’

Heavy chain variable primer 1H

(MHV.B8)

5’-GAGGTGAAGCTGGTGGAGTTC-3’

Heavy chain variable primer 1I

(MHV.B9)

5’-GAGGTGAAGCTGGTGGAATC-3’

Heavy chain variable primer 1K

(MHV.B10)

5’-GATGTGAACTTGGAAGTGTC-3’

Heavy chain variable primer 1L

(MHV.B12)

5’-GAGGTGCAGCTGGAGGAGTC-3’

Ref. code: 25605612040039JID

120

Table 1 The primer sequences of mouse IgG library set 1 which were used for

amplification of VH and VL fragments (Cont.)

Primer name Sequence

Heavy chain constant primer 1M

(MHC.F)

5’-GGCCAGTGGATAGTCAGATGGGG

GTGTCGTTTTGGC-3’

Light chain var.(kappa) primer 1N

(MKV.B1)

5’-GATGTTTTGATGACCCAAACT-3’

Light chain var.(kappa) primer 1O

(MKV.B2)

5’-GATATTGTGATGACGCAGGCT-3’

Light chain var.(kappa) primer 1P

(MKV.B3)

5’-GATATTGTGATAACCCAG-3’

Light chain var.(kappa) primer 1Q

(MKV.B4)

5’-GACATTGTGCTGACCCAATCT-3’

Light chain var.(kappa) primer 1R

(MKV.B5)

5’-GACATTGTGATGACCCAGTCT-3’

Light chain var.(kappa) primer 1S

(MKV.B6)

5’-GATATTGTGCTAACTCAGTCT-3’

Light chain var.(kappa) primer 1T

(MKV.B7)

5’-GATATCGAGATGACACAGACT-3’

Light chain var.(kappa) primer 1U

(MKV.B8)

5’-GACATCCAGCTGACTCAGTCT-3’

Light chain var.(kappa) primer 1V

(MKV.B9)

5’-CAAATTGTTCTCACCCAGTCT-3’

Light chain var.(kappa) primer 1W

(MKV.B10)

5’-GACATTCTGATGACCCAGTCT-3’

Light chain const.(kappa) primer 1X

(MKC.F)

5’-GGATACAGTTGGTGCAGCATC-3’

Light chain var.(lambda) primer 1Y

(MKV.B)

5’-CAGGCTGTTGTGACTCAGGAA-3’

Light chain const.(lambda) primer 1Z

(MKC.F)

5’-GGTGAGTGTGGCAGTGGACTTGG

GCTG-3’

Ref. code: 25605612040039JID

121

Table 2 The primer sequences of mouse IgG library set 2 which were used for

amplification of VH and VL fragments

Primer name Sequence

Heavy chain variable primer 2A

(MHV.B1.Nco)

5’GAATAGGCCATGGCGGATGTGAAG

CTTCAGGAGTC-3’

Heavy chain variable primer 2B

(MHV.B2.Nco)

5’-GAATAGGCCATGGCGCAGGTG

CAGCTGAAGGAGTC-3’

Heavy chain variable primer 2C

(MHV.B3.Nco)

5’-GAATAGGCCATGGCGCAGGTG

CAGCTGAAGCAGTC-3’

Heavy chain variable primer 2D

(MHV.B4.Nco)

5’-GAATAGGCCATGGCGCAGGTT

ACTCTGAAAGAGTC-3’

Heavy chain variable primer 2E

(MHV.B5.Nco)

5’-GAATAGGCCATGGCGGAGGTC

CAGCTGCAACAATCT-3’

Heavy chain variable primer 2F

(MHV.B6.Nco)

5’-GAATAGGCCATGGCGGAGGTC

CAGCTGCAGCAGTC-3’

Heavy chain variable primer 2G

(MHV.B7.Nco)

5’-GAATAGGCCATGGCGCAGGTC

CAACTGCAGCAGCCT-3’

Heavy chain variable primer 2H

(MHV.B8.Nco)

5’-GAATAGGCCATGGCGGAGGTG

AAGCTGGTGGAGTTC-3’

Heavy chain variable primer 2I

(MHV.B9.Nco)

5’-GAATAGGCCATGGCGGAGGTG

AAGCTGGTGGAATC-3’

Heavy chain variable primer 2K

(MHV.B10.Nco)

5’-GAATAGGCCATGGCGGATGTG

AACTTGGAAGTGTC-3’

Heavy chain variable primer 2L

(MHV.B12.Nco)

5’-GAATAGGCCATGGCGGAGGTG

CAGCTGGAGGAGTC-3’

Heavy chain constant primer 2M

(MHC.F.Hind)

5’-GGCCAGTGGATAAAGCTTTGG

GGGTGTCGTTTTGGC-3’

Light chain var.(kappa) primer 2N

(MKV.B1.Mlu)

5’-TACAGGATCCACGCGTAGATG

TTTTGATGACCCAAACT -3’

Light chain var.(kappa) primer 2O

(MKV.B2.Mlu)

5’-TACAGGATCCACGCGTAGATA

TTGTGATGACGCAGGCT -3’

Ref. code: 25605612040039JID

122

Table 2 The primer sequences of mouse IgG library set 2 which were used for

amplification of VH and VL fragments (Cont.)

Primer name Sequence

Light chain var.(kappa) primer 2P

(MKV.B3.Mlu)

5’-TACAGGATCCACGCGTAGATA

TTGTGATAACCCAG-3’

Light chain var.(kappa) primer 2Q

(MKV.B4.Mlu)

5’-TACAGGATCCACGCGTAGACA

TTGTGCTGACCCAATCT -3’

Light chain var.(kappa) primer 2R

(MKV.B5.Mlu)

5’-TACAGGATCCACGCGTAGACA

TTGTGATGACCCAGTCT -3’

Light chain var.(kappa) primer 2S

(MKV.B6.Mlu)

5’-TACAGGATCCACGCGTAGATA

TTGTGCTAACTCAGTCT-3’

Light chain var.(kappa) primer 2T

(MKV.B7.Mlu)

5’-TACAGGATCCACGCGTAGATA

TCGAGATGACACAGACT-3’

Light chain var.(kappa) primer 2U

(MKV.B8.Mlu)

5’-TACAGGATCCACGCGTAGACA

TCCAGCTGACTCAGTCT-3’

Light chain var.(kappa) primer 2V

(MKV.B9.Mlu)

5’-TACAGGATCCACGCGTACAAA

TTGTTCTCACCCAGTCT-3’

Light chain var.(kappa) primer 2W

(MKV.B10. Mlu)

5’-TACAGGATCCACGCGTAGACA

TTCTGATGACCCAGTCT-3’

Light chain const.(kappa) primer 2X

(MKC.F.Not)

5’-TGACAAGCTTGCGGCCGCGGA

TACAGTTGGTGCAGCATC-3’

Light chain var.(kappa) primer 2Y

(MKV.B.Mlu)

5’-TACAGGATCCACGCGTACAGG

CTGTTGTGACTCAGGAA-3’

Light chain const.(kappa) primer 2Z

(MKC.F.Not)

5’TGACAAGCTTGCGGCCGCGGTGAG

TGTGGCAGTGGACTTGGGCTG-3’

The underlined letters are sequence of restriction endonuclease sites consist of

Mul I for VH forward primer, Hind III for VH reverse primer, Nco I for VL forward

primer and Not I for reverse primer.

Ref. code: 25605612040039JID

123

Figure 1 Schematic diagram of pSEX81 phasemid vector

Ref. code: 25605612040039JID

124

Figure 2 Schematic diagram of pOPE101 plasmid vector

Ref. code: 25605612040039JID

125

BIOGRAPHY

Name: Miss Phatcharaporn Chiawwit

Date of birth: January 17, 1987

Place of birth: Nongkai Province, Thailand

Education records:

2005-2008 Bachelor of science (Veterinary Technology)

Faculty of Veterinary Technology,

Kasetsart University, Thailand

2013 -2018 Master of science in Biomedical Sciences

Graduate Program in Biomedical Sciences,

Faculty of Allied Health Sciences,

Thammasat University, Thailand

Official address: Molecular Immunology and Microbiology Unit,

Graduate Program in Biomedical Sciences,

Faculty of Allied Health Sciences,

Thammasat University,

99 Moo 18, Phaholyothin Road, Klong 1 Sub-District,

Khlong Luang District, Pathumthani Province, Thailand

12121

Home address: 122/127 Moo 6, Napru Sub-District, Phraprom District,

Nakhon Si Thammarat Province, Thailand 80000

E-mail address: phatcharaporn.cw@gmail.com

Scholarships:

2015 – 2016 Teaching Assistantship Scholarship, from Research

Administration Division, Thammasat University

Ref. code: 25605612040039JID

126

Publication Chiawwit P, Boonyahong M, Thawornwan U,

Srimanote P, Tongtawe P. Identification of VPA1327

(vopT) as a Novel Genetic Marker for Detecting

Pathogenic Vibrio parahaemolyticus. J Pure Appl

Microbiol. 2018;12:429–38.

Work Experience:

2008 – Present Research assistant at Molecular Immunology and

Microbiology unit, Graduate Program in Biomedical

Sciences, Faculty of Allied Health Sciences, Thammasat

University

Training and workshop attended:

1. Biosafety Training, February 28th, 2014, Faculty of Allied Health Sciences,

Thammasat University, Pathumthani, Thailand

2. Human Ethics Training, March 21st, 2014, Faculty of Allied Health Sciences,

Thammasat University, Pathumthani, Thailand

3. Animal Ethics Training. June 9th, 2014, Faculty of Allied Health Sciences,

Thammasat University, Pathumthani, Thailand

4. Statistic for Animal Laboratory research, July 29th – 31st, 2014, Maruay Garden

Hotel, Bangkok, Thailand

5. Training Course in the Science of Laboratory Animals, March – September 2014,

Thammasat University, Pathumthani, Thailand

6. The Working-Training course, The Care and Practice Techniques for Laboratory

Animals, November 27, 2014, Laboratory Animal Center, Thammasat University,

Pathumthani, Thailand

7. Writing for International Journal Publication Training, June 29th, 2015, Faculty of

Allied Health Sciences, Thammasat University, Pathumthani, Thailand

8. Enhancement of Safety Practice of Research Laboratory in Thailand, ESPRel

Training, August 17th, 2015, Faculty of Allied Health Sciences, Thammasat

University, Pathumthani, Thailand

Ref. code: 25605612040039JID

127

9. Laboratory Waste Management Training, August 8th, 2017, Faculty of Allied

Health Sciences, Thammasat University, Pathumthani, Thailand

Seminar and conferances attended

1. The 3rd Scientific Meeting in Allied Health Sciences, February 19th, 2010,

Faculty of Allied Health Sciences, Thammasat University, Pathumthani, Thailand

2. The National Conference of Zoonotic Diseases, July 15th, 2010, Faculty of

Tropical Medicine, Mahidol University, Bangkok Thailand

3. The 4th Scientific Meeting in Allied Health Sciences, February 21st, 2011, Faculty

of Allied Health Sciences, Thammasat University, Pathumthani, Thailand

4. The 1st Thailand national Research Universities Summit, April 29th, 2012, The

Queen Sirikit Convention Center, Bangkok, Thailand

5. The 1st Conference on Graduate student Network of Thailand (GS-NETT 2012),

December 18th, 2012, Thammasat-Rangsit Conference Center, Thammasat University,

Pathumthani, Thailand

6. The TRF Seminar Series in Basic Research, September 24th, 2014, Siriraj

Hospital, Mahidol University, Bangkok Thailand

7. The 1st International Allied Health Sciences Conference, November 4th – 6th,

2014, Rama Garden Hotel, Bangkok

8. The 2nd Joint Symposium of BK21-PLUS of CUK and Thammasat University,

January 21st – 23rd, 2015, Thammasat University, Pathumthani, Thailand

9. The 2017 Annual Conference of Faculty of Medicine and Health Sciences

Thammasat University: Diversity in Multidisciplinary Approach to Patient Self Care,

June 7th – 9th, 2017, Thammasat University, Pathumthani, Thailand