translation © 2007 paul billiet odwsodws. the trna molecule trna molecules do the final translating...
TRANSCRIPT
![Page 1: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/1.jpg)
Translation
© 2007 Paul Billiet ODWS
![Page 2: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/2.jpg)
The tRNA molecule tRNA molecules do the
final translating At one end the have a
specific amino acid attached by a tRNA activating enzymeThese enzymes do the first part of translating
At the other end they have an anticodon which is complementary to the mRNA codons © St Edward’s University: Dept Chemistry and Biochemistry
© 2007 Paul Billiet ODWS
![Page 3: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/3.jpg)
The 3-D structure of a tRNA
© ThinkQuest.org
![Page 4: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/4.jpg)
The genetic code
Made of 64 triplets of bases (codons)
© 2007 Paul Billiet ODWS
![Page 5: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/5.jpg)
1st position
2nd position 3rd position ↓
U C A G
U Phe Ser Tyr Cys U
Phe Ser Tyr Cys C
Leu Ser STOP STOP A
Leu Ser STOP Trp G
C Leu Pro His Arg U
Leu Pro His Arg C
Leu Pro Gln Arg A
Leu Pro Gln Arg G
A Ile Thr Asn Ser U
Ile Thr Asn Ser C
Ile Thr Lys Arg A
Met Thr Lys Arg G
G Val Ala Asp Gly U
Val Ala Asp Gly C
Val Ala Glu Gly A
Val Ala Glu Gly GAcidic Basic Uncharged Polar Non-polar
© 2007 Paul Billiet ODWS
![Page 6: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/6.jpg)
The degenerate genetic code
A few amino acids are coded for by a single codon
Most are coded for by more than one codon
Some are coded for by up to six codons This is degeneracy in the code
© 2007 Paul Billiet ODWS
![Page 7: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/7.jpg)
Grammar in the code?
Three codons are nonsense codons they represent the end of the information = STOP
The codon for methionine found at the beginning of the information to be transcribed it means START
The methionine amino acid is usually removed from the finished protein
© 2007 Paul Billiet ODWS
![Page 8: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/8.jpg)
1st position ↓
2nd position 3rd position ↓
U C A G
UPhe Ser Tyr Cys U
Phe Ser Tyr Cys C
Leu Ser STOP STOP A
Leu Ser STOP Trp G
CLeu Pro His Arg U
Leu Pro His Arg C
Leu Pro Gln Arg A
Leu Pro Gln Arg G
AIle Thr Asn Ser U
Ile Thr Asn Ser C
Ile Thr Lys Arg A
Met Thr Lys Arg G
GVal Ala Asp Gly U
Val Ala Asp Gly C
Val Ala Glu Gly A
Val Ala Glu Gly G© 2007 Paul Billiet ODWS
![Page 9: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/9.jpg)
Genetic code: characteristics
Only 61 triplets or codons code for amino acids
3 stop codons (aka nonsense codons or terminator codons) UUA UAG UGA
© 2007 Paul Billiet ODWS
![Page 10: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/10.jpg)
Codon Amino acid Codon Amino acid
UUU UUA
Phenylalanine Leucine
UUC UUG
Both pyrimidines
Both purines
The code is degenerative code Several codons code for the same amino acid
The first two letters seem to be the most important the third one tends to be interchangeable
© 2007 Paul Billiet ODWS
![Page 11: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/11.jpg)
Similar amino acids have similar codons
ExampleAspartic acid codons GAU and GACGlutamic acid codons GAA and GAG Both are acidic amino acids
© 2007 Paul Billiet ODWS
![Page 12: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/12.jpg)
Punctuation?
The is no punctuation between each codon
The reading frame is set at the beginning of the gene
Frame shift mutations can be caused by the ADDITION or DELETION of only one or two bases. Everything downstream is misread
© 2007 Paul Billiet ODWS
![Page 13: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/13.jpg)
Reading the code
The reading of mRNA is always in the same direction 5’ to 3’ (the same way as transcription and replication)
The polypeptide chain is constructed from the amino end to the carboxyl end
© 2007 Paul Billiet ODWS
![Page 14: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/14.jpg)
A universal code
The code is used by all organisms So it is very ancient Permits investigations into common
ancestry Permits genetically transformed organisms
© 2007 Paul Billiet ODWS
![Page 15: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/15.jpg)
20 is the limit
Some amino acids are chemically altered AFTER translation.
e.g. In collogen proline is converted to hydroxyproline
Therefore the total number of amino acids found in proteins is greater than 20 but the total used in translation is only 20
© 2007 Paul Billiet ODWS
![Page 16: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/16.jpg)
Translation plan
TRANSLATION
Polypeptide chain
Complete protein
Ribosomes
Stop codon Start codon
© 2007 Paul Billiet ODWS
![Page 17: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/17.jpg)
Translation1
AUGGGAUACACUUUUUGA
mRNARibosome
© 2007 Paul Billiet ODWS
![Page 18: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/18.jpg)
Translation 2
AUGGGAUACACUUUUUGA
met
UAC
tRNA
amino acid
anticodon
© 2007 Paul Billiet ODWS
![Page 19: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/19.jpg)
Translation 3
CCU
gly
AUGGGAUACACUUUUUGA
UAC
met
© 2007 Paul Billiet ODWS
![Page 20: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/20.jpg)
Translation 4
AUGGGAUACACUUUUUGA
CCU
gly
UAC
met
peptide bond
© 2007 Paul Billiet ODWS
![Page 21: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/21.jpg)
Translation 5
UAC
AUGGGAUACACUUUUUGA
CCU
glymet
AUG
tyr
© 2007 Paul Billiet ODWS
![Page 22: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/22.jpg)
Translation 6
AUGGGAUACACUUUUUGACCU AUG
glymet tyr
© 2007 Paul Billiet ODWS
![Page 23: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/23.jpg)
Translation 7
UGA
thr
CCU
AUGGGAUACACUUUUUGAAUG
glymet tyr
© 2007 Paul Billiet ODWS
![Page 24: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/24.jpg)
Translation 8
AAA
phe
AUGGGAUACACUUUUUGA
AUGUGA
glymet tyr thr
polypeptide chain
© 2007 Paul Billiet ODWS
![Page 25: Translation © 2007 Paul Billiet ODWSODWS. The tRNA molecule tRNA molecules do the final translating At one end the have a specific amino acid attached](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649da25503460f94a8e983/html5/thumbnails/25.jpg)
Translation: the sequence The tRNA molecules with the correct anticodons
are lined up with their bases complementary to the mRNA codons
Two tRNA molecules at a time can fit on the ribosome
A peptide bond forms between their amino acids
The first tRNA leaves the ribosome and mRNA move along to accept a new tRNA
The process of translation proceeds in the same direction as replication and transcription (5’ to 3’)
© 2007 Paul Billiet ODWS