ORIGINAL ARTICLE

Transgenic papaya: a useful platform for oral vaccines

Gladis Fragoso1• Marisela Hernandez1

• Jacquelynne Cervantes-Torres1•

Ruben Ramırez-Aquino2• Hector Chapula3

• Nelly Villalobos3• Rene Segura-Velazquez1

•

Alfredo Figueroa4• Ivan Flores8

• Herminio Jimenez2• Laura Adalid6

•

Gabriela Rosas7• Luis Galvez2

• Elias Pezzat2• Elizabeth Monreal-Escalante5

•

Sergio Rosales-Mendoza5• Luis G. Vazquez2

• Edda Sciutto1

Received: 24 August 2016 / Accepted: 31 January 2017 / Published online: 13 February 2017

� Springer-Verlag Berlin Heidelberg 2017

Abstract

Main conclusion Transgenic papaya callus lines

expressing the components of the S3Pvac vaccine con-

stitute a stable platform to produce an oral vaccine

against cysticercosis caused by Taenia solium or T.

crassiceps.

The development of effective delivery systems to cope

with the reduced immunogenicity of new subunit vaccines

is a priority in vaccinology. Herein, experimental evidence

supporting a papaya-based platform to produce needle-free,

recombinant, highly immunogenic vaccines is shown.

Papaya (Carica papaya) callus lines were previously

engineered by particle bombardment to express the three

protective peptides of the S3Pvac anti-cysticercosis vac-

cine (KETc7, KETc12, KETc1). Calli were propagated

in vitro, and a stable integration and expression of the

target genes has been maintained, as confirmed by PCR,

qRT-PCR, and HPLC. These results point papaya calli as a

suitable platform for long-term transgenic expression of the

vaccine peptides. The previously demonstrated protective

immunogenic efficacy of S3Pvac-papaya orally adminis-

tered to mice is herein confirmed in a wider dose-range and

formulated with different delivery vehicles, adequate for

oral vaccination. This protection is accompanied by an

increase in anti-S3Pvac antibody titers and a delayed

hypersensitivity response against the vaccine. A significant

increase in CD4? and CD8? lymphocyte proliferation

was induced in vitro by each vaccine peptide in mice

immunized with the lowest dose of S3Pvac papaya

(0.56 ng of the three peptides in 0.1 lg of papaya callus

total protein per mouse). In pigs, the obliged intermediate

host for Taenia solium, S3Pvac papaya was also

immunogenic when orally administered in a two-log dose

range. Vaccinated pigs significantly increased anti-vaccine

antibodies and mononuclear cell proliferation. Overall, the

oral immunogenicity of this stable S3Pvac-papaya vaccine

in mice and pigs, not requiring additional adjuvants, sup-

ports the interest in papaya callus as a useful platform for

plant-based vaccines.

Electronic supplementary material The online version of thisarticle (doi:10.1007/s00425-017-2658-z) contains supplementarymaterial, which is available to authorized users.

& Edda Sciutto

edda@unam.mx; argentina54@hotmail.com

1 Instituto de Investigaciones Biomedicas, Universidad

Nacional Autonoma de Mexico, Av. Universidad 3000,

CP 04510 Mexico City, Mexico

2 Facultad de Medicina, Benemerita Universidad Autonoma de

Puebla, Calle 13 Sur 2702, CP 72420 Puebla, Mexico

3 Facultad de Medicina Veterinaria y Zootecnia, Universidad

Nacional Autonoma de Mexico, Av. Universidad 3000,

CP 04510 Mexico City, Mexico

4 Unidad Academica de Ciencias Quımico Biologicas,

Universidad Autonoma de Guerrero, Av. Lazaro Cardenas

s/n, CP 39087 Chilpancingo, GRO, Mexico

5 Laboratorio de Biofarmaceuticos Recombinantes, Facultad

de Ciencias Quımicas, Universidad Autonoma de San Luis

Potosı, Av. Dr. Manuel Nava 6, 78210 San Luis Potosı,

Mexico

6 Instituto Nacional de Neurologıa y Neurocirugıa, SSA,

Colonia la Fama, Delegacion Tlalpan, Mexico, DF, Mexico

7 Facultad de Medicina, Universidad Autonoma del Estado de

Morelos, Av. Universidad 1001, CP 62209 Cuernavaca,

MOR, Mexico

8 Facultad de Ciencias Agropecuarias, Universidad Autonoma

del Estado de Morelos, Av. Universidad 1001,

CP 62209 Cuernavaca, MOR, Mexico

123

Planta (2017) 245:1037–1048

DOI 10.1007/s00425-017-2658-z

Keywords Cysticercosis � Embryogenic callus � Oralvaccine � Taenia solium � Taenia crassiceps

Abbreviations

DTH Delayed-type hypersensitivity

PBMC Peripheral blood mononuclear cell

Introduction

Vaccination is widely recognized as the most powerful tool

to prevent infectious diseases. By now, most of the effective,

commercially available vaccines were developed using

classical approaches (Greenwood 2014), i.e. attenuated or

inactivated virus, toxoids, and whole killed bacteria. How-

ever, classical vaccination approaches effectively protect

only against a few among the multitude of existing or

emerging pathogens, resulting in a persistent worldwide

morbidity and mortality by infectious diseases (WHO 2014).

The advances in the omics disciplines provide a significant

improvement in the identification and expression of

immunodominant target antigens critical for pathogen sur-

vival. With this knowledge, the development of subunit

vaccines is being greatly favored. Although such vaccines are

safer, they are usually less immunogenic than whole patho-

gen-based vaccines (Arama and Troye Blomberg 2014).

Therefore, attention is given to improve their efficacy using

new vaccine formulations and alternative immunization

routes. New approaches include the use of new delivery

systems to optimize the presentation of vaccine antigens

administered in a needle-free manner (Lebre et al. 2011). It is

also desirable to have delivery systems with adjuvant effects,

e.g. promoting some degree of inflammation and/or extend-

ing the antigen presence in the host (Rosales-Mendoza and

Salazar-Gonzalez 2014). Different delivery systems exhibited

some of these properties, in particular for injectable vaccines,

such as filamentous phages (Houten et al. 2006), Brucella

lumazine synthase (Berguer et al. 2012), and virus-like par-

ticles (Shirbaghaee 2016). On the other hand, much less

success has been attained in improving the efficacy of oral

vaccines. Attenuated or genetically modified normal flora

bacteria are currently being tested for immunization with

heterologous antigens through the oral route, with promising

results (Rosales-Mendoza et al. 2016). These needle-free

vaccines may improve both mucosal and systemic immunity,

an important issue considering that most pathogens enter

their host via the respiratory or oral tracts (Savelkoul et al.

2015). Moreover, these needle-free vaccines are less expen-

sive, overriding the costly logistic of vaccination with

injectable formulations. Within this context, plant-based

vaccines may provide optimal delivery systems, adequate for

oral immunization, easily scalable for massive production at

low cost, and non-dependent of a ‘‘cold-chain’’ for their

application. It is also noteworthy that plants produce com-

ponents with adjuvant properties, like saponins, that may

improve the immunogenicity of the vaccines themselves

(Rosales-Mendoza and Salazar-Gonzalez 2014).

Among the plant species used for oral delivery of vac-

cines, tobacco is a widely explored system, providing

notable immunogenic activity; however, the presence of

toxic compounds limits its use as a preliminary system for

proving the concept of oral delivery by plant cells. Previ-

ous studies have also explored lettuce cells as delivery

vehicle, providing evidence on the induction of humoral

responses against hepatitis B virus (Czy _z et al. 2014).

On the other hand, we have developed a vaccine to

prevent Taenia solium cysticercosis. T. solium cysticercosis

is a major parasitic disease that frequently affects human

health and the economy of non-developed countries. The

most severe and even fatal form of the disease occurs when

cysticerci are lodged in the human central nervous system,

causing neurocysticercosis. Pigs are the obligate interme-

diate hosts to complete the life cycle of the parasite. Thus,

it is plausible to curb human transmission by reducing pig

cysticercosis through effective vaccination programs.

Different protective parasite antigens have been identified

and successfully tested for vaccination under experimental

conditions (Sciutto et al. 2008). However, only Tsol18 and

S3Pvac have been tested in field trials (Huerta et al. 2001;

Morales et al. 2011; Gauci et al. 2013). The S3Pvac vaccine

includes well-defined peptides and has been exploited to

evaluate the cost-benefit of different delivery systems and

vaccination routes. S3Pvac is based on the highly protective

18-aa epitope named GK-1 (which was identified as a highly

immunogenic peptide in the partial 100-aa-length KETc7 T.

crassiceps recombinant protein) and two additional 12-aa

(KETc1), and 8-aa (KETc12) peptides. Either synthetically

or recombinantly produced, the S3Pvac vaccine exhibited a

high protective efficiency when tested on the field under

natural conditions of transmission (Huerta et al. 2001; Mor-

ales et al. 2008, 2011). Later on, a plant-based vaccine

against cysticercosis was developed in transgenic embryo-

genic papaya cells.

Carica papaya L. ‘‘Maradol Tabasco’’ (Hernandez et al.

2007) was selected to express the S3Pvac vaccine peptides

because this system was first successfully employed in

Mexico to produce transgenic papaya plants using

embryogenic calli as target cells for particle bombardment

(Cabrera-Ponce et al. 1995). Thereafter, some anti-parasitic

components produced by papaya itself, like carpasemine

(Okeniyi et al. 2007), which underlie the remarkable yet

non-specific protection induced by subcutaneous mouse

immunization with non-transformed papaya cells (Her-

nandez et al. 2007), increased the suitability of this system.

S3Pvac-papaya induced high protection levels against T.

crassiceps and T. pisiformis cysticercosis when

1038 Planta (2017) 245:1037–1048

123

parenterally or even orally administered (Hernandez et al.

2007; Betancourt et al. 2012). Further properties of the

S3Pvac-papaya vaccine are herein reported, highlighting its

potential as a vaccine platform for oral immunization.

Materials and methods

Animals

All experiments were conducted in accordance to the

principles set forth in the Guide for the Care and Use of

Laboratory Animals, Institute of Laboratory Animal

Resources, National Council, Washington, DC, USA,

1996. This study was approved by the Ethical Committee

of Instituto de Investigaciones Biomedicas.

Mice

Six- to ten-week-old BALB/cAnN female mice (a per-

missive strain to murine cysticercosis) were used for vac-

cine trials (Fragoso et al. 2008). Mice were bred in a single-

line breeding system and kept in microisolators in the

animal facilities at the Instituto Nacional de Investiga-

ciones Biomedicas, Universidad Nacional Autonoma de

Mexico (UNAM), or in the Faculty of Medicine of

Universidad Autonoma de Puebla (BUAP).

Pigs

To assess the immune response induced by orally admin-

istered S3Pvac-papaya, 40 cysticercosis-free, 2- to

4-month-old, York-Landrace pigs of both sexes and mixed

genetic background from a rural farm in a southern Mexico

City suburb were employed.

S3Pvac-papaya vaccine

Embryo tissues from each transgenic clone (5 g) and from

non-transformed papaya calli were powdered in liquid

nitrogen and homogenized in extraction buffer [PBS pH

7.4, 50 mM sodium ascorbate, 1 mM EDTA pH 8.0, 0.2%

Triton X-100 and 10 lL/mL of protease inhibitor to His-tag

protein (Sigma, St. Louis, MO, USA)] and centrifuged at

21,3209g at 4 �C for 20 min to remove insoluble debris.

The supernatant was collected, and protein concentration

was determined by the Lowry method (Lowry et al. 1951).

Peptide detection by HPLC in the S3Pvac-papaya

clones

Protein extracts were obtained by milling 50 mg of papaya

callus fresh tissue in 300 lL of extraction buffer [750 mM

Tris–HCl (pH 8.0), 15% (w/v) sucrose, 100 mM b-mer-

captoethanol and 1 mM PMSF] (Franklin et al. 2002).

Samples were centrifuged at 16,0009g for 10 min, and

supernatants were subsequently mixed with 100 lL of

0.1% trifluoroacetic acid (TFA)/water with photometric

grade TFA (Sigma). Samples were analyzed in an Agilent

1260 Infinity Binary LC Chromatography RP-HPLC sys-

tem (Agilent Technologies, Palo Alto, CA, USA) and data

were analyzed with the ChemStation software. Protein

extract samples (100 lL) from either transgenic or trans-

formed plants were injected in the equipment using a

ZORBAX Eclipse XDB C18 column (4.6 9 150 mm,

5 lm) (Agilent Technology) equilibrated with 0.1% of

TFA in water, and separation was carried out at 30 �Cusing a linear gradient of aqueous acetonitrile containing

0.1% TFA at a flow rate of 1 mL/min. Acetonitrile con-

centration was increased from 0 to 50% over 75 min and

held constant thereafter. Column effluent was monitored by

UV absorption (217 nm) to identify peptide signals. The

major peaks from the HPLC chromatogram were identified

individually and the corresponding areas calculated

(Fig. 1). Peptide concentration in plant lines was deter-

mined using a standard curve constructed with a concen-

tration range of 1.5–250 ng/lL of pure synthetic peptides,

comprising GK-1 (USV Ltd, Mumbai, Maharashtra, India),

KETc12 (AnaSpec, Fremont, CA, USA), and KETc1

(AnaSpec) (data not shown).

Immunization

The S3Pvac-papaya oral vaccine was prepared by com-

bining in equal amount of soluble extract of the three

transgenic embryogenic papaya clones named pKETc126,

pKETc19, and pKETc723, which express the KETc12.6His,

KETc1.6His, and KETc7 peptides, respectively (Hernan-

dez et al. 2007).

Mouse immunization

Groups of 6–9 mice were orally immunized with the

S3Pvac-papaya soluble extract at doses ranging from 0.56

to 56.1 ng per mouse (accounting for 0.19–19 ng of

KETc1, 0.22–22 ng of KETc7, and 0.15–15.1 ng of

KETc12) included in 0.1–10 lg of papaya callus total

extract, respectively. The immunogens were prepared by

mixing total callus protein in saline solution and/or using

vehicles like soy oil (10 lg/200 lL, Cargill) (Stein et al.

2013), corn starch (10 lg/200 lL) (Stertman et al. 2006),

canola oil (10 lg/200 lL, Cargill), or maize wafers (10 lgper wafer) (Rojo et al. 2001). These vehicles were chosen

as appealing for mice and pigs. To test the effect of papaya

alone, control groups administered with the respective

amount of soluble extract from transgenic papaya callus,

Planta (2017) 245:1037–1048 1039

123

either with or without vehicle, were included. The vaccine

with or without vehicles was intragastrically administered

using a curved feeding needle, except for mice that

received the vaccine in maize wafers. In this case, each

mouse was isolated until the entire wafer was consumed.

All mice received two vaccine or vehicle doses, 15 days

apart. Mice were anesthetized with Sevorane (Abbot,

http://www.abbott.com) and bled from the orbital plexus

before sacrificed.

Pig immunization

Forty 2–4 month-old pigs (15 castrated males and 25

females) were included in this study. Pigs were randomly

divided into four groups of ten animals each. One group

was fed with a tuna oil-enriched maize bolus containing

only saline, and the other three groups received the S3P-

vac-papaya vaccine at a dose of, 1, 10, or 100 lg per pig in

the maize bolus, and a boost two weeks later. Blood

samples were obtained by intravenous puncture before the

immunization protocol and fifteen days after. Serum was

separated and stored at -70 �C until used.

Parasites for infection

Taenia crassiceps cysts for experimental mouse infection

were harvested from the peritoneal cavity of stock female

mice with 2–3 months of infection. Mice were infected

with 20 small (2-mm), non-budding, highly motile T.

Fig. 1 Identification of peptides in transgenic papaya calli by RP-

HPLC. a HPLC profile of papaya transgenic lines expressing the

KETc1 (clone 9), KETc12 (clone 6), and KETc7 (clone 23) peptides.

Peaks matching the retention time of standards evidence the

expression of the recombinant peptides. These signals are nearly

absent in WT papaya. b Results are expressed as mean ± standard

deviation of the recombinant peptide per gram of callus papaya fresh-

tissue. The background from WT papaya at the respective peaks was

subtracted to the signal yield by the transgenic lines, and mAU values

were used to determine the concentration of each recombinant peptide

1040 Planta (2017) 245:1037–1048

123

crassiceps cysticerci in 0.9 mL of 0.9% isotonic saline

solution (ISS) two weeks after the last immunization. Mice

were sacrificed 30 days after infection and cysts were

harvested from the peritoneal cavity and counted to

determine the effect of vaccination, as previously reported

(Toledo et al. 1999, 2001). Organs in the peritoneal cavity

were carefully inspected to detect any remaining T. cras-

siceps larvae.

The humoral and cellular immunity

The humoral and cellular immune responses were evalu-

ated in mice and pigs fifteen days after the last oral

immunization, as described below.

ELISA assay

For antibody detection, Immulon I plates (Nunc, Thermo

Scientific, http://www.thermoscientific.com) were sensi-

tized with 1 lg/well of either papaya or S3Pvac-papaya

soluble extract (Hernandez et al. 2007) in carbonate buf-

fered saline, pH = 9.6, overnight at 4 �C. Plates were

washed and blocked with 200 lL of PBS containing bovine

serum albumin 1% w/v and 0.3% (v/v) Tween 20, and left

for 60 min at 37 �C. Pig or mouse serum samples were

diluted 1:200 or serially diluted for titration and incubated

for 30 min at 37 �C. The reaction was detected with 100

lL/well of HRP-goat anti-pig IgG (Fc) (Serotec, https://

www.bio-rad-antibodies.com) diluted 1:12,000 or HRP-

anti-mouse IgG (H?L) (Invitrogen) diluted 1:2000 and

incubated for 30 min at 37 �C. The reaction was developed

with 100 lL/well of tetramethylbenzidine (TMB) (Zymed,

San Francisco, CA, USA) for 5 min at 4 �C in the dark and

stopped by adding 100 ll 0.2 M H2SO4. OD values were

measured at 450 nm in an ELISA reader (Opsys MR

Dynex Technology, Chantilly, VA, USA).

Immediate and delayed-type hypersensitivity (DTH)

response

To account for a vaccine-induced cellular immune

response, a DTH test was conducted. Three groups of five

mice each were administered with either saline or soluble

extracts of papaya alone or S3Pvac-papaya (10 lg per

mouse) (Hernandez et al. 2007). Twenty days after the

last dose, the abdomen of each mouse was raised and 20

lL of saline or 10 lg of soluble total cysticercal antigens

(Ramos-Kuri et al. 1992), papaya, or S3Pvac-papaya

soluble extract (Hernandez et al. 2007) were subcuta-

neously inoculated in four abdomen spots. To assess

DTH, two measures were performed 48 and 72 h later. In

addition, to account for the lack of possible immediately

hypersensitive reactions, the thickness at the injection site

was determined with an electronic Vernier caliper

(Stainless Hardened Vernier Digital) 5, 10, and 15 min

after inoculation.

In-vitro lymphocyte proliferation

Fifteen days after the last immunization, a cell suspension

was made by spleen perfusion in control and vaccinated

mice. For pigs, blood samples collected before and 15 days

after the boost immunization were processed in a Ficoll-

Hypaque gradient (Sigma) to recover peripheral blood

mononuclear cells (PBMCs) as reported elsewhere

(Manoutcharian et al. 2004).

Mouse spleen cells or pig PBMCs were washed twice

with RPMI 1640 medium. Red blood cells were removed

from spleen cell suspensions by lysis with ammonium

chloride buffer as previously reported (Manoutcharian

et al. 2004). PBMCs suspensions were labeled with car-

boxyfluorescein succinimidyl ester 5 lM (CFSE; Molec-

ular Probes) according to the manufacturer’s instructions,

and extensively washed following a previously described

procedure (Segura-Velazquez et al. 2009). Cells were then

placed in RPMI 1640 medium supplemented with L-glu-

tamine (0.2 mM), penicillin (100 U/mL), streptomycin

(100 mg/mL) (Invitrogen), and FBS (10%) (Gibco).

Either S3Pvac peptides for mice (10 lg/mL) or S3Pvac-

papaya soluble extract for pigs (0.6 and 6 lg/mL) were

added to the culture wells containing 2 9 105 cells in 200

lL of culture medium and plates were incubated at 37 �Cin a 5% CO2 humidified atmosphere in flat-bottomed

microtiter plates (Costar, Cambridge, MA, USA). Con-

canavalin A (ConA, 2.5 lg/mL) was added to the cultures

as a positive control. After 5 days of culture, T cell pro-

liferation was measured by flow cytometry in pigs by

counting blast cells identified by forward scatter (FSC)

and side scatter (SSC) in a FACScan flow cytometer

(Becton–Dickinson, Palo Alto, CA, USA). For mice, cell

suspensions were stained at 4 �C with the antibodies

CD4-phycoerithrine and CD8-PerCP-Cy5.5 (Biolegend,

http://www.biolegend.com), and analyzed by flow

cytometry.

Real-time reverse transcription PCR (RT-qPCR)

To evaluate the stability of the expression of the S3Pvac

components in the transgenic lines, transcript levels of the

genes KETc12.6His, KETc1.6His, and KETc7 were ana-

lyzed using specific primers (Hernandez et al. 2007). In

parallel, four housekeeping genes were amplified for nor-

malization: elongation factor 1-alpha (EF1), elongation

factor 2-alpha (EF2), TATA binding protein 1 (TBP1),

TATA binding protein 2 (TBP2), which were previously

reported by Zhu et al. (2012). The following primers were

Planta (2017) 245:1037–1048 1041

123

used: EF1 forward 50GGCAGATTGGAAATGGCA30

reverse 50AGGAGGATACTGGGAGAA30; EF2 forward

50CTTTGCCTTCGGTCGTGTCTTC30 reverse 50CACTGTCTCCTGCTTCTTTCCC30; TBP1 forward 50GGTAGTAGTAGTTAGGTATGTG30 reverse 50GGCAATCTGGTCTCACTT30 TBP2 forward 50TGTGAATACTGGTGCTGAG30 reverse 50GGCATGAGACAAGACCTATA30.

RT-qPCR was carried out in 48-well plates using a

StepOneTM Real-Time PCR System and StepOneTM Real-

Time PCR System Software (Applied Biosystems, Carls-

bad, CA, USA) using a SYBR Green-based PCR assay.

Each reaction mix containing 2 lL of diluted cDNAs, 5 lLof iTaqTM Universal SYBR Green Supermix (Bio-Rad),

0.5 mM of each primer to a final volume of 10 lL was

subjected to the following amplification conditions: 95 �Cfor 10 min; followed by 40 cycles of 95 �C for 15 s, 60 �Cfor 60 s, and 95 �C for 15 s. Melting curves were analyzed

at 65–95 �C after 40 cycles. Each RT-qPCR analysis was

performed in triplicate and the mean was used for RT-

qPCR analysis.

Statistical analysis

Data were collected in Excel 7.0 (Microsoft, Redmond,

WA, USA) and analyzed with the InStat software

(GraphPad, La Jolla, CA, USA). Parasite load was com-

pared between mouse groups using the Mann–Whitney

non-parametric test. Data on antibody levels were com-

pared using an unpaired t test. Stimulation index data were

analyzed by the Tukey–Kramer multiple comparisons test.

A value of P\ 0.05 was considered as statistically

significant.

Results

Stability of the S3Pvac papaya transgenic lines

To investigate the stability of transformation events in the

transgenic embryogenic papaya clones pKETc126,

pKETc19, and pKETc723, transcript levels of the corre-

sponding transgenes were measured by qPCR. KETc12

transcripts were the most abundant, while KETc7 showed

an intermediate expression and KETc1 the lowest levels

(Suppl. Fig. S1). Transgene expression was normalized

using four different housekeeping genes (EF1, EF2, TBP1,

TBP2), observing no significant changes in the abundance

patterns among the distinct transgene transcripts, suggest-

ing that these housekeeping genes provide a consistent

constitutive expression and thus a proper normalization

(Suppl. Fig. S1).

Peptide detection by HPLC

Peptides with molecular masses between 2 and 9 kDa were

identified in supernatants from three different transgenic

papaya cell lines by RP-HPLC chromatography, using a

ZORBAX Eclipse XDB C18 column (4.6 9 150 mm,

5 lm). The peptides were quantified in the transgenic

clones using synthetic peptides as a standard in RP-HPLC.

First, peaks corresponding to synthetic KETc1, GK-1, and

KETc12 peptides were identified with retention times of

20, 33, and 41 min, respectively. Protein extracts from

transgenic cell lines were individually injected in the

equipment, and one main peak was observed in the chro-

matograms for the pKETc19, pKETc723, and pKETc126clones, with retention times matching the respective pep-

tides (Fig. 1a). Other minor peaks were observed, corre-

sponding to peaks present in the WT plant chromatogram.

Peptide concentration in plant lines was determined using a

standard curve constructed with a concentration range of

1.5–250 ng/lL of pure synthetic peptides and the mAU

response. The mAU values obtained for each recombinant

peptide were used to determine the concentration using

linear regression. Results are expressed in ng of recombi-

nant peptide per microgram of total extract. (Fig. 1b).

Oral S3Pvac-papaya vaccine using differentvehicles

In mice

Protection

The protective effect induced by oral immunization in mice

with papaya or S3Pvac-papaya soluble extract is shown in

Table 1. Considering the dose dependence of antigens

orally administered in triggering mucosal tolerance, three-

log doses were tested for their protective capacity against

murine cysticercosis. A statistically significant protection

was induced by the three tested doses: 0.56, 5.6 and 56 ng

of S3Pvac soluble extract per mouse, with protection

ranging from 55.8 to 66.2%. In contrast, the corresponding

papaya soluble extract did not significantly modify the

expected parasite load.

Towards the vaccine formulation, different vehicles were

tested. As shown in Table 2, either orally administered in

saline or included in three of the four different vehicles, the

vaccine significantly reduced the expected parasite load

from 75 to 89.8%. A statistically non-significant reduction

(41.4%) was observed when the vaccine was administered

formulated with corn starch as the vehicle.

1042 Planta (2017) 245:1037–1048

123

Humoral immune response

Specific antibodies were detected both in mice immunized

with papaya alone or with S3Pvac-papaya. As shown in

Table 3, significantly higher levels of anti-S3Pvac papaya

antibodies were found in mice immunized with the

vaccine.

Type-IV DTH response

To evaluate the role of vaccination on Th1/Tc1 differen-

tiation in vivo, cell-mediated type-IV DTH was measured.

Four out of five mice immunized with S3Pvac-papaya

showed an infiltrated erythematous reaction that enlarged

Table 1 Dose-dependent protection induced by oral S3Pvac-papaya

vaccine against murine cysticercosis

Mice immunized with Number of cysticerci Mean ± SD�

Saline (control) 24, 52, 36, 18, 15, 18 27.2 ± 14.2a

Soluble extract (lg/dose)

Papaya

0.1 25, 30, 17, 34, 25, 22 25.5 ± 5.9a

1 10, 22, 28, 16, 25, 15 19.3 ± 6.8a

10 37, 29, 24, 12, 13, 40 25.8 ± 11.8a

S3Pvac-papaya�

0.1 9, 11, 18, 11, 10, 15 12.3 ± 3.4b

1 8, 13, 10, 8, 13, 13 10.8 ± 2.5b

10 8, 9, 10, 8, 11, 9 9.2 ± 1.0b

Letters indicate statistically significant differences between groups at

95% confidence using the unpaired t test with Welch correction,

which assumes the populations may have different SD� Mean ± standard deviation of the number of parasites recovered in

each mouse group� The content of the three peptides in each dose was 0.56, 5.6, and

56 ng in 0.1, 1, and 10 lg of soluble extract, respectively

Table 2 Effect of different

vehicles in the protection

against murine cysticercosis

induced by oral S3Pvac-papaya

vaccine

Oral immunized with Mean ± standard deviation % Protection

1st experiment

Saline 141.2 ± 114.2a

S3Pvac-papaya-saline 18.6 ± 17.3b 86.8

Corn starch 70.5 ± 56.8a

S3Pvac-papaya in corn starch 29.8 ± 31.4a,b 41.4

Soil Oil 41.2 ± 16.4a

S3Pvac-papaya in soy oil 10.3 ± 2.2a,b 75

Canola oil 72.4 ± 68.2a

S3Pvac-papaya in canola oil 11.5 ± 8.6b 84.1

2nd experiment

Saline (control) 122.8 ± 73.2a

S3Pvac-papaya 17.8 ± 33.9b 85.5

S3Pvac-papaya in maize wafers 12.5 ± 18.2b 89.8

Groups of six mice were fed with S3Pvac-papaya soluble extract (5.6 ng in 1 lg of total protein from

papaya callus per mouse) in saline or into different vehicles

Different literals indicate significant differences in the parasite load between mice that received the dif-

ferent treatments (P\ 0.05) using the unpaired t test with Welch correction, which assumes the populations

may have different SD

Table 3 Humoral and cellular immunity induced in mice with oral

S3Pvac-papaya vaccine

Groups Antibody levels (OD450 nm ± SD) against�

Papaya S3Pvac-papaya

Saline 0.16 ± 0.10a 0.26 ± 0.25b

Papaya 0.39 ± 0.14c 0.64 ± 0.27c

S3Pvac-papaya 0.57 ± 0.15c 0.92 ± 0.16d

Intradermal reaction [diameter (in cm) ± SD]

against�

Saline 0a 0a

Papaya 0a 0a

S3Pvac-papaya 0a 1.3 ± 0.79b

Different literals indicate significant differences at P\ 0.05 using an

un-paired t-test� Serum antibody levels in mice (n = 7–8) orally immunized with

saline, papaya or S3Pvac-papaya (56 ng in 10 lg of total protein frompapaya callus per mouse) measured by ELISA� DTH responses induced in saline, papaya or S3Pvac-papaya orally

immunized mice (n = 5) were measured by an electronic Vernier

caliper. A larger lesion diameter was measured in S3Pvac-papaya

immunized mice, 48 h after intradermal inoculation

Planta (2017) 245:1037–1048 1043

123

48 h after inoculation (Table 3). No reaction was detected

in those mice that received saline or papaya only; also,

S3Pvac-papaya vaccination did not induce an immediate

reaction (5, 10, or 15 min after subcutaneous inoculation).

In vitro T cell proliferation

To further analyze the phenotype of the T cell population

involved in the increased DTH response induced by the

vaccine, the recall antigen response of CD4? and CD8? T

lymphocytes was measured. Figure 2 shows the index of

CFSE incorporation in CD4? and CD8? T cells from

mouse spleen. Oral immunization with S3Pvac-papaya

induced a significant increase in the percentage of prolif-

erating CD4? and CD8? cells, although with some dif-

ferences depending on the peptide used for stimulation

in vitro and on the vaccine dose employed.

In pigs

Humoral immune response

The levels of antibodies against papaya and S3Pvac-papaya

in sera from vaccinated and control pigs are shown in

Fig. 3. A significant increase in antibody levels was found

in pigs immunized with 5.6 or 56 ng of vaccine per pig as

confirmed by antibody titration (Fig. 3b). Immunization

using 560 ng of vaccine per pig did not significantly

increased Ab levels. A higher non-specific binding was

observed when S3Pvac-papaya was used as the antigen

source compared to papaya alone.

In vitro T cell proliferation

Figure 4 shows the T cell proliferation level induced

in vitro by two different doses of soluble S3Pvac-papaya

extract in peripheral blood cells from pigs that either

received saline or the three vaccine doses (Chavarrıa et al.

Fig. 2 CD4 and CD8 proliferative response induced by S3Pvac-

papaya orally administered in mice. Splenocytes from mice orally

immunized with ISS or S3Pvac-papaya were stimulated in vitro with

the synthetic peptides GK-1, KETc1, or KETc12, and CFSE-stained.

Five days after culture, cell suspensions were labeled with anti-CD4

or anti-CD8 antibodies and analyzed by flow cytometry. Stimulation

index of CD4 or CD8 proliferative T cells is shown. Asterisk

Significantly increased proliferation in cells from mice immunized

with S3Pvac-papaya vaccine with respect to those that received saline

only (P\ 0.05)

Fig. 3 a Individual antibody responses in pigs orally immunized with

three different S3Pvac-papaya vaccine doses administered in maize

bolus or formulated in maize wafers. Antibody levels are significantly

higher in those pigs vaccinated with 5.6 and 56 ng of vaccine than in

controls pigs (P\ 0.05). b Antibody titration in pooled sera of non-

immunized and S3Pvac immunized pigs

1044 Planta (2017) 245:1037–1048

123

2003; Manoutcharian et al. 2004). A statistically significant

increase was observed only in pigs vaccinated with either

5.6 or 56 ng of vaccine with respect to the group that

received saline only. It is also remarkable the overall

increase of the proliferative response in vitro, disregarding

the presence of the antigen. Indeed, significant differences

were observed in proliferation levels among cells from the

pigs immunized with 1 or 10 lg in the S3Pvac-vaccinated

groups. It is also noteworthy the high heterogeneity in the

proliferative response in the pigs that received a same

treatment; this heterogeneity is more marked when the

highest vaccine dose was used for immunization.

Discussion

Oral vaccination would be the optimal route to prevent

infectious diseases in which pathogens are acquired by the

mucosal route. It also offers clear advantages for a sus-

tained application of vaccines at low costs (Lamichhane

et al. 2014). Despite the convenience of oral vaccines, no

subunit oral vaccines are under use to prevent any human

disease; only recombinant cholera toxin B subunit is used

as a component of an internationally licensed oral cholera

vaccine, including whole killed Vibrio cholerae cells as its

main component (Baldauf et al. 2015). The limited

absorption of antigens from mucosal surfaces and their

possible degradation by proteolytic enzymes that limit the

elicitation of the desired immunity and the feasibility of

inducing oral tolerance may underlie this absence.

In this study, experimental evidence clearly indicates

that the papaya-based delivery system is stable and ade-

quate to elicit oral immunity, using a broad antigen dose

range, as confirmed in two different mammal species.

These findings overcome the limitation of several oral

vaccines in inducing mucosal tolerance (Buchanan et al.

2012; Lamichhane et al. 2014). During our research using

the anti-cysticercosis vaccine (S3Pvac) based in three

peptides separately expressed in papaya transgenic calli, it

became clear that a plant-based platform will be an ade-

quate system for oral immunization (Hernandez et al.

2010). In this respect, it should be remarked that transgenic

plants are recognized as an advantageous platform for oral

delivery of subunit vaccines, since they allow vaccine

production at low cost and protect the antigen from

degradation in the digestive system.

In a first study, the transgenic lines that induced the

highest protection levels against experimental murine cys-

ticercosis were selected by immunizing mice with the

respective soluble extract from different clones that

expressed each of the peptides (KETc7, KETc1, or KETc12)

(Hernandez et al. 2007). This strategy let us to select three

highly protective clones that express each of the vaccine

antigens. In the latter study, clones that expressed KETc7

were administered by subcutaneous injection in two differ-

ent doses, i.e. 200 and 1000 lg of total soluble extract per

mouse. Since a similar level of protection was obtained

disregarding the dose employed, the lower dose was selected

for further experiments. The protective capacity of the

vaccine included in soluble extracts or in a transgenic callus

suspension was then compared (Hernandez et al. 2010).

Interestingly, high and similar protection levels were

induced by both vaccine formulations. Indeed, high levels of

sterile immunity to experimental T. crassiceps cysticercosis

were conferred to female mice immunized with the

pKETc19, pKETC723, or pKETc126 clone. It has been

considered that plant cell walls can protect vaccine antigens.

However, the high and similar protection levels found when

powdered calli or a soluble extract were employed for

vaccination do not support this hypothesis. Instead, it is

likely that other components of the papaya itself can

improve vaccine protection. Among these components fig-

ure saponins, extensively used as adjuvants in veterinary

vaccine formulations, which along with flavonoids, alka-

loids, and tannin have been found in Carica papaya

(Sasidharan et al. 2011).

The protective and immunogenic capacity of the oral

S3Pvac anti-cysticercosis vaccine was thoroughly studied

herein.

A critical feature to assess was the range of dose-de-

pendent protection induced by the vaccine. Considering the

Fig. 4 In vitro proliferative response induced by two concentrations

of S3Pvac-papaya in peripheral cells from pigs immunized with three

doses of S3Pvac-papaya, formulated in maize wafers. A significantly

increased proliferation was observed in cells from pigs immunized

with 1 or 10 lg of S3Pvac-papaya vaccine with respect to those that

received saline only (P\ 0.01). No differences were detected

between non-treated cells and cells treated in vitro with immunogen

(P[ 0.05). Statistical analysis was performed using the Kruskal–

Wallis test (non-parametric ANOVA)

Planta (2017) 245:1037–1048 1045

123

protection induced by the S3Pvac-papaya vaccine when

subcutaneously applied a lower three-log range of

0.1–10 lg of total protein per mouse was tested herein. The

vaccine, formulated with 0.19–19 ng of KETc1,

0.22–22 ng of KETc7, and 0.15–15.0 ng of KETc12 orally

administered as a soluble extract, induced statistically

significant protection in the three doses tested, ranging

from 55 to 66% (Table 1). Then, the feasibility of

improving the vaccine protective capacity using different

vehicles for administration was tested. The vaccine pro-

tective capacity was maintained when administered in

combination with different vehicles, i.e. soy oil, canola oil,

and maize wafers (Table 2). The most interesting results

were observed when a maize bolus was employed to feed

mice. These results indicate that the vaccine can be

incorporated directly into animal food without losing its

protective capacity (Table 2). A significant protection was

induced by oral vaccination with S3Pvac-papaya, although

in a lower extent than that induced when injectable vaccine

was applied (Hernandez et al. 2007). However, since the

experiments were performed in different times, results are

hardly comparable.

In this regard, it is important to mention that the pro-

portion of totally protected mice and the average decrement

in the parasite load in the immunized group varied in

experiments performed on different occasions (Toledo

et al. 1999, 2001). Variation in parasite infection intensity

within experimental groups and between experimental

sessions is a common finding in this form of cysticercosis

due to factors not fully identified but that we attribute to

variation in infectivity of each parasite harvest and

inoculums. It is noteworthy that the low peptide amount

included in the vaccine resulted in an immunogenic

response. Several factors may account for this unexpected

result, namely the high molar ratio of the peptides used

with respect to proteins, and the adjuvant properties of

papaya components. Nevertheless, it would be relevant to

test much higher doses than those tested herein for oral

vaccination (Fragoso et al. 2011).

An interesting finding is the fact that the high level of

mRNA expression of the pKETc12 clone does not corre-

spond to the protein concentration as shown by HPLC, a

point that may be related with transcriptional gene

regulation.

The immunity accompanying the observed protection

was tested in mice and pigs, and a specific antibody

response was observed in both species (Table 3; Fig. 3). It

is also unexpected that the lowest and medium vaccine

doses elicited significantly increased antibody levels. It is

feasible that the immunogenic properties of papaya con-

stituents may be involved in this unusual response. An

increased specific proliferative response of CD4? and

CD8? cells was also detected in mice (Fig. 2). Additional

DTH experiments, suggesting the induction in vivo of a

Th1/Tc1-type effector T cells response are reported

(Table 3). An increased proliferative response was also

observed in pigs orally immunized with two of the three

tested vaccine doses. Proliferation of peripheral mononu-

clear cells from S3Pvac-immunized pigs was observed

disregarding additional in vitro re-calling (Fig. 4). It is

likely that the mitogenic proteolytic enzymes contained in

papaya latex as a protection against insects (Konno et al.

2004), which may override the in vitro effect of the vac-

cine, may account for these increased proliferation levels.

It is also interesting to note the observed heterogeneous

response, since vaccination failed to increase the cell pro-

liferative capacity in some pigs. The reasons behind these

differences are not explored in this study, but genetic

make-up as well as differences in food intake could be

underlying them. Nevertheless, once the immunological

parameters related with vaccine-induced protection have

been elucidated, the heterogeneity of induced immunity

should be evaluated to maximize the protection induced.

Evidence on the feasibility of using plants as vehicle for

oral delivery of several biopharmaceuticals has been gen-

erated during the last two decades (Kwon and Daniell

2015). In the case of vaccines, freeze-dried material from

lettuce plants expressing the hepatitis B surface antigen

(HBsAg) was processed by lyophilization using sucrose as

a lyoprotectant, and employed as an oral boosting vaccine

in mice. This approach succeeded in enhancing the anti-S-

HBsAg humoral response in a scheme comprising intra-

muscular priming with the conventional antigen. The

boosting effect was comparable to that attained when

boosting by injection of the pure antigen (Czy _z et al. 2014).

Papaya vaccine does not require neither priming with pure

antigens, which is expensive, nor using excipients during

freeze-drying process. Moreover, the efficiency of expres-

sion for foreign antigens in papaya, along with its intrinsic

anti-parasitic properties, points to its usefulness to express

other antigens for vaccine development against intestinal

pathogens.

In conclusion, this study demonstrates the usefulness of

the papaya platform for oral immunization and the effec-

tiveness of oral S3Pvac-papaya anti-cysticercosis vaccine

to elicit an effective immunity against murine cysticercosis

and evidences its immunogenic capacity in pigs. Further

studies to evaluate its protective properties against porcine

cysticercosis in the most immunogenic dose range are

needed to propose its inclusion in sustainable and realistic

control campaigns to prevent transmission.

Author contribution statement GF, conception and design

of the study, data analysis and interpretation, manuscript

drafting; MH, data acquisition and analysis, sample pro-

cessing; JC, protective study in mice; RRA, sample

1046 Planta (2017) 245:1037–1048

123

processing; HC, data acquisition and sample processing;

NV, data acquisition; RS, humoral and cellular response

evaluation in mice; AF, cellular response assay in pigs; IF,

cellular response assay in pigs; HJ, technical support in

swine care; GR, design and analysis of DTH study; LG,

DTH assay; EP, DTH assay; EM, qRT-PCR; SM, qRT-

PCR; LGV, Data analysis; ES, conception and design of

the study, data analysis and interpretation, manuscript

drafting.

Acknowledgements This work was supported by CONACyT

(201448, 152793), DGAPA (IG-200414), Programa de Investigacion

para el Desarrollo y la Optimizacion de Vacunas, Inmunomodu-

ladores y Metodos Diagnosticos del Instituto de Investigaciones

Biomedicas, UNAM, and Programa de Redes Tematicas de Colabo-

racion academica, PRODEP. The authors acknowledge Georgina

Diaz, Carlos Escamilla Weinman, Francisco Ramos Collazo, Daniel

Garzon, Heriberto Prado-Garcia, Jorge Rebollar and Omar Rangel for

technical support, and Juan Francisco Rodriguez for English edition

of this manuscript. All authors have read and approved the final

manuscript draft.

Compliance with ethical standards

Conflict of interest The authors declare no financial or commercial

conflict of interest.

References

Arama C, Troye Blomberg M (2014) The path of malaria vaccine

development: challenges and perspectives. J Intern Med

275:456–466

Baldauf KJ, Royal JM, Hamorsky KT, Matoba N (2015) Cholera

toxin B: one subunit with many pharmaceutical applications.

Toxins (Basel) 7:974–996

Berguer PM, Alzogaray VA, Rossi AH, Mundinano J, Piazzon I,

Goldbaum FA (2012) A polymeric protein induces specific

cytotoxicity in a TLR4 dependent manner in the absence of

adjuvants. PLoS One 7:e45705

Betancourt MA, de Aluja AS, Sciutto E, Hernandez M, Bobes RJ,

Rosas G, Hernandez B, Fragoso G, Hallal-Calleros C, Aguilar L,

Flores-Perez I (2012) Effective protection induced by three

different versions of the porcine S3Pvac anticysticercosis

vaccine against rabbit experimental Taenia pisiformis cysticer-

cosis. Vaccine 30:2760–2767

Buchanan RM, Tetland S, Wilson HL (2012) Low dose antigen

exposure for a finite period in newborn rats prevents induction of

mucosal tolerance. PLoS One 7:e51437

Cabrera-Ponce JL, Vegas-Garcia A, Herrera-Estrella L (1995)

Herbicide resistant transgenic papaya plants produced by an

efficient particle bombardment transformation method. Plant

Cell Rep 15(1–2):1–7

Chavarrıa A, Roger B, Fragoso G, Tapia G, Fleury A, Dumas M,

Dessein A, Larralde C, Sciutto E (2003) TH2 profile in

asymptomatic Taenia solium human neurocysticercosis.

Microbes Infect 5:1109–1115

Czy _z M, Dembczynski R, Marecik R, Wojas-Turek J, Milczarek M,

Pajtasz-Piasecka E, Wietrzyk J, Pniewski T (2014) Freeze-

drying of plant tissue containing HBV surface antigen for the

oral vaccine against hepatitis B. Biomed Res Int 2014:485689.

doi:10.1155/2014/485689

Fragoso G, Meneses G, Sciutto E, Fleury A, Larralde C (2008)

Preferential growth of Taenia crassiceps cysticerci in female

mice holds across several laboratory mice strains and parasite

lines. J Parasitol 94:551–553

Fragoso G, Esquivel-Guadarrama F, Santana MA, Bobes RJ,

Hernandez B, Cervantes J, Segura R, Goldbaum FA, Sciutto E,

Rosas G (2011) Heterologous prime-boost oral immunization

with GK-1 peptide from Taenia crassiceps cysticerci induces

protective immunity. Clin Vaccine Immunol 18:1067–1076

Franklin S, Ngo B, Efuet E, Mayfield SP (2002) Development of a

GFP reporter gene for Chlamydomonas reinhardtii chloroplast.

Plant J 30:733–744

Gauci C, Jayashi C, Lightowlers MW (2013) Vaccine development

against the Taenia solium parasite: the role of recombinant

protein expression in Escherichia coli. Bioengineered 4:343–347

Greenwood B (2014) The contribution of vaccination to global health:

past, present and future. Philos Trans R Soc Lond B Biol Sci

369:20130433

Hernandez M, Cabrera-Ponce JL, Fragoso G, Lopez-Casillas F,

Guevara-Garcıa A, Rosas G, Leon-Ramırez C, Juarez P,

Sanchez-Garcıa G, Cervantes J, Acero G, Toledo A, Cruz C,

Bojalil R, Herrera-Estrella L, Sciutto E (2007) A new highly

effective antycisticercosis vaccine expressed in transgenic

papaya. Vaccine 25:4252–4260

Hernandez M, Cervantes J, Cabrera-Ponce JL, Herrera-Estrella L,

Rosas G, Villareal ML, Fragoso G, Sciutto E (2010) Develop-

ment of an oral anti-cysticercosis vaccine delivered in geneti-

cally modified embryogenic callus of papaya. Transgenic Plant J

4(special issue 1):64–70

Houten N, Zwick M, Menendez A, Scott J (2006) Filamentous phageas an immunogenic carrier to elicit focused antibody responses

against a synthetic peptide. Vaccine 24(19):4188–4200

Huerta M, de Aluja AS, Fragoso G, Toledo A, Villalobos N,

Hernandez M, Gevorkian G, Acero G, Dıaz A, Alvarez I, Avila

R, Beltran C, Garcia G, Martinez JJ, Larralde C, Sciutto E (2001)

Synthetic peptide vaccine against Taenia solium pig cysticerco-

sis: successful vaccination in a controlled field trial in rural

Mexico. Vaccine 20(1–2):262–266

Konno K, Hirayama C, Nakamura M, Tateishi K, Tamura Y, Hattori

M, Kohno K (2004) Papain protects papaya trees from herbiv-

orous insects: role of cysteine proteases in latex. Plant J

37:370–378

Kwon KC, Daniell H (2015) Low-cost oral delivery of protein drugs

bioencapsulated in plant cells. Plant Biotechnol J 13:1017–1022

Lamichhane A, Azegamia T, Kiyonoa H (2014) The mucosal immune

system for vaccine development. Vaccine 32:6711–6723

Lebre F, Borchard G, de Lima MC, Borges O (2011) Progress towards

a needle-free hepatitis B vaccine. Pharm Res 28:986–1012

Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein

measurement with the Folin phenol reagent. J Biol Chem

193:265–275

Manoutcharian K, Dıaz-Orea A, Gevorkian G, Fragoso G, Acero G,

Gonzalez E, De Aluja A, Villalobos N, Gomez-Conde E, Sciutto

E (2004) Recombinant bacteriophage-based multiepitope vac-

cine against Taenia solium pig cysticercosis. Vet Immunol

Immunopathol 99:11–24

Morales J, Martınez JJ, Manoutcharian K, Hernandez M, Fleury

Gevorkian G, Acero G, Blancas A, Toledo A, Cervantes J, Maza

V, Quet F, Bonnabau H, de Aluja AS, Fragoso G, Larralde C,

Sciutto E (2008) Inexpensive anti-cysticercosis vaccine: S3Pvac

expressed in heat inactivated M13 filamentous phage proves

effective against naturally acquired Taenia solium porcine

cysticercosis. Vaccine 26:2899–2905

Morales J, de Aluja AS, Martınez JJ, Hernandez M, Rosas G,

Villalobos N, Hernandez B, Blancas A, Manoutcharian K,

Gevorkian G, Cervantes J, Dıaz A, Fleury A, Fragoso G,

Planta (2017) 245:1037–1048 1047

123

Larralde C, Sciutto E (2011) Recombinant S3Pvac-phage

anticysticercosis vaccine: simultaneous protection against cys-

ticercosis and hydatid disease in rural pigs. Vet Parasitol

176:53–58

Okeniyi J, Ogunlesi T, Oyelami O, Adeyemi L (2007) Effectiveness

of dried Carica papaya seeds against human intestinal parasito-

sis: a pilot study. J Med Food 10:194–196

Ramos-Kuri M, Montoya RM, Padilla A, Govezensky T, Dıaz ML,

Sciutto E, Sotelo J, Larralde C (1992) Immunodiagnosis of

neurocysticercosis. Disappointing performance of serology (en-

zyme-linked immunosorbent assay) in an unbiased sample of

neurological patients. Arch Neurol 49:633–636

Rojo A, Perez V, Bayardo A, Correa HJ, Cuaron J (2001) Pasta de

canola como suplemento proteico en dietas para la finalizacion

de cerdos. Tecnica Pecuaria en Mexico 39:179–192. http://www.

redalyc.org/articulo.oa?id=61339301

Rosales-Mendoza S, Salazar-Gonzalez JA (2014) Immunological

aspects of using plant cells as delivery vehicles for oral vaccines.

Expert Rev Vaccines 13:737–749

Rosales-Mendoza S, Angulo C, Meza B (2016) Food-grade organisms

as vaccine biofactories and oral delivery vehicles. Trends

Biotechnol 34:124–136

Sasidharan S, Sumathi V, Jegathambigai NR, Latha LY (2011)

Antihyperglycaemic effects of ethanol extracts of Carica papaya

and Pandanus amaryfollius leaf in streptozotocin-induced dia-

betic mice. Nat Prod Res 25:1982–1987

Savelkoul HF, Ferro VA, Strioga MM, Schijns VE (2015) Choice and

design of adjuvants for parenteral and mucosal vaccines.

Vaccines (Basel) 3:148–171

Sciutto E, Fragoso G, de Aluja AS, Hernandez M, Rosas G, Larralde

C (2008) Vaccines against cysticercosis. Curr Top Med Chem

8(5):415–423

Segura-Velazquez R, Fragoso G, Sciutto E, Sarukhan A (2009)

Towards identification of the mechanisms of action of parasite-

derived peptide GK1 on the immunogenicity of an influenza

vaccine. Clin Vaccine Immunol 16:1338–1343

Shirbaghaee Z (2016) Different applications of virus-like particles in

biology and medicine: vaccination and delivery systems.

Biopolymers 105:113–132

Stein HH, Roth JA, Sotak KM, Rojas OJ (2013) Nutritional value of

soy products fed to pigs. Swine Focus #004. The University of

Illinois at Urbana-Champaign. http://nutrition.ansci.illinois.edu/

sites/default/files/SwineFocus004.pdf

Stertman L, Lundgren E, Sjoholm I (2006) Starch microparticles as a

vaccine adjuvant: only uptake in Peyer’s patches decides the

profile of the immune response. Vaccine 24:3661–3668

Toledo A, Larralde C, Fragoso G, Gevorkian G, Manoutcharian K,

Hernandez M, Acero G, Rosas G, Lopez-Casillas F, Garfias CK,

Vazquez R, Terrazas I, Sciutto E (1999) Towards a Taenia

solium cysticercosis vaccine: an epitope shared by Taenia

crassiceps and Taenia solium protects mice against experimental

cysticercosis. Infect Immun 67:2522–2530

Toledo A, Fragoso G, Rosas G, Hernandez M, Gevorkian G, Lopez-

Casillas F, Hernandez B, Acero G, Huerta M, Larralde C, Sciutto

E (2001) Two epitopes shared by Taenia crassiceps and Taenia

solium confer protection against murine T. crassiceps cysticer-

cosis along with a prominent T1 response. Infect Immun

69:1766–1773

WHO (2014) Weekly epidemiological record, vol 47. World Health

Organization, pp 517–528. http://www.who.int/wer/2014/en

Zhu X, Li X, Chen W, Chen J, Lu W, Chen L, Fu D (2012) Evaluation

of new reference genes in papaya for accurate transcript

normalization under different experimental conditions. PLoS

One 7:e44405

1048 Planta (2017) 245:1037–1048

123