Contents lists available at ScienceDirect

Aquaculture

journal homepage: www.elsevier.com/locate/aquaculture

Transcriptome profiling of the Eriocheir sinensis thoracic ganglion under theSpiroplasma eriocheiris challenge

Libo Houa,b,1, Yubo Maa,1, Xiaohui Caoa, Wei Gua,d, Yongxu Chengc, Xugan Wuc, Wen Wanga,Qingguo Menga,d,⁎

a Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences & College of Marine Science and Engineering, Nanjing Normal University, Nanjing, Chinab Jiangsu Provincial Key Laboratory of Coastal Wetland Bioresources and Environmental Protection, Yancheng Teachers University,Yancheng City, Jiangsu Province224002, People’s Republic of Chinac Key Laboratory of Freshwater Aquatic Genetic Resources, Ministry of Agriculture, Shanghai Ocean University, Shanghai 201306, Chinad Co-Innovation Center for Marine Bio-Industry Technology of Jiangsu Province, Lianyungang, Jiangsu, China

A R T I C L E I N F O

Keywords:Eriocheir sinensisSpiroplasma eriocheirisTremor diseaseTranscriptomeThoracic ganglion

A B S T R A C T

Spiroplasma eriocheiris, has been identified as a novel lethal pathogen of Eriocheir sinensis tremor disease (TD,typically paroxysmal tremors of the pereiopod). The thoracic ganglion of E. sinensis infected by S. eriocheiris wasthe direct reason of the TD. This study was designed to understand of TD processes in crab and the immuneresponse of thoracic ganglion at the transcriptomic levels. The transcriptomic profiles of thoracic ganglion in theexperimental group (S. eriocheiris inject, termed SI) and the control group (R2 medium inject, termed RI) wereobtained using Illumina HiSeq 2500. In total, there were 60,159,089 and 47,613,445 high-quality clean readsassembled from SI and RI, respectively. In addition, 39,636 unigenes were obtained with an N50 length of575 bp. Moreover, by RPKM analysis, a total of 8049 differentially expressed genes (SI vs RI) were detected,including 927 up-regulated and 7122 down-regulated genes. The transcription levels of gene in prophenolox-idase-activating system (proPO), Wnt signaling pathway, phagocytosis, Toll-like system, Ca2+ regulation relatedprocess, etc. of SI were significantly changed compare with RI. Finally, 12 selected differentially expressed genes(Serpin, TLR, FZ4, SPI2, Tax1, TLSP, AI, CTLR, Rab11A, LAMP-1, Trx1 and PI3K) were verified using qRT-PCRshowed similar tendency with the RNA-seq. The results shown that the proPO, Wnt signaling pathway, pha-gocytosis, Toll-like system, Ca2+ regulation related process, glutamate signal related process, etc. were involvedin the process of the S. eriocheiris infection.

1. Introduction

The Chinese mitten crab, Eriocheir sinensis, is an economicallycrustacean in China due to its high commercial value and suitability invarious culture systems. However, with rapid development of intensiveculture, parasites, viral and bacterial infections are causing a seriousdamage to the aquaculture industry, and severely impacting its com-mercial production. Among them, tremor disease (TD) is one of themost devastating epizootics that serious affect economic benefit of E.sinensis cultivation industry (Zhang et al., 2015). A spiroplasma waspreviously identified as a novel causative pathogen of TD, and given thename Spiroplasma eriocheiris (Wang et al., 2004; Wang et al., 2011a,2011b). Spiroplasma, one of the smallest prokaryotes (passing through

220 nm pore-sized filters), has a typical helical structure and the ca-pacity to be motile (Weisburg et al., 1989; Labroussaa et al., 2010).Recent years studies shown that this bacterium also was the pathogen ofmany other aquaculture species and led to catastrophic economic lossesin aquaculture (Liang et al., 2011; Bi et al., 2008).

Previous research indicated that the crab hemocyte was the firsttarget cell of S. eriocheiris infection and formed inclusion body to re-strict the replication of S. eriocheiris. At the later stage of S. eriocheirisinfection, this bacterium was transported to muscles, nerves and con-nective tissues of the crab (Wang et al., 2002). As one of the majortarget cell of S. eriocheiris infection, the immune response of hemocytesagainst the S. eriocheiris at protein level was studied (Meng et al., 2014).The nervous system plays essential role in maintenance the normal

https://doi.org/10.1016/j.aquaculture.2020.735257Received 30 December 2019; Received in revised form 20 February 2020; Accepted 17 March 2020

⁎ Corresponding author at: Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Marine Science and Engineering & College of Life Sciences, NanjingNormal University, 1 Wenyuan Road, Nanjing 210023, China.

E-mail address: mlzzcld@aliyun.com (Q. Meng).1 These authors contributed equally to this paper.

Aquaculture 524 (2020) 735257

Available online 19 March 20200044-8486/ © 2020 Elsevier B.V. All rights reserved.

T

physiological activity and immune of crab. As another target tissue of S.eriocheiris infection, thoracic ganglion's immune response against thisbacterium and the TD pathogenesis known very little. To better un-derstanding the relationship between pathogens and the host, manyapproaches have been applied (Leu et al., 2007; Robalino and Carnegie,2009; Rojtinnakorn et al., 2002). Transcriptome analysis is a powerfultool provided additional evidence for the mechanism of host-pathogeninteractions. So, during the last few years the transcriptome analysishas been increasingly used after pathogen stimulation. Up to now, therewere many papers using transcriptome to study interaction betweenhost and pathogens. For example, transcriptome analysis of the Rudi-tapes philippinarum hepatopancreas response to Vibrio anguillarum in-fection show that many genes and signaling pathways participated inthe host's immune response (Ren et al., 2017). In the transcriptomeanalysis of Ctenopharyngodon idellus against Aeromonas hydrophila,phagocytosis, complement system and antigen processing were in-volved in the host cell immune response against infection (Yang et al.,2016a, 2016b). Transcriptome analysis was also used in the Scyllaparamamosain hemocytes in response to White Spot Syndrome Virusand Vibrio parahaemolyticus (Xue et al., 2013; Xie et al., 2014). All theseresearches help to improve the current understanding between patho-gens and the host, and indicated that the transcriptome analysis is moreaccurate and reliable method. However, there is none transcriptomeanalysis used in crustaceans nervous tissue and also none any studiesabout neurological disease in crustaceans.

In this study, a transcriptome analysis of E. sinensis thoracic gang-lion to elucidate the immune responses and the pathogenesis at thetranscriptional level upon S. eriocheiris challenge is reported for the firsttime. By this study, the key immune pathways and nerve signal trans-mission genes involved in E. sinensis thoracic ganglion in response to S.eriocheiris infection were identified, including proPO system, Wnt sig-naling pathway, Ca2+ regulation related process, glutamate signal re-lated process, and so on. This study will be provided some importantand new information about immune responses and understanding of TDpathogenesis in crab nervous tissue upon S. eriocheiris challenge.

2. Materials and methods

2.1. Experimental bacterial infection and thoracic ganglion collection

The S. eriocheiris used in this study was isolated from the diseased E.sinensis using the methods described by Wang et al. (Wang et al., 2004)and were cultured in R2 medium (heart infuso broth cultivation (HIBC),25 g/L; sucrose, 8 g/L; PBS-B, 8 mL/L) at 30 °C. E. sinensis (50 ± 5 g)were purchased from an aquaculture pond in Baoying, Jiangsu Pro-vince, China and cultivated in an ultraviolet radiation sterilizationcirculating water temperature controlled aquaculture system. HealthyE. sinensis (verified by S. eriocheiris negative results using PCR by 16 srRNA sequence) were maintained for 1 week before tests. The crabs inthe experimental group (30 individuals) received an injection of 100 μLof S. eriocheiris (107 cells/mL), individually. Thirty crabs in the controlgroup received an injection of 100 μL of R2 medium. Six crabs from thecontrol group and 6 crabs from the experimental group, when the crabshave typical paroxysmal tremors of the pereiopod, were randomlycollected to prepare thoracic ganglion samples. Three biological repeatswere carried out.

2.2. RNA extraction and cDNA library construction

Total RNA was extracted from the thoracic ganglion by using TRIzolreagent (Invitrogen, USA) according to the instruction of the manu-facturer. Agilent 2100 BioAnalyzer and ABI OnePlus Real-time PCRSystem were used to test the integrity and quantity of total RNAs.Following the standard TruSeq sample preparation guide (Illumina,USA), the cDNA libraries were constructed.

2.3. Illumina sequencing, assembly, and annotation

The cDNA library sequencing was performed using the IlluminaHiseq 2500 platform that generated approximately 100 bp paired-end(PE) raw reads by LC Sciences (USA). For the results of RNA-Seq, togenerate clean data, raw sequencing data was filtered by using theFASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). The readswith following characteristics were removed from the raw data: con-taining adaptor sequence and the sequence< 20 bp after quality clip,N10% “N” ratio and/or low-quality reads (that is, the base number ofquality value Q ≤ 5 accounts for N50% of the entire read). Trinitysoftware (http://sourceforge.jp/projects/sfnet_trinityrna) was used toassemble the Contigs from clean data using, and non-redundant con-sensus sequences were then assembled without a reference genome.

Gene prediction and identifying protein-coding sequences from as-sembled contigs were handled by using the GetORF. By using BLASTxalignment (E-value< 10−5) between transcripts and protein databasessuch as non-redundant protein (NR), Gene Ontology (GO), KOG(Clusters of orthologous groups for eukaryotic complete genomes),Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.genome.jp/kegg/) and Swissport (a manually annotated and reviewedprotein sequence database, http://www.ebi.ac.uk/uniprot/), the best-aligned results were used to determine the annotation of transcripts.

2.4. Analysis of differentially expressed genes

To analyze differentially expressed genes, the number of perfectclean reads corresponding to each gene was calculated and normalizedto the number of Reads per kilo base of exon model permillion mappedreads (RPKM). The DESeq was to determine the FDR (false discoveryrate) threshold was used to determine the FDR (false discovery rate)threshold, FDR was ≤0.05 and Fold change ≥1.2 were set as thethreshold for significant differential expression. The GO functional en-richment and KEGG pathway were used to analysis DifferentiallyExpressed Genes (DEGs) (Yang et al., 2016a, 2016b) and understandthe biological functions of the high level functions of genes as well asthe utilities of the biological system of large-scale molecular datasets(Zhang et al., 2016a, 2016b). GOseq (version 1.16.2) and WEGO wasused to acquire GO annotation and the KEGG database (http://www.genome.jp/kegg) was used to pathway analysis. The threshold for sig-nificant was set as P-value< .05 and Q-values< 0.05, respectively.

2.5. Experimental validation using quantitative real-time PCR

To validate the results of DEGs from transcriptome, 12 DEGs werevalidated using quantitative real-time PCR (qRT-PCR). The 12 genesinclude Serpin, serine proteinase inhibitor-2 (SPI2), Tax1 binding pro-tein (Tax1), trypsin-like serine proteinase (TLSP), apoptosis inhibitor(AI), Trx1, phosphoinositide-3 kinase (PI3K), toll-like receptor (TLR),Frizzled-4 (FZ4), C-type lectin receptor protein (CTLR), Rab11A andlysosome-associated membrane glycoprotein 1-like (LAMP-1). In theqRT-PCR analysis, glyceraldehyde-3-phosphate dehydrogenase(GAPDH) was amplified as a reference gene. Primers used in the qRT-PCR analysis are listed in Table 1. The RNA samples used for qRT-PCRamplifications were the same as those used to construct the RNA-Seqlibrary mentioned above. qRT-PCR was carried out using the ABI Quantstudio 6 Flex system with SYBR® Premix Ex Taq™ (TaKaRa, Japan)according to the manufacturer's instructions. The PCR reaction wasperformed with a 20 μL volume (2 μM of each specific primer, 2 μL ofcDNA, 10 μl of 2 × SYBR and 6 μl of sterile distilled H2O Premix ExTaq). The PCR program was the following procedure: initial dena-turation at 95 °C for 2 min; followed by 40 cycles of amplification (95 °Cfor 10 s, 55 °C for 30 s, and 72 °C for 30 s). The relative expression levelsof different genes in thoracic ganglion were calculated according to the2−ΔΔCT method (Livak and Schmittgen, 2001). Statistical analysis wasperformed using SPSS software (Ver11.0). Data represent the mean ±

L. Hou, et al. Aquaculture 524 (2020) 735257

2

standard error (S.E.). Statistical significance was determined by one-way ANOVA, and posthoc Duncan multiple range tests. Significancewas set at P < .05.

3. Result

3.1. Transcriptome sequencing and assembly

High-throughput sequencing was performed on three duplicatessamples from the control group and S. eriocheiris-infected experimentalgroup using Illumina Hiseq 2500 platform. The consistency of geneexpressed levels among three duplicates samples were analysied (Fig.S1). Through the screening of raw sequencing data, at least 45 millionclean reads were generated in each sequencing library, and the Q30 ineach sample was more than 94% (Table 2). A total of 39,636 unigeneswere obtained with an N50 length of 575 bp and an average length592 bp using de novo assembly. The length distribution of genes wasshown in Fig. S2.

3.2. Functional annotation and pathway assignment

All the unigenes were referenced against NR (12,454, 31.42%), GO(5425, 13.69%), COG (11,494, 28.99%), KEGG (7764, 19.59%) andSWISS-Prot (9355, 23.6%) databases (Fig. 1A, Table S1). In this study,the BLASTx top hit species distribution showed that unigenes matchedsequences from a range of species based on the NCBI-NR database(Fig. 1B). Among the unigenes matched in the NR database, 3900unigenes shared similarity to Hyalella azteca, 467 unigenes shared si-milarity to Cryptotermes secundus, and about 4703 unigenes did nothave high homology with other species. Sequence homology based onGO classification revealed that 5425 matched unigenes were dividedinto three GO categories, biological processes, cellular component andmolecular function, including 60 functional groups (Fig. 2A). To furtherannotate the assembled unigenes functional phylogenetic classification,11,494 unigenes were subdivided into 25 COG classifications. Amongthem, the cluster of “General function prediction only” (548, 4.77%)represented the largest group, followed by “Posttranslational mod-ification, protein turnover, chaperones” (536, 4.66%), “Extracellular

structures” (1, 0.01%) was the smallest group (Fig. 2B).To classify the biological pathways in the E. sinensis, 7764 unigenes

were mapped to the KEGG database. The results show that the unigeneswere assigned to five specific pathways， cellular processes, environ-mental information processing, genetic information processing, meta-bolism and organismal systems (Fig. 3).

3.3. Functional classification of DEGs

To explore the molecular mechanisms of E. sinensis thoracic gang-lion in response to S. eriocheiris, the DEGs mRNAs was determined byRPKM method analysis. 8049 differential expressed genes, contained927 significantly up-regulated genes and 7122 significantly down-regulated genes were found (Table S2). The representative DEGs genesin E. sinensis transcriptome with a 1.2-fold change post-injection with S.eriocheiris shown in Table 3. In order to further understand the

Table 1Primer sequences used in this study.

Name Sequence (5′—3′)

Serpin-RT-F CTCGGTCCTTCCTCATCGSerpin-RT-R TATCTACTTCTACGGGTCCTGGTLR-RT-F CGATGGTGTCTGCGATGTTLR-RT-R CGATGCGTTCGTCTCCTAFZ4-RT-F ACCAGGTAGCCCACCGACACFZ4-RT-R GTCACCCTCTTCACCGTCCTCSPI2-RT-F GCAGTCACCTTATCCGTCASPI2-RT-R CCCAGAATCTAGTGCAAACCTax1-RT-F CTCCTTGCTCCGTATGACTax1-RT-R AATCTTCCGCTAACTGTGGTLSP-RT-F GACCGACAGATCCAACAAAGTLSP-RT-R CATCCAGCACGAAGATTACAAI-RT-F CCCTGTCAGCGTTCCTTTAI-RT-R CCGACATCCTGGCACAACCTLR-RT-F TGCCGTCTATCTTCTCCACCTLR-RT-R GAACTGAACTCCGACCTTGRab11A-RT-F CCTCTATGCTTCTTGTGGCRab11A-RT-R CGGGACGACGAGTATGACLAMP-1-RT-F GGTAATGGAGGAGCGACALAMP-1-RT-R ACAGATGCTGGCAAGACATrx1-RT-F TTCAGCGTCGTAAATATCTCGTrx1-RT-R GTCTTCCACTCCAACTATCAGCPIK3-RT-F TTGGGAGTCGTAATCAAGGTAAPIK3-RT-R ATCTCAAGGGTAGGATTAAGGTGGAPDH-RT-F CTGCCCAAAACATCATCCCATCGAPDH-RT-R CTCTCATCCCCAGTGAAATCGC

Fig. 1. (A) Statistics of functional annotation of NR, GO, KEGG, SWSS and COG.(B) Similarity analysis based on the NR database.

L. Hou, et al. Aquaculture 524 (2020) 735257

3

biological functions of DEGs, GO analysis was performed to classifyDEGs. GO analysis showed that all 8049 DEGs were classified into threefunctional categories: biological processes, cellular component, mole-cular function, including a total of 44 subcategories (Fig. 4). All DEGswere analyzed in KEGG database for pathway classification enrichmentof E. sinensis genes after S. eriocheiris infection. The results of DEGsKEGG enrichment content are shown in Fig. 5.

3.4. Verification of transcriptome data by real-time RT-PCR

To further validate the results from DEG, 12 DEGs were selected toquantify their expression by qRT-PCR analysis. The efficiency of variousprimers used in qRT-PCR were tested, and the amplified fragments weresequenced for target verification. The qRT-PCR analyses were per-formed in the three biological replicates of each sample. As shown inFig. 6, the 12 selected DGEs determined by qRT-PCR were showed

Fig. 2. (A) GO classification of all unigenes. (B) COG annotation of putative proteins.

L. Hou, et al. Aquaculture 524 (2020) 735257

4

similar expression pattern with the results from RNA-seq. Among the 12selected DGEs include seven up-regulated genes (Serpin, SPI2, Tax1,TLSP, AI, Trx1 and PI3K) and five down-regulated gene (TLR, FZ4,CTLR, Rab11A and LAMP-1).

4. Discussion

Transcriptome analysis, as an efficient research tool for mRNAmeasurement, has been shown to be very useful for quantifying DEGs inorganisms (Shendure and Ji, 2008). Previous studies have found thatthe crab hemocytes, muscles and nerves tissues were the main targettissue of S. eriocheiris (Wang et al., 2002). The typical symptom of TDwas paroxysmal tremors of the crab pereiopod that regulated by thor-acic ganglion due to S. eriocheiris infection. However, little is knownabout the molecular mechanisms of the thoracic ganglion under S.eriocheiris infection. This study was designed to identify some importantgenes and pathways that were associated with S. eriocheiris infection inthe nerve tissues of E. sinensis.

In total, 8049 different expression genes (927 up-regulated and7122 down-regulated) were identified, and many of those genes wereinvolved in immune-related signaling pathways, nervous system

regulates and signal transmission pathways, such as proPO system,phagocytosis, Wnt signaling pathway, Ca2+ related proteins or process.The proPO system is one of the important components of innate im-munity only found in invertebrates. This system is controlled andregulated by many molecules, such as prophenoloxidase-activatingenzymes, proteinase and proteinase inhibitors (Cerenius and Söderhäll,2004). Lectin, as a member of pattern recognition receptors (PRRs) ininnate immunity, has the ability of binding specific sugar residues onthe surface of pathogen, promoting bacterial agglutination (Huanget al., 2014; Xiu et al., 2015) and involving in the activation of proPOsystem (Wu et al., 2013; Wang et al., 2011a, 2011b; Yu and Kanost,2000). Our data showed that three serine proteinases (serine proteinaseand TLSP were up-regulated, serine proteinase 3 was down-regulated)and three serpins (serpin, serpin 3 and SPI 2 were up-regulated) weresignificantly changed after S. eriocheiris infection. At the same time, twokinds of lectin (C-type lectin receptor (CTLR) and VIP36) were alsosignificantly down-regulated. Meanwhile, the transcription levels ofTLSP, serpin, SPI2 and CTLR from qRT-PCR were consistent with theresults of RNA-seq. Thus, the proPO system was convinced as one ofmajor immune system of E. sinensis to resist S. eriocheiris. And the lectinwas receptor to recognize S. eriocheiris and activate the proPO system toagainst the invading.

Phagocytosis, a critical component of the innate immune system,can initiated by the receptors on the cell surface combines with preyand internalizes into large vesicles (phagosomes), which are then fusedwith lysosomes to form phagolysosomes, in which a variety of hydro-lytic enzymes kill and digest bacteria (Barreiro et al., 2007). S. erio-cheiris, as one of the intracellular bacterium, can enter into the neu-rogliocyte and form inclusion body. So the phagocytosis may play animportant role in the process of S. eriocheiris infection the host cell. Inthis study, many phagocytosis initial receptor and lysosomal relatedproteins were significantly changed. Such as six integrins were

Table 2Statistics of E. sinensis transcriptome sequences.

Sample Raw reads Clean reads Q20 (%) Q30 (%)

SI-1 59,618,122 8,737,444,145 98.52 95.32SI-2 67,123,676 9,872,414,467 98.69 95.75SI-3 53,735,470 7,787,170,523 98.47 94.89RI-1 51,909,986 7,610,297,090 98.53 95.32RI-2 45,121,772 6,637,048,820 98.79 96.01RI-3 45,808,576 6,645,646,589 98.53 95.04

Fig. 3. KEGG pathways assignment of the assembled unigenes. 7764 unigenes were assigned into five specific pathways: Cellular Processes, EnvironmentalInformation Processing, Genetic Information Processing, Metabolism and Organismal Systems.

L. Hou, et al. Aquaculture 524 (2020) 735257

5

significant changed after the S. eriocheiris stimulated, of which five wereup-regulated (β-integrin1, β-integrin2, integrin-β1, integrin-αPS, in-tegrin-αPS5-like) and only one was down-regulated (integrin-α5-like).This may duo to the different kinds of integrin plays different role in theprocess of S. eriocheiris infection. After the S. eriocheiris challenge, thetranscriptional levels of lysosomal membrane protein (LAMP-1),Rab11A and three lysosomal hydrolases (LαM, ARSA and β-mannosi-dase X3) were also significantly down-regulated. Two kinds of lyso-somal membrane protein NPC1 (NPC1a and NPC1b) were significantlyup-regulated. The translational levels of Rab11A and LAMP-1 alsoverified to decrease significantly from the qRT-PCR result. Based on theabove results, S. eriocheiris might induce phagocytosis of host cells bybinding to receptor integrin, thus entering host cells. In addition, bychanging the expression of some important proteins, S. eriocheiris mayprevent the migration of phagosome block the fusion of phagosome andlysosomes, and reduce hydrolytic enzymes expression in lysosomes toprevent its degradation and escape from the immune attack of the host.

Toll signaling pathways plays an important role in invertebrate in-nate immunity response to the bacteria infection (Ren et al., 2017).Toll-like receptors (TLRs) are innate immune recognition receptors thatdetect microbial infection, induce an antimicrobial immune response(Schnare et al., 2001). Phosphoinositide 3-kinases (PI3K) as one of the

important downstream core proteins of the Toll pathway, direct inter-action with Toll receptor and then negatively regulates downstreamsignaling to NF-κB transactivation (Ojaniemi et al., 2003). Tax1 is anA20 binding protein and can negatively regulate NF-κB (Valck et al.,1999). Many studies also shown that the PI3K/Akt and NF-κB signalingpathways have been proved to play important roles in regulate cellapoptosis (Yin et al., 2006). Such as PI3K can lead to the activation ofAkt, and the activated Akt is involved in the regulation of various cel-lular activities, leading to diminished apoptosis (Downward, 1998). Inthis study, the mRNA expression level of TLR and NF-κB2 were sig-nificantly down-regulated compared with the control sample from theRNA-seq result. At the same time, by RT-PCR result, TLR was also de-creased significantly post S. eriocheiris infection, thereby indicating thatthe Toll pathway was inhibited to some extent when the S. eriocheirisinfected the thoracic ganglion. Meanwhile, the transcription levels ofPI3K, Tax1 and apoptosis inhibitor (AI) were up-regulated post S.eriocheiris infection by RAN-seq and RT-PCR. Based on the above re-sults, we speculated that S. eriocheiris weaken the antibacterial immuneresponse by inhibiting the Toll pathway, thus escaping from the host'sclearance. At the same time, the S. eriocheiris inhibit cell apoptosis toprovide space for itself replicate.

Wnt signaling pathway included three part: Wnt-β-catenin pathway

Fig. 4. Gene ontology (GO) classifications of differentially expressed genes (up/down). All pathways terms were classified into three secondary classifications:Biological Process, Cellular Component and Molecular Function.

L. Hou, et al. Aquaculture 524 (2020) 735257

6

(the canonical Wnt signaling pathway), planar cell polarity (PCP)pathway and WnteCa2+ signaling pathway (Toledo et al., 2008; Kohnand Moon, 2005). Wnt bund to the receptor Frizzled (FZ) proteins toactivate Disheveled (Dvl) to inhibit the phosphorylation of β-catenin byGSK3, thereby increased the expression of β-catenin and allowed thecytoplasmic β-catenin moves into the nucleus (Li et al., 1999). Wntpathway not only involve in the immune response directly or throughcross-talk with some immune-related signaling pathways also play animportant role in regulated the nervous system development. For ex-ample, knockdown Marsupenaeus japonicas β-catenin resulted in im-paired bacterial clearance ability and increased virus copy in shrimp invivo (Zhang et al., 2016a, 2016b). In this paper, after the S. eriocheirisinfection the thoracic ganglion of E. sinensis, the transcription levels ofthree kinds of FZs were significantly changed, including two down-regulated (sFZ3-like, FZ4) and one up-regulated (FZ2-like). Meanwhile,the transcription levels of FZ4 was also down-regulated post S. erio-cheiris infection from the qRT-PCR result. This indicated that the in-vasion of S. eriocheiris may restrained the Wnt signaling pathway andNF-κB signaling pathway to reduce the host immune response and help

itself infection. In the WnteCa2+ signaling pathway, the signals in-creased intracellular Ca2+ levels through DVL and induced the activa-tion of calcium sensitive kinases such as Ca2+/calmodulin-dependentprotein kinase II (CaMKII) and protein kinase C (PKC) (Kühl et al.,2000). Ca2+ as a ubiquitous second messenger regulated wide-rangingcellular biological processes, including muscle contraction, nerve con-duction, cell growth or proliferation, neurogenesis and regulation ofenzyme activity, etc. (Rash et al., 2016; Ali et al., 2016). In neurons, theER, as a Ca2+ sink, plays a crucial role in regulate the concentration ofintracytoplasmic Ca2+ (Verkhratsky and Petersen, 2002). Inositol1,4,5-triphosphate receptor (IP3R) is a member of the intracellularcalcium release channel family and locates in the endoplasmic re-ticulum, which mediate Ca2+ release from the ER and involve in manybiological processes and diseases. IP3R integrates signals from manysmall molecules and proteins, such as kinases, phosphatases, non-en-zymatic proteins and nucleotides, to fine-tune intracellular Ca2+ re-lease (Patterson et al., 2004). Endoplasmic reticulum resident protein44 (ERp44), an ER lumenal protein, can directly interacts IP3R andmodulates IP3R activity (Higo et al., 2005). In our study, these two

Fig. 5. Scatterplot of enriched KEGG pathways for differentially expressed genes (DEGs). X-axis: the rich factor, Y-axis: the pathways.

L. Hou, et al. Aquaculture 524 (2020) 735257

7

genes significantly down-regulated duo to the S. eriocheiris infection.These results demonstrated that the Ca2+ regulation was disorder in thecrab's never system after the S. eriocheiris infection. At the same time, alarge number of DEGs have been identified as essential for calcium-triggered, including calpain-C, calcium-dependent secretion activator(CaDPS), Calcium-activated chloride channel regulator 2 (CaCCR2) andcalmodulin-binding transcription activator 2 (CbTA2), syntaxin,

synaptotagmin (Syt), etc. Several of these genes are involved in therelease of neurotransmitter, for example, Syt, syntaxin, CaDPS. Neu-rotransmitter release is highly dependent on intracellular calcium le-vels, specifically during the late stages of vesicular fusion and release(Sudhof, 2004). Syt, the major calcium sensor for synaptic vesicleexocytosis and highly conserved protein, participates in triggeringneurotransmitter release at the synapse (Yoo et al., 2013). Syt andsyntaxin are the core proteins of v-SNARE/t-SNARE complex, whichplays critical role in trigger and adjustment of the target membranevesicles and fusion process to participate in the process of neuro-transmitters and hormones released strict control (Sutton et al., 1998).Syntaxin can bound to synaptotagmin in a Ca2+-independent manner(Masumoto et al., 2012). CaDPS is a neural/endocrine cell-specificprotein that has been shown plays a fundamental role in at the Ca2+-dependent neurosecretion by interaction with syntaxin (Sutton et al.,1998). Knock-outing CaDPS would result in severe reductions of sy-naptic glutamate release in pyramidal neurons (Jockusch et al., 2007).Knock-downing Drosophila Null (homologues of CaDPS) would result in50% reduction of glutamate release in neuromuscular junction (Rendenet al., 2001). In our results, the transcription level of Syt, syntaxin andCaDPS in the diseased crab all significantly down-regulated. This resultsdemonstrated that the S. eriocheiris infection affected the normal releaseof neurotransmitters by disturbed the Ca2+ regulation.

In nervous system, glutamate is the principal excitatory neuro-transmitter and play a crucial role in neuronal differentiation, survivaland migration in the developing nervous system largely through facil-itating the entry of Ca2+ (Prickett and Samuels, 2012; Hack, 1994). Inour results, lots of genes related with glutamate regulate were sig-nificantly changed after S. eriocheiris infection, including glutamatesynthase 1, glutamine synthetase, glutamate receptors (glutamate re-ceptor ionotropic, kainate 2, ionotropic glutamate receptor kainate 2C,variant ionotropic glutamate receptor, glutamate receptor ionotropickainate 5 and glutamate-gated chloride channel), neuroligin-4, neuro-peptide Y receptor type 5, etc. The S. eriocheiris infection disturbed theglutamate synthase by down-regulated glutamate synthase relatedgenes like glutamate synthase 1 and glutamine synthetase. There is noany doubt that the glutamate synthase 1 plays very important role inthe synthase of glutamate. Similarly, the glutamine is considered thepreferred precursor for the neurotransmitter pool of glutamate. Theglutamine synthetase in this paper also significantly down-regulated(Yano et al., 1998). Glutamate is released from vesicles in presynapticterminals with a Ca2+- dependent mechanism (Erickson, 2017). Therelease of glutamate from synaptic is controlled by a wide range ofpresynaptic receptors, for example gamma-aminobutyric acid receptors(GABAR), neuropeptide Y receptors, etc. (Birnbaumer et al., 1994).

Table 3Representative DEGs in E. sinensis transcriptome with a 1.2-fold change post-injection with S. eriocheiris.

Genes Accession no. Fold changes

Serine protease gi|375157305| +1.25114516Serine protease 3 gi|1338037668| −1.91303177Trypsin-like serine proteinase (TLSP) gi|849976741| +2.11849083Serpin gi|295293393| +1.04784753Serpin 3 gi|565056041| +1.30558193Serine proteinase inhibitor-2 (SPI2) gi|764399009| +1.97769216C-type lectin receptor protein (CTLR) gi|296803399| −9.4383302Vesicular integral-membrane protein VIP36 gi|677283342| −8.852697Frizzled-2-like (FZ2-like) gi|1067098098| +1.08650597Secreted frizzled-related protein 3-like

(sFRP3-like)gi|957836628| −10.9937326

Frizzled-4 (FZ4) gi|1015806889| −8.05344789Ionotropic glutamate receptor kainate 2C

(IGRK-2C)gi|1108658422| −8.92914989

Inositol 1,4,5-trisphosphate receptor (IP3R) gi|3660667| −2.001445566Synaptotagmin-17-like (SYT-17-like) gi|291223503| −1.567103056calpain-C gi|939233451| −1.175472251Neuropeptide Y receptor type 5-like (NPYR

5-like)gi|1067092124| −1.449803751

Calcium-dependent secretion activatorisoform X5 (CDSA-X5)

gi|1233203423| −1.121814784

Calcium-activated chloride channelregulator 2 (CaCCR2)

gi|1275508098| +1.669979445

Calmodulin-binding transcription activator2 isoform X1 (CbTA2-x1)

gi|642935079| −8.790695761

Syntaxin-16 (SYN-16) gi|910324522| −2.663133744Trx1 gi|229368511| +1.053645332Heat shock protein 21 (HSP21) gi|356651196| −2.087836805Heat shock protein 22 (HSP22) gi|152031623| +1.748278345Heat shock protein 40 (HSP40) gi|324604902| +2.048614338Oxidation resistance protein 1, partial

(OXR1)gi|646702414| −6.659748586

peroxidase gi|1344769873| −1.718285953Integrin alpha-5-like gi|1158933759| −1.616905579Integrin alpha ps gi|1317829286| +1.012182797Beta-integrin gi|285802975| +1.307408024Integrin alpha-PS5-like gi|1325349418| +1.014172788Beta-integrin gi|345452837| +1.573145521Integrin beta 1 gi|576702995| +1.284800032Niemann-Pick C1 protein-like (NPC1a) gi|1067075805| +1.129836084Niemann-Pick C1 protein-like (NPC1b) gi|1067075805| +1.194657813Lysosome-associated membrane

glycoprotein 1-like (LAMP-1)gi|1067093414| −9.399176792

Lysosomal alpha-mannosidase-like (LαM) gi|1067092598| −8.510081058Beta-mannosidase isoform X3 gi|1339072357| −9.066376265Legumain gi|919020804| +1.064576109Arylsulfatase A-like, partial (ARSA) gi|1067093087| −1.486974093Rab6A gi|744514383| −1.301128218Rab11A gi|744514391| −9.57445477Caspase gi|304569876| −1.859997453Apoptosis inhibitor (AI) gi|356651200| +1.209285724Inhibitor of apoptosis protein gi|1016106416| −10.14686987Nuclear factor κ-B kinase epsilon isoform 2

(NF-κB2)gi|1350353428| −8.508983185

Phosphoinositide-3 kinase (PI3K) gi|486170770| +1.861004397

Tax1 binding protein (TAXBP)Toll-like receptor (TLR) gi|914344133| −8.138952663Alpha-2-macroglobulin gi|747175305| +1.206696385Alpha-2-macroglobulin gi|520188163| +3.006674381Apolipoprotein D gi|1061477830| +1.498456081Alpha 2-macroglobulin gi|291059187| −1.549071335Alpha-2-macroglobulin gi|520188163| +3.359307064Alpha-2-macroglobulin 2 isoform 3 gi|331031258| +1.335837493

Fig. 6. Comparison of the expression profiles of 12 selected genes as de-termined by real-time PCR (black) and by RNA-seq (gray). The full name ofSerpin, TLR, FZ4, SPI2, Tax1, TLSP, AI, CTLR, Rab11A, LAMP-1, Trx1 and PI3Kare Serpin, toll-like receptor, Frizzled-4, serine proteinase inhibitor-2, Tax1binding protein, trypsin-like serine proteinase, apoptosis inhibitor, C-type lectinreceptor protein, Rab11A, lysosome-associated membrane glycoprotein 1-like,Trx1 and phosphoinositide-3 kinase, respectively.

L. Hou, et al. Aquaculture 524 (2020) 735257

8

When the glutamate release from synaptic vesicle, it will receive by theglutamate receptors located at the postsynaptic membrane, and thentransform signals to the next neuron. Glutamate has two broad familiesof receptors: glutamate metabotropic receptors (mGluR) and the iono-tropic receptors that are glutamate-gated ion channels (Meldrum,1998). Serve as the first messenger of glutamate, glutamic acid iono-tropic glutamate receptors by binding of the excitatory neuro-transmitter glutamate induces a conformation change, and then leadingto the opening of the cation channel, thereby converts the chemicalsignal to an electrical impulse (Laurie et al., 1997). Glutamate-gatedchloride channels were first only identified in invertebrate as extra-junctional glutamate receptors, which could activate by the glutamateanalog ibotenic acid (Prickett and Samuels, 2012; Moroz et al., 2014).In the nervous system, neuroligins (NL1-NL4) are postsynaptic adhesionproteins that control the maturation and function of synapses. NL-1,−3, and− 4 only link to glutamatergic postsynaptic proteins, NL-2 canlink to both glutamatergic and GABA ergic postsynaptic proteins (Smartand Paoletti, 2012; Graf et al., 2004). In this paper, in the diseased craball the above genes were significantly down-regulated. This resultsdemonstrated that the S. eriocheiris infection would induce many glu-tamate regulated genes and then disturb the glutamate synthase, releaseand the related signal transmission. This may be one of the majorreason of the S. eriocheiris induced the crab typical paroxysmal tremorsof the pereiopod.

In addition to genes involved in glutamate regulation, there werealso many other DEGs which played an important role in neural signaltransmission, including glycine receptor proteins, neuropeptide relatedproteins (neuropeptide Y receptor type 5, short neuropeptide F andneuroparsin 2), glutamyl aminopeptidase, etc. Except metabolism andprotein synthesis, glycine was also a well-established inhibitory neu-rotransmitter in the nervous system. After depolarization, glycine wasreleased from synaptic vesicles contained in the nerve terminal of in-terneurons with a Ca2+-dependent manner. The released glycine couldbind to glycine receptors which located in the postsynaptic elements.The glycine receptors binding with the extracellular glycine wouldcause hyperpolarization of the postsynaptic neurons by chloride chan-nels opening and the influx of chloride through those receptors (Betzand Laube, 2006). S. eriocheiris infection could induce two glycine re-ceptors, glycine receptor subunit alpha-4 and glycine receptor subunitalpha-1, significantly down-regulated. This results shown that the S.eriocheiris infection also can disturb the glycine related signal trans-mission in the diseased crab. Neuropeptides composed by a large anddiverse class of signaling molecules, which were produced by manytypes neurons cell. Neuropeptides played important role in many bio-logical processes such as neuromodulators, co-transmitters of neuro-transmitters, neurite outgrowth, neural cell locomotion, synaptic plas-ticity and so on (Hökfelt et al., 2008). In this paper, there are severalneuropeptides related genes were significantly changed, includingneuropeptide Y receptor type 5, short neuropeptide F and neuroparsin2.

In conclusion, transcriptome analysis of thoracic ganglion in E. si-nensis was performed in this study. Approximately 927 genes were up-regulated, whereas 7122 genes were down-regulated. One hand, proPOsystem, phagocytosis and Wnt signaling pathway were involved in thehost cell against the S. eriocheiris infection. On the other hand, S. erio-cheiris can restrained the WnteCa2+ signaling pathway induced manygenes in the neural signaling and nervous system development sig-nificantly changed and leaded to the disturbance of neural signaling.This may be the reason of the S. eriocheiris induced the crab typicalparoxysmal tremors of the pereiopod. Overall, the results provided abasic step forward toward a more complete understand of TD processesin crab and the immune function of invertebrate nervous system.

Supplementary data to this article can be found online at https://doi.org/10.1016/j.aquaculture.2020.735257.

Declaration of Competing Interest

The authors declare that no conflict of interest exists.

Acknowledgments

The current study was supported by the National Key Research andDevelopment Program of China (Grant No. 2018YFD0900602), theNational Natural Science Foundation of China (NSFC Nos. 31870168),the Modern Fisheries Industry Technology System Project of JiangsuProvince (Grant No. JFRS-01) and the project funded by the PriorityAcademic Program Development of Jiangsu Higher EducationInstitutions (PAPD).

References

Ali, E.S., Hua, J., Wilson, C.H., 2016. The glucagon-like peptide-1 analogue exendin-4reverses impaired intracellular Ca2+ signaling in steatotic hepatocytes. Biochim.Biophys. Acta 1863 (9), 2135–2146.

Barreiro, O., Fuente, H.D.L., Mittelbrunn, M., 2007. Functional insights on the polarizedredistribution of leukocyte integrins and their ligands during leukocyte migration andimmune interactions. Immunol. Rev. 218, 147–164.

Betz, H., Laube, B., 2006. Glycine receptors: recent insights intotheir structural organi-zation and functional diversity. J. Neurochem. 97, 1600–1610.

Bi, K., Huang, H., Gu, W., 2008. Phylogenetic analysis of Spiroplasmas from threefreshwater crustaceans (Eriocheir sinensis, Procambarus clarkia and Penaeus vannamei)in China. J. Invertebr. Pathol. 99 (1), 60–65.

Birnbaumer, L., Campbell, K.P., Catterall, W.A., Harpold, M.M., Hofmann, F., Horne,W.A., et al., 1994. The naming of voltage-gated calcium channels. Neuron 13,505–506.

Cerenius, L., Söderhäll, K., 2004. The prophenoloxidase-activating system in in-vertebrates. Immunol. Rev. 198 (1), 116–126.

Downward, J., 1998. Mechanisms and consequences of activation of protein kinase B/Akt. Curr. Opin. Cell Biol. 10, 262–267.

Erickson, J.D., 2017. Functional identification of activity-regulated, high-affinity gluta-mine transport in hippocampal neurons inhibited by riluzole. J. Neurochem. 142,29–40.

Graf, E.R., Zhang, X.Z., Jin, S.X., 2004. Neurexins induce differentiation of GABA andglutamate postsynaptic specializations via euroligins. Cell 119 (7), 1013–1026.

Hack, N., Bala’zs, R., 1994. Selective stimulation of exitatory amino acid receptor sub-types and the survival of granule cells in culture: effect of quisqualate and AMPA.Neurochem. Int. 25, 235–241.

Higo, T., Hattori, M., Nakamura, T., Natsume, T., Michikawa, T., Mikoshiba, K., 2005.Subtype-specific and ER Lumenal environment-dependent regulation of inositol1,4,5-trisphosphate receptor type 1 by ERp44. Cell 120, 85–98.

Hökfelt, T., Stanić, D., Sanford, S.D., Gatlin, J.C., Nilsson, I., Paratcha, G., et al., 2008.NPY and its involvement in axon guidance, neurogenesis, and feeding. Nutrition 24,860–868.

Huang, Y., An, L., Hui, K.M., 2014. An LDLa domain-containing C-type lectin is involvedin the innate immunity of Eriocheir sinensis. Dev. Comp. Immunol. 42, 333–344.

Jockusch, W.J., Speidel, D., Sigler, A., Sørensen, J.B., Varoqueaux, F., Rhee, J.S., Brose,N., 2007. CAPS-1 and CAPS-2 are essential synaptic vesicle priming proteins. Cell131, 796–808.

Kohn, A.D., Moon, R.T., 2005. Wnt and calcium signaling: β-catenin-independent path-ways. Cell Calcium 38, 439–446.

Kühl, M., Sheldahl, L.C., Malbon, C.C., 2000. Ca2+/calmodulin-dependent protein kinaseII is stimulated by Wnt and frizzled homologs and promotes ventral cell fates inXenopus. J. Biol. Chem. 275 (17), 12701–12711.

Labroussaa, F., Arricau-Bouvery, N., Dubrana, M.P., 2010. Entry of Spiroplasma citri intoCirculifer haematoceps cells involves interaction between Spiroplasma phosphogly-cerate kinase and leafhopper actin. Appl. Environ. Microbiol. 76, 1879–1886.

Laurie, D.J., Bartke, I., Schoepfer, R., Naujoks, K., Seeburg, P.H., 1997. Regional, de-velopmental and interspecies expression of the four NMDAR2 subunits, examinedusing monoclonal antibodies. Mol. Brain Res. 51, 23–32.

Leu, J.H., Chang, C.C., Wu, J.L., 2007. Comparative analysis of differentially expressedgenes in normal and white spot syndrome virus infectedpenaeus monodon. BMCGenomics 8 (1), 120.

Li, L., Yuan, H., Weaver, C.D., 1999. Axin and Frat1 interact with Dvl and GSK, bridgingDvl to GSK in Wnt-mediated regulation of LEF-1. EMBO J. 18 (15), 4233–4240.

Liang, T., Li, X., Du, J., 2011. Identification and isolation of a spiroplasma pathogen fromdiseased freshwater prawns, Macrobrachium rosenbergii, in China: a new freshwatercrustacean host. Aquaculture 318 (1–2), 1–6.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using re-altime quantitative PCR and the 2(−Delta Delta C (T)) method. Methods 25 (4),402–408.

Masumoto, K., Suzuki, K., Ohmori, I., Michiue, H., Tomizawa, K., Fujimura, A., 2012.Ca2+-independent syntaxin binding to the C2B effector region of synaptotagmin.Mol. Cell. Neurosci. 49, 1–8.

Meldrum, B.S., 1998. The glutamate synapse as a therapeutic target: perspectives for thefuture. In: Ottersen, O.P., Langmoen, I.A., Gjerstad, L. (Eds.), Progress in Brain

L. Hou, et al. Aquaculture 524 (2020) 735257

9

Research. 116. Elsevier Science B.V, Amsterdam, The Netherlands, pp. 413–430.Meng, Q., Hou, L., Zhao, Y., 2014. iTRAQ-based proteomic study of the effects of

Spiroplasma eriocheiris on Chinese mitten crab Eriocheir sinensis hemocytes. FishShellfish Immunol. 40 (1), 182–189.

Moroz, L.L., Kocot, K.M., Citarella, M.R., Dosung, S., Norekian, T.P., Povolotskaya, I.S.,et al., 2014. The ctenophore genome and the evolutionary origins of neural systems.Nature 510, 109–114.

Ojaniemi, M., Glumoff, V., Harju, K., 2003. Phosphatidylinositol 3-kinase is involved intoll-like receptor 4-mediated cytokine expression in mouse macrophages. Eur. J.Immunol. 33, 597–605.

Patterson, R.L., Boehning, D., Snyder, S.H., 2004. Inositol 1,4,5-trisphosphate receptors assignal integrators. Annu. Rev. Biochem. 73 (1), 437–465.

Prickett, T.D., Samuels, Y., 2012. Molecular pathways: dysregulated glutama-tergic sig-naling pathways in cancer. Clin. Cancer Res. 18 (16), 4240–4246.

Rash, B.G., Ackman, J.B., Rakic, P., 2016. Bidirectional radial Ca2+ activity regulatesneurogenesis and migration during early cortical column formation. Sci. Adv. 2 (2),e1501733.

Ren, Y., Xue, J., Yang, H., 2017. Transcriptome analysis of Ruditapes philippinarum he-patopancreas provides insights into immunesignaling pathways underVibrioanguillarum infection. Fish Shellfish Immunol. 64, 14–23.

Renden, R., Berwin, B., Davis, W., Ann, K., Chin, C.T., et al., 2001. Drosophila CAPS is anessential gene that regulates dense-core vesicle release and synaptic vesicle fusion.Neuron 31, 421–437.

Robalino, J., Carnegie, R.B., Nuala, O’Leary, 2009. Contributions of functional genomicsand proteomics to the study of immune responses in the Pacific white leg shrimpLitopenaeus vannamei. Vet. Immunol. Immunopathol. 128 (1–3), 110–118.

Rojtinnakorn, J., Hirono, I., Itami, T., 2002. Gene expression in haemocytes of kurumaprawn, Penaeus japonicus, in response to infection with WSSV by EST approach. FishShellfish Immunol. 13 (1), 69–83.

Schnare, M., Barton, G.M., Holt, A.C., 2001. Toll-like receptors control activation ofadaptive immune responses. Nat. Immunol. 2 (10), 947–950.

Shendure, J., Ji, H., 2008. Next-generation DNA sequencing. Nat. Biotechnol. 26,1135–1145.

Smart, T.G., Paoletti, P., 2012. Synaptic neurotransmitter-gated receptors. Cold SpringHarb. Perspect. Biol. 4 (3), a009662.

Sudhof, T.C., 2004. The synaptic vesicle cycle. Annu. Rev. Neurosci. 27, 509–547.Sutton, R.B., Fasshauer, D., Jahn, R., Brunger, A.T., 1998. Crystal structure of a SNARE

complex involved in synaptic exocytosis at 2.4 Å resolution. Nature 395, 347–353.Toledo, E.M., Colombres, M., Inestrosa, N.C., 2008. Wnt signaling in neuroprotection and

stem cell differentiation. Prog. Neurobiol. 86, 281–296.Valck, D.D., Jin, D.Y., Heyninck, K., 1999. The zinc finger protein A20 interacts with a

novel anti-apoptotic protein which is cleaved by specific caspases. Oncogene 18 (29),4182–4190.

Verkhratsky, A., Petersen, O.H., 2002. The endoplasmic reticulum as an integrating sig-nalling organelle: from neuronal signaling to neuronal death. Eur. J. Pharmacol. 447,141–154.

Wang, W., Zhu, N., Gu, Z., 2002. Study on the transmission of tremor disease (TD) in the

Chinese mitten crab, Eriocheir sinensis (Crustacea: Decapoda). J. Invertebr. Pathol. 81(3), 202–204.

Wang, W., Chen, J., Du, K., 2004. Morphology of spiroplasmas in the Chinese mitten crabEriocheir sinensis associated with tremor disease. Res. Microbiol. 155 (8), 630–635.

Wang, W., Gu, W., Gasparich, G.E., 2011a. Spiroplasma eriocheiris sp. nov. associated withmortality in the Chinese mitten crab, Eriocheir sinensis. Int. J. Syst. Evol. Microbiol. 61(4), 703–708.

Wang, X.W., Li, H.W., Zhao, X., 2011b. Characterization of a C-type lectin (PcLec2) as anupstream detector in the prophenoloxidase activating system of red swamp crayfish.Fish Shellfish Immunol. 30, 241–247.

Weisburg, W.G., Tully, J.G., Rose, D.L., 1989. A phylogenetic analysis of the myco-plasmas: basis for their classification. J. Bacteriol. 171 (12), 6455–6467.

Wu, C., Charoensapsri, W., Nakamura, S., 2013. An MBL-like protein may interfere withthe activation of the proPO-system, an important innate immune reaction in in-vertebrates. Immunobiology 218, 159–168.

Xie, C., Chen, Y., Sun, W., 2014. Transcriptome and expression profiling analysis of thehemocytes reveals a large number of immune-related genes in mud crab Scyllaparamamosain during Vibrio parahaemolyticus infection. PLoS One 9 (12), e114500.

Xiu, Y., Hou, L., Liu, X., 2015. Isolation and characterization of two novel C-type lectinsfrom the oriental river prawn, Macrobrachium nipponense. Fish Shellfish Immunol. 46,603–611.

Xue, S., Liu, Y., Zhang, Y., 2013. Sequencing and de novo analysis of the hemocytestranscriptome in Litopenaeus vannamei white spot syndrome virus infection. PLoS One8, e76718.

Yang, Y., Yu, H., Li, H., 2016a. Transcriptome profiling of grass carp (Ctenopharyngodonidellus) infected with Aeromonas hydrophila. Fish Shellfish Immunol. 51, 329–336.

Yang, Y., Yu, H., Li, H., 2016b. Transcriptome profiling of grass carp (Ctenopharyngodonidellus) infected with Aeromonas hydrophila. Fish Shellfish Immunol. 51, 329–336.

Yano, S., Tokumitsu, H., Soderling, T.R., 1998. Calcium promotes cell survival throughCaM-k kinase activation of the protein-kinase-B pathway. Nature 396, 584–587.

Yin, D., Woodruff, M., Zhang, Y., 2006. Morphine promotes Jurkat cell apoptosis throughpro-apoptotic FADD/P53 and anti-apoptotic PI3K/Akt/NF-κB pathways. J.Neuroimmunol. 174 (1–2), 101–107.

Yoo, J.C., Lim, T.Y., Park, J.S., Hah, Y.S., Park, N., Hong, S.G., 2013. SYT14L, especiallyits C2 domain, is involved in regulating melanocyte differentiation. J. Dermatol. Sci.72, 246–251.

Yu, X.Q., Kanost, M.R., 2000. Immulectin-2, a lipopolysaccharide-specific lectin from aninsect, Manduca sexta, is induced in response to gram-negative Bacteria. J. Biol.Chem. 275, 37373–37381.

Zhang, Y., Bao, H., Miao, F., 2015. Production and application of polyclonal and mono-clonal antibodies against Spiroplasma eriocheiris. Sci. Rep. 5, 17871.

Zhang, S., Shi, L., Li, H., Wang, S., He, J., Li, C., 2016a. Cloning, identification andfunctional analysis of a ??-catenin homologue from Pacific white shrimp, Litopenaeusvannamei. Fish Shellfish Immunol. 54, 411–418.

Zhang, G., Yin, S., Mao, J., 2016b. Integrated analysis of mRNA-seq and miRNA-seq in theliver of Pelteobagrus vachelli in response to hypoxia. Sci. Rep. 6, 22907.

L. Hou, et al. Aquaculture 524 (2020) 735257

10