transcriptional repression by the proline rich homeodomain ... · the proline-rich homeodomain...

M4:04488 revised version

The Proline-Rich Homeodomain (PRH) protein recruits

members of the Groucho/TLE protein family to co-

repress transcription in haematopoietic cells

Tracey E. Swingler, Kirstin L. Bess, Jing Yao1, Stefano Stifani1 and

Padma-Sheela Jayaraman*

Department of Biochemistry, University of Bristol, University Walk,

Bristol BS81TD, U.K. 1Montreal Neurological Institute, McGill University, 3801 rue University,

Montreal, Quebec H3A2B4, Canada.

Running title: Transcriptional repression by PRH

*corresponding author

Phone: (+44-117-9289708)

Fax: (+ 44-117-9288274)

E-mail: [email protected]

Abbreviations used: PRH, Proline-Rich Homeodomain; TLE, transducin-like Enhancer of

split; GAL4AD, activation domain of GAL4; GAL4DBD, DNA binding domain of GAL4:

GST, glutathione S-transferase; TK, thymidine kinase; UAS, Upstream Activating

Sequence; 5-FOA, 5-Fluoroorotic Acid; Ura, Uracil; His, Histidine; X-gal, 5-bromo-4-

chloro-3-indolyl-β-D-galactopyranoside; MCS, multiple cloning site.

by guest on February 3, 2019http://w

ww

.jbc.org/D

ownloaded from

mailto:[email protected]

http://www.jbc.org/

SUMMARY

The Proline-Rich Homeodomain protein (PRH/Hex) is important in the control

of cell proliferation and differentiation and in the regulation of multiple processes in

embryonic development. We have shown previously that PRH contains two domains

that can independently bring about transcriptional repression. The PRH homeodomain

represses transcription by binding to TATA box sequences, whilst the proline-rich N-

terminal domain of PRH can repress transcription when attached to a heterologous

DNA-binding domain. The Groucho/Transducin-like Enhancer of split (TLE) family

of proteins are transcriptional co-repressors that interact with a number of DNA-bound

transcription factors and play multiple roles in development. Here we demonstrate that

the proline-rich N-terminal domain of PRH binds to TLE1 in vitro and in yeast two-

hybrid assays. We show that PRH and TLE proteins are co-expressed in

haematopoietic cells and interact in co-immunoprecipitation assays. We demonstrate

that TLE1 increases repression by PRH in transient transfection assays and that

titration of endogenous TLE proteins by co-expression of Grg5, a natural trans-

dominant negative protein, alleviates transcriptional repression by PRH. Finally we

show that a mutation in the PRH N-terminal domain that blocks the PRH-TLE1

interaction in vitro eliminates co-repression. We discuss these results in terms of the

roles of PRH and TLE in cell differentiation and development.

Key words: Transcriptional repression, PRH, HEX, TLE, co-repressor,

haematopoiesis, trans-dominant negative,

2


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

INTRODUCTION

The Proline-Rich Homeodomain (PRH) protein also known as Hex

(Haematopoietically expressed), is an orphan homeodomain protein that functions as

an important regulator of haematopoiesis (1). PRH was first identified in human and

avian haematopoietic cells (1). PRH is strongly expressed in pluripotent

haematopoietic progenitors, in erythromyeloid and B-cell progenitors but not in T-

cell lineages (2-5) and is down-regulated in most haematopoietic lineages during

differentiation (3;6). PRH interacts with the growth control protein PML (7) and has

been shown to regulate cell growth or differentiation in a number of different tissues

(8-10). Up-regulation of PRH expression is linked with several lymphoid leukaemias

(11;12). In mice transplanted with bone marrow transduced with a PRH expressing

retrovirus PRH can act as an oncogene and cause T-cell derived lymphomas (11;12).

However PRH also acts as a tumour suppressor in some haematopoietic lineages.

PRH can inhibit oncogenic transformation by the translation initiation factor eIF4E

by disruption of the mRNA transport activity of eIF4E through a direct interaction

with eIF4E in the nucleus (13). Disruption of the nuclear localisation of PRH is

associated with the loss of this key regulatory function in a subset of myeloid

leukaemias (14). Thus the effects of PRH on growth and differentiation are both dose-

dependent and context-dependent. PRH also has an important role in the regulation of

early embryonic patterning (4;15;16). Indeed it plays a central role in the formation of

the vertebrate head and the formation of many endoderm-derived organs such as liver

and thyroid (5).

PRH functions as a transcriptional repressor in haematopoietic, liver, thyroid

and embryonic stem cells (15;17-19). However, it has also been reported to activate

transcription of its own gene in thyroid cells (20). PRH represses transcription in

3


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

haematopoietic cells by binding to TATA box sequences and TBP using the PRH

homeodomain. In addition however, the proline-rich PRH N-terminal repression

domain can repress transcription independently of the DNA binding activity of the

homeodomain by as yet unidentified mechanisms (21). Whilst the PRH N-terminal

repression domain is known to bind to PML, eIF4E and the proteosome subunit C8.

These interactions have not been shown to influence transcriptional repression in vivo

(7;13;22).

The TLE proteins are members of a family of co-repressor proteins that

includes the murine Grg proteins and the Drosophila Groucho protein. Groucho/TLE

family proteins are involved in many developmental decisions including: neuronal

and epithelial differentiation, segmentation and sex determination, differentiation of

haematopoietic, osteoblast and pituitary cells (23-27). Members of the Groucho /TLE

family do not have DNA binding activity but are instead recruited to DNA by

interactions with DNA binding proteins. In general, these proteins use a C-terminal

region known as the WD repeat domain to interact with DNA-binding proteins

(28;29) and an N-terminal glutamine-rich Q domain for tetramerisation (30-32).

Some members of the TLE family of proteins, such as Grg5, lack the WD repeat

regions but retain the oligomerisation Q domain. Over-expression of Grg5 can relieve

TLE-mediated co-repression, presumably because this protein retains the ability to

tetramerise with full-length TLE proteins (32-34). Once recruited to a promoter, the

Groucho/TLE proteins can bring about transcriptional repression by recruiting histone

deacetylases (35-37) or by directly interacting with histones (38), or with the basal

transcriptional machinery (39;40).

Here we show that the PRH N-terminal repression domain can interact with

TLE1 in vitro and in vivo using a short sequence of amino acids that corresponds to an

4


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Engrailed homology (Eh-1) motif. Moreover we demonstrate that the interaction

between TLE1 and PRH is required for enhanced repression of transcription by PRH.

Furthermore, we show that titration of endogenous TLE proteins by Grg5 decreases

repression by PRH. Thus TLE proteins co-repress transcription with PRH.

5


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

EXPERIMENTAL PROCEDURES

Bacterial expression plasmids

A GST-tagged avian PRH N-terminus (GST-PRHN1-141) expression vector has

been described previously (21). PCR fragments encoding amino acids 1-125 or 61-

141 of avian PRH and flanked by 5’ SalI and 3’ SpeI restriction sites were cloned into

pGEX20T (Pharmacia) downstream of the GST moiety to create pGEX-PRHN61-141

and pGEX-PRHN1-125. The GST-tagged human PRH N-terminus expression vector

pGEX-MycPRHN1-132 was created as follows. Briefly, a DNA sequence encoding the

Myc-tagged human PRH N-terminus (amino acids 1-132) was cloned as a BamHI-

StuI fragment from pMUG1-MycPRH (see below) into pGEX20T (Pharmacia). The

PRH fragment was inserted between the unique BamHI site and the XbaI site in the

vector by first modifying the XbaI restriction site with Klenow enzyme to blunt the

XbaI restriction site. The pGEX-MycPRH F32E N1-132 plasmid that expresses the PRH

N-terminus carrying the F32E mutation was created exactly as described above except

that the PRH N-terminal fragment was obtained from pMUG1-MycPRH F32E (see

below). The DNA sequence of these plasmids and the plasmids described below were

verified by DNA sequencing.

Mammalian expression and reporter plasmids

The pTK-PRH and pTK-GAL reporter plasmids have been described

previously (21). pSV-β-Galactosidase Control Vector (pSV-lacZ) was obtained from

Promega. pBSK II-HPRH is a vector carrying the full-length human PRH cDNA and

was a gift from Dr. G. Manfioletti (University of Trieste). The mammalian expression

plasmid pFlag-Grg5 (pCMV-Tag1-AES) expresses the Grg5 protein tagged with the

pFlag epitope and has been described previously (41) and was a gift from Dr. T.

6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Okamoto (Nagoya University). The mammalian expression plasmid pCMV2-

FlagTLE1 contains TLE1 coding sequence in frame with the Flag epitope. The

FlagTLE1 construct was generated by first digesting a pBluescript-TLE1 plasmid

with BanII, followed by removal of protruding ends with T4 DNA polymerase and

recovery of a 1.6 kb fragment encoding the N-terminal region of TLE1. This fragment

was subcloned into pCMV2-Flag digested with EcoRV. A second pBluescript-TLE1

restriction fragment obtained after digestion with SmaI and encoding the remaining

half of TLE1 was then ligated in frame into the first ligation product to generate

pCMV2-FlagTLE1 expressing full-length TLE1.

The mammalian expression plasmid pMUG1-MycPRH expresses full-length

human PRH and was created as follows: pUHD15-1 (42) was modified by replacing

the sequence between the unique BamHI and EcoRI sites with a linker which destroys

these two restriction sites and contains a multiple cloning sequence (MCS). The

sequence of the linker is as follows: 5’ A ATT GGA TCC ATG GGA ATT CGA

GGT CGA CAG TGA 3’.The linker contains a translational start signal (bold) and

BamHI , NcoI, EcoRI, and SalI restriction sites. The resulting pMUG1 plasmid,

contains the CMV promoter with a MCS downstream. A BamHI-SmaI double-

stranded oligonucleotide encoding a Myc tag (Myc 9E10 epitope)

(5’GATCCATGGAACAAAAACTCATCTCAGAAGAGGATCTG 3’) and a SmaI-

EcoRI fragment from pBSK-HPRH carrying the human PRH coding sequence from

amino acid 7 was inserted between the BamHI and EcoRI sites in pMUG1. This

results in an expression construct where the PRH coding sequence was placed in

frame with the Myc tag and the ATG in the MCS.

7


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Yeast plasmids

pACT2 contains the GAL4 AD upstream of a MCS (Clontech). To create

pACT2-HPRH a SmaI –EcoRI fragment from pBSK-HPRH carrying the PRH coding

sequence from amino acid 7, was ligated into pACT2 between the BamHI and EcoRI

restriction sites. The BamHI site in pACT2 was filled in using Klenow enzyme to

allow blunt end ligation with the PRH SmaI site. pGBT9-TLE1 contains the TLE1

cDNA in frame with the GAL4 DBD and has been described previously (31;31;43).

pAS2-1 contains the GAL4 DBD upstream of a MCS (Clontech). To create pAS2-1-

PRHN1-132 an EcoRI-StuI fragment from pBSK-HPRH encoding the N-terminal 132

amino acids of PRH was ligated between the EcoRI and SmaI sites of pAS2-1. An

oligonucleotide was inserted between the EcoRI site in pAS2-1 and the internal SmaI

site in HPRH to achieve the correct reading frame (5’

CATGCAGTACCCGCACCCC 3’). To create the deletion mutant pAS2-1-PRHN1-98,

the pAS2-1-PRHN1-132 construct was digested with BamHI and partially digested with

ApaI. An ApaI-BamHI oligonucleotide (5’ CGCCGCGCCCACG 3’) was then ligated

between the ApaI site located at amino acid 98 within the PRH amino acid sequence

and the unique BamHI site in the vector pAS2-1. pGAD424-TLE1 contains the full-

length TLE1 coding sequence and expresses a GAL4-TLE1 fusion protein.

pGAD424-TLE1Q-SP and pGAD424-TLE1WD contain the Q (amino acids 1-135),

Q-SP (amino acids 1-435) and WD (amino acids 444-770) domains of TLE1,

respectively. These plasmids have all been described previously (31;43).

Yeast two-hybrid assay

The two-hybrid assay (44) was carried out in yeast strain MaV203 (Clontech).

The two-hybrid assay and β-galactosidase assays in liquid culture were performed as

8


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

described by Fields and Song (44) and the Clontech manual. Colony lift assays were

performed by transferring yeast colonies onto 3MM filter paper. The yeast were then

lysed by rapidly freeze thawing in liquid nitrogen and then placed on filter paper

saturated with Z-buffer (60mM Na2HPO4, 40mM NaH2PO4, 10mM KCl, 1mM

MgCl2, 50mM β-mercaptoethanol) containing X-gal indicator (0.32mg/ml). The blue

colour for each transformant was compared after incubation of the filter at 37°C for

3hrs.

Mutagenesis

The QuikChange kit (Stratagene) was used for the mutagenesis of pMUG1-

MycPRH to PRH F32E and was used according to the manufacturer’s instructions.

The resulting mutant was fully sequenced to confirm the sequence change.

Expression and purification of tagged-PRH proteins

The human and avian GST-PRH fusion proteins were expressed in BL21

pLysS cells (Novagen). Fusion protein expression was induced with 1mM IPTG.

Cells were harvested and lysed by incubation with 100µl of lysozyme (1mg/ml) for

20 mins followed by sonication in PBS/1% Triton-X-100. GST-PRHN fusion proteins

were purified over glutathione-Sepharose 4B beads (Sigma) according to the

manufacturer’s instructions and snap frozen in liquid nitrogen. Aliquots of these

proteins were eluted with 10mM glutathione and assayed for purity by SDS-PAGE

followed by staining with Coomassie blue. Proteins were quantified using the Bio-

RAD phosphoric acid protein assay.

9


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

In vitro binding assays

The plasmid used for the in vitro transcription and translation of TLE1,

pcDNA3-TLE1, has been described previously (27;43). Transcription and translation

was carried out using a TNT kit (Promega) according to the manufacturer’s protocol.

Approximately 20 µg of each of the GST fusion proteins, or an equimolar amount of

GST protein as judged by Coomassie staining, were bound to 50µl of glutathione-

Sepharose 4B beads (Sigma) according to the manufacturer’s instructions. To assay

for specific interactions, 10µl of [35S] methionine-labelled in vitro translated protein

was added and incubated in binding buffer (20mM Hepes pH7.8, 200mM KCl, 5mM

MgCl2, 0.5mM DTT, 0.5% NP40, 50ng/µl BSA), with gentle agitation, for 60 mins at

4°C. The beads were then washed six times with 1ml of binding buffer. Bound

proteins were eluted by boiling the beads in protein sample buffer containing 1% SDS

and analysed by SDS-PAGE and fluorography.

Pull-downs and western blotting

Whole cell extract from 2 x 108 K562 cells was made as follows: the cell

pellet was washed in PBS twice and then resuspended in 1ml high salt lysis buffer

(500mM NaCl, 50mM Tris pH 7.5, 0.1% SDS, 0.1% NP-40). The cell suspension was

drawn up and down six times with a 3 X Monojet needle (1.1x50mm, 19Gx2”) and

then incubated on ice for 5 mins. The extract was centrifuged at maximum speed for 5

mins at 4°C in an Eppendorf microcentrifuge. Whole cell extract was added to

approximately 10µg of GST-HPRHN protein or 10µg of GST protein bound to

glutathione resin. After two hours at 4°C with tumbling, the resin was collected by

centrifugation in an Eppendorf microcentrifuge, washed three times in 1ml of wash

buffer (150mM NaCl, 50mM Tris pH 7.5, 0.1% SDS, 0.1% NP-40) and then

10


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

resuspended in 50µl 2X SDS loading buffer. All operations were carried out at 4°C

and in the presence of protease inhibitors. After SDS PAGE the proteins were

immunoblotted onto Immobilon-P membrane (Sigma). TLE proteins were detected

using a rat monoclonal pan TLE antibody raised against the conserved carboxyl-

terminal WD40 domain of Groucho/TLEs (25;45) and an ECL kit (Amersham). HC8

was detected with a mouse monoclonal antibody (Affiniti).

Immunofluoresence

K562 cells were grown to a density of 1x 106 cells/ml. 10mls of cells were

collected by centrifugation and resuspended in 1ml of PBS. Glass slides were coated

with poly-L-lysine (Sigma) for 10 mins at 20°C and then washed with water. The

washed K562 cells were incubated on the coated slide for 10 mins at 20°C and then

washed in PBS. The cells were fixed in paraformaldehyde for 30 mins, and then

rinsed twice in PBS and permeabilised by incubation in 0.1% Triton-X-100 in PBS

for 10 mins. The cells were then rinsed with PBS and incubated with PBSA (3% BSA

in PBS) for 20 mins to block non-specific antibody binding. After rinsing in PBS,

antibody staining was performed with a 1:10 dilution of a rat monoclonal pan TLE

antibody and a 1:10 dilution of a mouse polyclonal anti-PRH antibody for 1 hour at

20°C. The cells were rinsed in PBS twice, in PBSA twice, and then incubated with

secondary antibodies for 1 hour at 20°C. PRH was detected with a TRITC donkey

anti-mouse secondary antibody (Stratec) that had been preadsorbed for

immunoreactivity against rat antibodies. MycPRH was detected with a monoclonal

antibody (Santa Cruz). TLE was detected with a 1:100 dilution of a biotinylated rabbit

anti-rat secondary antibody (Vector Laboratories Inc.) and a 1:100 dilution of a

Fluorescein-labelled goat anti-Biotin tertiary antibody (Vector Laboratories Inc.).

11


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Immunostained cells were viewed on a Leica DM IRBE confocal microscope and

imaging performed using Leica Confocal Software Version 2.00.

Cell culture and transient transfection assays

K562 cells were grown in glutamine added DMEM media (Sigma)

supplemented with 10% foetal calf serum (FCS) to a density of approximately 1x106

cells/ml. The cells were then collected by centrifugation and then resuspended in

media plus 10% FCS to a density of 5x107 cells/ml. 5µg of the luciferase reporter

plasmid with 5µg of the β-galactosidase reporter plasmid and the amount of

expression plasmids indicated in the Results, were electroporated into 1x107 cells

using a BIORAD Genepulser (200V, 975µF). The cells were rested for 10 mins and

then incubated overnight in 10ml of supplemented media. After 24 hours the cells

were harvested and luciferase activity assayed using the Promega Luciferase Assay

System according to the manufacturer’s instructions. β-galactosidase assays were

performed as an internal control for transfection efficiency. After subtraction of the

background the luciferase counts were normalised against the β-galactosidase value.

Co-immunoprecipitation assays

K562 cells (2 x 107) were co-transfected with 2µg pMUG1-MycPRH and

either 2µg pCMV2-FlagTLE1 or 2µg pCMV-Flag-Grg5 as described above. Five

transfections were pooled (1 x 108 cells) to make the nuclear extract for each co-

immunoprecipitation. Nuclear extracts were made by the method of Dignam et al.

(46) with modifications described by Dorn et al. (47). Nuclear extracts were incubated

with 4µl of a monoclonal anti-Myc9E10 antibody (Santa Cruz) for 30 mins at 4°C.

100µl of a 50% slurry of Protein G beads (Sigma) was then incubated with the nuclear

12


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

extracts for a further 90 mins at 4°C. After this time, the resin was collected by

centrifugation in an Eppendorf microcentrifuge (13,000 rpm for 1 min), washed three

times in 1ml of wash buffer B (150mM NaCl, 50mM Tris pH 7.5, 0.2% NP-40) and

then resuspended in 50 µl 2X SDS loading buffer. All operations were carried out at

4°C and in the presence of protease inhibitors. After SDS PAGE the proteins were

immunoblotted onto Immobilon-P membrane and TLE and Grg5 proteins were

detected using anti-Flag antibodies (Sigma). Approximately 10% of the nuclear

extract (200µg protein) was used for Western blotting experiments as described

above.

13


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

RESULTS

PRH and TLE1 interact in yeast

PRH contains two motifs that could be involved in an interaction with TLE

proteins. Amino acids 30-39 (TPFYIEDILG) contains a sequence that matches the

Engrailed homology (Eh-1) motif (FxIxxIL) identified originally in the Drosophila

homeodomain proteins Engrailed and Goosecoid and shown to mediate the interaction

of both these proteins with Groucho (48;49). The second is a putative ‘Runt/Hairy’

motif (LLWSPF amino acids 124-129 in PRH) which loosely resembles the

tryptophan containing motifs WRPY and WRPW that are used to recruit the Groucho

protein to the Runt and Hairy transcription factors respectively (50;51). To investigate

whether PRH might interact with TLE proteins we made use of the yeast two-hybrid

assay (Fig. 1). The human PRH cDNA was placed in frame with GAL4 activation

domain in the vector pACT2 to create pACT2-PRH (see EXPERIMENTAL

PROCEDURES). pGBT9-TLE1 contains the full-length TLE1 cDNA (amino acids 1-

770) in frame with the GAL4 DNA binding domain (31;43;43). pACT2-PRH and

pGBT9-TLE1 were co-transformed into yeast strain MaV203. This strain contains

integrated copies of the LacZ and His reporter genes under the control of GAL4-

dependent promoters. A functional interaction between the two hybrids in this strain

would be expected to produce β-galactosidase activity and histidine prototrophs.

Although expression of pGBT9-TLE1 with a vector containing the GAL4AD or

expression of pACT2-PRH with a vector containing the GAL4DBD did not result in

the production of β-galactosidase activity (Fig. 1B, columns 1 and 2), significant β-

galactosidase activity was detected when pGBT9-TLE1 and pACT2-PRH were co-

expressed (Fig. 1B, column 3). These data suggest that a functional transcription

factor is produced only when both proteins are present and therefore that PRH

14


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

interacts with TLE1 in this assay. However, the co-expression of PRH and TLE1

results in very poor growth of the transformed yeast strain when histidine is added to

the growth media and no growth in the absence of histidine (not shown). This

suggests that the interaction of the full-length PRH and TLE proteins is toxic for this

yeast strain.

To confirm that the PRH-TLE1 interaction occurs and to establish whether the

N-terminal domain of PRH is responsible for the interaction we repeated the yeast

two-hybrid assay with a truncated PRH construct (Fig. 1C). In this case, full-length

TLE1 (1-770) was fused to the GAL4 activation domain in pGAD424 to create

pGAD424-TLE1 (31;43). A fragment of the human PRH cDNA encoding the first 98

amino acids of PRH was cloned into the GAL4 DNA binding domain vector pAS2-1

to create pAS2-1-PRHN1-98 (see EXPERIMENTAL PROCEDURES). This fragment

of PRH lacks the Runt/Hairy-like motif (LLWSPF) described earlier but contains the

putative Eh-1 motif. These constructs were then transformed into yeast. To inhibit

leaky expression of the histidine gene transformants were assayed for growth on

dropout media plates containing 50mM 3-amino-triazol (50mM 3-AT) and

subsequently assayed for lacZ expression. Yeast co-transformed with PRHN1-98 and

TLE1 grew well on -HLT (+50mM 3AT) dropout medium whereas yeast transformed

with only one of the partners and the corresponding empty vector either did not grow

or grew very poorly on this medium (Fig. 1C). Moreover only yeast co-transformed

with PRHN1-98 and TLE1 resulted in colonies that produced β-galactosidase activity in

X-gal colony lift assays (Fig. 1C, compare sectors 7 and 2 on X-gal). Thus it appears

that the N-terminal 98 amino acids of PRH are sufficient for the interaction of PRH

with TLE1 and that the ‘Runt/Hairy’-like sequence found in PRH is not required for

the interaction.

15


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

The TLE1 protein is 770 amino acids long and has several functional domains

(Fig. 1A) (45). The N-terminal region of the protein (amino acids 1-135) is a

glutamine-rich tetramerisation domain known as the Q domain. The middle of the

protein (amino acids 135- 435) contains a glycine/proline rich G/P domain, a nuclear

localisation and CKII phosphorylation region (CcN) and a Ser/Thr/Pro-rich SP

domain. The C-terminus of the protein contains a WD-repeat domain (amino acids

444-770) that can mediate protein-protein interactions with transcription factors

(28;29;31;52). To determine which regions of TLE1 are involved in the interaction

between PRH and TLE1 a series of TLE1 deletion mutants were fused to the GAL4

activation domain in pGAD and co-transformed into yeast with pAS2-1-PRHN1-98.

The TLE deletion mutants pGAD-TLEQ (1-135), pGAD-TLEQ/SP (1-435) and

pGAD-TLEWD (444-770) have been described previously (31). Interestingly, when

co-transformed with pAS2-1-PRHN1-98 all of the TLE deletion mutants allowed

growth of the corresponding yeast transformants on –HLT (+50mM 3AT) media and

also resulted in β-galactosidase activity in X-gal filter lift assays (Fig. 1C, sectors 7-

10) and in liquid β-gal assays (not shown). These data suggest that PRHN 1-98 is able to

interact with both the Q domain at the N-terminus of TLE1 and also with the WD-

repeat domain at the C-terminus of TLE1.

To confirm the growth phenotypes of the yeast co-transformed with these

constructs we made use of the Ura- (+5-Fluoroorotic acid) counter-selection assay

(53). Yeast strain MaV203 is Ura- and contains an integrated copy of the Ura3 gene

under the control of a Gal4-dependent UAS. Only yeast carrying interacting proteins

become Ura+ and can convert 5-Fluoroorotic acid (5-FOA) to the highly toxic

compound 5-fluorouracil. As can be seen from the data in Fig. 1C, yeast containing

any of the TLE1 proteins and PRHN 1-98 die on media containing 5-FOA (Fig. 1C,

16


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

sectors 7-10, on FOA). In contrast, yeast transformed with the two empty vectors

pAS2-1 and pGAD424 (sector 1), or each of the TLE1 proteins with pAS2-1 (sectors

2-5), or PRHN 1-98 with pGAD424 (sector 6) show very limited growth on -HLT

(+3AT) media, no β-galactosidase activity, and growth on media containing 5-FOA.

Taken together these data confirm that PRH and TLE1 can interact in yeast.

Furthermore, these data suggest that both the Q domain and the WD domains of TLE1

are involved in the interaction with the first 98 amino acids of PRH,

Immunostaining of PRH and TLE proteins in K562 cells

To investigate further the biological significance of the interaction between

PRH and TLE proteins we next examined the distribution of these proteins in K562

haematopoietic cells. PRH is known to be strongly expressed in this cell line and

other PRH interacting proteins have been identified from yeast two-hybrid screens

with cDNAs obtained from this cell line (22;54). The K562 cell line was originally

obtained from a patient with Chronic Myeloid Leukaemia (CML) in blast crisis and in

culture these cells spontaneously give rise to multiple cell types, larger myeloblasts

and smaller myeloid cells at various stages of differentiation (55). To determine the

intracellular localisation of the endogenous PRH and TLE proteins in the K562 cell

line we used confocal laser microscopy and immunofluoresence. Figure 2A shows

endogenous TLE staining of K562 cells with a fluorescein labelled pan-TLE antibody

(green signal) and Figure 2B shows DNA staining with DAPI (blue signal). TLE is

present in both the nucleus and the cytoplasm of K562 blasts and smaller myeloid

cells. The staining pattern of the cells is not however uniform. For example, cells 1

and 2 both show a predominant cytoplasmic staining for TLE and cells 3 and 4 show

predominant nuclear staining for TLE (compare DAPI and fluorescein staining). The

17


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

differences in sub-cellular localisation of TLE proteins in these cells may reflect the

differentiation status of these cells. Certainly TLE proteins are known to become

more strongly associated with the nuclear compartment during the neural

differentiation of P19 embryonic carcinoma cells (56). Fig. 2C shows endogenous

PRH staining of the same cells with a TRITC labelled anti-PRH mouse polyclonal

antibody (red signal). This antibody stains both the nucleus and the cytoplasm of

K562 cells. In all cases when cells were stained without the primary antibody there

was little, if any, detectable immunofluoresence (data not shown). As expected, co-

immunofluoresence experiments using TRITC labelled anti-PRH mouse polyclonal

antibodies and the same fluorescein labelled pan-TLE rat monoclonal antibodies show

that a significant proportion, but not all K562 cells, contain both PRH and TLE

proteins in the nucleus (Fig. 2D). Figure 2 also shows a high magnification image of a

K562 cell, where endogenous PRH is present in the nucleus and cytoplasm (Fig. 2F,

TRITC staining) and endogenous TLE proteins are strongly nuclear (Fig. 2G, FITC

staining). Co-immunofluoresence of this cell shows that both endogenous PRH and

TLE proteins are present in the nucleus (Fig. 2H).

Since both TLE and PRH proteins can be found in both cytoplasmic and

nuclear compartments, we wanted to determine whether over-expressed TLE1 and

PRH proteins are predominantly cytoplasmic or nuclear. Transfection of K562 cells

with either pMUG1-MycPRH or pFLAGTLE1 followed by immunostaining with a

Myc monoclonal antibody or the rat panTLE antibody respectively, results in around

10% of cells expressing the transfected proteins. However, in both cases

immunofluoresence experiments show that the transfected proteins are located in the

nucleus (data not shown). Similarly, when K562 cells are co-transfected with both

PRH and TLE1 expression plasmids, both MycPRH and FlagTLE1 are strongly

18


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

localised to the nucleus. Figure 2I shows a high magnification transmitted light image

of a transfected K562 cell. Figures, 2J, and 2K show PRH (TRITC), TLE (FITC), and

DAPI staining of the same cell. Figure 2L shows co-localisation of TLE1 with PRH in

the nucleus of a transfected K562 cell.

PRH and TLE proteins interact in vitro and in K562 haematopoietic cells

To provide biochemical evidence for the interaction between PRH and TLE1

we carried out in vitro binding studies and pull-down experiments. The equivalent N-

terminal regions of human PRH (amino acid 1-132) and avian PRH (amino acids 1-

141) were expressed in bacteria as GST fusion proteins and partially purified. In vitro

transcription and translation was used to produce labelled TLE1. Glutathione beads

carrying GST or the GST-PRHN proteins were incubated with labelled TLE1 and then

washed extensively. Bound protein was eluted by boiling in SDS-PAGE loading

buffer and analysed by SDS-PAGE. Figure 3A shows that labelled TLE1 binds to the

human GST-PRHN1-132 (lane 3) and avian GST-PRHN 1-141 (lane 4) fusion proteins but

binds only very weakly, if at all, to GST alone (lane 2). Thus both the human and the

avian PRH N-terminal domains bind to TLE1 in vitro. To extend our in vitro binding

studies we determined whether the purified human PRH N-terminus is able to interact

with endogenous TLE proteins in K562 whole cell extracts. Human GST-PRHN 1-132

or GST alone were immobilised on glutathione-Sepharose beads and incubated with

K562 whole cell extracts. After extensive washing, bound proteins were eluted by

boiling in SDS-PAGE loading buffer and separated by SDS-PAGE. The bound

proteins were then probed with the pan TLE rat monoclonal antibody in a Western

blot. The GST-PRHN1-132 protein is clearly able to retain the endogenous TLE proteins

present in the whole cell extracts (Fig. 3B, lane 3). However, an equivalent amount of

19


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

GST (as judged by Coomassie staining) does not retain TLE (Fig. 3B, lane 2). We

conclude that the human PRH N-terminal protein purified from bacterial cells is able

to interact with the endogenous TLE proteins present in K562 cell extracts.

To confirm these results co-immunoprecipitation studies were carried out

using full-length PRH tagged with the Myc9E10 epitope (pMUG1-MycPRH) and

TLE1 tagged with a Flag epitope (pCMV2-FlagTLE1) (Fig. 3C). K562 cells were

transiently co-transfected with MycPRH and FlagTLE1 plasmids and nuclear extracts

were made from the transfected cells. Proteins in these nuclear extracts were

separated on SDS-PAGE gels and probed with an antibody raised against the Flag

epitope. Flag-tagged TLE1 proteins with a molecular weight of approximately 90kD

were detected with this antibody in Western blotting experiments (Fig. 3C, lane 1).

Shorter exposures show the presence of a doublet of TLE1 proteins (data not shown).

The same nuclear extract was incubated with either Protein G-Sepharose beads alone,

or with an anti-Myc mouse monoclonal antibody bound to Protein G-Sepharose

beads. After extensive washing the bound proteins were separated on SDS-PAGE gels

and probed with the anti-Flag antibody. In the presence of the Myc antibody, a

doublet of the same molecular weight as that of the TLE1 proteins is co-

immunoprecipitated (Fig. 3C, lane 3). This doublet is not present when Protein G-

Sepharose beads alone are incubated with nuclear extracts made from the transfected

cells (Fig. 3C, lane 2). Thus, FlagTLE1 can interact with MycPRH in haematopoietic

cells.

Some apparent protein-protein interactions occur indirectly and are observed

because two proteins both independently bind to contaminating DNA present in the

nuclear extract. For example, Oct-2 and the non-specific DNA binding subunits of the

Ku protein co-immunoprecipitate only in the presence of DNA, whereas the

20


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

interaction between Rb and E1A is not dependent on the presence of DNA (57).

Ethidium bromide (EtBr) intercalates into DNA and can abolish protein-DNA

interactions without disrupting protein-protein interactions. To determine whether the

PRH-TLE1 interaction requires the presence of DNA we carried out the co-

immunoprecipitation experiment with MycPRH and FlagTLE1 described above in the

presence of different concentrations of EtBr. The direct protein-protein interactions

between Rb and E1A are insensitive to EtBr concentrations of 0.2mg/ml (57). Figure

3C, shows that TLE co-immunoprecipitates with MycPRH even in the presence of

0.4mg/ml of EtBr (Fig. 3C, compare lanes 3 and 4). Since Ethidium bromide does not

appear to significantly affect the co-immunoprecipitation of TLE1 and PRH it is

likely that this is a protein-protein interaction that does not require promoter DNA.

To establish whether transfected MycPRH interacts with endogenous TLE

proteins, nuclear extracts were made from K562 cells alone or K562 cells transfected

with MycPRH. Proteins in these nuclear extracts were separated on SDS-PAGE gels

and probed with the rat pan-TLE antibody raised against the C-terminus of TLE

proteins. In the presence of transfected MycPRH, nuclear TLE proteins with a

molecular weight of approximately 90kD were detected in Western blotting

experiments (Fig. 3D, lane 1). Nuclear extracts expressing transfected MycPRH were

incubated with an anti-Myc mouse monoclonal antibody bound to Protein G-

Sepharose beads (Fig. 3D, lane 4) or incubated with Protein G-Sepharose beads alone

(Fig. 3D, lane 3). As a further control untransfected K562 nuclear extracts were

incubated with an anti-Myc mouse monoclonal antibody bound to Protein G-

Sepharose beads (Fig. 3D, lane 2). After washing the bound proteins were separated

on SDS-PAGE gels and probed with the pan-TLE antibody. Small amounts of TLE

proteins non-specifically bound to Protein G-Sepharose beads are detected by the pan-

21


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

TLE antibody even in the absence of the Myc antibody (Fig. 3C, lane 3) or in the

absence of transfected MycPRH (Fig. 3C, lane 2). However, in the presence of

transfected MycPRH, a doublet of the same molecular weight as that of the

endogenous TLE proteins is strongly co-immunoprecipitated by the Myc antibody

(Fig. 3D, lane 4). We conclude that TLE proteins can associate with PRH both in vitro

and in haematopoietic cells.

TLE proteins can co-repress transcription with PRH

To determine the biological significance of the interaction between PRH and

TLE1 we investigated whether TLE1 could function as a co-repressor of transcription

with PRH. We have shown previously that the reporter plasmid pTK-PRH is

repressed by chicken PRH in avian haematopoietic BM2 cells (21) and by human

PRH in K562 cells (22). The pTK-PRH reporter and the control reporter plasmid

pSV-β-gal were transiently transfected into K562 cells with 100ng of pMUG1-

MycPRH. As can be seen in Figure 4A, this amount of pMUG1-MycPRH decreases

pTK-PRH promoter activity to approximately 60% of its unrepressed activity

(compare columns 1 and 2). Co-transfection with 200ng of the TLE1 expression

plasmid pCDNA3-TLE1 results in increased repression by PRH (Fig. 4A, compare

columns 2 and 3). This effect although small, is highly reproducible. Transfection of

pCDNA3-TLE1 and the pTK-PRH reporter alone does not decrease reporter activity,

and if anything there is an increase in promoter activity (Fig. 4A, compare columns 1

and 4). This data suggests that TLE1 can co-repress transcription, albeit weakly, with

PRH in transient transfection assays.

There are a number of possible reasons why we might not observe very strong

co-repression between PRH and TLE1 in transient transfection assays. K562 cells

22


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

strongly express several TLE family members (TS and PSJ unpublished observations)

and one possibility is that transfection of the TLE1 plasmid into K562 cells does not

strongly increase the amount of TLE1 proteins in the cells available to interact with

PRH. A complementary approach to examine co-repression between PRH and TLE

proteins in these cells is to remove endogenous TLE proteins and measure any effects

on PRH activity. Several studies have shown that Grg5, a naturally occurring protein

that is related to the first 200 amino acids of Groucho/TLE, can tetramerise with TLE

proteins and function as a dominant negative regulator (32;32-34;34). We therefore

examined whether we could relieve repression by PRH by using Grg5 to titrate out

endogenous TLE proteins. Transfection of 100ng of pMUG1-MycPRH decreases

pTK-PRH promoter activity to approximately 60% of its unrepressed activity

(Fig. 4B, compare columns 1 and 2). Co-transfection of Grg5 with PRH relieves

repression by PRH in a dose-dependent fashion. In the presence of 5µg pFlag-Grg5

reporter activity returns to approximately 75% of its unrepressed level (Fig. 4B, lanes

3-5). The presence of pFlag-Grg5 did not similarly increase reporter activity in the

absence of PRH (Fig. 4B, lanes 6-8). In fact, 5µg pFlag-Grg5 decreases reporter

activity in the absence of PRH to approximately 65-70% of its normal level.

However, Flag-Grg5 does not appear to significantly affect the activity of the viral

CMV promoter that is used to express both MycPRH and Flag-Grg5 (data not shown).

Thus, repression of the TK-PRH promoter by PRH can be relieved by co-expression

of Grg5. To examine whether Grg5 can itself interact with PRH in K562 cells, we

carried out co-immunoprecipitation studies using pMycPRH and pFlag-Grg5. We

were unable to demonstrate co-immunoprecipitation of Grg5 and PRH, although in a

parallel experiment TLE1 and PRH were co-immunoprecipitated under wash

conditions of the same stringency (data not shown). Thus, whilst we cannot rule out

23


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

the possibility that Grg5 might bind directly to PRH and inhibit PRH-dependent

repression, our experiments indicate that most likely, the titration of TLE proteins by

Grg5 results in decreased repression by PRH. We conclude that endogenous TLE

proteins do co-repress with PRH and that over-expressed TLE1 can co-repress with

PRH.

Mapping the TLE interaction motif in PRH

The human and avian PRH proteins are strongly conserved (1) and both

proteins contain an Eh-1 motif within the first 60 amino acids of the PRH N terminus

(Fig. 5A). To determine whether this motif is required for the interaction of TLE

proteins with PRH we made use of three avian GST-PRHN fusion proteins in in vitro

binding assays. The N-terminus of avian PRH (amino acids 1-141) or N-terminal

fragments of avian PRH (amino acids 1-125 and 61-141) were expressed in bacteria

as GST fusion proteins and purified. In vitro transcription and translation was used to

produce labelled TLE1 and binding assays were carried out as described above.

Figure 5B shows that labelled TLE1 binds to the GST-PRHN 1-141 (lane 3) and GST-

PRHN 1-125 (lane 5) fusion proteins but does not bind to GST-PRHN 61-141 (lane 4) or to

GST alone (lane 2). These data confirm the interaction data in yeast which showed

that the ‘Runt/Hairy’ motif is not required for the PRH-TLE interaction. Furthermore,

these data strongly suggest that the Eh-1 domain located within the first 60 amino

acids of PRH is required for the interaction. To confirm these in vitro binding studies

we determined whether the purified GST-PRHN deletion proteins are able to bind to

endogenous TLE proteins in pull-down experiments. Bound proteins were probed

with pan TLE rat monoclonal antibody or with a mouse monoclonal antibody raised

against the C8 subunit of the proteosome. Figure 5C shows that endogenous TLE

24


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

proteins bind to GST-PRHN 1-141 (lane 3) and GST-PRHN 1-125 (lane 5) but do not bind

to GST-PRHN 61-141 (lane 4) or GST alone (lane 2). In contrast with this, Figure 5C

shows that another PRH interacting protein, proteosome subunit C8 binds to GST-

PRHN 1-141 (lane 3), GST-PRHN 1-125 (lane 5) and GST-PRHN 61-141 (lane 4) but not to

GST alone (lane 2). Thus whilst all the fusion proteins appear to be functional for

protein-protein interactions with C8, the GST-PRHN fusion protein lacking the first 60

amino acids of PRH is unable to interact with endogenous TLE proteins.

To establish whether the Eh-1 motif in PRH is responsible for the interaction

of PRH with TLE, we mutated phenylalanine 32 to glutamic acid (F32E) in the Myc-

tagged Human PRH mammalian expression plasmid pMUG1-MycPRH to create

pMUG1-MycPRHF32E. This amino acid is the most conserved within the Eh-1 motif

and changing this amino acid to glutamic acid has previously been shown to abolish

the interaction of the homeodomain proteins Goosecoid and Engrailed with Groucho

(49;58). The wild type human PRH N terminus (amino acids 1-132) and the mutated

PRH N terminus were transferred to a GST expression vector and GST-PRHN1-132 and

GST-PRHN1-132 F32E fusion proteins were expressed in bacteria and purified. In vitro

binding assays were carried out with these fusion proteins and in vitro transcribed and

translated TLE1 as described above. Figure 5D shows that labelled TLE1 binds to the

human GST-PRHN1-132 (lane 3) but binds only very weakly, if at all, to GST-PRHN 1-

132 F32E (lane 4) or to GST alone (lane 2). Pull-down experiments were also carried

out as described above with these fusion proteins and K562 nuclear extracts. Figure

5E shows that endogenous TLE proteins bind to the human GST-PRHN1-132 (lane 2)

but binds only very weakly, if at all, to GST-PRHN 1-132 F32E (lane 3) or to GST alone

(lane 1). In contrast, Figure 5E shows that proteosome subunit C8 binds to GST-

PRHN1-132 (lane 2) and GST-PRHN 1-132 F32E (lane 3) but binds only very weakly, if at

25


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

all, to GST alone (lane 1). Thus we conclude that the Eh-1 domain in PRH mediates

the interaction between PRH and TLE proteins present in K562 cells.

To confirm that the Eh-1 domain mediates the interaction between PRH and

TLE1 that occurs during co-repression of the TK promoter, we carried out transient

co-transfection assays. The pTK-PRH reporter and the control reporter plasmid pSV-

β-gal were transiently transfected into K562 cells with 100ng of pMUG1-

MycHPRHF32E. Figure 5F shows that pMUG1-MycHPRHF32E decreases pTK-PRH

promoter activity to approximately 60% of its unrepressed activity (compare columns

1 and 2). However, co-transfection of 200ng of the TLE1 expression plasmid

pCDNA3- TLE1 with pMUG1- MycHPRHF32E does not result in increased repression

by PRHF32E (Fig. 5F, compare columns 2 and 3). This data suggests that the Eh-1

domain mediates the interaction between PRH and TLE1 in vivo.

26


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

DISCUSSION

We have shown previously that the PRH N-terminal region contains a

transcriptional repression domain with potential Groucho/TLE interaction motifs (21).

Here we have demonstrated that PRH interacts with TLE proteins in haematopoietic

cells, in yeast and in vitro and that an Eh-1 motif in the PRH N-terminal region

mediates the interaction of these proteins. It has been documented previously that

Grg5 binds to TLE proteins and functions as a trans-dominant negative (32-34). We

have shown that titration of endogenous TLE proteins by Grg5 results in decreased

transcriptional repression by PRH suggesting that PRH and TLE associate in cells.

Furthermore over-expression of TLE1 increases repression by PRH but does not

increase repression by a PRH protein containing a mutation in the Eh-1 motif that

eliminates binding to TLE1 in vitro. Taken together, these observations strongly

suggest that PRH and TLE proteins interact in K562 haematopoietic cells and that

TLE proteins function as co-repressors for PRH. It is of interest to note that the PRH

F32E mutation does not significantly decrease the ability of PRH to repress

transcription in transient transfection assays. This situation is similar to that reported

by Tolkunova et al., for Engrailed (En) (48). En has multiple repression domains and

repression mechanisms. En interacts with the Groucho co-repressor and the

interaction is essential for full repression in Drosophila embryos but the Eh-1 F to E

mutation in En resulted in less than a 10% reduction of En repression activity in

standard transient transfection assays (48). Like En, PRH has several repression

mechanisms and therefore the full effect of this mutation might only be clearly seen in

genomic DNA in the natural in vivo context.

Groucho/TLE-dependent repressors have been found to function as long-range

repressors, that is, they block promoter function in a distance and orientation-

27


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

independent manner. The ability to recruit TLE proteins to a promoter represents an

important mechanism for PRH-dependent transcriptional repression. There are at least

two domains in Groucho/TLE proteins that are known to interact with DNA bound

transcription factors: the N-terminal Q domain and the C-terminal WD-repeat domain.

The Q domain (amino acids 1-135) is a tetramerisation domain that is essential for

transcriptional repression (23;30) and sufficient for the interaction of TLE with the

transcription factors TCF and Blimp-1 (PRD1-BF1) (32). In contrast with the

interaction of TLE proteins with TCF and Blimp-1, the WD-repeat domain in

Groucho is essential and sufficient for direct interactions with the Engrailed and Hairy

transcription factors (59). However, the Q and WD-repeat domains in TLE1 are both

involved in interactions of TLE proteins with the Runt-related transcription factor

RUNX2/Cbfa1 and the winged-helix protein BF-1 (60;61). Similarly, we have shown

that the PRH N-terminal domain interacts with both the Q domain and the WD-repeat

domain in TLE1. It has been suggested that the employment of several TLE protein-

protein interactions domains allows greater specificity of interaction (62).

Alternatively, the use of more than one TLE protein-protein interaction domain might

confer greater stability to a TLE-PRH complex. Certainly the stable interaction of

another homeodomain protein, Pax5, with TLE proteins requires two separate

domains in TLE1 and two separate domains in Pax5 (63).

Although the TLE proteins were not originally identified in the haematopoietic

compartment, it has become apparent that TLE proteins interact with a number of

transcription activator proteins that are found in haematopoietic cells, including the

human Runt domain protein, AML1 (also known as RUNX-1/CEBP-2/

PEBP2)(27;64), T-cell factor (TCF) also known as Lymphoid Enhancer Factor (LEF-

1) (64), and the B-cell specific factors PRDI-BF1 and Pax5 (32;63). In each case the

28


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

interaction of the transcription activator with TLE proteins results in transcriptional

repression. Thus, TLE proteins are likely to be co-repressors for PRH in a number of

haematopoietic lineages. In addition, both PRH and TLE are expressed in a variety of

tissues in the developing embryo. PRH is expressed in the pre-gastrulation embryo

and is one of the earliest markers for dorsoventral patterning (4). Later, in the early

embryo, PRH is expressed in the anterior endoderm (head organiser region) adjacent

to tissues expressing the Goosecoid homeodomain protein (15), that co-represses

transcription with TLE proteins (49). Interestingly, PRH is essential for forebrain

development (16) and TLE proteins have been implicated in neuronal differentiation

(65) and dorsoventral patterning of the neural tube (66). Expression of PRH has also

been detected in endothelial precursor cells (4;67) and in osteoblasts (3). TLE

expression occurs post-gastrulation in mesoderm derivatives that go on to produce the

endothelial cells of the lining of the heart, muscle, and bone (25). In Drosophila

Groucho is part of the Notch signalling cascade. It is believed that the role of this

signalling pathway is to bring about a halt in embryonic neurogenesis so that cells that

were committed to become neuroblasts are made competent to enter the epidermal

lineage instead (68). Studies with TLE proteins have shown that they play a similar

developmental role (25). TLE expression is elevated in undifferentiated or

transformed epithelial cells and down-regulated as epithelial cells differentiate. This

suggests that TLE proteins are involved in the maintenance of the undifferentiated

state (69). Significantly, Notch signalling also plays a fundamental role in

haematopoietic development; in general Notch signalling promotes self-renewal and

inhibits differentiation (70). PRH is found in haematopoietic and endothelial

progenitors (3;4), and a variety of tissues derived from endoderm including thyroid

and liver (5). However PRH is absent in terminally differentiated haematopoietic cells

29


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

and/or endothelial cells (3;4). Furthermore, our studies on myeloid stem cells have

shown that PRH expression is down-regulated during differentiation of early myeloid

progenitors towards myeloblasts or erythrocytes (6). Thus, PRH expression is

associated with the undifferentiated state in haematopoietic and endothelial cells.

Here we have shown that undifferentiated haematopoietic blasts contain nuclear PRH

and TLE proteins. It is tempting to speculate that the interplay of TLE proteins and

PRH in these cells contributes to the control of cell differentiation. Further work will

be required to reveal in what other cell types TLE proteins act as co-repressor proteins

for PRH and the importance of the TLE1-PRH interaction in differentiation and

development.

30


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

AKNOWLEDGEMENTS

With many thanks to Dr. Kevin Gaston for comments on the manuscript and for

many useful discussions. Thanks also to Dr. Mark Jepson for help with the confocal

laser microscope studies at the Bristol University MRC Cell Imaging Facility. K. L.

Bess and T. E. Swingler were supported by B.B.S.R.C. studentships. Dr. S. Stifani is

a Scholar of the Fonds de la Recherche en Sante du Quebec. Dr. P. -S. Jayaraman is

grateful to the MRC for a Career Development Award.

31


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

FIGURE LEGENDS

Figure 1 TLE1 binds to PRH in yeast cells.

(A) A schematic representation of the PRH and TLE1 proteins (not to scale). (B) Top-

A schematic of the interacting fusion proteins GAL4DBD-TLE1 and GAL4AD-PRH

at the GAL4 UAS. Below- A bar chart of the β-galactosidase activity obtained after

transformation with (1) pACT2-PRH and pAS2-1, (2) pACT2 and pGBT9-TLE1, and

(3) pACT2-PRH and pGBT9-TLE1. The experiment was performed several times and

the results of one experiment performed in triplicate are shown. The data is presented

as the mean and standard error. (C) Top- A schematic of the fusion proteins

GAL4DBD-PRHN and GAL4AD-TLE1 at the GAL4 UAS. Below- Growth

phenotypes on -LT media, -HLT (+ 50mM 3AT) media, -LT (+ 0.2% 5FOA) media,

and β-galactosidase activity of yeast transformants in a colony-lift assay (X-gal). The

sectors contain: (1) pAS2-1 and pGAD424, (2) pAS2-1 and pGADTLE1, (3) pAS2-1

and pGADTLE1 WD, (4) pAS2-1 and pGADTLE1 Q, (5) pAS2-1 and pGADTLE1

Q-SP (6) pAS2-1-PRHN1-98 and pGAD424, (7) pAS2-1-PRHN1-98 and pGADTLE1, (8)

pAS2-1-PRHN1-98 and pGADTLE1 WD, (9) pAS2-1-PRHN1-98 and pGADTLE1 Q,

(10) pAS2-1-PRHN1-98 and pGADTLE1 Q-SP.

Figure 2 PRH and TLE expression in K562 cells.

(A) Endogenous TLE staining of K562 cells using a FITC labelled pan-TLE antibody

(low magnification x40). (B) DNA staining of the same cells with DAPI. (C)

Endogenous PRH staining of the same cells using a TRITC labelled anti-PRH mouse

polyclonal antibody. (D) Co-immunofluoresence of endogenous PRH and TLE

proteins using TRITC labelled anti-PRH mouse polyclonal antibodies and FITC

labelled pan-TLE rat monoclonal antibodies. (E) High magnification (x100)

32


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

brightfield image of a single K562 cell. (F) Endogenous PRH in the nucleus and

cytoplasm of the same cell (FITC staining). (G) Endogenous TLE in the nucleus of

the same cell (TRITC staining). (H) Co-immunofluoresence of endogenous PRH and

TLE proteins in the same cell. (I) High magnification (x100) brightfield view of

transfected K562 cells. (J) Transfected MycPRH (TRITC staining). (K) Transfected

TLE1 (FITC staining). (L) Co-localisation of TLE1 with MycPRH in the transfected

cell.

Figure 3 TLE proteins binds to PRH in vitro and in vivo.

(A) In vitro transcribed and translated TLE1 (1) was incubated with glutathione beads

coated with GST (2), GST-Human PRHN (3), or GST-Avian PRHN (4). Bound

proteins were eluted using glutathione, separated by SDS-PAGE and visualised using

fluorography and a PhosphorImager. (B) Lane 1 shows a Western analysis of

endogenous TLE proteins in K562 cell nuclear extract. Lanes 2 and 3 show a Western

blot of endogenous TLE binding to glutathione beads coated with GST alone or GST-

Human PRHN, respectively. The sizes of marker proteins are indicated. (C) Lane 1

shows a Western of Flag-tagged TLE1 in K562 cell nuclear extract made after

transfection with pCMV2-FLAGTLE1 and pMug1-MycPRH. Lanes 2 and 3 show

TLE1 in the same extract after immunoprecipitation with Protein G beads (2) or

Protein G beads and Myc9E10 antibody (3). The blot was probed with an anti-Flag

antibody. Lane 4 is exactly as lane 3 except that all incubations and washes were

performed in the presence of 0.4 mg/ml Ethidium bromide. (D) Lane 1 shows a

Western of endogenous TLE proteins in K562 cell nuclear extract made after

transfection with pMug1-MycPRH. Lane 2 shows endogenous TLE proteins in

nuclear extract from untransfected cells after immunoprecipitation with Protein G

33


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

beads and Myc9E10 antibody. Lanes 3 and 4 show endogenous TLE proteins in the

nuclear extract from transfected cells after immunoprecipitation with Protein G beads

or Protein G beads and Myc9E10 antibody.

Figure 4 PRH and TLE proteins co-repress transcription.

(A) K562 cells were transiently transfected with 5µg of a luciferase reporter plasmid

(pTK-PRH) containing 5 PRH binding sites upstream of the minimal TK promoter (1-

4). pMug1-MycPRH (100ng) was co-transfected into the same cells either alone or

together with pCDNA3-TLE1 (200ng), (2) and (3), respectively. Luciferase activity

was normalised for transfection efficiency using a co-transfected plasmid expressing

β-galactosidase. The data is presented as promoter activity relative to the reporter

alone and the values represent the mean and standard error of at least three

experiments. (B) K562 cells were transiently transfected with 5µg pTK-PRH (1-8).

100ng of a PRH expression vector (pMug1-MycPRH) was co-transfected into the

same cells (2-5) with 0.5µg (3), 1µg (4) or 5µg (5) of the Grg5 expression vector

pFlag-Grg5. As a control the same amounts of pFlag-Grg5 were transfected into K562

cells in the absence of PRH (6-8). Luciferase activity is normalised and presented

exactly as in (A).

Figure 5 The PRH Eh-1 motif mediates interaction and co-repression with TLE

proteins

(A) A schematic representation of the PRH proteins showing the putative Eh-1 motif

located between amino acids 30 and 39. (B) In vitro transcribed and translated TLE1

(1) was incubated with glutathione beads coated with GST (2), GST-PRHN 1-141 (3),

GST-PRHN 61-141 (4), or GST-PRHN 1-125 (5). Bound proteins were eluted using

34


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

glutathione, separated by SDS-PAGE and visualised using fluorography and a

PhosphorImager. (C) The top panel shows a pull-down experiment using GST-PRH

proteins and the endogenous TLE proteins from K562 cell nuclear extract after

Western blotting with the pan-TLE antibody. The bottom panel shows the same

membrane after stripping and reprobing with an HC8 antibody. (D) In vitro

transcribed and translated TLE1 (1) was incubated with glutathione beads coated with

GST (2), GST-PRHN 1-141 (3), or GST-PRHN 1-141 F32E (4). Bound proteins were

eluted and visualised as above. (E) The top panel shows a pull-down experiment using

GST-PRHN 1-141 and GST-PRHN 1-141 F32E and the endogenous TLE proteins from

K562 cell nuclear extract after Western blotting with a TLE antibody. The bottom

panel shows that same membrane after stripping and reprobing with an HC8 antibody.

(F) K562 cells were transiently transfected with 5µg of pTK-PRH (1-4). pMug1-

MycPRH F32E (100ng) was co-transfected into the same cells either alone or together

with pCDNA3-TLE1 (200ng), (2) and (3), respectively. Luciferase activity is

normalised and presented exactly as in Figure 4.

35


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

REFERENCESReferences

1. Crompton, M. R., Bartlett, T. J., MacGregor, A. D., Manfioletti, G., Buratti, E., Giancotti, V., and Goodwin, G. H. (1992) Nucleic.Acids.Res. 20, 5661-5667

2. Bedford, F. K., Ashworth, A., Enver, T., and Wiedemann, L. M. (1993) Nucleic.Acids.Res. 21, 1245-1249

3. Manfioletti, G., Gattei, V., Buratti, E., Rustighi, A., De Iuliis, A., Aldinucci, D., Goodwin, G. H., and Pinto, A. (1995) Blood 85, 1237-1245

4. Thomas, P. Q., Brown, A., and Beddington, R. S. (1998) Development 125, 85-94

5. Bogue, C. W., Ganea, G. R., Sturm, E., Ianucci, R., and Jacobs, H. C. (2000) Dev.Dyn. 219, 84-89

6. Jayaraman, P., Frampton, J., and Goodwin, G. (2000) Leuk.Res. 24, 1023-1031

7. Topcu, Z., Mack, D. L., Hromas, R. A., and Borden, K. L. (1999) Oncogene 18, 7091-7100

8. Guo, Y., Chan, R., Ramsey, H., Li, W., Xie, X., Shelley, W. C., Martinez-Barbera, J. P., Bort, B., Zaret, K., Yoder, M., and Hromas, R. (2003) Blood

9. Nakagawa, T., Abe, M., Yamazaki, T., Miyashita, H., Niwa, H., Kokubun, S., and Sato, Y. (2003) Arterioscler.Thromb.Vasc.Biol. 23, 231-237

10. Obinata, A., Akimoto, Y., Omoto, Y., and Hirano, H. (2002) Dev.Growth Differ. 44, 281-292

11. George, A., Morse, H. C., III, and Justice, M. J. (2003) Oncogene 22, 6764-6773

12. Hansen, G. M. and Justice, M. J. (1999) Oncogene 18, 6531-6539

13. Topisirovic, I., Culjkovic, B., Cohen, N., Perez, J. M., Skrabanek, L., and Borden, K. L. (2003) EMBO J. 22, 689-703

14. Topisirovic, I., Guzman, M. L., McConnell, M. J., Licht, J. D., Culjkovic, B., Neering, S. J., Jordan, C. T., and Borden, K. L. (2003) Mol.Cell Biol. 23, 8992-9002

15. Brickman, J. M., Jones, C. M., Clements, M., Smith, J. C., and Beddington, R. S. (2000) Development 127, 2303-2315

16. Martinez Barbera, J. P., Clements, M., Thomas, P., Rodriguez, T., Meloy, D., Kioussis, D., and Beddington, R. S. (2000) Development 127, 2433-2445

36


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

17. Tanaka, T., Inazu, T., Yamada, K., Myint, Z., Keng, V. W., Inoue, Y., Taniguchi, N., and Noguchi, T. (1999) Biochem.J. 339, 111-117

18. Pellizzari, L., D'Elia, A., Rustighi, A., Manfioletti, G., Tell, G., and Damante, G. (2000) Nucleic Acids Res. 28, 2503-2511

19. Guiral, M., Bess, K., Goodwin, G., and Jayaraman, P. S. (2001) J.Biol.Chem. 276, 2961-2970

20. Puppin, C., D'Elia, A. V., Pellizzari, L., Russo, D., Arturi, F., Presta, I., Filetti, S., Bogue, C. W., Denson, L. A., and Damante, G. (2003) Nucleic Acids Res. 31, 1845-1852

21. Guiral, M., Bess, K., Goodwin, G., and Jayaraman, P. S. (2001) J.Biol.Chem. 276, 2961-2970

22. Bess, K. L., Swingler, T. E., Rivett, J., Gaston, K., and Jayaraman, P. S. (2003) Biochem.J. 374, 667-675

23. Courey, A. J. and Jia, S. (2001) Genes Dev. 15, 2786-2796

24. Dasen, J. S., Barbera, J. P., Herman, T. S., Connell, S. O., Olson, L., Ju, B., Tollkuhn, J., Baek, S. H., Rose, D. W., and Rosenfeld, M. G. (2001) Genes Dev. 15, 3193-3207

25. Dehni, G., Liu, Y., Husain, J., and Stifani, S. (1995) Mech.Dev. 53, 369-381

26. Eastman, Q. and Grosschedl, R. (1999) Curr.Opin.Cell Biol. 11, 233-240

27. Levanon, D., Goldstein, R. E., Bernstein, Y., Tang, H., Goldenberg, D., Stifani, S., Paroush, Z., and Groner, Y. (1998) Proc.Natl.Acad.Sci.U.S.A 95, 11590-11595

28. Chen, G. and Courey, A. J. (2000) Gene 249, 1-16

29. Pickles, L. M., Roe, S. M., Hemingway, E. J., Stifani, S., and Pearl, L. H. (2002) Structure.(Camb.) 10, 751-761

30. Chen, G., Nguyen, P. H., and Courey, A. J. (1998) Mol.Cell Biol. 18, 7259-7268

31. Grbavec, D., Lo, R., Liu, Y., and Stifani, S. (1998) Eur.J.Biochem. 258, 339-349

32. Ren, B., Chee, K. J., Kim, T. H., and Maniatis, T. (1999) Genes Dev. 13, 125-137

33. Roose, J., Molenaar, M., Peterson, J., Hurenkamp, J., Brantjes, H., Moerer, P., van de, W. M., Destree, O., and Clevers, H. (1998) Nature 395, 608-612

34. Wang, J. C., Waltner-Law, M., Yamada, K., Osawa, H., Stifani, S., and Granner, D. K. (2000) J.Biol.Chem. 275, 18418-18423

37


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

35. Chen, G., Fernandez, J., Mische, S., and Courey, A. J. (1999) Genes Dev. 13, 2218-2230

36. Boddy, M. N., Freemont, P. S., and Borden, K. L. (1994) Trends Biochem.Sci. 19, 198-199

37. Choi, C. Y., Kim, Y. H., Kwon, H. J., and Kim, Y. (1999) J.Biol.Chem. 274, 33194-33197

38. Palaparti, A., Baratz, A., and Stifani, S. (1997) J.Biol.Chem. 272, 26604-26610

39. Yu, X., Li, P., Roeder, R. G., and Wang, Z. (2001) Mol.Cell Biol. 21, 4614-4625

40. Zhang, H. and Emmons, S. W. (2002) Genetics 160, 799-803

41. Tetsuka, T., Uranishi, H., Imai, H., Ono, T., Sonta, S., Takahashi, N., Asamitsu, K., and Okamoto, T. (2000) J.Biol.Chem. 275, 4383-4390

42. Gossen, M. and Bujard, H. (1992) Proc.Natl.Acad.Sci.U.S.A 89, 5547-5551

43. Grbavec, D., Lo, R., Liu, Y., Greenfield, A., and Stifani, S. (1999) Biochem.J. 337, 13-17

44. Fields, S. and Song, O. (1989) Nature 340, 245-246

45. Stifani, S., Blaumueller, C. M., Redhead, N. J., Hill, R. E., and Artavanis-Tsakonas, S. (1992) Nat.Genet. 2, 343

46. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic.Acids.Res. 11, 1475-1489

47. Dorn, A., Benoist, C., and Mathis, D. (1989) Mol.Cell Biol. 9, 312-320

48. Tolkunova, E. N., Fujioka, M., Kobayashi, M., Deka, D., and Jaynes, J. B. (1998) Mol.Cell Biol. 18, 2804-2814

49. Jimenez, G., Verrijzer, C. P., and Ish-Horowicz, D. (1999) Mol.Cell Biol. 19, 2080-2087

50. Aronson, B. D., Fisher, A. L., Blechman, K., Caudy, M., and Gergen, J. P. (1997) Mol.Cell Biol. 17, 5581-5587

51. Paroush, Z., Finley, R. L., Jr., Kidd, T., Wainwright, S. M., Ingham, P. W., Brent, R., and Ish-Horowicz, D. (1994) Cell 79, 805-815

52. Gehring, W. J., Affolter, M., and Burglin, T. (1994) Annu.Rev.Biochem. 63:487-526, 487-526

53. Vidal, M., Braun, P., Chen, E., Boeke, J. D., and Harlow, E. (1996) Proc.Natl.Acad.Sci.U.S.A 93, 10321-10326

38


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

54. Jayaraman, P. S., Frampton, J., and Goodwin, G. (2000) Leuk.Res. 24, 1023-1031

55. Koeffler, H. P. and Golde, D. W. (1980) Blood 56, 344-350

56. Husain, J., Lo, R., Grbavec, D., and Stifani, S. (1996) Biochem.J. 317 ( Pt 2), 523-531

57. Lai, J. S. and Herr, W. (1992) Proc.Natl.Acad.Sci.U.S.A 89, 6958-6962

58. Smith, S. T. and Jaynes, J. B. (1996) Development 122, 3141-3150

59. Jimenez, G., Paroush, Z., and Ish-Horowicz, D. (1997) Genes & Development 11, 3072-3082

60. McLarren, K. W., Lo, R., Grbavec, D., Thirunavukkarasu, K., Karsenty, G., and Stifani, S. (2000) J.Biol.Chem. 275, 530-538

61. Yao, J., Lai, E., and Stifani, S. (2001) Mol.Cell Biol. 21, 1962-1972

62. Du, Z., Cong, H., and Yao, Z. (2001) Biochem.Biophys.Res.Commun. 282, 701-706

63. Eberhard, D., Jimenez, G., Heavey, B., and Busslinger, M. (2000) EMBO J. 19, 2292-2303

64. Imai, Y., Kurokawa, M., Tanaka, K., Friedman, A. D., Ogawa, S., Mitani, K., Yazaki, Y., and Hirai, H. (1998) Biochem.Biophys.Res.Commun. 252, 582-589

65. Yao, J., Liu, Y., Lo, R., Tretjakoff, I., Peterson, A., and Stifani, S. (2000) Mech.Dev. 93, 105-115

66. Muhr, J., Andersson, E., Persson, M., Jessell, T. M., and Ericson, J. (2001) Cell 104, 861-873

67. Newman, C. S., Chia, F., and Krieg, P. A. (1997) Mech.Dev. 66, 83-93

68. Artavanis-Tsakonas, S., Rand, M. D., and Lake, R. J. (1999) Science 284, 770-776

69. Liu, Y., Dehni, G., Purcell, K. J., Sokolow, J., Carcangiu, M. L., Artavanis-Tsakonas, S., and Stifani, S. (1996) Genomics 31, 58-64

70. Ohishi, K., Katayama, N., Shiku, H., Varnum-Finney, B., and Bernstein, I. D. (2003) Semin.Cell Dev.Biol. 14, 143-150

39


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Figure 1

770

A

B

C

PRH N +TLE1 Q-SP

10 12

3

456

7

8

9

PRH N +TLE1 Q

PRH N +TLE1 WD

PRH N +TLE1

PRH N +pGAD424

V +pGAD424

V +TLE1

V + TLE1 WD

V + TLE1 Q

V +TLE1 Q-SP

1-LT

X-Gal-LT +0.2% 5-FOA

-HLT +50mM 3-AT

TLE1-AD

DBD-PRH N

REPORTERGAL UAS

lacZ / His

DBD-TLE1

PRH-AD

0

0.2

0.4

0.6

0.8

1.0

β -ga

lact

osid

ase

activ

ity( a

rbita

ry u

nits

)

1 2 3

REPORTERGAL UAS

lacZ

PRHRepression

1 137 197 270HD

1 137 197 270HD

TLE1

1 383128SP

- + + + - +

WD-repeatQ

DBD-TLE1PRH-AD


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Figure 2

2

3

1

42

3

1

4

2

3

1

4

2

3

1

4

2

3

1

4

A

C D

B

F HGE

J LKI


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Figure 3

10% INPUT

TLE1

GSTH C

GST-PRH N

1 2 3 4

A

C

B

D

Endog. TLE

+ + + PG beads+ - + α MycPRH- + + MycPRH

Westernblot

Co-IP

1 2 3 4

11666

1 2 3

Endog.TLE

Westernblot GST

GST-PRH N

Fl-TLE1

1 2 3 4

+ + + PG beads- + + α MycPRH- - + EtBr

Westernblot

Co-IP


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Figure 4

0

20

40

60

80

100

+ PRH

+ grg5 + grg5

Rel

ativ

e Pr

omot

er A

ctiv

ity (%

)

1 2 3 4 5 6 7 8

A

- PRH

A

B

0

20

40

60

80

100

Rel

ativ

e Pr

omot

er A

ctiv

ity (%

)

1 3 42--

PRH

TLE1

++

+-

-+


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Figure 5

A

C

E

TLE130%

INPUT GSTGST-PRH N

GST-PRH N

F32E

1 2 3 4

TLE1

B

D

F

TLE130%

INPUT GST

1 2 3 4 5

GST-PRH 1-141

GST-PRH 61-14

1

GST-PRH 1-125

TLE1

GSTK562 extract

1 2 3 4 5

Endog. TLE

GST-PRH 1-141

GST-PRH 61-14

1

GST-PRH 1-125

1 2 3 4 5

HC8*

GSTGST-PRH N

GST-PRH N

F32E

1 2 3

Endog.TLE

HC8*

1 2 3

TPFYIEDILG putative Eh-1 motif30 39

Repression

1 137 196 270

HD

1 137 270

HD

. .

- + + -- - + +

0

20

40

60

80

100

Relat

ive Pr

omote

r Acti

vity (

%)

PRH F32E TLE1

1 3 42


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

JayaramanTracey E. Swingler, Kirstin L. Bess, Jing Yao, Stefano Stifani and Padma-Sheela

groucho/TLE protein family to co-repress transcription in haematopoietic cellsThe proline-rich homeodomain (PRH) protein recruits members of the

published online June 7, 2004J. Biol. Chem.

10.1074/jbc.M404488200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M404488200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M404488200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/06/07/jbc.M404488200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/06/07/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/06/07/jbc.M404488200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

transcriptional repression by the proline rich homeodomain ... · the proline-rich homeodomain...

Documents