transcription the synthesis of a ribonucleic acid (rna) polymer from a deoxyribonucleic acid (dna)...
TRANSCRIPT
![Page 1: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/1.jpg)
Transcription• The synthesis of a ribonucleic acid (RNA) polymer from a
deoxyribonucleic acid (DNA) template
– Separates storage from use– Provides a control point for regulation– Amplification step (can make many RNA copies)
RNA DNA
H
5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGGAACCACCATGCT…-3’3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’
![Page 2: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/2.jpg)
Nucleic acid structure• Natural DNA adopts a linear double helical form
– complete complementary base-pairing between two strands
• RNA “transcripts” yield complex overall shapes– synthesized as single strands that fold back upon themselves– “folding’ is driven by base pairing
noteG:U pair
![Page 3: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/3.jpg)
![Page 4: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/4.jpg)
General outline of transcription (txn)• Transcription (Txn) process consists of 5 general steps
– BINDING• RNA polymerase (RNAp) binds to DNA in promoter region
– UNWINDING• Duplex DNA must be unwound to expose bases of template strand
– INITIATION• Polymerize nucleotides one at a time into complementary RNA strand
– ELONGATION• Disengage from “additional factors” and the promoter region to continue
transcript synthesis throughout full length of gene– TERMINATION
• Respond to “stop” signals at the end of the gene by stopping synthesis and releasing the RNA transcript product
![Page 5: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/5.jpg)
Binding
• RNA polymerase (RNAp) binds to DNA in Promoter region– Bind to specific sequences or “elements”
• Additional factors help RNAp recognize promoters– TXN factors
• General Txn Factors (GTFs): used at all promoters• Activators/Repressors: used at specific promoters
– Bind specific sequence “elements”– Directly or indirectly affect RNAp
Txnfactor RNAp
Co-factor
5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGGAACCACCATGCT…-3’3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’
![Page 6: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/6.jpg)
UNWINDING
• Duplex must be unwound to expose bases of template strand– Helicase: enzyme that unwinds duplex regions of
polynucleotides• DNA helicases act on DNA strands
– In txn (see below) and DNA replication (not covered)• RNA helicases act on RNA strands
– In a variety of settings, including transcriptional regulation
Txnfactor RNAp
Co-factor
5’-…TGAGTCACTGTACGCTATATAAGGC…GA3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’
TCGCCTCAGGAACCA
CATGCT…-3’C
![Page 7: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/7.jpg)
INITIATION
• Start polymerizing nucleotides one at a time into an RNA strand that is complementary to the template DNA strand– Template DNA is “read” in 3’ --> 5’ direction– The RNA transcript is synthesized in 5’ --> 3’ direction
RNAn + NTP --> RNAn+1 + pyrophosphate (PPi)
PPi --> 2 inorganic phosphate (Pi)– A short 10-12nt region of RNA-DNA hybrid is created and
maintained
Txnfactor RNAp
Co-factor
5’-…TGAGTCACTGTACGCTATATAAGGC…GA3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’
TCGCCTCAGGAACCA
GCCUCAGGAA-3’ CATGCT…-3’C
![Page 8: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/8.jpg)
![Page 9: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/9.jpg)
GCCUCAGGA
ELONGATION
• Disengagement of RNAp from various GTFs, cofactors and the promoter region is often called “Promoter Escape”
• After disengaging, RNAp continues transcript synthesis throughout full length of gene
• A short 10-12nt region of RNA-DNA hybrid is maintained• Transcribed region of DNA is allowed to re-anneal (close),
displacing the RNA strand• RNAp moves 3’ --> 5’ on the DNA template strand
– Note movement is 5’ --> 3’ on the non-template DNA strand
Txnfactor
Co-factor
5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGG3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’
AACCACCATGCT…-3’
ACCACCAUGC-3’
![Page 10: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/10.jpg)
![Page 11: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/11.jpg)
![Page 12: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/12.jpg)
CCAUGCU
TERMINATION
• Respond to “stop” signal sequences indicating the end of the gene– stop synthesis (a pause in the polymerization reaction)– release the RNA transcript product– Release RNAp from the DNA
5’-…CCATGCT CTTATGTACGTAGCGACT…-3’3’-…GGTACGATGTTATTTGATTTAATAATGGAATACATGCATCGCTGA…-5’
A CCAATAAACTAAATTATTA
AGAAUAAACU-3’
![Page 13: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/13.jpg)
Bacterial txn
• RNAp “core” enzyme (no promoter specificity)– 5 subunits capable of binding DNA & RNA synthesis
• Sigma factors target RNAp to different types of promoters – Sigma70 is for “housekeeping” and most other genes
-35 element “TTGACA”
-10 element “TATAAT”– Sigma32 is for “heat shock” genes
• Chaperone genes induced in response to excess heat
![Page 14: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/14.jpg)
BACTERIA:
• BIND
• UNWIND
• INITIATE• ELONGATE
without sigma
![Page 15: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/15.jpg)
BACTERIA
• TERMINATE– Rho-dependent
• Rho protein (helicase) unwinds RNA-DNA duplex causing release of finished RNA transcript
– Rho-independent• Rho protein is not required• DNA “terminator” sequence
causes RNAp to pause, release from DNA and release RNA transcript
Rho
![Page 16: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/16.jpg)
Txn in eukaryotes• Three different RNAp enzymes: RNApI, RNApII, RNApIII
• All eukaryotic RNAs require additional processing steps after synthesis to yield the mature RNA
• Primary RNA transcripts are often called “pre-RNAs”
![Page 17: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/17.jpg)
Txn in eukaryotes: RNApI• 100s of copies of the large ribosomal RNA (rRNA) genes in most genomes
– Large numbers needed to yield large amounts of RNA• Copies are grouped into clusters called rDNA
– For example, humans have 5 rDNA clusters– rDNA clusters are grouped within the nucleus to form the nucleoli
• Nucleoli are the site of rRNA synthesis, processing and ribosome assembly
18S 5.8S 28S 18S 5.8S 28S 18S 5.8S 28S
![Page 18: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/18.jpg)
Txn in eukaryotes: RNApI• RNApI molecules, densely packed on DNA template• Very high rate of rRNA synthesis• pre-rRNA must be processed to yield mature rRNA
18S 5.8S 28S 18S 5.8S 28S 18S 5.8S 28S
![Page 19: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/19.jpg)
Txn in eukaryotes: RNApIII• RNApIII can recognize as “promoter” sequences, regions
internal to the transcription unit– Specific General Transcription Factors (GTFs) enable promoter binding
• TFIIIA, TFIIIC
(Note, there are GTFs for RNApI also, TFIA, etc…)
RNAp
5’-…TACGCTGTCTAGGCGA3’-…ATGCGACAGATCCGCTAGCGGAGTCCTTGGTGGCATAGGAGTTAGGGA…-5’
TCGCCTCAGGAACCA
CGTATCCTCAATCCCT…-3’C
GTF
![Page 20: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/20.jpg)
Txn in eukaryotes: RNApIII• Transcribe 5S rRNA genes
– Product transported to nucleoli for processing/assembly into ribosomes• Transcribe tRNA genes
– Exist in genomic clusters– Clusters contain a variety of different tRNAs– Total number of tRNA genes can be very high
• (e.g. ~275 in yeast, ~1300 in humans)– Primary tRNA transcripts require processing to mature form
• Processing involves cutting and trimming reactions
![Page 21: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/21.jpg)
Txn in eukaryotes: RNApII• For messenger RNA (mRNA), microRNA (miRNA) genes
– 12 subunits = core RNApII enzyme– Promoter specificity requires 6 additional GTFs
• TFIID, TFIIA, TFIIB, TFIIF, TFIIE, TFIIH• TATA box, at -24 to -32 matches closely to “TATATAA”
– TFIID contains the TATA Binding Protein (TBP)
![Page 22: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/22.jpg)
RNApII txn
BIND
• TFIID, via TBP, binds TATA box DNA sequence
• TFIIA & TFIIB add next, assemble with some DNA sequence selectivity
• A TFIIF-RNApII complex binds
• TFIIE & TFIIH bind to complete the “pre-initiation complex”
![Page 23: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/23.jpg)
![Page 24: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/24.jpg)
RNApII txn
UNWIND
• TFIIH contains a helicase subunit for unwinding the promoter region
INITIATE
• Synthesize 10-12nts
ELONGATE
• TFIIH contains two kinase subunits that phosphorylate the C-terminal Domain (CTD) of RNApII
CTD repeat: YSPTSPS
• Breaks contacts w/ promoter
![Page 25: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/25.jpg)
RNApII transcript processing• mRNA structure
– 5’-end is “capped”
• Capping enzymes bind to phospho-CTD of RNApII
• Unusual 5’ -- 5’ linkage of 7-methylG-PPP
• Protects 5’-end from exonucleases
• Enhances nuclear export
• Enhances mRNA tln
![Page 26: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/26.jpg)
RNApII transcript processing• mRNA structure
– 5’-untranslated region (UTR)• Regulation of translation (TLN) and stability
– Coding region• Sequence of nucleotides continuously encoding a protein• Also called an ‘open reading frame’ (ORF)
– 3’-UTR• Regulation of translation (TLN) and stability
![Page 27: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/27.jpg)
• mRNA structure– 3’-end is polyadenylated
• Requires a large protein complex– (e.g. CPSF, CStF)
• Recognizes 5’-AAUAAA-3’ sequence in primary transcript
• Cleaves pre-RNA ~20nt downstream of AAUAAA
• PolyA polymerase adds 50-250 adenosines at new 3’-end
– Protects 3’-end from exonucleases
TERMINATE• Recognition of AAUAAA coupled
with RNApII destabilization• Cleavage effectively releases
pre-RNA from RNApII• RNApII with reduced processivity
falls off DNA template
![Page 28: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/28.jpg)
RNApII transcript processing• Primary transcripts for protein coding genes (hnRNAs)
are much larger than their corresponding mRNAs
• Heteronuclear RNAs– Localized to the cell nucleus– Contain “exon” sequences– Contain “intron” sequences
• mRNAs– Localized to the cell cytoplasm– Contain only “exon” sequences
• RNA splicing– Removal of introns– Joining exons together
![Page 29: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/29.jpg)
RNApII transcript processing: splicing• Exons can be either protein coding or 5’-/3’-UTR sequences
– Exons contribute to the final mRNA product– ~150nts each
• Intervening sequences between exons are introns– Introns must be removed to yield the final mRNA product– ~3500nts each
![Page 30: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/30.jpg)
RNApII transcript processing: splicing• Specific RNA sequences demarcate the exon/intron borders
– Subunits of the “spliceosome” recognize these “exon junctions”
![Page 31: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/31.jpg)
• The spliceosome catalyzes two reactions that eliminate the intron and join upstream and downstream exons together
![Page 32: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/32.jpg)
![Page 33: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/33.jpg)
![Page 34: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/34.jpg)
• How does the cell machinery determine which exons to splice together?
– Which ones should be made?
Exon 1 Exon 2 Exon 3 Exon 4
Exon 1 Exon 2 Exon 3 Exon 4
Exon 1 Exon 3 Exon 4
Exon 1 Exon 2 Exon 4
??
?
?
![Page 35: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/35.jpg)
• Spliceosomes are assembling on pre-RNA during Elongation– Provides mechanism to avoid confusing which exons go together– Sequential assembly of spliceosomes as pre-RNA is synthesized helps
assure no exon/intron junctions are accidentally missed
![Page 36: Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control](https://reader035.vdocuments.us/reader035/viewer/2022070415/56649d095503460f949dbfd7/html5/thumbnails/36.jpg)
Alternative splicing• Not all exons have “ideal” exon/intron splicing sequences
– Not all are efficiently recognized by spliceosome
– Exonic Splicing Enhancer (ESE) sequences• Binding factors can promote use of an exon/intron junction
- ESE binding protein
+ ESE binding protein
Exon 1 ESE Exon 3 Exon 4
Exon 1 Exon 3 Exon 4
Exon 1 ESE Exon 3 Exon 4