Reports

Active promoters and enhancer elements are transcribed bi-directionally (Fig. 1A) (1–3). Although various models have been proposed for the roles of RNA species produced from these regulatory elements, their functions are not fully un-derstood (4–13). Evidence that some DNA-binding transcrip-tion factors (TFs) also bind RNA (14, 15) led us to consider the possibility that there might be a direct and general role for promoter-proximal and distal enhancer RNA in the binding and maintenance of TFs at regulatory elements.

We sequenced nascent transcripts (GRO-seq) in murine embryonic stem cells (ESCs) at great depth, which con-firmed that active promoters and enhancer elements are generally transcribed bi-directionally (Fig. 1B, fig. S1A, and table S1). We then focused our studies on the TF Yin-Yang 1 (YY1) because it is ubiquitously expressed in mammalian cells, plays key roles in normal development, and can bind RNA species in vitro (15, 16). ChIP-seq analysis in ESCs re-vealed that YY1 binds to both active enhancers and promot-ers, with some preference for promoters (Fig. 1, C and D, fig. S1, and table S2). In contrast, the pluripotency TF OCT4 preferentially occupies enhancers (fig. S1B). Consistent with this, YY1 sequence motifs were enriched at promoters, whereas OCT4 motifs were enriched at enhancers (fig. S1B). Neither YY1 nor OCT4 occupied the promoter-proximal se-quences of inactive genes (fig. S2). These results establish

that YY1 generally occupies ac-tive enhancer and promoter-proximal elements in ESCs.

We next investigated YY1 binding to RNA in vivo by using CLIP-seq in ESCs (figs. S3 and S4 and table S3). The results showed that YY1 binds RNA spe-cies at the active enhancer and promoter regions where it is bound to DNA (Fig. 1, C and D, and fig. S1C). At promoters, YY1 preferentially occupied RNA downstream rather than up-stream of transcription start sites (fig. S1B), consistent with YY1 motif distribution and evi-dence that upstream ncRNA is unstable (3, 17, 18). In similar experiments with OCT4, signifi-cant levels of RNA binding were not observed (fig. S5). These re-sults suggest that YY1 generally binds to RNA species transcribed from enhancers and promoters in vivo.

The DNA and RNA binding properties of YY1 were further investigated in vitro (Fig. 2 and figs. S6 to S8). Recombinant mu-

rine YY1 protein bound both DNA and RNA probes in elec-trophoretic mobility shift essays (EMSA), showing higher affinity for DNA than RNA. There was variation in the affin-ity of YY1 for different RNA sequences (fig. S8). The four YY1 zinc-fingers can bind DNA (19), but the portion of YY1 that interacts with RNA is unknown. The zinc-finger–containing C-terminal region and the N-terminal region of YY1 were purified and their DNA and RNA binding properties were further investigated (fig. S9). The zinc-finger region of YY1 bound to DNA, but not to RNA, whereas the N-terminal re-gion of YY1 bound to RNA (fig. S9). Furthermore, the DNA probe did not compete efficiently with the RNA probe for YY1 binding (figs. S7C and S8C). These results suggest that different regions of YY1 are responsible for binding to DNA and RNA.

The observation that YY1 binds to enhancer and promot-er-proximal elements and to RNA transcribed from those regions led us to postulate that nascent RNA contributes to stable TF occupancy at these regulatory elements (Fig. 3A). If this model is correct, then reduced levels of nascent RNA at promoters and enhancers might lead to reduced YY1 oc-cupancy at these sites. We briefly inhibited transcription elongation with the reversible inhibitor d-rybofuranosylbenzimidazole (DRB) to reduce RNA levels at promoters and enhancers without causing changes in the

Transcription factor trapping by RNA in gene regulatory elements Alla A. Sigova,1 Brian J. Abraham,1 Xiong Ji,1 Benoit Molinie,4 Nancy M. Hannett,1 Yang Eric Guo,1 Mohini Jangi,2,3* Cosmas C. Giallourakis,4 Phillip A. Sharp,2,3 Richard A. Young1,2† 1Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA. 2Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02142, USA. 3David H. Koch Institute for Integrative Cancer Research, Cambridge, MA 02140, USA. 4Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114, USA.

*Present address: Biogen, Cambridge, MA 02142, USA.

†Corresponding author. E-mail: young@wi.mit.edu

Transcription factors (TFs) bind specific sequences in promoter-proximal and distal DNA elements in order to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA-binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF YY1 binds to both gene regulatory elements and also to their associated RNA species genome-wide. Reduced transcription of regulatory elements diminishes YY1 occupancy whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive feedback loop that contributes to the stability of gene expression programs.

/ www.sciencemag.org/content/early/recent / 29 October 2015 / Page 1 / 10.1126/science.aad3346

on October 11, 2020

http://science.sciencem

ag.org/D

ownloaded from

steady-state levels of YY1 (figs. S10 and S11). DRB treatment reduced transcription at promoters and enhancers and this caused small but significant decrease in the levels of YY1 at these regions (fig. S10). Super-enhancers are clusters of en-hancers that are highly transcribed (20), and DRB treatment had a profound effect on transcription at these sites (fig. S10). Similar results were observed with additional inhibi-tors (fig. S10). When transcription was allowed to resume after DRB removal, the levels of YY1 increased at promoters and enhancers (Fig. 3B and fig. S10A). These results suggest that nascent RNA produced at promoters and enhancers contributes to YY1 binding to these elements.

The exosome reduces the levels of enhancer RNAs once they are released from Pol II (degradation is 3′ to 5′) (21), so knockdown of an exosome component will cause an in-crease in untethered enhancer RNA, which might titrate some YY1 away from enhancers. Indeed, exosome knock-down led to increased steady state levels of enhancer RNAs and a decrease in the levels of YY1 bound to enhancers (Fig. 3C and fig. S12). These results are consistent with the model that YY1 binding to DNA is stabilized by binding to nascent RNA.

If YY1 binding to DNA is stabilized by its binding to RNA, then RNase treatment of chromatin should reduce YY1 occupancy. Chromatin was extracted from ESC nuclei and the levels of YY1 in the chromatin preparation were com-pared with and without RNase A treatment (Fig. 3D). The results show that the levels of YY1 bound to chromatin were significantly decreased when the chromatin preparation was treated with RNase, consistent with the idea that RNA con-tributes to the stability of YY1 in chromatin.

To test the idea that RNA near regulatory elements can contribute to stable TF occupancy in vivo, we tethered RNA in the vicinity of YY1 binding sites at six different enhancers in ESCs using the CRISPR/Cas9 system and determined whether the tethered RNA increases the occupancy of YY1 at these enhancers (Fig. 4). We generated stable murine ESC lines expressing both the catalytically inactive form of bac-terial endonuclease Cas9 (dCas9) and a fusion RNA com-posed of guide RNA (sgRNA), tracrRNA, and a 60-nt RNA derived from the promoter sequence of Arid1a compatible with YY1 binding in vitro (fig. S8). For controls, stable cell lines were created that express dCas9 and sgRNA fused to tracrRNA for the six enhancers. Tethering the Arid1a RNA at each enhancer led to increased binding of YY1 to the tar-geted enhancer as measured by ChIP-qPCR (Fig. 4B). This elevation in YY1 binding was specific to the targeted locus and the sequence of tethered RNA as there was no observa-ble increase in YY1 binding at the enhancers not targeted in the same cells (Fig. 4B) or targeted with tethered RNA not compatible with YY1 binding in vitro (fig. S13). These results show that RNA tethered near regulatory elements in vivo can enhance the level of YY1 occupancy at these elements.

To corroborate the in vivo RNA tethering results, a com-petition EMSA was used to test whether tethered RNA in-

creases the apparent binding affinity of YY1 to its motif in DNA (fig. S14 and S15). A short 30-bp labeled DNA probe containing a consensus YY1 binding motif was incubated with recombinant murine YY1 protein in the presence of increasing concentrations of cold competitor DNA with tethered or untethered RNA, and the amount of radio-labeled DNA that remained bound was quantified (fig. S15). This analysis revealed that DNA containing tethered RNA outcompetes the DNA without tethered RNA for YY1 bind-ing. These results indicate that tethering RNA near the YY1 binding motif in DNA leads to increased binding of YY1 to DNA in vitro.

In summary, our results are consistent with the proposal that RNA enhances the level of YY1 occupancy at active en-hancer and promoter-proximal regulatory elements (Fig. 3A). We suggest that nascent RNA produced in the vicinity of enhancer and promoter elements captures dissociating YY1 via relatively weak interactions, which allows this TF to rebind to nearby DNA sequences, thus creating a kinetic sink that increases YY1 occupancy on the regulatory ele-ment. The observation that YY1 occupies active enhancers and promoters throughout the ESC genome where RNA is produced, coupled with evidence that YY1 is expressed in all mammalian cells, suggests that this model is general. There are additional DNA-binding TFs that can bind RNA (fig. S16) (14), so transcriptional control may generally involve a positive feedback loop, where YY1 and other TFs stimulate local transcription, and newly transcribed nascent RNA re-inforces local TF occupancy. This model helps explain why TFs occupy only the small fraction of their consensus motifs in the mammalian genome where transcription is detected and suggests that bidirectional transcription of active en-hancers and promoters evolved, in part, to facilitate trap-ping of TFs at specific regulatory elements. The model also suggests that transcription of regulatory elements produces a positive feedback loop that may contribute to the stability of gene expression programs in cells. The significance of this TF trapping mechanism in cellular regulation has yet to be established, but will be important for future study because much of disease-associated sequence variation occurs in enhancers (20, 22) and may thus affect both DNA and RNA sequences that interact with gene regulators.

REFERENCES AND NOTES 1. L. J. Core, J. J. Waterfall, J. T. Lis, Nascent RNA sequencing reveals widespread

pausing and divergent initiation at human promoters. Science 322, 1845–1848 (2008). Medline

2. A. C. Seila, J. M. Calabrese, S. S. Levine, G. W. Yeo, P. B. Rahl, R. A. Flynn, R. A. Young, P. A. Sharp, Divergent transcription from active promoters. Science 322, 1849–1851 (2008). Medline doi:10.1126/science.1162253

3. A. A. Sigova, A. C. Mullen, B. Molinie, S. Gupta, D. A. Orlando, M. G. Guenther, A. E. Almada, C. Lin, P. A. Sharp, C. C. Giallourakis, R. A. Young, Divergent transcription of long noncoding RNA/mRNA gene pairs in embryonic stem cells. Proc. Natl. Acad. Sci. U.S.A. 110, 2876–2881 (2013). Medline doi:10.1073/pnas.1221904110

4. T. K. Kim, M. Hemberg, J. M. Gray, A. M. Costa, D. M. Bear, J. Wu, D. A. Harmin, M. Laptewicz, K. Barbara-Haley, S. Kuersten, E. Markenscoff-Papadimitriou, D. Kuhl, H. Bito, P. F. Worley, G. Kreiman, M. E. Greenberg, Widespread

/ sciencemag.org/content/early/recent / 29 October 2015 / Page 2 / 10.1126/science.aad3346

on October 11, 2020

http://science.sciencem

ag.org/D

ownloaded from

transcription at neuronal activity-regulated enhancers. Nature 465, 182–187 (2010). Medline doi:10.1038/nature09033

5. D. Wang, I. Garcia-Bassets, C. Benner, W. Li, X. Su, Y. Zhou, J. Qiu, W. Liu, M. U. Kaikkonen, K. A. Ohgi, C. K. Glass, M. G. Rosenfeld, X. D. Fu, Reprogramming transcription by distinct classes of enhancers functionally defined by eRNA. Nature 474, 390–394 (2011). Medline doi:10.1038/nature10006

6. C. A. Melo, J. Drost, P. J. Wijchers, H. van de Werken, E. de Wit, J. A. F. Oude Vrielink, R. Elkon, S. A. Melo, N. Léveillé, R. Kalluri, W. de Laat, R. Agami, eRNAs are required for p53-dependent enhancer activity and gene transcription. Mol. Cell 49, 524–535 (2013). Medline doi:10.1016/j.molcel.2012.11.021

7. F. Lai, U. A. Orom, M. Cesaroni, M. Beringer, D. J. Taatjes, G. A. Blobel, R. Shiekhattar, Activating RNAs associate with Mediator to enhance chromatin architecture and transcription. Nature 494, 497–501 (2013). Medline doi:10.1038/nature11884

8. M. T. Lam, H. Cho, H. P. Lesch, D. Gosselin, S. Heinz, Y. Tanaka-Oishi, C. Benner, M. U. Kaikkonen, A. S. Kim, M. Kosaka, C. Y. Lee, A. Watt, T. R. Grossman, M. G. Rosenfeld, R. M. Evans, C. K. Glass, Rev-Erbs repress macrophage gene expression by inhibiting enhancer-directed transcription. Nature 498, 511–515 (2013). Medline doi:10.1038/nature12209

9. W. Li, D. Notani, Q. Ma, B. Tanasa, E. Nunez, A. Y. Chen, D. Merkurjev, J. Zhang, K. Ohgi, X. Song, S. Oh, H. S. Kim, C. K. Glass, M. G. Rosenfeld, Functional roles of enhancer RNAs for oestrogen-dependent transcriptional activation. Nature 498, 516–520 (2013). Medline doi:10.1038/nature12210

10. M. U. Kaikkonen, N. J. Spann, S. Heinz, C. E. Romanoski, K. A. Allison, J. D. Stender, H. B. Chun, D. F. Tough, R. K. Prinjha, C. Benner, C. K. Glass, Remodeling of the enhancer landscape during macrophage activation is coupled to enhancer transcription. Mol. Cell 51, 310–325 (2013). Medline doi:10.1016/j.molcel.2013.07.010

11. K. Mousavi, H. Zare, S. Dell’orso, L. Grontved, G. Gutierrez-Cruz, A. Derfoul, G. L. Hager, V. Sartorelli, eRNAs promote transcription by establishing chromatin accessibility at defined genomic loci. Mol. Cell 51, 606–617 (2013). Medline doi:10.1016/j.molcel.2013.07.022

12. A. Di Ruscio, A. K. Ebralidze, T. Benoukraf, G. Amabile, L. A. Goff, J. Terragni, M. E. Figueroa, L. L. De Figueiredo Pontes, M. Alberich-Jorda, P. Zhang, M. Wu, F. D’Alò, A. Melnick, G. Leone, K. K. Ebralidze, S. Pradhan, J. L. Rinn, D. G. Tenen, DNMT1-interacting RNAs block gene-specific DNA methylation. Nature 503, 371–376 (2013). Medline doi:10.1038/nature12598

13. K. Schaukowitch, J. Y. Joo, X. Liu, J. K. Watts, C. Martinez, T. K. Kim, Enhancer RNA facilitates NELF release from immediate early genes. Mol. Cell 56, 29–42 (2014). Medline doi:10.1016/j.molcel.2014.08.023

14. L. A. Cassiday, L. J. Maher III, Having it both ways: Transcription factors that bind DNA and RNA. Nucleic Acids Res. 30, 4118–4126 (2002). Medline doi:10.1093/nar/gkf512

15. Y. Jeon, J. T. Lee, YY1 tethers Xist RNA to the inactive X nucleation center. Cell 146, 119–133 (2011). Medline doi:10.1016/j.cell.2011.06.026

16. S. Gordon, G. Akopyan, H. Garban, B. Bonavida, Transcription factor YY1: Structure, function, and therapeutic implications in cancer biology. Oncogene 25, 1125–1142 (2006). Medline doi:10.1038/sj.onc.1209080

17. R. A. Flynn, A. E. Almada, J. R. Zamudio, P. A. Sharp, Antisense RNA polymerase II divergent transcripts are P-TEFb dependent and substrates for the RNA exosome. Proc. Natl. Acad. Sci. U.S.A. 108, 10460–10465 (2011). Medline doi:10.1073/pnas.1106630108

18. P. Preker, J. Nielsen, S. Kammler, S. Lykke-Andersen, M. S. Christensen, C. K. Mapendano, M. H. Schierup, T. H. Jensen, RNA exosome depletion reveals transcription upstream of active human promoters. Science 322, 1851–1854 (2008). Medline doi:10.1126/science.1164096

19. H. B. Houbaviy, A. Usheva, T. Shenk, S. K. Burley, Cocrystal structure of YY1 bound to the adeno-associated virus P5 initiator. Proc. Natl. Acad. Sci. U.S.A. 93, 13577–13582 (1996). Medline doi:10.1073/pnas.93.24.13577

20. D. Hnisz, B. J. Abraham, T. I. Lee, A. Lau, V. Saint-André, A. A. Sigova, H. A. Hoke, R. A. Young, Super-enhancers in the control of cell identity and disease. Cell 155, 934–947 (2013). Medline doi:10.1016/j.cell.2013.09.053

21. M. Lubas, P. R. Andersen, A. Schein, A. Dziembowski, G. Kudla, T. H. Jensen, The human nuclear exosome targeting complex is loaded onto newly synthesized RNA to direct early ribonucleolysis. Cell Reports 10, 178–192 (2015). Medline doi:10.1016/j.celrep.2014.12.026

22. M. T. Maurano, R. Humbert, E. Rynes, R. E. Thurman, E. Haugen, H. Wang, A. P. Reynolds, R. Sandstrom, H. Qu, J. Brody, A. Shafer, F. Neri, K. Lee, T. Kutyavin, S.

Stehling-Sun, A. K. Johnson, T. K. Canfield, E. Giste, M. Diegel, D. Bates, R. S. Hansen, S. Neph, P. J. Sabo, S. Heimfeld, A. Raubitschek, S. Ziegler, C. Cotsapas, N. Sotoodehnia, I. Glass, S. R. Sunyaev, R. Kaul, J. A. Stamatoyannopoulos, Systematic localization of common disease-associated variation in regulatory DNA. Science 337, 1190–1195 (2012). Medline doi:10.1126/science.1222794

23. W. A. Whyte, D. A. Orlando, D. Hnisz, B. J. Abraham, C. Y. Lin, M. H. Kagey, P. B. Rahl, T. I. Lee, R. A. Young, Master transcription factors and mediator establish super-enhancers at key cell identity genes. Cell 153, 307–319 (2013). Medline doi:10.1016/j.cell.2013.03.035

24. L. Wang, Y. Zhou, L. Xu, R. Xiao, X. Lu, L. Chen, J. Chong, H. Li, C. He, X. D. Fu, D. Wang, Molecular basis for 5-carboxycytosine recognition by RNA polymerase II elongation complex. Nature 523, 621–625 (2015). Medline doi:10.1038/nature14482

25. P. Vella, I. Barozzi, A. Cuomo, T. Bonaldi, D. Pasini, Yin Yang 1 extends the Myc-related transcription factors network in embryonic stem cells. Nucleic Acids Res. 40, 3403–3418 (2012). Medline doi:10.1093/nar/gkr1290

26. J. Kim, J. Chu, X. Shen, J. Wang, S. H. Orkin, An extended transcriptional network for pluripotency of embryonic stem cells. Cell 132, 1049–1061 (2008). Medline doi:10.1016/j.cell.2008.02.039

27. L. A. Boyer, K. Plath, J. Zeitlinger, T. Brambrink, L. A. Medeiros, T. I. Lee, S. S. Levine, M. Wernig, A. Tajonar, M. K. Ray, G. W. Bell, A. P. Otte, M. Vidal, D. K. Gifford, R. A. Young, R. Jaenisch, Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441, 349–353 (2006). Medline doi:10.1038/nature04733

28. R. Schmieder, R. Edwards, Quality control and preprocessing of metagenomic datasets. Bioinformatics 27, 863–864 (2011). Medline doi:10.1093/bioinformatics/btr026

29. J. Kim, A. B. Cantor, S. H. Orkin, J. Wang, Use of in vivo biotinylation to study protein-protein and protein-DNA interactions in mouse embryonic stem cells. Nat. Protoc. 4, 506–517 (2009). Medline doi:10.1038/nprot.2009.23

30. B. Langmead, C. Trapnell, M. Pop, S. L. Salzberg, Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25 (2009). Medline doi:10.1186/gb-2009-10-3-r25

31. Y. Zhang, T. Liu, C. A. Meyer, J. Eeckhoute, D. S. Johnson, B. E. Bernstein, C. Nusbaum, R. M. Myers, M. Brown, W. Li, X. S. Liu, Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 (2008). Medline doi:10.1186/gb-2008-9-9-r137

32. W. J. Kent, C. W. Sugnet, T. S. Furey, K. M. Roskin, T. H. Pringle, A. M. Zahler, D. Haussler, The human genome browser at UCSC. Genome Res. 12, 996–1006 (2002). Medline doi:10.1101/gr.229102

33. C. E. Grant, T. L. Bailey, W. S. Noble, FIMO: Scanning for occurrences of a given motif. Bioinformatics 27, 1017–1018 (2011). Medline doi:10.1093/bioinformatics/btr064

34. J. C. Bryne, E. Valen, M. H. Tang, T. Marstrand, O. Winther, I. da Piedade, A. Krogh, B. Lenhard, A. Sandelin, JASPAR, the open access database of transcription factor-binding profiles: New content and tools in the 2008 update. Nucleic Acids Res. 36 (suppl. 1), D102–D106 (2008). Medline doi:10.1093/nar/gkm955

35. A. Jolma, J. Yan, T. Whitington, J. Toivonen, K. R. Nitta, P. Rastas, E. Morgunova, M. Enge, M. Taipale, G. Wei, K. Palin, J. M. Vaquerizas, R. Vincentelli, N. M. Luscombe, T. R. Hughes, P. Lemaire, E. Ukkonen, T. Kivioja, J. Taipale, DNA-binding specificities of human transcription factors. Cell 152, 327–339 (2013). Medline doi:10.1016/j.cell.2012.12.009

36. C. Trapnell, L. Pachter, S. L. Salzberg, TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105–1111 (2009). Medline doi:10.1093/bioinformatics/btp120

37. L. Wang, S. Wang, W. Li, RSeQC: Quality control of RNA-seq experiments. Bioinformatics 28, 2184–2185 (2012). Medline doi:10.1093/bioinformatics/bts356

38. J. Lovén, D. A. Orlando, A. A. Sigova, C. Y. Lin, P. B. Rahl, C. B. Burge, D. L. Levens, T. I. Lee, R. A. Young, Revisiting global gene expression analysis. Cell 151, 476–482 (2012). Medline

39. C. Y. Lin, J. Lovén, P. B. Rahl, R. M. Paranal, C. B. Burge, J. E. Bradner, T. I. Lee, R. A. Young, Transcriptional amplification in tumor cells with elevated c-Myc. Cell 151, 56–67 (2012). Medline doi:10.1016/j.cell.2012.08.026

40. A. R. Quinlan, I. M. Hall, BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010). Medline doi:10.1093/bioinformatics/btq033

/ sciencemag.org/content/early/recent / 29 October 2015 / Page 3 / 10.1126/science.aad3346

on October 11, 2020

http://science.sciencem

ag.org/D

ownloaded from

41. E. Kopylova, L. Noé, H. Touzet, SortMeRNA: Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 28, 3211–3217 (2012). Medline doi:10.1093/bioinformatics/bts611

42. W. J. Kent, A. S. Zweig, G. Barber, A. S. Hinrichs, D. Karolchik, BigWig and BigBed: Enabling browsing of large distributed datasets. Bioinformatics 26, 2204–2207 (2010). Medline doi:10.1093/bioinformatics/btq351

43. M. Jangi, P. L. Boutz, P. Paul, P. A. Sharp, Rbfox2 controls autoregulation in RNA-binding protein networks. Genes Dev. 28, 637–651 (2014). Medline doi:10.1101/gad.235770.113

44. M. Martin, Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal 17, 10–12 (2011). doi:10.14806/ej.17.1.200

45. B. Langmead, S. L. Salzberg, Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359 (2012). Medline doi:10.1038/nmeth.1923

46. H. Li, B. Handsaker, A. Wysoker, T. Fennell, J. Ruan, N. Homer, G. Marth, G. Abecasis, R. Durbin; 1000 Genome Project Data Processing Subgroup, The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009). Medline doi:10.1093/bioinformatics/btp352

47. F. M. Cernilogar, M. C. Onorati, G. O. Kothe, A. M. Burroughs, K. M. Parsi, A. Breiling, F. Lo Sardo, A. Saxena, K. Miyoshi, H. Siomi, M. C. Siomi, P. Carninci, D. S. Gilmour, D. F. V. Corona, V. Orlando, Chromatin-associated RNA interference components contribute to transcriptional regulation in Drosophila. Nature 480, 391–395 (2011). Medline doi:10.1038/nature10492

48. A. C. Mullen, D. A. Orlando, J. J. Newman, J. Lovén, R. M. Kumar, S. Bilodeau, J. Reddy, M. G. Guenther, R. P. DeKoter, R. A. Young, Master transcription factors determine cell-type-specific responses to TGF-β signaling. Cell 147, 565–576 (2011). Medline doi:10.1016/j.cell.2011.08.050

49. H. Wang, H. Yang, C. S. Shivalila, M. M. Dawlaty, A. W. Cheng, F. Zhang, R. Jaenisch, One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910–918 (2013). Medline doi:10.1016/j.cell.2013.04.025

50. N. A. Kearns, R. M. Genga, M. S. Enuameh, M. Garber, S. A. Wolfe, R. Maehr, Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development 141, 219–223 (2014). Medline doi:10.1242/dev.103341

ACKNOWLEDGMENTS

We thank D. Orlando, C. Lin, V. Saint-André, Z. P. Fan, L. Zhang, and A. Chiu for help with computational analysis and advice. The lentiviral dCas9 and sgRNA expression plasmids are available from Addgene under the Uniform Biological Material Transfer Agreement. Supported by NIH HG002668 (R.A.Y.), the Hope Funds for Cancer Research (B.J.A.), the Cancer Research Institute (Y.E.G), and Biogen (R.A.Y.). The Whitehead Institute intends to file a patent application that relates to transcription factor trapping by RNA. R.A.Y. is a founder of Syros Pharmaceuticals.

SUPPLEMENTARY MATERIALS www.sciencemag.org/cgi/content/full/science.aad3346/DC1 Materials and Methods Figs. S1 to S16 Tables S1 to S3 References (25–50) 29 August 2015; accepted 14 October 2015 Published online 29 October 2015 10.1126/science.aad3346

/ sciencemag.org/content/early/recent / 29 October 2015 / Page 4 / 10.1126/science.aad3346

on October 11, 2020

http://science.sciencem

ag.org/D

ownloaded from

Fig. 1. YY1 binds to DNA and RNA at transcriptional regulatory elements. (A) Cartoon depicting divergent transcription at enhancers and promoters in mammalian cells. (B) Alignment of GRO-seq reads at all enhancers and promoters in ESCs. Enhancers were defined as in (23). The x-axis indicates distance from either the enhancer center (C) or the transcription start site (TSS) in kilobases. The y-axis indicates average density of uniquely mapped GRO-seq reads per genomic bin. (C) Gene tracks for the Arid1a gene and enhancer showing ChIP-seq and CLIP-seq data for bio-YY1 cells, as well as GRO-seq reads for mESCs. (D) Mean read density of YY1 ChIP-seq and CLIP-seq reads at enhancers and promoters of all RefSeq genes in ESCs.

/ sciencemag.org/content/early/recent / 29 October 2015 / Page 5 / 10.1126/science.aad3346

on October 11, 2020

http://science.sciencem

ag.org/D

ownloaded from

Fig. 2. YY1 binds to DNA and RNA in vitro. (A) Left panel: EMSA of YY1-DNA complexes at different concentrations of recombinant YY1. 5 nM of radioactively labeled 30-bp DNA probe derived from the promoter region of Arid1a gene containing a consensus YY1 binding motif (CTCTTCTCTCTTAAAATGGCTGCCTGTCTG) was incubated with increasing concentrations of recombinant murine YY1 protein. Right panel: EMSA of YY1-RNA complexes at different concentrations of recombinant YY1. 5 nM of radioactively labeled 30-nt RNA probe derived from the same region of the Arid1a gene was incubated with increasing concentrations of recombinant YY1 protein. (B) Graph depicting relationship between the fraction of radioactively labeled DNA or RNA probe bound and the concentration of recombinant YY1 in the binding reaction.

/ sciencemag.org/content/early/recent / 29 October 2015 / Page 6 / 10.1126/science.aad3346

on October 11, 2020

http://science.sciencem

ag.org/D

ownloaded from

Fig. 3. Perturbation of RNA levels affects YY1 binding to DNA. (A) Cartoon depicting hypothesis that RNA transcribed from regulatory elements enhances occupancy of these elements by TFs capable of binding both DNA and RNA. (B) (Top) GRO-seq reads (24) at promoters, enhancers, and super-enhancer constituents in cells before (DRB) and after release (Rel) from transcriptional inhibition by DRB. (Bottom) YY1 ChIP-seq reads at promoters, enhancers and super-enhancer constituents in cells before (DRB) and after release (Rel) from transcriptional inhibition by DRB. Increase in YY1 binding after release from DRB inhibition is significant: p-value < 3.6 × 10−207 for promoters, p-value < 1.6 × 10−214 for enhancers, p-value < 9.8 × 10−37 for super-enhancers. (C) (Top) Box plots depicting RNA-seq data for ribo-depleted total RNA at promoters, enhancers, and super-enhancers in ESCs after targeting with control (Ctrl) or Exosc3 (ExoKD) shRNA. (Bottom) Alignment of YY1 ChIP-seq reads at promoters, enhancers and super-enhancers in ESCs after targeting with control (Ctrl) or Exosc3 (ExoKD) shRNA. The decrease in YY1 binding in ExoKD ESCs is significant: p-value < 8.1 × 10−9 for promoters, p-value < 1.8 × 10−27 for enhancers, p-value < 3.3 × 10−5 for super-enhancers. (D) Western blot analysis of YY1, OCT4, and histone H3 levels in whole-cell extracts (WCE), nuclei (N), and a nuclear chromatin preparation before and after RNase A treatment. Histone H3 serves as a loading control and OCT4 serves as a negative control. Quantitation of the relative levels of YY1 and OCT4 are noted.

/ sciencemag.org/content/early/recent / 29 October 2015 / Page 7 / 10.1126/science.aad3346

on October 11, 2020

http://science.sciencem

ag.org/D

ownloaded from

Fig. 4. Tethering of RNA adjacent an YY1 DNA binding site enhances binding of YY1 to the genome in vivo. (A) Strategy for tethering of RNA in the vicinity of an YY1 binding site at enhancers in vivo. (B) ChIP-qPCR analysis of YY1 binding at six targeted (red) and three not targeted (blue) enhancers in three independent experiments. The y-axis indicates fold change in YY1 binding in ESCs expressing the sgRNA-Arid1a RNA fusion construct relative to cells expressing the control sgRNA targeted to the same locus. The difference in YY1 binding was significant for the targeted enhancers: Klf5 (p-value = 0.03), Suz12 (p-value = 0.01), E2f3 (p-value = 0.01), Nufip2 (p-value = 0.03), Cnot6 (p-value = 0.03), and Pias1 (p-value = 0.01), but not for the not targeted enhancers.

/ sciencemag.org/content/early/recent / 29 October 2015 / Page 8 / 10.1126/science.aad3346

on October 11, 2020

http://science.sciencem

ag.org/D

ownloaded from

Transcription factor trapping by RNA in gene regulatory elements

Giallourakis, Phillip A. Sharp and Richard A. YoungAlla A. Sigova, Brian J. Abraham, Xiong Ji, Benoit Molinie, Nancy M. Hannett, Yang Eric Guo, Mohini Jangi, Cosmas C.

published online October 29, 2015

ARTICLE TOOLS http://science.sciencemag.org/content/early/2015/10/28/science.aad3346

MATERIALSSUPPLEMENTARY http://science.sciencemag.org/content/suppl/2015/10/28/science.aad3346.DC1

REFERENCES

http://science.sciencemag.org/content/early/2015/10/28/science.aad3346#BIBLThis article cites 50 articles, 7 of which you can access for free

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

is a registered trademark of AAAS.ScienceScience, 1200 New York Avenue NW, Washington, DC 20005. The title (print ISSN 0036-8075; online ISSN 1095-9203) is published by the American Association for the Advancement ofScience

Copyright © 2015, American Association for the Advancement of Science

on October 11, 2020

http://science.sciencem

ag.org/D

ownloaded from