title (research brief) · 3/31/2018 · 1 title (research brief) response to erbb3-directed...

1

TITLE (RESEARCH BRIEF) Response to ERBB3-Directed Targeted Therapy in NRG1-Rearranged Cancers AUTHORS Alexander Drilon1,2, Romel Somwar1, Biju P. Mangatt3, Henrik Edgren4, Patrice Desmeules1, Anja Ruusulehto4, Roger S. Smith1, Lukas Delasos1, Morana Vojnic1, Andrew J. Plodkowski1, Joshua Sabari1, Kenneth Ng1, Joseph Montecalvo1, Jason Chang1, Huichun Tai1, William W. Lockwood5, Victor Martinez5, Gregory J. Riely1,2, Charles M. Rudin1,2, Mark G. Kris1,2, Maria E. Arcila1, Christopher Matheny3, Ryma Benayed1, Natasha Rekhtman1, Marc Ladanyi1, Gopinath Ganji3 AFFILIATIONS 1Memorial Sloan Kettering Cancer Center, 2Weill Cornell Medical Center, 3GlaxoSmithKline, 4MediSapiens, 5University of British Columbia, KEYWORDS: NRG1 rearrangement, NRG1 fusion, CD74-NRG1, HER3 monoclonal antibody, GSK2849330 FINANCIAL SUPPORT: AD, GJR, CMR, and MGK are supported by the National Institutes of Health by a National Cancer Institute Cancer Support Grant P30 CA008748, which did not directly fund study costs. NCT01966445 study was sponsored by GlaxoSmithKline CORRESPONDING AUTHOR: Alexander Drilon MD 885 2nd Avenue, NY, NY, 10017 Tel 646-888-4206, Fax 646-888-4263 Email: [email protected] DISCLOSURE STATEMENT AD has received consulting fees from Loxo Oncology, Exelixis, Blueprint Medicines and Ariad/Takeda and Beigene, consulting fees and honoraria from Astra Zeneca and honoraria from Roche/Genentech, and he has received grants from Foundation Medicine outside the submitted work; HE and AR are employees of MediSapiens Ltd and own shares and options in MediSapiens Ltd; GG, BM and CM are employees of GSK and hold GSK stock; MK reports grants from GSK, during the conduct of the study and personal fees from AstraZeneca, Ariad and Roche/Genentech; ML reports personal fees from NCCN, Astra-Zeneca, Bristol Myers Squibb, and Takeda, and grants from Loxo Oncology; GR reports receiving grant from GSK to the institution to support trial conduct and consulting fees and grants to institution for other clinical research from Genentech/Roche, Novartis and grants from Takeda and Pfizer to the institution for other clinical research; CR reports consulting fees from BMS, Araxes, Astra Zeneca, Celgene, Harpoon Therapeutics, G1 Therapeutics and Chugai; MA, RB, JC, LD, PD, WL, JM, VM, KN, AP, JS, RSS, RS, HT, NR, MV report no conflicting interests.

Research. on August 19, 2020. © 2018 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 2, 2018; DOI: 10.1158/2159-8290.CD-17-1004

mailto:[email protected]

http://cancerdiscovery.aacrjournals.org/

2

ABSTRACT

NRG1 rearrangements are oncogenic drivers that are enriched in invasive mucinous

adenocarcinomas (IMAs) of the lung. The oncoprotein binds ERBB3-ERBB2 heterodimers and

activates downstream signaling, supporting a therapeutic paradigm of ERBB3/ERBB2 inhibition.

As proof of concept, a durable response was achieved with anti-ERBB3 monoclonal antibody

therapy (GSK2849330) in an exceptional responder with an NRG1-rearranged IMA on a phase 1

trial (NCT01966445). In contrast, response was not achieved with anti-ERBB2 therapy (afatinib)

in four NRG1-rearranged IMA patients (including the index patient post-GSK2849330). While in

vitro data supported the use of either ERBB3 or ERBB2 inhibition, these clinical results were

consistent with more profound anti-tumor activity and downstream signaling inhibition with

anti-ERBB3 versus anti-ERBB2 therapy in an NRG1-rearranged patient-derived xenograft model.

Analysis of 8,984 and 17,485 tumors in The Cancer Genome Atlas and MSK-IMPACT datasets,

respectively, identified NRG1 rearrangements with novel fusion partners in multiple histologies,

including breast, head and neck, renal, lung, ovarian, pancreatic, prostate, and endometrial

cancers.




3

STATEMENT OF SIGNIFICANCE

This series highlights the utility of ERBB3 inhibition as a novel treatment paradigm for NRG1-

rearranged cancers. In addition, it provides preliminary evidence that ERBB3 inhibition may be

more optimal than ERBB2 inhibition. The identification of NRG1 rearrangements across various

solid tumors supports a basket trial approach to drug development.




4

INTRODUCTION

Oncogenic gene fusions or rearrangements are identified across a wide range of solid tumors

(1). Many of these events, such as fusions involving ALK, ROS1, RET, NTRK1/2/3, FGFR1/2/3, and

PDGFB are clinically actionable. In lung adenocarcinomas, targeted therapy for patients with

ALK- or ROS1-rearranged tumors is highly effective, and several tyrosine kinase inhibitors (TKIs)

are currently approved or being investigated for the treatment of these patients. Similarly,

dramatic and durable responses have been reported in NTRK1/2/3-rearranged solid tumors

regardless of histology (2), and in select cancers with FGFR1/2/3 or RET rearrangements (1).

Fusions involving the neuregulin-1 gene (NRG1) were identified by Fernandez-Cuesta and

colleagues in non-small cell lung cancers (NSCLCs) with an initially approximated frequency of

1.7% in lung adenocarcinomas (3). Transcriptome sequencing revealed fusion of CD74 to NRG1

exons encoding the NRG1 III-β3 isoform. Other fusions such as SLC3A2-NRG1 and SDC4-NRG1

have also been identified (4, 5). NRG1 fusions are particularly enriched in invasive mucinous

adenocarcinomas (IMAs) of the lung where they are found in 27-31% of cases. These are often

mutually exclusive with KRAS mutations, a driver known to be enriched in IMAs (4, 6-8).

Activating NRG1 rearrangements are drivers of cancer growth. NRG1 encodes several isoforms

that contain an epidermal growth factor (EGF)-like domain that serves as the ligand of the

receptor ERBB3 (9). Chimeric transmembrane proteins encoded by NRG1 fusions are predicted

to maintain this extracellular domain, thus activating ERBB3 in a para/juxtacrine or autocrine




5

fashion (10). NRG1 binding to ERBB3 results in heterodimerization of the latter with ERBB2,

activation of downstream signaling including the ERK, PI3K-AKT, and NF-kB pathways, and

increased tumor cell proliferation and growth (9, 11). Therefore, rational targeting of ERBB3 or

ERBB2 in NRG1-rearranged tumors could be efficacious (3).

In this paper, we provide proof of principle that targeting ERBB3 in NRG1-rearranged cancers

represents a novel therapeutic paradigm. In contrast, we demonstrate that targeting ERBB2 is

not as effective in patients in this series despite preclinical data supporting its use and

previously published clinical reports. Lastly, we present large-scale genomic profiling data

supporting a basket trial drug development approach for NRG1 rearrangements that extends

beyond NSCLCs to other cancers.

RESULTS

Outcomes with targeted therapy in patients with NRG1-rearranged lung cancers. An 86 year-

old man presented with recurrent, unresectable, advanced invasive mucinous adenocarcinoma

nine months after an initial resection and radiation for stage IIA (pT2bN0M0) disease. He was

treated with carboplatin and pemetrexed, followed by paclitaxel and bevacizumab (with a best

objective response of stable disease with both regimens), and finally nivolumab (with primary

progressive disease). Broad, hybrid capture-based next-generation sequencing using MSK-

IMPACT (12) identified an in-frame CD74-NRG1 translocation (Figure 1A) resulting in the fusion

of exons 1 to 6 of CD74 with exons 6 to 13 of NRG1; the only other alteration identified was an




6

ARID2 c.592A>T nonsense mutation. The patient was enrolled in a NSCLC expansion cohort of a

phase 1 trial (NCT01966445) of GSK2849330, an anti-ERBB3 monoclonal antibody (mAb).

GSK2849330 is a humanized mAb that binds with high affinity to the ERBB3 domain III where it

blocks the binding of NRG1 and inhibits receptor heterodimerization (13).

GSK2849330 was administered at the recommended phase 2 dose of 30 mg/kg weekly during

induction, followed by maintenance therapy of 30 mg/kg every two weeks. A confirmed partial

response to therapy was achieved, with substantial shrinkage of a right lower lobe mass (Figure

1B) accompanied by resolution of the patient’s dyspnea. While the maximal decrease in

measurable tumor burden by RECIST v1.1 was 32%, this underestimated total tumor shrinkage;

an exploratory volumetric analysis revealed a 90% reduction in tumor volume at the nadir. An

on-treatment tumor biopsy was performed on day 14 of therapy but little tumor tissue was

present, likely due to the robust response observed; pharmacodynamic changes could thus not

be assessed. The patient tolerated the drug with no major issues. The response was durable

and lasted 1 year and 7 months, exceeding the duration, in aggregate, of four prior systemic

therapies he received.

While GSK2849330 bears antibody-dependent cytotoxicity (ADCC) and complement-dependent

cytotoxicity (CDC) enhancements (13), no other responses were noted in the same trial

(NCT01966445, n=29), which enrolled several patients with similar and higher ERBB3

expression. None of these other tumors were known to harbor an NRG1 fusion. These data




7

strongly suggest that ADCC, CDC, or ERBB3 expression alone do not predict responses, and that

our index NRG1-rearranged patient was an exceptional responder to therapy.

In contrast to these outcomes, treatment with afatinib did not achieve a response in four

patients with NRG1-rearranged lung cancers. After progression of disease, the same patient

with a CD74-NRG1-rearranged lung cancer described above was immediately transitioned to

afatinib (40 mg daily). Repeat imaging after 8 weeks of therapy revealed progressive disease,

with an increase in the right basilar mass and paratracheal lymph node, and new satellite

nodules. In addition to this case, three other targeted therapy-naïve patients with NRG1-

rearranged lung cancers received afatinib at 40 mg daily, none of whom responded to therapy.

The clinicopathologic and molecular details of these three additional patients are summarized

in Table S1. The first patient with a CD74-NRG1 fusion had a best response of stable disease at

5 weeks (7% disease shrinkage), but frank disease progression at 13 weeks. The second patient

with an SDC4-NRG1 fusion had frank disease progression at 6 weeks, similar to the third patient

with a CD74-NRG1 fusion who had primary disease progression at 8 weeks; both patients died

of disease progression shortly after discontinuing afatinib.

Targeted inhibition of ERBB3/ERBB2 results in decreased growth of cell lines with aberrant

NRG1 expression. Published preclinical data on ERBB3/ERBB2 inhibition in NRG1-altered cell

lines is limited (4), and the activity of ERBB2 inhibition with select clinically available tyrosine

kinase inhibitors has largely been examined in cells with ectopic expression of CD74-NRG1




8

cDNA (3). We thus explored the effect of ERBB3/ERBB2 inhibition by genetic and

pharmacological approaches in cell lines with endogenous NRG1 alterations.

We first examined the breast cancer cell line MDA-MB-175-VII, previously published to harbor a

DOC4-NRG1 fusion (10, 14), and confirmed the finding via RT-PCR (Figure 2A). Orthogonal

sequencing of the PCR amplicon revealed that exon 12 of DOC4 is fused in frame with exon 2 of

NRG1 (confirmed by targeted RNA sequencing, Figure S1A). To identify a lung cancer cell line

with aberrant expression of NRG1, 67 lung cancer cell lines were screened using microarray

expression data. HCC-95 cell line had the highest level of NRG1 mRNA expression (three-fold

higher than the next highest cell line, Figure S1B). While an NRG1 fusion was not detected in

this cell line using the MSK-Solid Fusion Assay, NRG1 was subsequently found to be amplified

based on array CGH analysis (Figure 2B). Both MDA-MB-175-VII and HCC-95 significantly

overexpressed NRG1 relative to tissue type-matched control cell lines (Figure 2C). In addition,

using a phospho-receptor tyrosine kinase array that allows for profiling the activation state of

49 receptor tyrosine kinases (15), we observed that the MDA-MB-175-VII cell line had high

levels of phosphorylation of EGFR, ERBB2, and ERBB3, as expected, but little activation of any of

the remaining 46 receptor tyrosine kinases (Figure S1C).

To further investigate these cell lines with aberrant NRG1 expression, we examined the effect

of the anti-ERBB3 mAb, GSK2849330, on proliferation and activation of the ERBB3 pathway.

MDA-MB-175-VII and HCC-95 cells showed higher basal levels of phospho-ERBB3 compared to

control cell lines (MCF-7 and H292) with low NRG1 expression (Figure 2D). Addition of




9

exogenous heregulin did not further stimulate ERBB3, as evidenced by little effect on phospho-

ERBB3 or phospho-AKT levels in the MDA-MB-175-VII or HCC-95 cell lines, unlike the effects

observed in control cell lines. MDA-MB-175-VII and HCC-95 cells treated with GSK2849330

showed suppression of ERBB2, ERBB3, and AKT phosphorylation compared to treatment with a

non-specific IgG control. Moreover, relative to the control lines, both cell lines exhibited

significant growth inhibition upon GSK2849330 treatment over the IgG control (Figure 2E). We

observed similar results repeating the same experiments with a variety of ERBB2/EGFR

inhibitors such as afatinib, erlotinib, and neratinib (Figure S2 and Figure S3), complementing

prior experience with trastuzumab, pertuzumab, or T-DM1 treatment in vitro (16). These data

collectively show that these models, despite their molecular differences in terms of NRG1

alterations, are similar in their constitutive activation, dependence on the pathway, and

sensitivity to inhibitors.

To dissect the roles of ERBB family members on in vitro growth and survival, we tested shRNAs

targeting EGFR, ERBB2, or ERBB3 in the NRG1 fusion-positive cell line, MDA-MB-175-VII (Figure

S4). ERBB2 or ERBB3 knockdown reduced cell growth significantly (Figure 2F, top) and induced

>8-fold increase in caspase 3/7 activity (Figure 2F, bottom). However, these cells were less

sensitive to EGFR inhibition, phenocopying the reduced cell viability observed with neratinib

and afatinib relative to erlotinib (Figure S3). Collectively, these results support that NRG1

alteration drives basal activation and dependence on the ERBB2/ERBB3 signaling pathway, and

confers sensitivity to ERBB2/ERBB3 inhibitors such as GSK2849330 and afatinib in vitro,

reflecting the clinical experience, here and elsewhere (5, 17, 18).




10

Differential growth inhibition is observed with ERBB3 versus ERBB2 targeting in OV-10-0050,

a PDX model harboring an NRG1 fusion. Profiling a variety of patient derived xenograft (PDX)

models by RNA-seq identified OV-10-0050, an ovarian model with outlier expression of NRG1

mRNA (Figure 3A). Further analysis of this sample revealed a novel CLU-NRG1 fusion resulting

from the intragenic fusion of exon 2 of CLU with exon 6 of NRG1, retaining the EGF-like

extracellular domain. Mice bearing OV-10-0050 tumors implanted subcutaneously were treated

with vehicle, afatinib (15 mg/kg daily), GSK2849330 (25 mg/kg, BIW), or control IgG (25 mg/kg,

BIW). Afatinib treatment caused a significant reduction in tumor growth compared to vehicle

(Figures 3B and S5A); however, no tumor regression was observed.

In contrast, GSK2849330 elicited a more profound anti-tumor response as evidenced by durable

and complete tumor regression (Figures 3B and S5A) that persisted even after treatment was

discontinued after 35 days of dosing (Figure S5B). Pharmacodynamic analysis of samples

collected 4 hours after a single dose treatment of GSK2849330 demonstrated near complete

inhibition of phospho-HER3 and phospho-AKT relative to IgG control (Figure 3C). Afatinib-

treated samples, however, showed relatively lower inhibition of phospho-HER3 and little to no

change in phospho-AKT.

Taken together, these in vivo results were analogous to the differential clinical responses

observed with ERBB3- versus ERBB2-directed targeted therapy as described earlier, where a




11

deep and durable objective response to therapy was noted with GSK2849330, as opposed to

afatinib therapy where no responses were observed in patients with NRG1-rearranged tumors.

NRG1 fusions identified across a variety of cancers. Recognizing the clinical activity of targeted

therapy in NRG1-rearranged lung cancers, we proceeded to determine the prevalence of NRG1

fusions in advanced solid tumors of both lung and non-lung origin. Using MSK-IMPACT alone,

among 17,485 patients with a variety of advanced solid tumors, NRG1 rearrangements were

detected in non-small cell lung cancers (3 of 2,079 patients [0.14%] with lung

adenocarcinomas), pancreatic adenocarcinoma (1 of 791 patients [0.13%] with pancreatic

adenocarcinoma), and ER+/HER2- breast cancer (1 of 2703 patients [0.04%] with breast

carcinoma).

Knowing that NRG1 fusions are more common in IMAs of the lung, and that the NRG1 fusions of

two patients who received targeted therapy in this series (Table S1) were detected by targeted

RNA sequencing (MSK-Solid Fusion Assay, Archer FusionPlex) and not next-generation

sequencing of DNA (MSK-IMPACT), we performed additional targeted RNA sequencing of IMAs

of the lung that did not harbor KRAS mutations using the MSK-Solid Fusion Assay. In patients

with KRAS wild-type IMAs, NRG1 fusions were detected in 4 of 36 patients (11%). Targeted RNA

sequencing also detected an NRG1 fusion in a pancreatic adenocarcinoma not previously

detected by MSK-IMPACT alone.




12

Collectively, MSK-IMPACT and the MSK-Solid Fusion Assay detected 10 NRG1 fusions in total: 7

in lung adenocarcinomas, 2 in pancreatic adenocarcinomas, and 1 in a breast carcinoma. All

fusions included exon 6 that encodes the EGF-like domain of NRG1 that likely binds to ERBB3 to

trigger downstream signaling. CD74 was the most common upstream partner (Figure 4A).

Additional fusions included the known SDC4-NRG1, and the novel ROCK1-NRG1 and FOXA1-

NRG1 fusions (Figure 4B).

We then performed an analysis of RNA-seq data for 8,984 tumors from The Cancer Genome

Atlas. NRG1 rearrangements with a wide variety of novel 5’ and 3’ partners were found across

several tumor histologies. These included breast, lung, and pancreatic cancer, matching the

results obtained using MSK-IMPACT and the MSK-Solid Fusion Assay, but also additional tumor

types, such as ovarian and head-and-neck cancers.

The identified fusions and their corresponding frequencies were AKAP13-NRG1 (breast cancer;

0.01%), THBS1-NRG1 and PDE7A-NRG1 (head and neck cancer; 0.49%), SDC4-NRG1 (lung

adenocarcinoma; 0.22%), PCM1-NRG1 (renal clear cell carcinoma; 0.19%), THAP7-NRG1 and

SMAD4-NRG1 (squamous cell lung cancer; 0.21%), RAB3IL1-NRG1 (ovarian cancer; 0.24%),

ATP1B1-NRG1 (pancreatic cancer; 0.55%), NRG1-PMEPA1 (uterine carcinosarcoma; 1.75%), and

NRG1-STMN2 (prostate cancer; 0.3%, Figure 4C).

Of these rearrangements, the NRG1-PMEPA1, ATP1B1-NRG1, SDC4-NRG1, PDE7A-NRG1, and

RAB3IL1-NRG1 fusions were clearly predicted to be in-frame. For the remaining fusions, frame




13

retention prediction was more difficult; however, fusion mRNA was still clearly detected (Figure

4D). All fusions, except NRG1-PMEPA1, NRG1-STMN2 and PCM1-NRG1, retained the EGF-like

domain of NRG1 and were, thus, predicted to be functional and activating, as described above.

DISCUSSION

In this paper, we provide early clinical proof of principle data supporting the use of ERBB3-

directed targeted therapy in patients with advanced NRG1-rearranged cancers. GSK2849330, an

anti-ERBB3 mAb, elicited a dramatic and durable response in an exceptional responder with an

advanced CD74-NRG1-rearranged IMA on a phase 1 trial. This activity is supported by durable

tumor regression observed in a PDX mouse model and anti-proliferative activity noted in MDA-

MB-175-VII with HER3 mAb therapy. On a molecular level, these NRG1-rearranged models

demonstrate functional similarity in their dependence on ERBB3 by basal pathway activation

and near complete suppression of downstream signaling upon ERBB3 inhibition. NRG1 fusions

can be added to a growing list of therapeutically actionable driver alterations including ALK,

ROS1, RET, NTRK1/2/3, FGFR1/2/3, and PDGFB fusions (1, 19).

In contrast, ERBB2-directed targeted therapy was not as effective in this population. None of

the four patients with NRG1-rearranged tumors in this report responded to afatinib (two of

whom developed rapidly progressive disease resulting in death), although significant responses

to afatinib were recently reported in other patients with NRG1-rearranged tumors (5, 17, 18).

Our cases temper the previous observations of responses with afatinib, and underscore the




14

potential for enhanced anti-tumor activity with ERBB3 inhibition. It is noteworthy that our index

case demonstrated a much longer response to GSK2849330 (19 months) relative to all other

published cases of afatinib responses (≤12 months, (5, 17, 18)). This was consistent with the

substantially reduced anti-tumor activity and suboptimal pathway inhibition noted in our NRG1-

rearranged PDX model treated with afatinib relative to GSK2849330. While genomic context

and heterogeneity may play a role, we speculate that these differences could be explained by

NRG1-mediated activation of ERBB3 limiting responses to and/or offering an escape from

ERBB2 inhibition (9).

Targeted therapy trials should evaluate dedicated cohorts of NRG1-rearranged tumors. Several

ERBB3 inhibitors, besides GSK2849330, have been explored in the clinic, such as patritumab

(U3-1287, AMG-888), seribantumab (MM-121), lumretuzumab, AV-203, and LJM716 (20-24), but

early testing did not focus on molecular enrichment for NRG1 fusions. A case could also be

made for the use of ERBB2 inhibitors, such as afatinib, lapatinib, neratinib, trastuzumab, T-

DM1, or pertuzumab in patients with NRG1-rearranged cancers; however, our study and

previous data (16) suggest that agents such as afatinib, trastuzumab, pertuzumab, or T-DM1

may provide more limited benefits. Finally, combinations of one or more of these agents may

maximize antitumor activity in NRG1-rearranged tumors as previously explored preclinically

(16).

We recommend that screening for NRG1-rearranged tumors be performed. In this paper, NRG1

rearrangements were more optimally detected when a combination of DNA-based targeted




15

hybrid capture-based next-generation sequencing and targeted RNA sequencing with anchored

multiplex PCR were performed. Considering the diversity of NRG1 fusion partners, the latter

offers the distinct advantage of detecting unknown fusion partners using a unidirectional

targeted approach. Consistent with previous data (3, 6, 25), the NRG1 rearrangements we

identified occurred predominantly in lung cancers. These cancers thus represent a target

population to screen in the absence of other actionable drivers, especially in driver-negative

lung IMAs.

Lastly, using two large genomic datasets, we show that NRG1 rearrangements can be detected

across a variety of other cancers, including breast, head and neck, renal, ovarian, pancreatic,

prostate, and endometrial cancers. This supports the utility of a basket trial approach to drug

development for this genomic subset. We previously demonstrated the clinical utility of this

approach with NTRK1/2/3-rearranged tumors, where age- and histology-agnostic responses

were observed with TRK-directed targeted therapy across a wide variety of adult and pediatric

solid tumors (2). Should NRG1 fusions be similarly amenable to targeted therapy regardless of

histology, tumor-agnostic development should be adopted to explore the activity of

ERBB3/ERBB2 inhibition.

METHODS

Molecular profiling. Targeted hybrid-capture next-generation sequencing (NGS) was performed

using the MSK-IMPACT (Integrated Mutational Profiling of Actionable Cancer Targets, data




16

accessible on www.cbioportal.org), designed to capture base substitutions, small indels, copy

number alterations and select rearrangements in more than 340 cancer-related genes as

previously described (12, 19). Targeted RNA sequencing was performed using the MSK-Solid

Fusion Assay, an NGS-based assay designed to detect fusions which utilizes Anchored Multiplex

PCR technology (Archer FusionPlex, Illumina MiSeq). Unidirectional gene-specific primers

targeted specific exons in more than 35 genes known to be involved in chromosomal

rearrangements.

Targeted therapy. GSK2849330 was administered on a NSCLC expansion cohort of a phase 1

trial (NCT01966445) conducted in accordance with International Ethical Guidelines for

Biomedical Research Involving Human Subjects after approval by institutional board review.

Informed written consent was obtained from subjects. Patients were eligible if they had ERBB3-

/NRG1-expressing tumors and advanced disease. GSK2849330 was administered at the

recommended phase 2 dose (30 mg/kg intravenously weekly for 5 doses, followed by 30 mg/kg

every other week). Imaging was performed at baseline and every 8 weeks. Response was

assessed by RECISTv1.1. An exploratory assessment of volumetric tumor response was

performed. Adverse events were captured using CTCAE v4.0. Commercial afatinib was

administered at 40 mg daily.

Cell lines and culture. MDA-MB-175-VII, NCI-292, and MCF7 were obtained from ATCC

(Manassas, VA) in 2015. HCC-95 cells were obtained from the Korean Cell Line Bank (Seoul,

South Korea) in 2016. Cell lines were grown in a humidified incubator (37 oC, 5% CO2),




17

authenticated by short tandem repeat profiling, and tested for mycoplasma (ATCC Universal

Mycoplasma Detection Kit upon receipt and every 6 months, last tested on 9/2017). MCF7 was

cultured in EMEM (Gibco) supplemented with 0.01 mg/ml insulin and 10% FBS. All other cell

lines were cultured in RPMI supplemented with 10% FBS.

In vitro and in vivo experiments. NRG1 fusion testing (MDA-MB-175-VII, HCC-95) was

performed by RT-PCR and targeted RNA sequencing (MSK-Solid Fusion Assay). RTK

phosphorylation was assessed using a phospho-RTK array (profiles the activation state of 49

RTKs) (15). To generate growth curves for cells treated with GSK2849330 or control IgG, MDA-

MB-175-VII (500 cells/well), HCC-95 (200 cells/well), NCI-H292 (200 cells/well) and MCF7 (300

cells/well) were plated in 96-well plates (Nunc 136102) in triplicate. Cells were treated with 10

µg/mL GSK2849330 or control IgG. Cell proliferation was measured (CellTiter-Glo Luminescent

Cell Viability Assay, Promega). For shRNA infection, 250,000 cells were plated (6-well plates)

and infected (24h later) with viral supernatant. Infected cells were selected with 5 µg/mL

puromycin. For caspase 3/7 activation, 25,000 puromycin-selected cells were plated (white

clear bottom 96-well plates) and caspase 3/7 enzymatic activity measured (APO-ONE

homogenous caspase 3/7 activity assay kit, Promega). 0V-10-0050 was treated (vehicle, IgG

control at 25 mg/kg, or GSK2849330 at 25 mg/kg BIW) on day 35 post-implantation at an

average tumor size of approximately 163 mm3. Tumor size was measured twice weekly in two

dimensions and used for calculations of both T-C and T/C values.




18

TCGA sample analysis. 8,984 cancer samples from 33 different cancer types (dbGaP Study

Accession: phs000178.v9.p8) were analyzed using the MediSapiens FusionSCOUT fusion gene

detection pipeline. Candidate fusion genes were filtered based on: gene-gene distance,

sequence homology, either partner annotated as a pseudogene, and presence of the fusion in

RNA-seq data (~600 normal tissue samples). Fusion junctions were identified by constructing all

possible exon-exon combinations between each pair of genes, followed by alignment of

unmapped reads against synthetic junctions. Reading frame status was predicted based on the

end and start phases of junction exons. NRG1 expression by cancer type was drawn using the

RSEM scaled estimate expression values (Broad Institute GDAC Firehose pipeline).

Additional details regarding cell lines, molecular profiling, shRNA infection, caspase 3/7 activity,

Western blotting, patient-derived xenograft generation and treatment, fusion gene analysis for

TCGA samples, and expression/copy number analysis of non-small cell lung cancer lines are

detailed in the Supplementary Methods.

ACKNOWLEDGEMENTS

We would like to thank all our patients, their families, and the site staff for their participation

and contributions to this study. We also acknowledge BioWa, Inc. (U.S. subsidiary of Kyowa

Hakko Kirin Co., Ltd.) for their POTELLIGENT® Technology and COMPLEGENT® Technology in

developing GSK2849330, an ADCC and CDC enhanced anti-ERBB3 mAb. Baseline




19

characterization of OV-10-0050 PDX model was carried out at WuXi AppTec (Shanghai) Co., Ltd.

(Shanghai, China).




20

REFERENCES

1. Schram AM, Chang MT, Jonsson P, Drilon A. Fusions in solid tumours: diagnostic

strategies, targeted therapy, and acquired resistance. Nat Rev Clin Oncol 2017;14:735-748.

2. Drilon A, Laetsch TW, Kummar S, Dubois F, Lassen UN, Demetri GD, et al. Efficacy of

Larotrectinib in TRK Fusion-Positive Cancers in Adults and Children. N Engl J Med 2018;378:731-

9.

3. Fernandez-Cuesta L, Plenker D, Osada H, Sun R, Menon R, Leenders F, et al. CD74-NRG1

fusions in lung adenocarcinoma. Cancer Discov 2014;4:415-22.

4. Shin DH, Lee D, Hong DW, Hong SH, Hwang JA, Lee BI, et al. Oncogenic function and

clinical implications of SLC3A2-NRG1 fusion in invasive mucinous adenocarcinoma of the lung.

Oncotarget. 2016;7:69450-65.

5. Jones MR, Lim H, Shen Y, Pleasance E, Ch'ng C, Reisle C, et al. Successful targeting of the

NRG1 pathway indicates novel treatment strategy for metastatic cancer. Ann Oncol

2017;28:3092-7.

6. Nakaoku T, Tsuta K, Ichikawa H, Shiraishi K, Sakamoto H, Enari M, et al. Druggable

oncogene fusions in invasive mucinous lung adenocarcinoma. Clin Cancer Res 2014;20:3087-93.

7. Shim HS, Kenudson M, Zheng Z, Liebers M, Cha YJ, Hoang Ho Q, et al. Unique Genetic

and Survival Characteristics of Invasive Mucinous Adenocarcinoma of the Lung. J Thorac Oncol

2015;10:1156-62.

8. Trombetta D, Graziano P, Scarpa A, Sparaneo A, Rossi G, Rossi A, et al. Frequent NRG1

fusions in Caucasian pulmonary mucinous adenocarcinoma predicted by Phospho-ErbB3

expression. Oncotarget 2018;9:9661-71.




21

9. Fernandez-Cuesta L, Thomas RK. Molecular Pathways: Targeting NRG1 Fusions in Lung

Cancer. Clin Cancer Res 2015;21:1989-94.

10. Schaefer G, Fitzpatrick VD, Sliwkowski MX. Gamma-heregulin: a novel heregulin isoform

that is an autocrine growth factor for the human breast cancer cell line, MDA-MB-175.

Oncogene 1997;15:1385-94.

11. Murayama T, Nakaoku T, Enari M, Nishimura T, Tominaga K, Nakata A, et al. Oncogenic

Fusion Gene CD74-NRG1 Confers Cancer Stem Cell-like Properties in Lung Cancer through a

IGF2 Autocrine/Paracrine Circuit. Cancer Res 2016;76:974-83.

12. Cheng DT, Mitchell TN, Zehir A, Shah RH, Benayed R, Syed A, et al. Memorial Sloan

Kettering-Integrated Mutation Profiling of Actionable Cancer Targets (MSK-IMPACT): A

Hybridization Capture-Based Next-Generation Sequencing Clinical Assay for Solid Tumor

Molecular Oncology. J Mol Diagn 2015;17:251-64.

13. Clarke N, Hopson C, Hahn A, Sully K, Germaschewski F, Yates J, et al. Preclinical

pharmacologic characterization of GSK2849330, a monoclonal AccretaMab® antibody with

optimized ADCC and CDC activity directed against HER3. Eur J Cancer 2014;50:98-9.

14. Adelaide J, Huang HE, Murati A, Alsop AE, Orsetti B, Mozziconacci MJ, et al. A recurrent

chromosome translocation breakpoint in breast and pancreatic cancer cell lines targets the

neuregulin/NRG1 gene. Genes Chromosomes Cancer 2003;37:333-45.

15. Roudabush FL, Pierce KL, Maudsley S, Khan KD, Luttrell LM. Transactivation of the EGF

receptor mediates IGF-1-stimulated shc phosphorylation and ERK1/2 activation in COS-7 cells. J

Biol Chem 2000;275:22583-9.




22

16. Phillips GD, Fields CT, Li G, Dowbenko D, Schaefer G, Miller K, et al. Dual targeting of

HER2-positive cancer with trastuzumab emtansine and pertuzumab: critical role for neuregulin

blockade in antitumor response to combination therapy. Clin Cancer Res 2014;20:456-68.

17. Cheema PK, Doherty M, Tsao MS. A Case of Invasive Mucinous Pulmonary

Adenocarcinoma with a CD74-NRG1 Fusion Protein Targeted with Afatinib. J Thorac Oncol

2017;12:e200-e2.

18. Gay ND, Wang Y, Beadling C, Warrick A, Neff T, Corless CL, et al. Durable Response to

Afatinib in Lung Adenocarcinoma Harboring NRG1 Gene Fusions. J Thorac Oncol 2017;12:e107-

e10.

19. Zehir A, Benayed R, Shah RH, Syed A, Middha S, Kim HR, et al. Mutational landscape of

metastatic cancer revealed from prospective clinical sequencing of 10,000 patients. Nat Med

2017;23:703-13.

20. Le Clorennec C, Bazin H, Dubreuil O, Larbouret C, Ogier C, Lazrek Y, et al. Neuregulin 1

Allosterically Enhances the Antitumor Effects of the Noncompeting Anti-HER3 Antibody 9F7-F11

by Increasing Its Binding to HER3. Mol Cancer Ther 2017;16:1312-23.

21. Huang J, Wang S, Lyu H, Cai B, Yang X, Wang J, et al. The anti-erbB3 antibody MM-

121/SAR256212 in combination with trastuzumab exerts potent antitumor activity against

trastuzumab-resistant breast cancer cells. Mol Cancer 2013;12:134.

22. Meulendijks D, Jacob W, Martinez-Garcia M, Taus A, Lolkema MP, Voest EE, et al. First-

in-Human Phase I Study of Lumretuzumab, a Glycoengineered Humanized Anti-HER3

Monoclonal Antibody, in Patients with Metastatic or Advanced HER3-Positive Solid Tumors. Clin

Cancer Res 2016;22:877-85.




23

23. Meetze K, Vincent S, Tyler S, Mazsa EK, Delpero AR, Bottega S, et al. Neuregulin 1

expression is a predictive biomarker for response to AV-203, an ERBB3 inhibitory antibody, in

human tumor models. Clin Cancer Res 2015;21:1106-14.

24. Garner AP, Bialucha CU, Sprague ER, Garrett JT, Sheng Q, Li S, et al. An antibody that

locks HER3 in the inactive conformation inhibits tumor growth driven by HER2 or neuregulin.

Cancer Res 2013;73:6024-35.

25. Duruisseaux M, McLeer-Florin A, Antoine M, Alavizadeh S, Poulot V, Lacave R, et al.

NRG1 fusion in a French cohort of invasive mucinous lung adenocarcinoma. Cancer Med

2016;5:3579-85.




24

FIGURE 1. Clinical response to anti-ERBB3 monoclonal antibody therapy in a patient with an

advanced NRG1-rearranged non-small cell lung cancer. A. A never smoker with advanced

invasive mucinous adenocarcinoma was treated with four lines of systemic therapy

(chemotherapy and immune therapy) with no response to any of these treatments. His tumor

was subsequently found to harbor an in-frame CD74-NRG1 fusion that includes the EGF-like

extracellular domain that serves a binding site for ERBB3. Targeted therapy with GSK2849330,

an anti-ERBB3 monoclonal therapeutic antibody, was initiated on a phase 1 clinical trial. B. A

durable (19 months) and confirmed partial response (RECIST version 1.1) was achieved that

exceeded the duration of disease control achieved on all four prior systemic therapy regimens

in aggregate. Substantial disease shrinkage of a right lower lobe mass was noted early (by week

6 as shown) in the course of therapy.




25

FIGURE 2. Cell lines with aberrant expression of NRG1 are exquisitely sensitive to

downregulation of ERBB3 signaling. A. Expression of the DOC4-NRG1 fusion was confirmed by

RT-PCR (left panel) and by DNA sequencing of the PCR amplicon (right panel) in MDA-MB-175-

VII cells. B. Copy number breakpoints affecting NRG1 in HCC-95, a human lung cancer cell line,

are depicted using normal human DNA as reference. The outer circle depicts human autosomes

(1–22), chromosomes X and Y, and the mitochondrial genome (M). Chromosome 8, zooming

into the amplified NRG1 locus (inset), is shown. Genome-wide distribution of log2 ratios is

represented in concentric circles as gains (red) and losses (blue), each data point representing a

probe from the array according to the locations in the human genome (NCBI 36). C.

Quantitative RT-PCR was used to determine the levels of NRG1 mRNA in MDA-MB-175-VII and

HCC-95 using MCF-7 and HCC827 as control cell lines for comparison. D. Cells were treated with

GSK2849330 for 1 hour then stimulated with heregulin (HRGB1) for 30 minutes before

preparation of whole-cell extracts for Western blotting with the antibodies described. A

representative blot is shown. E. Cells were left untreated, or treated with 10 µg/mL

GSK2849330 or non-specific IgG and then measured for growth by CTG assays at the indicated

time points. The y-axis represents the mean ± SD of relative luciferase units (RLU) measured in

triplicate. F. Cells were infected with lentivirus containing non-targeting (NT) or shRNAs

targeting the genes shown and then examined for relative number of cells remaining after 7

days of infection (top panel) or relative caspase 3/7 enzymatic activity (bottom panel). Results

represent the mean ± SD of two experiments in which each condition was assayed in duplicate.

*significantly different from NT-shRNA, p<0.05, two tailed t-test




26

FIGURE 3. In vivo growth inhibition elicited by afatinib and GSK2849330 in a CLU-NRG1-

rearranged patient-derived xenograft (PDX) mouse model. A. A panel of patient-derived

xenograft (PDX) models was profiled by RNA-seq. An ovarian cancer PDX model, OV-10-0050,

showed a high level of NRG1 mRNA expression, resulting from a novel CLU-NRG1 intragenic

rearrangement (inset) where Exon 2 of CLU (chromosome 8) was fused with exon 6 or NRG1

(chromosome 8) with retention of the extracellular epidermal growth factor (EGF)-like domain

in the fusion product, as shown. B. Female BALB/c nude mice were subcutaneously implanted

with CLU-NRG1-rearranged tumors and treated with afatinib at 15 mg/kg daily for 28 days,

resulting in a significant inhibition of tumor growth compared to the vehicle arm (n=6, top

panel). The same PDX mouse model was treated with anti-ERBB3 monoclonal antibody,

GSK2849330 at 25 mg/kg biweekly for 35 days, resulting in a dramatic response of complete

tumor regression compared to vehicle- or IgG-treated controls (n=10, bottom panel). Changes

from baseline tumor volume (TV), as measured by [TV(final) – TV(initial)]*100/TV(initial), are

shown in the waterfall plots. C. Pharmacodynamic changes in tumor tissues as measured 4

hours after a single dose of treatment with afatinib, vehicle, GSK2849330, or IgG control (n=3)

are shown.




27

FIGURE 4. NRG1 rearrangements are found in multiple solid tumors. A. A schematic of CD74-

NRG1, the most commonly identified genomic rearrangement identified in lung cancers in this

series, is shown. The CD74 gene (chromosome 5q) is disrupted and inverted downstream of

exon 5 and subsequently ligated to a position upstream of exon 6 of the NRG1 gene. B.

Structural features of fusions, involving the indicated 5’ and 3’ chromosomal partners,

identified by next-generation DNA sequencing (MSK-IMPACT, n=17,485 tumors profiled) or

targeted RNA sequencing (MSK-Solid Fusion Assay) are shown. The EGF-like domain is

maintained in all fusions identified. C. Fusion junction exons, the associated chromosomal

partners, and corresponding transcripts (Ensembl database version 75) are shown for all fusions

detected by analyzing The Cancer Genome Atlas (TCGA) dataset (n=8,984 tumors analyzed),

with the EGF-like domain indicated, wherever applicable. NRG1 fusion partners are not drawn

to scale. The asterisk indicates that two distinct fusions were found in the same tumor sample.

D. NRG1 RNA-seq expression is plotted across fusion-positive TCGA cancer types (x-axis) with

fusion-positive samples indicated in red. Note that only one NRG1 expression value is plotted

for the lung squamous cell carcinoma (LUSC) sample with two distinct fusions. BRCA (breast

invasive carcinoma); HNSC (head and neck squamous cell carcinoma); KIRC (kidney renal clear

cell carcinoma); LUAD (lung adenocarcinoma); OV (ovarian serous cystadenocarcinoma); PAAD

(pancreatic adenocarcinoma); PRAD (prostate adenocarcinoma); UCS (uterine carcinosarcoma)




baseline week 6

A

B

FIGURE 1. Clinical response to anti-ERBB3 monoclonal antibody therapy in a patient

with an advanced NRG1-rearranged non-small cell lung cancer.

Anti-ERBB3 mAb: GSK2849330

carboplatinpemetrexed(1.4 mo SD)

paclitaxel(5.5 mo SD)

paclitaxelbevacizumab(9 months SD)

nivolumab(1.3 mo PD)

CD74-NRG1 fusion identified

19 monthsconfirmed

partial response

resection for stage IIA (pT2bN0M0) diseasefollowed by radiation

recurrent metastatic disease

TUMOR

NORMAL

invasivemucinousadenocarcinoma




A

B

C

D

E F

DOC4-NRG1

NRG1 (exon 2)DOC4 (exon 12)

600500400300200

100

GAPDH

MC

F-7

HC

C-9

5

-RT

HC

C-8

27

0

25

50

75

100

NT-

sh

EGFR

-sh1

EGFR

-sh2

ERBB2-

sh1

ERBB2-

sh3

ERBB3-

sh1

ERBB3-

sh2

Re

lati

ve C

ell

Nu

mb

er

(%)

MDA-MB-175-VII

*

*

*

*

0

5

10

15

20

NT-

sh

EGFR

-sh1

EGFR

-sh2

ERBB2-

Sh1

ERBB2-

sh3

ERBB3-

sh1

ERBB3-

sh2 R

ela

tiv

e C

ap

ase

3/7

Ac

tivit

y

MDA-MB-175-VII

* *

*

*

FIGURE 2. Cell lines with aberrant expression of NRG1 are exquisitely sensitive to

downregulation of ERBB3 signaling.




B

A

outlier NRG1mRNA expression

OV-10-0050

SampleID # of

Reads

5’ → 3’ 5’ breakpoint 3' breakpoint 5’gene

FPKM

3’gene

FPKM

5’gene

CNV

3’gene

CNV

OV-10-

0050

861 CLU-exon2

→NRG1-exon6

chr8:

27467992

chr8:

32,585,467

110.87 14.97 2.29 2.25

GTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGG|CTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGG|CTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAAGA

CAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGG|CTACAGCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAGGAGAGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGG|CTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAGGAGAGAA

CCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGG|CTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAGGAGAAAACTGGGGACCAGACGGTCTCAGACAATGAGCTCCAGG|CTACATCTACATCCACCACTGGGACACGCCATCTTGTAAAATGTGCGTAGAAGGAGAAAACTTTCT

ACCAGACGGTCTCAGACAATGAGCTCCAGG|CTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAGGAGAAAACTTTCTGTGT CAGACAATGAGCTCCAGG|CTACATCTACATCCACCACTGGGACAAGCCATCTTGTAAAATGTGCGGAGAAGGAGAAAACTTTCTGTGTGAATGG

Ig1*:Ig-like C2-type 1

NRG1 640 Ig1* EGF-like

CLU 449

CLU->NRG1

Clusterin

Signal peptide

506

168

NM_013964.3

33

NM_001831.3

EGF-like

Fusion junction sequence

-100

-50

00

500

1000

1500

Ch

an

ge in

tu

mo

r vo

lum

e (

%)

Vehicle Afatinib(15mg/kg QD)

-100

-50

00

500

1000

1500

Ch

an

ge in

tu

mo

r vo

lum

e (

%)

Vehicle IgG(25mg/kg BIW)

GSK2849330(25mg/kg BIW)

C

FIGURE 3. In vivo growth inhibition elicited by afatinib and GSK2849330 in a CLU-NRG1-

rearranged patient-derived xenograft (PDX) mouse model.




A

D

B

C

NRG1 expression

RSE

M (

scal

ed e

stim

ate

)

Tumor type

EGF

t(5;8) CD74-NRG1

Exon 6 Exon 6

Exon 6 Exon 7

Exon 6 Exon 8

Exon 2Exon 7

EGF

EGF

EGF

Exon 4Exon 7 EGF t(8;20) SDC4-NRG1

Exon 3Exon 6 EGF

NRG1Partner

Exon 2EGF

Exon 2EGF

t(8;18) ROCK1-NRG1

t(8;14) FOXA1-NRG1

Protein domains TMEGF

Exon 2

Exon 2

FIGURE 4. NRG1 rearrangements are found in multiple solid tumors.




Published OnlineFirst April 2, 2018.Cancer Discov Alexander Drilon, Romel Somwar, Biju P. Mangatt, et al. NRG1-Rearranged CancersResponse to ERBB3-Directed Targeted Therapy in

Updated version

10.1158/2159-8290.CD-17-1004doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerdiscovery.aacrjournals.org/content/suppl/2018/03/31/2159-8290.CD-17-1004.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerdiscovery.aacrjournals.org/content/early/2018/03/31/2159-8290.CD-17-1004To request permission to re-use all or part of this article, use this link



http://cancerdiscovery.aacrjournals.org/lookup/doi/10.1158/2159-8290.CD-17-1004

http://cancerdiscovery.aacrjournals.org/content/suppl/2018/03/31/2159-8290.CD-17-1004.DC1

http://cancerdiscovery.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerdiscovery.aacrjournals.org/content/early/2018/03/31/2159-8290.CD-17-1004


title (research brief) · 3/31/2018 · 1 title (research brief) response to erbb3-directed...

Documents