TIIE JOURNAL OF BIOLOOIGU CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 269, No. 23, Issue of June 10, pp. 16180-16186, 1994 Printed in U.S.A.

Regulation of Two EBF-related Genes in Presenescent and Senescent Human Fibroblasts*

(Received for publication, February 17, 1994)

Goberdhan P. Dimri, Eiji Hara, and Judith CampisiS From the Department of Cell and Molecular Biology, Lawrence Berkeley Laboratory, University of California, Berkeley, Caiifornia 94720

”

Several mammalian genes expressed in late G, are positively regulated by E2F, a heterodimeric transcrip- tion factor. Genes encoding two E2F proteins, E2F-1 and DP-1, were regulated differently during the cell cycle and replicative senescence of normal human fibroblasts. In presenescent cells, E2F-1 mRNA was cell-cycle regu- lated, appearing a few hours before S phase. By contrast, DP-1 mRNA was constitutively expressed, independent of position in the cell cycle. After a finite number of divisions, normal cells enter a state of irreversible growth arrest termed senescence. Many genes remain mitogen-inducible in senescent cells; there are, however, exceptions, including several late G, genes potentially regulated by E2F. Senescent cells expressed DP-1 at the presenescent level, but did not express E2F-1 mRNA. Senescent cells were also markedly deficient in E2F binding activity associated with the dihydrofolate re- ductase promoter. E2F-1 and DP-1 expression vectors only weakly induced DNA synthesis in quiescent or se- nescent human cells and immortal murine NIH3T3 cells, although the E2F-1 vector stimulated DNA synthesis in immortal murine A31 cells, and transactivated E2F-re- sponsive promoters in NIH3T3 cells. The results suggest that senescent cells may fail to express late GI genes due to repression of E2F-1, leading to a deficiency of E2F activity. Furthermore, although E2F-1 stimulates DNA synthesis in some cells, other cells, including normal human fibroblasts, require additional factors.

Many higher eukaryotic cells can exist in a reversibly quies- cent growth state, Go, from which they can be stimulated to proliferate by mitogenic signals. During the transition from Go to the S phase of the cell cycle, a large number of “growth- related” genes are induced (1). Several of these genes encode proteins that are essential or regulatory for the proliferative response.

Growth-related genes have been particularly well studied in cultured fibroblasts. These studies suggest that genes induced during the Go to S phase transition can be classified into three temporal categories: immediate early genes, which are induced 1-2 h after mitogen stimulation, independent of prior gene expression; mid-G, and late G, genes, which are induced sev- eral hours thereafter, and require de novo protein synthesis; and late G, genes, which are expressed just prior to S phase

AGO9909 (to J. C.) and a fellowship from the Japan Society for the * This work was supported by National Institutes of Health Grant

Promotion of Science (to E. H.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisernent” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ To whom correspondence should be addressed: Dept. of Cell and Molecular Bioloev. Lawrence Berkelev Laboratorv. 1 Csclotron Rd., Berkeley, CA 94720. Tel.: 510-486-4416; Fax: 510-486-5586; Internet: JCAMPISI@LBL.GOV.

(1-3). Recent findings from several laboratories suggest that several late G, genes are positively regulated by a common transcription factor, E2F. E2F activity, in turn, is negatively regulated by the growth suppressive (unphosphorylated) form of pRb, the product of the retinoblastoma tumor suppressor gene (4-6).

After a finite number of cell cycles, eukaryotic cells enter a state of irreversible growth arrest and altered function termed replicative senescence. Senescent cells fail to enter S phase after mitogenic stimulation, even though many growth-related genes remain mitogen-inducible (7-10). There are, however, exceptions. For example, senescent human fibroblasts fail to express three growth regulatory immediate early genes: c-fos (91, Id-1, and Id-2 (10). They also fail to express several late G, genes. Among these are the thymidine kinase, dihydrofolate reductase (DHFR),’ DNA polymerase a, cyclin A, and cdc2 genes (11-131, all of which are potentially regulated, or known to be regulated, by E2F (4, 5, 14, 15). Because pRb is constitu- tively underphosphorylated in senescent cells (161, E2F might be under continuous negative regulation by pRb. Alternatively, senescent cells might fail to express late GI, and possibly other, genes due to a deficiency in one or more E2F component.

E2F was first identified as a transcriptional inducer of sev- eral mammalian and viral genes that are needed for cellular or viral DNA replication (4-6). Recent data suggest that E2F is a heterodimer (17-19) and that there are several E2F-related genes (17-26). Two of these, E2F-1 and DP-1, are highly syn- ergistic for DNA binding and transactivating activity (17-20). The E2F-1 and DP-1 proteins each interact with pRb and bind the same E2F recognition sequence, weakly as homodimers but strongly as heterodimers (17, 19-24). E2F DNA binding activ- ity is cell cycle-regulated, increasing just before the S phase of the cell cycle. This increase is preceded by a sharp rise in E2F-1 mRNA expression (22, 23, 27). I t is not known whether DP-1 mRNA is cell cycle regulated. Very recently, an E2F-1 expres- sion vector was shown to be sufficient to induce the initiation of DNA synthesis, in the absence of external mitogenic signals, in quiescent immortal rat embryo fibroblasts (28).

Here we report on the regulation of DP-1 and E2F-1 mRNA, and E2F DNA binding activity, during the Go to S phase tran- sition and replicative senescence in normal human fibroblasts. We show that E2F-1, but not DP-1, mRNA expression is re- pressed in senescent cells and that this is accompanied by a marked deficiency in E2F binding activity. We further show that restoration of E2F-1 expression, to either quiescent or senescent cells, does not induce DNA synthesis in two human fibroblast strains and one immortal murine cell line. We sug- gest that senescent cells may fail to express late G, genes due to a deficiency in E2F activity, which in turn may result at least

The abbreviations used are: DHFR, dihydrofolate reductase; SSC, saline sodium citrate buffer; DME, Dulbecco’s modified Eagle’s medium; CAT, chloramphenicol acetyltransferase; CMV, cytomegalovirus.

16180

E2F Regulation in Human Fibroblasts 16181

in part from the repression of E2F-1. Furthermore, although E2F-1 expression is sufficient for the initiation of DNA synthe- sis in some quiescent cells, this is not the case for other cells, which may require additional positive factors or the inactiva- tion of a negative factor.

EXPERIMENTAL PROCEDURES Cell Culture-Human fetal lung fibroblasts strain WI-38 were ob-

tained from the National Institute on Aging Cell Repository (AG06814); human neonatal foreskin fibroblasts strain HCA-2 were from Dr. 0. Pereira-Smith. NIH3T3 andA31 cells (originally from Drs. R. Weinberg and A. Pardee, respectively) are nontumorigenic immortal murine em- bryo fibroblast cell lines derived from NIH and BALBlc mice, respec- tively. Cells were cultured in 10% fetal calf (human cells) or calf (murine cells) serum, and characterized with respect to growth properties, as previously described (9,29,30). Human cells were considered presenes- cent if greater than 70% synthesized DNA within 48 h (labeling index 70-78%), and senescent if less than 10% synthesized DNA in 72 h (labeling index <2-10%). DNA synthesis was monitored by PHIthymi- dine incorporation into nuclei, detectable by autoradiography, as de- scribed elsewhere (9). Proliferating cells were made quiescent by shift- ing them at 60-80% confluence to medium containing 0.2% (human cells) or 0.4% (murine cells) serum; after 72 or 48 h, less than 10% of the cells synthesized DNA over an ensuing 48 h.

RNA Isolation and Northern Analyses-RNA was prepared by lysing cells in guanidinium isothiocyanate and spinning the lysate through a CsC1, cushion, as previously described (31). Northern analysis was per- formed essentially as described elsewhere (29). Briefly 20 pg of total RNA were separated by electrophoresis through formaldehyde-agarose gels, transferred to nylon membranes (Amersham Corp.), and hybrid- ized to 32P-labeled probes in 5 x saline-sodium phosphate-EDTA buffer, 5 x Denhardt's solution, 50% formamide, and 10% dextran sulfate at 42 "C for 20-24 h. The membranes were then washed sequentially with 2 x saline-sodium citrate buffer (SSC) containing 0.2% SDS, 1 x SSC plus 0.2% SDS, and 0.2 x SSC plus 0.2% SDS, twice for each solution, a t 65 "C for 30 min, dried, and exposed to Kodak XAR-5 film for auto- radiography. The membrane was striped of the E2F-1 or DP-1 probe by boiling in 0.5% SDS before applying the Gia2 control probe.

cDNAs were labeled with [32PldCTP by random oligonucleotide prim- ing. The histone 3 and Gia2 cDNAs have been described (9,29,30). The E2F-1 and DP-1 cDNAs were gifts from Drs. W. H. Lee and B. Shan and Drs. N. B. La Thangue and R. Girling, respectively (23, 24).

Nuclear Extracts and Gel Mobility Shift Assays-Nuclear extracts were prepared using a modification of the method of Dignam et al. (32). Briefly. cells were scraped from the dish and pelleted in phosphate buffered saline, washed with hypotonic buffer (10 m~ HEPES buffer, pH 7.9, 1.5 mM MgCl,, 5 mM KCl, 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, 1 mM Na,VO,, 1 mM NaF), and resuspended in hypotonic buffer containing 0.1% Nonidet P-40. Cells were lysed by Dounce homogenization, and nuclei were collected by centrifugation at 13,000 x g for 2 min. Nuclear pellets were resuspended in cold extrac- tion buffer (20 m~ HEPES, 25% glycerol, 450 mM KCl, 1 mM EDTA, 1 m~ phenylmethylsulfonyl fluoride, 1 mM Na,VO,, 1 m~ NaF), gently agi- tated at 4 "C for 45 min, and spun at 13,000 x g for 30 min at 4 "C. The supernatant was collected, and protein concentration was determined using a Bio-Rad microassay kit. Aliquots of the extract (1-2 pg/pl) were frozen at -80 "C or used immediately.

E2F binding was detected using oligonucleotides corresponding to the E2F binding site that is conserved, including the flanking sequence, in the human, mouse, and hamster dihydrofolate reductase gene pro- moters (43). The binding sites were either wild-type ((binding site un- derlined): 5'CCCGACTGCAA?TTCGCGCAAACTTGGG3') or mutant ((mutant bases in lower case): 5'CCCGACTGAATTCGatCCAAACTT- GGG3'1. The AP1-like and Spl binding sites were 5'GGCAGTCAGTTT- mTiTAAAAATG3' and S'ATTCGATCGGGGCGGGGCGAGC3'. Oli- gonucleotides were end-labeled with polynucleotide kinase and gel-pu- rified prior to use. The Rb antibody was from Oncogene Science (Rbl), and the cdk2 antiserum was from Dr. E. Leof.

Equal amounts ( 2 4 pg) of nuclear extract protein were incubated in binding buffer (60 mM final salt concentration, 20 mM HEPES, 2.5 mM MgCl,, 1 mM dithiothreitol, 1 m~ phenylmethylsulfonyl fluoride, 1 pg of poly(dI.dC) or 3 pg of poly(dA.dT) for 2 min, labeled oligonucleotide (10,000 cpm) was added, and incubation was continued for 20 min at 25 "C. Where indicated, antibodies were incubated with the extract for 16-18 h, on ice, prior to binding. The mixture was loaded on a 5% nondenaturing polyacrylamide gel, made and run in 0.25 x Tris/borate/ EDTA buffer. Protein-DNA complexes were separated by electrophore-

sis for 2 h a t 150 V (25 or 4 "C). The gel was dried and exposed to XAR-5 film for autoradiography.

Expression Vectors-CMV-E2Fl and CMV-DP1 were constructed by cloning the E2F-1 or DP-1 cDNA downstream of the cytomegalovirus early promoter (CMV) in WCMV (Invitrogen) or a modified RdCMV (CMV-1) in which neo was deleted, and introduced by microinjection or transfection using RdCMV, CMV-1 or a bacterial p-galactosidase ex- pression vector (CMV-p-gal) as negative controls, and an SV40 large T antigen expression vector (CMV-T) as a positive control.

Microinjection-For microinjection, 5 x lo4 senescent cells, 1 X lo5 presenescent human cells, or 1.5 x lo5 murine cells were plated in 35-mm dishes marked with a quartered 25-mm circle; 24 h later, they were shifted to 0.2 or 0.4% serum to induce quiescence. After 48-96 h, most or all cells in a quadrant were injected; cells outside the circle served as uninjected controls. Cells were injected as described else- where (33) with a solution of 10 nglpl CMV-p-gal, which served to identify injected cells, and 10-100 ng/pl experimental or control vector, in distilled water. t3H1Thymidine (10 pCi/ml; 50-70 Ci/mmol) was added 30-60 min after injection, and cells were maintained in serum- deficient medium or stimulated with 10% serum. After 48 h, cells were processed first for in situ detection of @-galactosidase activity (34) and then for autoradiography (9).

7bansfection"For transfection, 7 x lo4 presenescent, lo5 senescent, or 2 x IO6 murine cells were plated in 35-mm dishes; 24 h later, they were transfected or shifted to 0.2% or 0.4% serum for 24-48 h. Super- coiled DNA(0.5-1 pg of CMV-p-gal and 1-2 pg of CMV-E2F1, CMV-DP1 or CMV-T) was mixed with 5-10 pl of lipofectamine (Life Technologies, Inc.) in 200 pl of Dulbecco's modified Eagle's medium (DME), incubated at 25 "C for 30 min, and diluted with 800 pl of DME. Cells were washed with DME, the lipid/DNA mixture was added, and cells were incubated at 37 "C. For human cells, the lipidDNA mixture was removed after 2-4 h, and cells were washed with DME and given 2 ml of 0.2% serum. For murine cells, the lipidDNA mixture was diluted with 1 ml of 0.4% serum after 4-8 h; 16-18 h later, cells were washed and given 2 ml of 0.4% serum. After 24-72 h, [3H]t~ymidine was added for 24 h; cells were processed for p-galactosidase activity and autoradiography.

Zhnsactiuation-The luciferase gene in DHFR-luc (27), a gift from Dr. P. Farnham, was replaced by the chloramphenicol acetyltransferase (CAT) gene to generate DHFR-CAT. TK-CAT (34) was a gift from Dr. A. Lee. cdc2-CAT was constructed by cloning 1.7 kb (EcoRI-Sac11 frag- ment) of the human cdc2 5'-regulatory region2 upstream of CAT in pCAT(basic) (Promega). Cells (2 x 10') were plated onto 60-mm dishes. Twenty-four h later, they were transfected with 1 pg of CMV-p-gal, 1 pg of CMV-E2F1, CMV-1, or RdCMV, and 2 pg of DHFR-CAT, TK-CAT, or cdca-CAT, as described above, using 20 pl of lipofectamine and 1.6 ml of DME. Seventy-two h later, cells were washed, scraped into phosphate- buffered saline, counted, and lysed in 0.25 M Tris-HC1 (pH 7.5) plus 0.2% Triton X-100. Lysates were clarified by centrifugation at 13,000 x g for 10 min at 4 "C and used immediately or frozen at -80 "C. Lysates were assayed for soluble @-galactosidase activity (35), as an internal control for transfection efficiency, and CAT activity, using ethyl acetate extrac- tion of acetylated ['4Clchloramphenicol (36).

RESULTS

E2F-1 and DP-1 mRNAs Are Regulated Differently in Prese- nescent Cells-We first determined the pattern of E2F-1 and DP-1 mRNA expression during the Go to S phase transition in presenescent human fibroblasts. Proliferating WI-38 cells were made quiescent by serum deprivation, and then were stimu- lated to proliferate semisynchronously by providing them with fresh medium containing 10% serum. RNA was isolated at varying intervals after stimulation and analyzed on Northern blots for E2F-1, DP-1, histone 3, and Gia2 mRNA (Fig. 1).

E2F-1 mRNA was undetectable in quiescent cells, and re- mained so until at least 8 hrs after serum stimulation; 8 h approximately corresponds to the mid-point of the Go to S phase transition for these cells. About 4 h before onset of S phase, E2F-1 mRNA, evident as a single 2.5-3-kb transcript (21-23), was expressed. As reported for other cells (21, 23, 27), E2F-1 expression was maximal at the start of S phase (18-20 h after serum stimulation) and persisted throughout S phase. Histone 3 mRNA (Fig. 1) and [3H]thymidine incorporation into nuclei

G. P. Dimri and J. Campisi, unpublished results.

16182 E2F Regulation in Human Fibroblasts

(not shown) served as indicators of S phase. G,a2 mRNA (Fig. l) , which we have shown does not change with growth state or replicative senescence (291, controlled for differences in RNA quantitation, loading, or transfer.

DP-1 mRNA was regulated very differently. A single DP-1 transcript, approximately 3 kb in length (241, was constitu- tively expressed, regardless of the cellular growth state or po- sition in the cell cycle. When controlled for the abundance of G,a2 mRNA, cells in Go, G,, or S phase expressed nearly iden-

Presenescent Senescent Q 8h 16h 20h 24h 30h116h 24h 30h

-

E2F-1

c Histone 3 .

Gia2

P" DP-1

Histone 3

Gia2 t 1

b

FIG. 1. DP-1 and E2F-1 mRNA in presenescent and senescent human fibroblasts. Presenescent and senescent W138 cells were made quiescent ( Q ) by serum-deprivation, stimulated with 10% serum, and, at the indicated times, RNA was isolated and analyzed for DP-1, E2F-1, histone 3, and Gp2 mRNA. as described under "Experimental Procedures."

FIG. 2. E2F complexes in quiescent and stimulated presenescent and se- nescent cells. Nuclear extracts prepared from presenescent (Pre) and senescent (Sn) W138 cells, deprived of serum (8) and then stimulated with serum for 20 h (St), were incubated with radiolabeled probe without (Panel 1, E2F Binding) or with (Panel 2, E2F Comp) unlabeled oli- gonucleotide, or preincubated with 200 ng of antibody protein (Panels 3 and 4, E2F Binding); protein-DNA complexes were resolved, as described under "Experimen- tal Procedures."Free, uncomplexed probe; Rb, monoclonal anti-peptide mouse IgG against human pRb; IgG, nonspecific mouse IgG; cdh2, polyclonal anti-peptide rabbit antiserum against human cdk2; Preimm, rabbit preimmune serum.

-

f 4

P

tical levels of DP-1 mRNA (Fig. 1). These findings are consist- ent with the idea that E2F-1 may be limiting for E2F activity, a t least in fibroblasts (27) and that the cell cycle-dependent rise in E2F binding and transactivating activity may be due to the induction of E2F-1 gene expression.

EZF-1, but Not DP-1, Is Repressed in Senescent Cells-We next determined the pattern of DP-1 and E2F-1 mRNA expres- sion in senescent cells. Senescent cultures were treated iden- tically to the presenescent cultures: they were deprived of and stimulated with serum, and RNA was isolated at various inter- vals after stimulation and analyzed on Northern blots.

When normalized for the abundance of G,a2 mRNA, senes- cent cells expressed DP-1 mRNA a t a level that was very simi- lar to that expressed by presenescent cells. Moreover, the rela- tive abundance of DP-1 mRNA did not fluctuate in response to serum stimulation in senescent cells (Fig. 1). Thus, DP-1 mRNA was expressed and regulated similarly in presenescent and senescent cells.

Presenescent and senescent cultures differed, however, in their ability to express E2F-1 mRNA. Senescent cells consis- tently failed to express E2F-1 mRNA, even after 30 h of serum stimulation (Fig. 1). This was the case for at least three inde- pendent cultures of senescent cells, all of which expressed little or no histone 3 mRNA and had L3H1thymidine nuclear labeling indices of 8% or less, and for two different strains of human fibroblasts (WI-38 and HCA-2).

We conclude that DP-1 mRNA is constitutively expressed in normal human fibroblasts, independent of growth state, posi- tion in the cell cycle or replicative senescence. By contrast, the expression of a t least one E2F component, E2F-1, is repressed in senescent cells.

Senescent Cells Are Deficient in EZF Binding Actiuity-To determine the relationship between the level of E2F-1 and DP-1 mRNA and the level of E2F DNA binding activity in presenescent and senescent human fibroblasts, we assayed nuclear extracts for protein complexes capable of binding an oligonucleotide containing the E2F recognition sequence pre- sent in the cellular DHFR promoter (Fig. 2).

-

1

E2F Bindina

EZF Regulation in Human Fibroblasts 16183

.l)r ..”

Lono exposure 0 8 q

QP..“‘ &*

-1-1 I E2F Binding 1 FIG. 3. Spl and E2F complexes in presenescent and senescent

cells. Nuclear extracts from presenescent (Pre) and senescent (Sn) WI38 cells, deprived of serum for 72 (Q) or 144 h (QO)) and stimulated with serum for 20 h (St), were incubated with radiolabeled probe cor- responding to an Sp l (Panel 1, Spl Binding) or E2F (Panels 3 and 4, E2FBinding) binding site without (Panels 1,3, and 4 ) or with (Panel 2, Spl Comp) unlabeled oligonucleotide, as described under “Experimen- tal Procedures.” Panel 4 shows E2F complexes in presenescent and senescent cells after the gel was exposed for 3 days, as opposed to overnight, for autoradiography.

We resolved several protein-DNA complexes, designated cl- c5, that associated with the radiolabeled oligonucleotide probe (Fig. 2, Panel I ) . One of these (c4) often resolved as multiple species (Figs. 2 and 3). Competition experiments showed that cl-c4 were E2F-specific (Fig. 2, Panel 2). Thus, unlabeled oli- gonucleotide containing a wild-type, but not a mutant, E2F binding site abolished the ability of the probe to bind cl-c4. The competition experiments also established that c5 was not E2F- specific (Fig. 2, Panel 2) , a result we have confirmed, in other studies, by methylation interference.2

Extracts from quiescent cells showed low, but detectable, E2F binding activity, predominantly as complexes c2 and c4 (Fig. 2, Panel 1 ). Quiescent cells that had been stimulated with serum for 20 h showed an increase in c4; in addition, c2 was replaced by cl and c3 (Fig. 2, Panel I). Antibody disruption experiments showed that c3 contained pRb (Fig. 2, Panel 3) , whereas c l contained cdk2 (Fig. 2, Panel 4) . The relative mo- bilities of cl-c4, their antibody sensitivity, and the character- ization of E2F complexes in other cells (37-41) suggest that quiescent human fibroblasts contain low levels of free E2F (c4), also suggested by deoxycholate treatment of the extracts (not shown), and a prominent p107.E2F complex (c2). Stimulated cells express free E2F (c4), as well as pRbeE2F (c3) and cdk2- cyclin A-E2F complexes (cl).

In sharp contrast to presenescent cells, all the E2F com- plexes were barely detectable in extracts from senescent cells. Thus, senescent cells were deficient in cl-c4, whether they had

been stimulated by serum for 20 h (Fig. 2, Panel I ) or main- tained in serum-deficient medium (data not shown). Only c5, which was not E2F-specific (Fig. 2, Panel 2 ) , was easily detect- able in senescent cells. On the other hand, presenescent and senescent cells contained similar levels of specific SP1 binding activity (Fig. 3, Panels I and 2) , which therefore served to control for the protein concentration and integrity of the nuclear extracts.

Because quiescence requires 3 days (of serum deprivation), whereas senescence requires many weeks (of culture), quies- cent cells might contain residues of a repressed E2F component (e.g. E2F-1), whereas senescent cells would not. However, qui- escent cells that were deprived of serum for either 3 or 6 days showed little difference in the quality or quantity of the E2F complexes that they expressed (Fig. 3, Panel 3) . When autora- diograms of the cell extracts were overexposed (Fig. 3, Panel 4) , it was apparent that stimulated senescent cells contained a low level of the complexes present in quiescent cells (c2 and c4), but undetectable levels of the complexes present in stimulated presenescent cells (cl and c3).

We conclude that senescent cells are markedly deficient in E2F binding activity associated with the DHFR promoter. This deficiency may be at least partially due to the inability of se- nescent cells to express E2F-1 mRNA.

Restoration of E2F-1 Expression to Quiescent and Senescent Cells-Recently, E2F-1 was shown to be sufficient for the ini- tiation of DNA synthesis by quiescent (immortal) rat embryo fibroblasts (28). We asked whether E2F-1 expression could stimulate quiescent or senescent normal human fibroblasts to synthesize DNA.

The E2F-1 cDNA was placed downstream of a strong viral promoter (CMV-EBFl), introduced into cells by needle microin- jection or transfection, and cells were monitored for ability to initiate DNA synthesis, detected by autoradiography of [3H]thymidine-labeled nuclei. In some experiments, a cointro- duced bacterial /+galactosidase expression vector (CMV-P-ga- lactosidase) allowed us to unambiguously identify injected or transfected cells by histochemical staining (35).

E2F-1 induced DNA synthesis only weakly in quiescent hu- man fibroblasts. CMV-E2F1 stimulated 22-24% of quiescent cells to synthesize DNAwithin 48 h after introduction by trans- fection or injection (Tables I and 11). This stimulation was re- producibly greater than that induced by a control vector, but it was substantially less than that induced by an SV40 large T antigen expression vector (CMV-T) (85-86%), or serum (70- 90%) (Tables I and I1 and data not shown). The poor response of quiescent cells to CMV-E2F1 was not improved by cointro- duction of a similarly constructed DP-1 expression vector (CMV-DP1) (Table 11). Moreover, similar results were obtained using two different strains of human fibroblasts, WI38 and HCA-2 (Tables I and 11).

Because the E2F-1 expression vector failed to stimulate ap- preciable DNA synthesis in quiescent cells, it was not surpris- ing that it similarly failed to induce DNA synthesis in senes- cent cells (Tables I and 11). Nearly identical results were obtained whether or not senescent cells were given fresh 10% serum over the 48 h following introduction of the vectors (data not shown).

To explain the apparent contradiction between our results, using normal human fibroblasts, and the findings of Johnson et al. (28), who used an immortal rodent cell line, we considered the possibility that E2F1 might be sufficient for the Go to S phase transition, but only in immortal cells. We therefore transfected CMV-E2F1 into quiescent NIH3T3 cells, a widely used immortal murine fibroblast cell line.

E2F-1 expression failed to induce appreciable DNA synthesis in quiescent NIH3T3 cells (Table I). This was true whether cells

16184 E2F Regulation in

TABLE I Dansfection of EZF-1 and T antigen expression vectors into normal

human and immortal murine fibroblasts Presenescent and senescent WI38 cells were transfected in serum-

“Experimental Procedures,” and then were shifted to 0.2% and 10% free medium with 2 pg of the indicated plasmids, as described under

serum, respectively. r3H1Thymidine was added 72 h after transfection. One plate of untransfected presenescent cells was shifted to 10% serum prior to addition of the radiolabel (stimulated); cells were processed for autoradiography 48 h thereafter. The percent labeled nuclei was deter- mined by counting at least 200 cells in at least 5 fields at 200 x mag- nification. A separate plate was transfected with CMV-p-gal; 72 h later, it was stained for p-galactosidase activity to assess the transfection efficiency (25% for presenescent cells, 20% for senescent cells). The percent labeled nuclei (%LN) was normalized as follows: (%LN trans- fected plates) - (%LN untransfected plates (no plasmid)) + (transfection efficiency). NIH3T3 cells were transfected in serum-free medium, 1 pg of the indicated plasmid, and 1 pg of CMV-p-gal, as described under “Experimental Procedures.” After transfection, the cells were shifted to 0.4% serum for 72 or 48 h, as indicated, after which C3H1thymidine was added for 24 h. One plate of untransfected cells was shifted to 10% serum prior to radiolabel addition (stimulated). The cells were pro- cessed first for p-galactosidase activity and then for autoradiography. The plates were scored for the percent labeled nuclei, as described above, and for the percent p-galactosidase positive cells with labeled nuclei (normalized).

Cells Condition Plasmid L,:22d Normalized

Human Fibroblasts

TABLE I1 Microinjection of EZF-1 and T antigen expression vectors into

normal human fibroblasts Presenescent HCA-2 cells were made quiescent by incubating in 0.2%

serum for 72 h. Quiescent cells, and senescent cells in 10% serum, were microinjected with a mixture of 5-10 ng/pl CMV-@-gal and 20 ng/pl of the indicated plasmids, as described under “Experimental Procedures.” r3H1Thymidine was added 30-60 min after injection. 48 h later, cells were processed first for p-galactosidase activity, to identify successfully injected cells, and then autoradiography. The cells were scored for the percent &galactosidase Dositive cells with labeled nuclei.

Cells

Injected cells Labeled with labeled nuclei,

no. injected i“tt:d nuclei/total

cells (+CMv-pgal)

Plasmid

%

Presenescent HCA-2 CMV-T 138/163 84.6 CMV-E2F1 731329 22.1 CMV-DP1 16/139 11.5 CMV-E2F1 + CMV-DP1 32/126 25.4 None 16/416 3.8

Senescent HCA-2 CMV-T 211/269 78.4 CMV-E2F1 28/250 11.2 CMV-DP1 2/30 0.6 CMV-E2Fl + CMV-DP1 4/32 12.5 None 7/263 2.7

WI38, presenescent Quiescent CMV-T CMV-E2F1

WI38, senescent

CMV-pGAL None

Stimulated None

CMV-T CMV-E2F1 CMV- 1 None

NIH3T3 Quiescent, 72 h CMV-T CMV-E2F1 RcJCMV

Stimulated None

NIH3T3 Quiescent, 48 h CMV-T CMV-E2F1 Rc/CMV

%

28.0 86 12.5 24 5.4 0 6.5

71.4

26.0 85 11.5 13 9.8 4 9.0

35.7 82.8

3.1 3.3

2.3 6.6

97.0

20.5 56.6 1.6 2.9

6.1 4.7

were serum-deprived for 72, 48 (Table I), or 24 (Fig. 4) h, the minimum time needed to induce quiescence in most of the cells. As expected, CMV-T was a relatively potent inducer of DNA synthesis, as was serum (Table I and Fig. 4). However, another immortal mouse fibroblast line, A31, responded differently. In quiescent A31 cells, CMV-E2F1 was nearly as effective as CMV-T in stimulating DNA synthesis (Fig. 4). This result, along with the experiment below, also served to demonstrate that our CMV-E2F1 was biologically active.

Thus, whereas E2F-1 expression is sufficient to induce DNA synthesis in some quiescent cells, this is clearly not the case for other cells, including quiescent or senescent human fibroblasts.

E2F1 Pansactivating Activity-Because E2F-1 failed to in- duce DNA synthesis in quiescent NIH3T3 and normal human fibroblasts, we considered that, when quiescent, these cells might express an inhibitor of E2F-1 activity. To explore this possibility, we asked whether E2F-1 could transactivate an E2F-responsive promoter in quiescent NIH3T3 cells.

NIH3T3 cells were transfected with CMV-E2F1 together with plasmids containing E2F-responsive promoters cloned up- stream of a CAT reporter gene. Three cellular promoters were tested: the murine DHFR, human thymidine kinase, and hu- man cdc2 promoters (Table 111).

CMV-E2F1, but not a control plasmid, stimulated all three cellular promoters in quiescent NIH3T3 cells. The DHFR pro-

moter, which contains two overlapping strong E2F binding sites (27, 42, 431, was most responsive, showing a >lO-fold increase in E2F-1-dependent CAT activity. The thymidine ki- nase promoter, which contains three weak E2F binding sites (351, was the least responsive, showing a 2-fold increase. The intermediate response ( S f o l d increase) of the cdc2 promoter is consistent with the presence of one strong E2F binding site (151.’ Thus, E2F-1 expression was fully capable of transactivat- ing E2F responsive promoters in quiescent cells in which it was incapable of stimulating DNA synthesis.

DISCUSSION

The heterodimeric E2F transcription factor is now recog- nized as an important integrator of the positive and negative signals that regulate the mammalian cell division cycle. Qui- escence and senescence are both stable, non-dividing growth states. They differ, however, in that mitogens stimulate quies- cent cells to progress through the cell cycle, whereas senescent cells are irreversibly growth arrested. Many genes remain mi- togen-responsive in senescent cells (7-101, suggesting that the irreversible growth arrest is not due to a general breakdown in mitogenic signaling. Indeed, only a few critical early G, genes fail to respond to mitogenic stimulation senescent cells (9, 10). In addition, senescent cells fail to express several late G, genes (11-131, many of which are potentially, or known to be, regu- lated by E2F.

Here, we considered the possibility that E2F regulation or function might be altered in senescent cells. Because pRb, a negative regulator of E2F function (4-61, remains in an under- phosphorylated and inhibitory form in senescent human fibro- blasts (161, E2F might be under continuous negative regulation by pRb in senescent cells. Alternatively, senescent cells might be deficient in one or more E2F component, the possibility that we have tested here. Our results show that quiescent and se- nescent normal human fibroblasts express one E2F component, DP-1, constitutively and to approximately the same level. By contrast, E2F-1, a second E2F component, was expressed in a cell cycle-dependent manner in presenescent cells, but was un- detectable in both resting and serum-stimulated senescent cells.

DP-1 and E2F-1 are the best characterized components of E2F, showing strong synergy for both DNA binding and trans-

E2F Regulation in Human Fibroblasts 16185

FIG. 4. Mitogenic activity of E2F-1

mouse fibroblasts. HCA-2, NIH3T3, in normal human and immortal

and A31 cells were transfected with 1 pg of CMV-p-gal and 1 pg of RdCMV (Con- trol vector), CMV-T, or CMV-E2F1 in se- rum-free medium, as described under “Experimental Procedures.” After trans- fection, cells were given 0.2% (HCA-2) or 0.4% (NIH3T3 and A311 serum for 24 h, L3Hlthymidine was added, and 24 h later,

activity to identify transfected cells and cells were processed for p-galactosidase

autoradiography to detect labeled nuclei.

TABLE I11 E2F-1 transactivation activity in NIH3T3 cells

NIH3T3 cells were transfected with 1 pg of CMV-P-galactosidase, 1 pg of CMV-1, or CMV-E2F1, and 2 pg of the indicated reporter plasmid in serum-free medium, as described under “Experimental Procedures.” After transfection, the cells were given 0.4% serum. 72 h after trans- fection, the cells were lysed and lysate aliquots were assayed separately for p-galactosidase and CAT activity, as described under “Experimental Procedures.” The radioactivity (in counts/min) in the acetylated chlor- amphenicol extraction phase was normalized for the p-galactosidase activity in each sample. This experiment was done twice, with similar results; shown is the average of duplicate samples from one experiment.

Test plasmid Reporter plasmid Normalized (+CMV-pGAL) CAT activity Induction

-fold CMV- 1 DHFR-CAT 297 CMV-E2F1 3469 11.6

CMV- 1 TK”-CAT 1129 CMV-E2F1 2578 2.3

CMV-1 cdc2-CAT 440 CMV-E2F1 3025 6.9

Thymidine kinase.

activation activity (17, 19). cDNAs for two other E2F compo- nents, E2F-2 and E2F-3, were recently cloned (25, 26). Our preliminary data suggest that E2F-2 mRNA is undetectable W138 cells, in agreement with the finding that E2F-2 expres- sion is very low or undetectable in MRC5 cells, another normal human fibroblast strain (25). The other recently cloned compo- nent, E2F-3, appears to be expressed by both quiescent and senescent cells.’ Additional E2F- and DP-1-like proteins will undoubtedly continue to be cloned. Nevertheless, t o date, ex- pression of E2F-1 is the most striking difference between prese- nescent and senescent cells with regard to the components of E2F.

To understand the significance of the patterns of DP-1 and E2F-1 expression in presenescent and senescent cells, we measured E2F DNA binding activity in nuclear extracts pre- pared from these cells. We used as a probe the E2F binding site in the DHFR promoter because DHFR is among the late G, genes that are not expressed by senescent cells (12), E2F is required for DHFR expression (27, 42, 43), and the complexes that bind the DHFR E2F site have been well characterized (19, 22, 43).

In agreement with findings in other cell systems (17-28), quiescent human fibroblasts expressed low but detectable lev- els of several E2F complexes. One of these (c2) disappeared

HCA-2 CELLS NIH3T3 CELLS A31 CELLS

when the cells were stimulated to proliferate. The E2F compo- nents that comprise these complexes are not known. Presum- ably, they include DP-1 and E2F-3, both of which are expressed by quiescent cells (Fig. 11.’ They are unlikely to contain E2F-1. E2F-1 mRNA is undetectable in quiescent cells, and this is evident within 72 h of serum deprivation. If residual E2F-1 contributed appreciably to the E2F complexes in quiescent cells, quantitative and possibly quantitative changes should be evident after prolonged serum-deprivation. As this was not the case (Fig. 31, we expect that E2F-1 does not contribute to the E2F complexes present in quiescent cells. We cannot, of course, rule out the possibility that E2F-1 continues to be expressed, albeit at a reduced level, in quiescent cells. Stimulated (prese- nescent) cells showed an overall increase in E2F binding, and the appearance of two complexes (cl and c3) not detectable in quiescent cell extracts. These complexes contained cdk2 and pRb, respectively, as expected (37-41).

Several lines of evidence suggest that the cell cycle-depend- ent rise in E2F-1 expression is largely responsible for the cell cycle-dependent rise in E2F activity (21-23, 27). Thus, the in- ability of both quiescent and senescent cells to express late G, genes may be at least in part due to a lack of E2F-1 expression. Repression of E2F-1, however, may not be the only explanation for the failure of senescent cells to express late GI genes. We were surprised to find that, in contrast to quiescent cells, se- nescent cells were nearly completely devoid of E2F complexes. This striking deficiency may be limited to promoters for cellular genes that are not expressed by senescent cells: our prelimi- nary data suggest that quiescent and senescent cells express similar E2F complexes associated with the adenovirus E2 pro- moter. The quantitative difference in DHFR-associated E2F complexes between quiescent and senescent cells could be due to E2F-related proteins, other than DP-1 and E2F-3, present in quiescent but not senescent cells. Alternatively, senescent cells may express a promoter- or context-specific inhibitor of E2F, and possibly other transcription factor, function, a hypothesis for which we have some preliminary data and which are cur- rently exploring.

There is substantial evidence to suggest that E2F is a critical positive regulator of cell cycle progression (4-6). Moreover, E2F-1 has been shown to be sufficient to induce the initiation of DNA synthesis in quiescent rat embryo fibroblasts (28). We found, however, that this is not the case for all cells. In our hands, two strains of normal human fibroblasts and one im- mortal cell line of murine embryo fibroblasts failed to initiate DNA synthesis when an E2F-1 expression vector was intro-

16186 E2F Regulation in Human Fibroblasts

duced into quiescent cells. The mitogenic activity of E2F-1 was T. (1994) Exp. Cell Res. 210, 94-101 separable from its transactivation activity. That is, E2F-1 was ::: ~ ~ ~ ~ : s ; I ’ . ~ ~ ~ ~ ~ ~ ~ , ~ ~ ~ ~ ~ ~ ~ , l ~ ~ l g g o ) Science 249, 666-669 a potent transactivator in cells in which it failed to induce DNA 17. Bandara, L,, Buck, v. M,, zamanian, M,, ~ ~ h ~ b ~ , L. H,, and L~ Thangue, N. synthesis. These results suggest that some cells, including nor- B. 11993) EMBO J. 12,4317-4324 mal human fibroblasts, require positive factors in addition to 18. Huber, H. E., Edwards, G., Goodhart, I? J., Patrick, D. R., Huang, i? S.,

E2F, or the inactivation of a negative factor, in order to progress key-Hoyle, M., Barnett, S., Oliff, A., and Heimbmok, D. C. (1993) Proc. Natl. Acad. Sci. U. S. A. SO, 3525-3529

t o the S phase of the cell cycle. 19. Krek, W., Livingston, D. M., and Shimdkar, S. (1993) Science 262,1557-1560 Our findings place E2F-1 among the key genes that fail to 20. Helin, K, Wu, C. L., Fattaey, A,, Lees, J. A,, Dynlacht, B. D., Ngwu, C., and

Harlow, E. (1993) Genes & Deu. 7, 1850-1861 respond to mitogens in senescent cells, and suggests an expla- 21. Helin, K, Lees, J. A., Vidal, M., Dyson, N., Harlow, E., and Fattaey, A. (1992)

nation for the Of these to express late 22. Kaelin, W. G., Jr., Krek, W., Sellers, W. R., DeCaprio, J. A,, Aichenbaum, F., Cell 70,337350

genes, including important regulatory genes such as cyclin A and cdc2, after mitogenic stimulation. The regulation of E2F

Fuchs, C. S., Chittenden, T., Li, Y., Farnham, P. J., Blanar, M, A,, Living. ston, D. M., and Flemington, E. K (1992) Cell 70, 351-364

activity in presenescent and senescent cells shares a number of 23. Shan, B., Zhu, X., Chen, P.-L., Durfee, T., Yaw, Y., Sharp, D., and Lee, W.-H.

features with that Of activity, Of which the C-fOS and c+Ln 24. Girling, R., Partridge, J. F., Bandma, L. B., Burden, N., “ty, N. F., Hauan, J. (1992) Mol. Cell. Biol. 12, 5620-5631

protooncogenes are components (44). Both E2F and AP1 are J., and La Thangue, N. B. (1993) Nature 362,8347

insufficient for the proliferation of human fibroblasts, and de- 26. Lees, J. A., Saito, M., Vidal, M., Valentine, M., Look, T., Harlow, E., Dyson, N., ficient in senescent fibroblasts due selective repression of one and Helin, K. (1993) Mol. Cell. Biol. 13, 7813-7825 component.

gowh-regulated (albeit with different kinetics), necessary but 25. IveYHoYle, M., ConroY, R., Huber, H. s.3 (hdh% p. J.3 oliff, A., and Heim- brook, D. C. (1993) Mol. Cell. Biol. 13,7802-7812

27. Slansky, J. E., Li, Y., Kaelin, W. G., and Farnham, P. J. (1993) Mol. Cell. Biol.

28. Johnson, D. G., Schwartz, J. K., Cress, W. D., and Nevins, J. R. (1993) Nature

cells, Drs. W.-H. Lee and B. Shan for the E2F-1 cDNA, Drs. N. €3. La 29. Seshadri, T., Uzman, J. A., Oshima, J., and Campisi, J. (1993) J. Biol. Chem. Thangue and R. Girling for the DP-1 cDNA, Dr. P. J. Farnham for 268,18474-18480 @HFR-luc, Dr. A. s, Lee for $~K-cAT, and Dr. E, Leoffor the anti-cdk2 30. LU, K.3 Levine, R. A,, and CamPiSi, J. (1989) Mol. cell. B i d . 9,3411-3417 antisera.

13, 1610-1618

Acknowledgments-We thank Dr. 0. M. Pereira-Smith for the HCA-2 366,349-352

31. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979)

32. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, Biochemistry 18,5294-5299

1475-1489 REFERENCES 1. Hofbauer, R., and Denhardt, D. T. (1991) Crit. Reu. Eukaryotic Gene Expression 33. Lu, K, and CamPisi, J. (1992) Prm. NatL h a d . SCi. u. s. A. 89, 3889-3893

2. Herschman, H. R. (1991)Annu. Reu. Biochem. 60,281-319 35. Li, L.J., Naeve, G. S., and Lee, A. S. (1993) Proc. Natl. Acad. Sci. U. S. A. SO, 3. Naeve, G. S,, Sharma, A., and Lee, A. S. (1991) Cum Opin. Cell Biol. 3, 3554-3559

261-268 36. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A 4. Helin, K, and Harlow, E. (1993) Dends Cell Biol. 3, 4336 Laboratory Manual, p. 16.63, Cold Spring Harbor Laboratory, Cold Spring 5. Nevins, J. R. (1992) Science 268, 424429 Harbor, NY 6. Hollingsworth, R. E., Chen, P.-L., and Lee, W.-H. (1993) Cum Cell B i d . 37. Devote, S. H., Mudryj, M., Pines, J., Hunter, T., and Nevins, J. R. (1992) Cell

5, 194-200 68,167-176 7. Goldstein, S. (1990) Science 249, 1129-1133 38. Shirodkar, S., Ewen, M., DeCaprio, J. A., Morgan, J., Livingston, D. M., and 8. Rittling, S. R., Brooks, K M., Cristofalo, V J., and Baserga, R. (1986) P m . Chittenden, T. (1992) Cell 68, 157-166

Natl. Acad. Sci. U. S. A. 83, 3316-3320 39. Cao, L., Faha, B., Dembski, M., Taai, L.-H., Harlow, E., and Dyson, N. (1992) 9. Seshadri, T., and Campisi, J. (1990) Science 247,205-209 10. Hara, E., Yamaguchi, T., Nojima, H., Ide, T., Campisi, J., Okayama, H., and 40. Chittenden, T., Livingston, D. M., and DeCaprio, J. A. (1993) Mol. Cell. B i d .

11. Chang, 2. F., and Chen, K Y. (1988) J. Biol. Chem. 263, 11431-11435 41. Fattaey, A. R., Harlow, E., and Helin, K (1993) Mol. Cell, Biol. 13, 7267-7277 12. Pang, J. H., and Chen, K. Y. (1993) J. Biol. Chem. 268,2909-2916 13. Stein, G. H., Drullinger, L. F., Robetorye, R. S., Pereira-Smith, 0. M., and 43. Wade, M., Kowalik, T. F., Mudryj, M., Huang, E. S., and Azizkhan, J. C . (1992)

14. Yamamoto, M., Yoshida, M., Fujita, T., Otani-Fujita, N., Sakai, T., and Nikaido, 44. Curran, T., and Franza, B. R., Jr. (1988) Cell 55, 395-397

1,247-300 34. Lim, K., and Chae, C.-B. (1989) Bionchniques 7,576-579

Nature 355, 17&179

Oda, K (1994) J. B i d . Chem. 269, 2139-2145 13,3975-3983

42. Blake, M. C . , and Azizkhan, J. C. (1989) Mol. Cell. Biol. 9, 4994-5002

Smith, J. R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 11012-11016 Mol. Cell. Biol. 12, 4364-4374