thymic lymphoproliferative disease after successful correction of cd40 ligand deficiency by gene...

NATURE MEDICINE • VOLUME 4 • NUMBER 11 • NOVEMBER 1998 1253

ARTICLES

The CD40 molecule has a central role in the induction and reg-ulation of immune responses. It is expressed by B cells,hematopoietic progenitors, endothelial cells, professional anti-gen-presenting cells and epithelial cells (including those in thethymus)1,2, as well as a subset of mature T cells3. Interaction ofthis molecule with the CD40 ligand (CD40L, or CD154) usuallyleads to cell activation, differentiation or both2,4–6. In contrastto its receptor, CD40L is expressed mostly by activated T cells7.Its production is exquisitely regulated, occurring after T-cell ac-tivation and in concert with other receptor–counter-receptorpairs while the T cells and their targets are in intimate contact,usually within a specialized microenvironment8. Inherited defi-ciency of the CD40L molecule, the so-called X-linked hyper-IgM syndrome, is associated with severe immune impairment,characterized by failure of immunoglobulin isotype switchingand defects of cell-mediated immunity9,10.

Because expression of CD40L is normally closely synchro-nized with T-cell activation, fewer than 1% of circulatingmononuclear cells are estimated to be CD40L+ at any giventime (M.E. Conley, unpublished observations). Several clinicalstudies with other transgenes have shown that equivalent lev-els of expression can be attained in vivo after transduction ofhuman hematopoietic progenitor cells, indicating that CD40Ldeficiency may be amenable to correction by gene transfer,even with vectors available now11,12. We therefore studied thetherapeutic effect of CD40L transgene expression in a CD40L–/–

murine model, whose features closely resemble those of the

human disease13. Because the CD40L gene is normally tightlyregulated, we also examined the consequences of constitutiveexpression of the transgene on the growth and development ofthe immune system14–21.

Our results show that low-level expression of CD40L will cor-rect the major immunodeficiencies in CD40L–/– mice. However,with extended follow-up, approximately two-thirds of the micedeveloped T-cell lymphoproliferations, most of which gener-ated overt lymphoblastic lymphomas. Thus, our findings raisethe possibility that use of gene transfer to treat monogenic dis-orders may have adverse long-term consequences, even whenthe transgene is expressed at apparently normal levels.

Transfer of the murine CD40L geneBone marrow from female CD40L–/– donor mice was trans-duced with the mCD40L gene and injected intravenously intomale CD40L–/– recipient mice that had been ‘lethally irradi-ated’ (that is, given a dose of irradiation sufficient to ablate thehost hematopoieitic system). The same gene was also trans-ferred to unirradiated CD40L–/– mice by transducing thymiccells from the female bone marrow donors with the mCD40Lretroviral producer line in a transwell co-culture system.Control mice were injected with transduced bone marrowunder identical conditions, except that the neomycin phos-photransferase gene was substituted for the mCD40L gene,whereas transduced thymic cells were injected subcutaneouslyinto the axillae of male CD40L–/– mice. Expression of the trans-

Thymic lymphoproliferative disease after successful correctionof CD40 ligand deficiency by gene transfer in mice

MICHAEL P. BROWN1, DAVID J. TOPHAM2, MARK Y. SANGSTER2, JINGFENG ZHAO1,KIRSTEN J. FLYNN2, SHERRI L. SURMAN2, DAVID L. WOODLAND2, PETER C. DOHERTY2,

ANDREW G. FARR3, PAUL K. PATTENGALE4 & MALCOLM K. BRENNER5

1Cell and Gene Therapy Program and 2Department of Immunology, St Jude Children’s Research Hospital,332 N. Lauderdale St, Memphis, Tennessee 38105, USA

3Departments of Biological Structure and Immunology, University of Washington, Seattle, Washington 98195, USA4Department of Pathology, Children’s Hospital Los Angeles, Los Angeles, California 90027, USA

5Center for Cell and Gene Therapy, Baylor College of Medicine, 6621 Fannin St, MC3-3320,Houston, Texas 77030, USA

Correspondence should be addressed to M.K.B.

Inherited deficiency of the CD40 ligand (X-linked hyper-IgM syndrome) is characterized by fail-ure of immunoglobulin isotype switching and severe defects of cell-mediated immunity. To testthe potential for gene transfer therapy to correct this disorder, we transduced murine bone mar-row or thymic cells with a retroviral vector containing the cDNA for the murine CD40 ligand(CD40L) and injected them into CD40L–/– mice. Even low-level, constitutive expression of thetransgene stimulated humoral and cellular immune functions in these mice. With extended fol-low-up, however, 12 of 19 treated mice developed T-lymphoproliferative disorders, rangingfrom polyclonal increases of lymphoblasts to overt monoclonal T-lymphoblastic lymphomas thatinvolved multiple organs. Our findings show that constitutive (rather than tightly regulated),low-level expression of CD40L can produce abnormal proliferative responses in developing Tlymphocytes, apparently through aberrant interaction between CD40L+ and TCRαβ+CD40+ thy-mocytes. Current methods of gene therapy may prove inappropriate for disorders involvinghighly regulated genes in essential positions in proliferative cascades.

1998 Nature America Inc. • http://medicine.nature.com19

98 N

atur

e A

mer

ica

Inc.

•ht

tp://

med

icin

e.na

ture

.com

Fig. 2 Transduction efficiencies andRT–PCR analyses in mice transplantedwith either corrected bone marrow(BMT) or vector control-transducedbone marrow. a, Gene transfer to bonemarrow, thymus and spleen was mea-sured by semiquantitative (32P) PCR.Genomic DNA was amplified with PCRprimers specific for either β-globin ormCD40L cDNA. The percentages ofmCD40L+ cells were determined byanalysis of phosphorimaging data withreference to DNA standards (indicatedas 0–25%). b, 32P-RT–PCR analysis ofbone marrow, thymus and spleen.cDNA was amplified with PCR primersspecific for either β-actin or mCD40LcDNA. Mice were transplanted with ei-ther corrected bone marrow (BMT) orvector control-transduced bone mar-row. +, pG1a-mCD40L plasmid con-trol; –, water control subsequentlymphoma development.

1254 NATURE MEDICINE • VOLUME 4 • NUMBER 11 • NOVEMBER 1998

ARTICLES

gene by marrow and by thymocytes was confirmed by flow cy-tometric analysis (Fig. 1a and b). At 6–9 months after trans-plantation, the mice were killed and the efficiency of genetransfer was evaluated.

Gene transfer efficiency and transgene expressionTo study the effects of CD40L expression at different levels ofgene transfer, we transplanted two cohorts of mice with cor-rected bone marrow. In the first group (n = 6), the mean per-centages (± s.d.) of transgene-bearing cells in bone marrow,thymus and spleen were 16.5% (± 7%), 13% (± 9.4%) and 7.3%(± 3.3%), respectively, after normalization for β-globin levels(Fig. 2a). In the second group (n = 7), which received lower pro-portions of transduced cells11, the mean percentages of trans-duced cells were 0.06% (± 0.1%) in bone marrow and 0.28% (±0.56%) in thymus (not shown). A third cohort (n = 6) includedunirradiated mice given small numbers of corrected thymiccells rather than corrected marrow. In these mice, the meanpercentages of mCD40L+ cells in bone marrow, thymus orspleen were within or below the 0.01–0.1% range (not shown).Transgene-derived mRNA was detected in the bone marrow,spleen and thymus of all mice given corrected bone marrow(Fig. 2b), but only in one of five assessable mice that had re-ceived corrected thymic cells. No signal was found in any ofthe vector control mice (not shown).

Cell-mediated and humoral responses to influenza infectionTo determine whether CD40L-reconstituted mice could mountnormal antigen-specific cell-mediated and humoral responsesagainst a viral pathogen, we infected mice 1, 5 and 6 from thefirst cohort intranasally with the HKx31 attenuated strain ofinfluenza A virus. On day 7 after infection, CD4-mediated pro-liferative responses were 342%, 8% and 76% of those in wild-type control mice, whereas CD8-mediated cytotoxic Tlymphocyte (CTL) responses were 103%, 22% and 56% of thewild-type values (Fig. 3a and b). At the time of this analysis,the percentages of transgene-bearing splenocytes from mice 1,5 and 6 were 12.1%, 7.6% and 4.5%, respectively. In mouse 1,there was also an increase in nonspecific killing of uninfectedtarget cells. This effect may indicate nonspecific activation ofthe effector cells in this mouse, or perhaps minor histocom-patibility differences between effector (CD40L–/–) and targetcell strains.

Fig. 1 Demonstration of transgene expression. a, Flow cytometricanalysis of CD40L vector-transduced bone marrow cells before intra-venous injection into lethally irradiated CD40L–/– mice. Normalized his-tograms are presented for isotype-matched negative control (filled) andanti-CD40L antibodies (solid line). Viable cells were defined by scatter cri-teria. 100,000 cells were analyzed. b, Flow cytometric analysis of CD40Lvector-transduced thymic cells before subcutaneous injection into non-ir-radiated CD40L–/– mice. Normalized histograms show mock-transduced(filled) and CD40L vector-transduced thymic cells (solid line). Viable cellswere defined by scatter criteria. 700,000 cells were analyzed.

a b

CD40L

a

b

Cell counts


98 N

atur

e A

mer

ica

Inc.

•ht

tp://

med

icin

e.na

ture

.com


ARTICLES

Influenza virus-specific humoral responses were evaluatedwith ELISA (Fig. 4) and an ELISPOT assay. On day 7 after infec-tion, CD40L-treated mice had IgG titers that were intermediatebetween those of wild-type and vector-treated control mice.Analysis of IgG subclasses indicated isotype switching to IgG1,IgG2a and IgG2b after reconstitution with corrected bone mar-row (Fig. 4), in contrast to the lack of isotype switching in con-ditions characterized by CD40L deficiency9,13. Among influenzavirus-specific cells from cervical lymph nodes, 18–42% formedIgG spots, compared with only 3% from the same tissue in vec-tor-treated control mice.

Thymus-dependent antibody response to DNP-KLHIn the second and third cohorts of CD40L–/– mice, which re-ceived low-efficiency transduced bone marrow and thymiccells, respectively, we determined whether CD40L treatmentwould restore the thymus-dependent antibody response to theDNP-KLH (dinitrophenol-keyhole limpet hemocyanin)neoantigen. DNP-specific IgE antibodies were detected afterimmunization with DNP-KLH in three of the seven mice trans-planted with corrected bone marrow; these mice also showedisotype switching to polyclonal IgG1 and IgG2b antibodies(data not shown). Four of the six CD40L–/– mice given correctedthymic cells similarly generated DNP-specific IgE antibodies(data not shown).

Thymic lymphoproliferative diseaseThe preceding results demonstrate that constitutive expres-sion of CD40L can fully or partially restore immunocompe-tence in mice with a deficiency of this ligand. However, in the

first cohort, two of the six mice showed increased numbers oflymphoblasts in the thymic medulla, and two others had T-lymphoblastic lymphomas, involving the thymus, spleen andother organs, at 7–9 months after transplantation (Table).Despite receiving marrow that had been transduced at a lowerlevel of efficiency, three of the seven mice in the second co-hort also had overt T-lymphoblastic lymphomas, at 6–8months after transplantation. None of the seven vector-treated control mice showed any evidence of lymphoprolifera-tive disease. Lymphoblastic lymphomas of thymic origin weresimilarly observed at 9 months after transplantation in four ofthe six unirradiated CD40L-deficient mice given correctedthymic cells (Table), indicating that tumor induction was notassociated with prior irradiation. Thus, of 19 CD40L–/– micetransduced with the mCD40L gene, 12 developed lymphopro-liferative disease.

Histopathology and clonality of T-cell proliferationHistologic evidence of the progression of lymphoproliferativelesions came from serial study of a cohort of transplantedmice. Three CD40L-transduced mice studied at 7 months aftertransplantation had increased numbers of thymic medullarylymphoblasts in their thymuses, which were larger than thosefrom vector-control mice. Two months later, another twomice from the same cohort were found to have large thymiclymphoblastic lymphomas (Fig. 5a). Immunohistochemicalanalysis of the prelymphomatous thymic lesions showeddensely stained collections of CD3+ cells that co-localized (es-pecially at the corticomedullary junction) with CD40+ andCD86+ thymic dendritic cells and macrophages (data not

Table Characteristics of T-lymphoproliferative lesions in mice bearing the mCD40L transgene

Animal Cells Histologic Predominant tumor TCR-Vβ by Weight of Distribution of Time to lesionnumber transduced classification immunophenotypea RT-PCR lesion (mg) lesions discovery (mo)

1 Marrow Prelymphomab - Vβ1, Vβ7, Vβ14 <100 Thymus 7

2 Marrow Lymphoblastic CD4+/–CD8+/– None >800 Thymus, Spleen, 9lymphoma Lymph node, Kidney

4 Marrow Lymphoblastic CD4+/–CD8+ None >800 Thymus, Spleen, 9lymphoma Lymph node, Lung, Kidney

5 Marrow Prelymphoma - Vβ7 <100 Thymus 7

6 Marrow Prelymphoma - None <100 Thymus 7

7 Marrowc Lymphoblastic CD4+/–CD8+ None >800 Thymus, Lymph node 8lymphoma

9 Marrowc Lymphoblastic CD4+/–CD8+ Vβ4 >800 Thymus, Blood, 8lymphoma Lymph node

12 Marrowc Lymphoblastic - None <100 Lymph node d 6lymphoma

14 Thymic Lymphoblastic CD4+CD8+ Vβ5 1100 Thymus, Spleen, 9lymphoma Lymph node, Lung, Kidney

15 Thymic Lymphoblastic CD4+CD8+ e Vβ6 <100 Thymus,Spleen, Lymph node 9lymphoma

18 Thymic Lymphoblastic - Vβ5, Vβ6, Vβ7, <100 Thymus 9lymphoma Vβ10, Vβ11, Vβ16

19 Thymic Lymphoblastic - None <100 Thymus 9lymphoma

aDashes indicate too few cells for flow cytometric analysis. bGross observations and results of RT–PCR indicated a classification of lymphoproliferative disease affecting the thymusthat was also supported by immunohistochemical analysis of the thymus. cMarrow cell transduction efficiency lower than in mice 1, 2 and 4–6. dCD4+CD8+ immunophenotypefound in lymphoma-involved spleen. eThymic tissue not available for histologic study.


98 N

atur

e A

mer

ica

Inc.

•ht

tp://

med

icin

e.na

ture

.com


ARTICLES

shown). Immunophenotypic analysis of five T-lymphoblasticlymphomas showed a heterogeneous pattern of CD4 and CD8expression that included major subpopulations of eitherCD4+CD8+ or CD4–CD8low (Fig. 5b). The CD4–CD8low cellsseemed to represent developmental precursors of theCD4+CD8+ population: they were larger than normal thymo-cytes, expressed high levels of CD24, and did not express

CD25 (ref. 14) (data not shown).The pattern of TCR Vβ expression indicated a progression of

tumorigenic events from small polyclonal lesions to large,mostly monoclonal tumors (Table and Fig. 5c). Of the twothymic lesions that demonstrated polyclonal Vβ usage, one wasprobably prelymphomatous and the other a small intrathymiclymphoma. Of the four thymic lesions associated with single Vβbands, one was prelymphomatous and another was a smallthymic tumor with considerable splenic involvement. The re-maining lesions were large T-lymphoblastic lymphomas withevidence of distant metastases; flow cytometry confirmed mon-oclonal predominance in these cases (Fig. 5c). Vβ bands werenot detected in thymus samples from age-matched nontrans-planted CD40L–/– mice or from vector-treated control mice.

Transplantability of thymic tumor cellsWe next determined whether the T-lymphoproliferative disor-ders represented transplantable tumors. Lymphoma cells frommice 2, 4 and 14 were expanded with cytokines and injected in-traperitoneally into three groups of CD40L–/– mice. Thymic tu-mors developed within 14 days in two of four mice thatreceived tumor cells from mouse 14. In one case, the tumor wasa moderate-sized thymic lymphoma involving the spleen andmesenteric lymph nodes (Fig. 6). Three of four mice inoculatedwith cultured lymphoma cells from mouse 2 died with thymictumors on days 28, 37 and 51 after inoculation. Three mice in-jected with lymphoma cells from mouse 4 died 35, 36 and 68days later with tumors in the thymus and lesser omentum.Thus, the tumors were transplantable and retained theirthymic homing ability.

Fig. 4 Restoration of immunoglobulin subclass switching in response tospecific antigens. Influenza-specific antibody and IgG subclass responses weremeasured by ELISA on day 7 after infection. Filled circles, wild-type sera; filledtriangles, vector-control CD40L–/– sera; open circles, triangles and squares, in-dividual sera from three CD40L–/– mice from the first cohort that were trans-planted with corrected bone marrow; open diamonds, preimmune sera.

Fig. 3 Corrected bone marrow restores virus-specific immune re-sponses. a, Induction of influenza-specific proliferative responses in micecorrected for CD40L deficiency. At day 7 after infection, the splenocytesfrom three mice were pooled from wild-type (WT) or vector-controlCD40L–/– mice (C) or were harvested from individual CD40L–/– mice trans-planted with corrected bone marrow. The splenocytes were then incu-bated with various numbers of infected or uninfected wild-typeantigen-presenting cells (filled bar, 2 × 105; hatched bar, 1 × 105; checkedbar, 5 × 104; open bar, 2.5 × 104). Proliferation was measured by 3H-

thymidine incorporation and expressed as a stimulation index. b, Induction of influenza-specific effector CTL in mice corrected forCD40L deficiency. At day 7 after infection, splenocytes were collectedfrom three wild-type (WT) or three vector-control CD40L–/– mice (C) orfrom individual CD40L–/– mice transplanted with corrected bone marrow.The cells were then incubated with infected (filled bars) or uninfected(open bars) target cells in a standard 51Cr-release assay. The results are re-ported as specific target cell lysis (%) at an effector:target ratio of 20:1. 1,5 and 6 (horizontal axis) represent individual mouse numbers.

OD

(40

5nm

)

Serum dilution

a bSt

imul

atio

n in

dex

% s

pec

ific

lysi

s

WT C 1 5 6 WT C 1 5 6


98 N

atur

e A

mer

ica

Inc.

•ht

tp://

med

icin

e.na

ture

.com


ARTICLES

CD40L expression by thymic tumor cellsUsing flow cytometry, we detected surface expression of theCD40L transgene on some of the thymic lymphoma cells. Asmany as 15% of CD4+CD8+ tumor cells were CD40L+ (Fig. 7a) inmice receiving transduced bone marrow. In the cohort receiv-ing small numbers of transduced thymic cells, evidence oftransgene expression was provided by clusters of CD40L+ cells inthe thymic tumors (Fig. 7b). An unusual subpopulation of earlythymocytes (B220+Thy1+TCRαβ+CD4low) that expressed variableamounts of CD40, the receptor for CD40L, was also identified(Fig. 7c). It accounted for 5–14% of the tumor cells and was alsoidentified in the secondary thymic lymphoma that resultedfrom inoculation of a CD40L-deficient host with primary tumorcells from mouse 14.

DiscussionUsing a CD40L–/– murine model, we determined whether consti-tutive low-level expression of the mCD40L transgene wouldcorrect immunodeficiencies resulting from defective produc-tion of the ligand. Despite successful transfer of the retroviralvector, leading to full or partial correction of both cellular andhumoral immune defects, we observed uncontrolled thymiclymphoproliferations in 12 of the 19 treated mice. This resultwas unexpected, given the paucity of similar reports fromgroups using retroviral gene transfer to treat monogenic im-munologic disorders in animal models22–24.

Given the recognized effects of CD40L on thymocyte selectionand thymic architecture1,25,26, how might constitutive expressionof the ligand by thymocytes induce lymphoproliferative disease?One possibility is that expression of CD40L in a CD40L-nullbackground causes unremitting stimulation of immature thymo-cytes, analogous to the uncontrolled EBV-induced stimulation ofB cells that results in progressive lymphoproliferation27. Thus,after an initial phase of thymic hyperplasia, reflecting polyclonalexpansion, an oligoclonal population could be expected toemerge as various growth-promoting mutations are favored.Eventually, a single malignant clone would predominate. CD40Lcould exert its effects indirectly through upregulation of co-stim-

ulator molecules on thymic accessory cells or directly on Tcells28–30. In vivo studies of peripheral lymphoid tissue support anindirect rather than a direct mechanism of T-cell stimulation31.Alternatively, constitutively expressed CD40L might perturb thenormal distribution and/or protein expression of CD40+CD86+

thymic accessory cells that influence T-cell survival, T-cell prolif-eration or both.

Several lines of evidence support the conclusion that thymo-cytes carrying the mCD40L transgene were responsible for neo-plastic transformation in the thymus. The transgene waspresent in only a minority of thymic tumor cells (Fig. 6a and b),indicating that further stimulation of neoplastic T cells occurredby a paracrine rather than an autocrine mechanism. A subpopu-lation of thymic tumor cells with an unusual phenotype(B220+Thy1+TCRαβ+CD4low) expressed CD40, the receptor forCD40L (Fig. 6c). Similar cells have been detected as part of thenonmalignant lymphoproliferations observed in Fas-deficientand FasL-deficient mice. They are thought to originate in thethymus because of a failure of Fas-dependent apoptotic mecha-nisms to eliminate ‘neglected’ thymocytes32–34. B220+Thy1+CD4+

cells have also been detected in Fas-related lymphoprolifera-tions and may be thymic precursors of the more commonly ob-served B220+Thy1+CD4–CD8– cells34.

Although failure of negative selection could underlie thelymphoproliferative effects of transgenic CD40L expression,enhanced positive selection may also contribute to this.

Fig. 6 Thymic homing of secondary lymphoma. a, Thymus of a littermatecontrol CD40L–/– mouse (arrows). b, Thymic tumor of CD40L–/– mouse in-jected intraperitoneally with thymic lymphoblastic lymphoma cells (arrows).

Fig. 5 Phenotypic and genetic heterogeneity of thymic tumors. a, Progression from prelymphomatous to lymphomatous thymic lesions;hematoxylin-and eosin-stained sections. Arrows indicate clusters of lym-phoblasts. Original magnifications: upper panels ×20; lower panels×100. b, Flow cyometric analyses of CD4 and CD8 expression by thymictumor cells. Lymphoid cells are displayed after they were gated accord-

ing to characteristic scatter criteria. The percentage of positive cells isshown in each quadrant. Numbers above boxes indicate individualmouse numbers c, Flow cytometric and RT–PCR analyses demonstratingthe monoclonality of tumor development in mice 9 and 14. T-cell recep-tor Vβ4 expression was measured in mouse 9, and Vβ5 expression, inmouse 14.

a b

c

CD40L vector

LymphomaPre-lymphoma

Control vector

CD8

CD8

CD4

Vβ4

Vβ4

408 bp

213 bp

Vβ5

Vβ5

a b


98 N

atur

e A

mer

ica

Inc.

•ht

tp://

med

icin

e.na

ture

.com


ARTICLES

Indeed, TCR-mediated positive and negative selection mecha-nisms were postulated to contribute to the spontaneous devel-opment of thymic lymphomas in a TCR-transgenic model14.These tumors seem to have originated from thymocytes under-going a pre-TCR-dependent transition from an immature(CD4–CD8+) to a more mature (CD4+CD8+) phenotype, thesame population that was targeted for expansion here. Suchcells are also frequent targets of other oncogenic agents14.

Our data argue strongly against transforming events otherthan constitutive expression of the transgene. We have not ob-served any spontaneous thymic tumors in our colony ofCD40L-knockout mice, nor have there been any published re-ports of such neoplasms. Further, the spontaneous incidence oflymphoma in aged male mice of the same background strain asour mice (B6/129) is approximately 2% (refs. 35,36). Althoughlymphomas occasionally develop in patients with X-linkedhyper-IgM syndrome, they rarely have a T-lymphoblastic ori-gin37. Radiation-associated lymphomagenesis is also unlikely

because thymic lymphomas occurred in unirradiated CD40L-deficient mice that had received corrected thymic cells.Replication-competent retrovirus was not detected by co-cul-ture analysis or by PCR amplification in samples from the retro-viral supernatant used in the transduction experiments or fromthe tumors themselves. In addition, no retroviral particles weredemonstrated by electron microscopic examination of threethymic tumors. Moreover, only a minor proportion of tumorcells contained proviral DNA, and the level was no higher thanthat in the input bone marrow DNA, indicating that insertionalmutagenesis was an unlikely contributor to lymphomagenesis.Thus, although provirally marked cells may have been involvedin malignant transformation, they could not have been thesole instigating factor. Finally, the long latency of tumor devel-opment (6–9 months) supports a multifactorial pathogenesis 38.

Although gene replacement therapy holds great promise forcorrecting a variety of monogenic disorders, the vectors avail-able now do not allow effective regulation of transgenes in

Fig. 7 Expression of CD40L by thymic tumor cells. a, CD40L expression by thymic tumor cells analysed byflow cytometry. Upper panels (1–3), CD4/CD8 fluores-cence profiles of three thymic tumors from mice receivingCD40L-transduced bone marrow cells (Fig. 1a). In 1 and 3,many of the tumor cells are doubly positive for CD4 andCD8. Lower panels (4–6), Proportion of CD4/CD8 cellsthat are also positive for the CD40L transgene (CD4 andCD8 for 4 and 6; CD4 or CD8 for 5). b, CD40L expressionby thymic tumors analyzed by immunohistochemicalmethods, showing clusters of CD40L+ cells within thebody of the thymic lymphomas of mice transplanted withCD40L expressing thymic cells (Fig. 1b). Left, staining with

isotype control antibody; right, with MR-1, andanti-CD40L antibody. Arrows indicate clusters ofCD40L-positive cells. c, Immunophenotypic char-acterization of B220+ Thy1+ tumor cells obtainedfrom thymus (mice 2, 4 and 14) or spleen (mouse15). CD40L–/– mice were either transplanted withcorrected bone marrow (2 and 4) or were givencorrected thymic cells (14 and 15). B220+Thy1+

cells are shown in boxes in the first column of dot-plots, and the percentage of total cells thus gatedis indicated. B220+Thy1+ cells were analyzed forexpression of TCRαβ, CD4 and CD40, shown byhistograms in the second, third and fourthcolumns, respectively. Dotted lines, results for iso-type controls; solid lines, antibodies.

a b

c

1

4 5 6

32

CD40L

CD40CD4B220

CD4

CD8

TCRαβThy1

Cell count

2

4

14

15

4914 14 120.4

18228

15 7 7

24


98 N

atur

e A

mer

ica

Inc.

•ht

tp://

med

icin

e.na

ture

.com


ARTICLES

vivo39. This well-recognized shortcoming limits applications ofgene therapy for diseases in which excessive, uncontrolled se-cretion of normally highly regulated molecules is detrimental.Our results indicate that even low levels of unregulated trans-gene expression can have dire consequences that would offsetany benefits from such therapy.

MethodsMice, antibodies and reagents. CD40L–/– mice13 and wild-type controlmice (B6J129SVF2) were obtained from Jackson Laboratories (Bar Harbor,Maine) and Immunex Corporation (Seattle, Washington). Cychrome-con-jugated monoclonal antibodies specific for CD4 (clone RM4-4) and B220(clone RA3-6B2); a biotinylated monoclonal antibody specific for CD40L(clone MR1); phycoerythrin (PE)-conjugated monoclonal antibodies spe-cific for CD4 (clone RM4-4), CD40 (clone 3/23), CD25 (clone 3C7),TCRαβ (clone H57-597), Vβ5.1, 5.2 TCR (clone MR9-4), and Vβ4 TCR(clone KT4); and fluorescein-isothiocyanate (FITC)-conjugated mono-clonal antibodies specific for CD8 (clone 53-6.7), CD24 (clone M1/M69)and Thy1.2 (clone 53-2.1) were all purchased from PharMingen (SanDiego, California). Biotinylated antibodies were detected withStreptavidin-Red670 (Life Technologies). Recombinant fibronectin frag-ments (CH-296) were provided by Takara (Shuzo, Japan) and thePE501/G1Na retroviral producer line was provided by Genetic Therapy(Gaithersburg, Maryland).

Retroviral transduction. The retroviral vector containing the mCD40LcDNA was constructed in pG1a (provided by Genetic Therapy,Gaithersburg, Maryland), as described40. A retroviral producer was madein the ecotropic packaging cell line GP+E86 by standard methods41. Thecontrol vector G1Na contained the neomycin phosphotransferase gene42,and the retroviral producer was packaged in the ecotropic packaging cellline PE501. Retroviral transduction of bone marrow was done as de-scribed43. At least 2 × 105 transduced bone marrow cells were injected in-travenously into each lethally irradiated (8.5 Gy) male CD40L–/– mouse.Thymuses obtained from bone marrow donors treated with 5-FU (female,CD40L–/– mice) were placed in PBS containing 10% FCS, disrupted by re-peated passage through a 16-gauge needle, digested with Collegenase A(Boehringer) and passed through a nylon filter with 100-µm pores. Theresultant single-cell suspension of thymic cells was transduced by co-cul-ture in a transwell system. GP+E86/pG1a.mCD40L retroviral producercells were seeded to confluence in a 6-well dish. Tissue culture inserts witha 0.1-µm pore diameter, coated with murine collagen IV (CollaborativeBiomedical Products, Bedford, Massachussetts), were placed in each well.Thymic cells were deposited in each tissue culture insert in S-MEM con-taining 10% FCS, 1 mM HEPES, 6 µg/ml polybrene, and supplements ofamino acids (Gibco) penicillin, streptomycin, gentamycin, sodium pyru-vate and l-glutamine. After 72 h in culture at 37 °C, 5% CO2, the thymiccells were scraped from the tissue culture insert, washed and resuspendedin HBSS containing 2% FCS and 20 U/ml of preservative-free heparin. 1.5× 107 cells were injected subcutaneously into the axillae of each maleCD40L–/– mouse.

PCR analysis of mCD40L transgene. The level of gene transfer was mea-sured by a semiquantitative DNA-PCR method44. 300 ng of genomic DNAwas amplified by two sets of primers. One set detected endogenousmurine β-globin sequences45; the other set, 5’–TGGATAAGGTCGAAGAG-GAAGT–3’ (Exons 1 and 2), and 5’–AGAGCAGAAGGTGACTTGAGTG–3’(Exon 5), yielded a 386-bp product that was specific for the mCD40LcDNA under the specified PCR conditions. PCR amplification catalyzedwith AmpliTaq Gold (Perkin-Elmer, Norwalk, Connecticut) consisted of aninitial step at 94 °C for 9 min, followed by cycles of 94 °C for 1 min, 60 °Cfor 30 s, 72 °C for 30 s, and a final extension step of 72 °C for 10 min, andwas done in a Perkin-Elmer DNA thermal cycler for either 22 cycles (β-glo-bin primers) or 32 cycles (mCD40L primers), with 0.2 µl α-32P-dCTP (800Ci/mmol; Amersham) added to each reaction. Amplified products wereseparated by 5% nondenaturing PAGE and visualized by autoradiographyof the dried gel. The radioactive PCR products were also detected byphosphorimaging and analyzed with ImageQuaNT software (MolecularDynamics, Sunnyvale, California). For each sample, normalized values for

β-globin were used to adjust values for mCD40L, which were then com-pared with standard DNA values. Transgene expression was evaluated byRT-PCR. First-strand cDNA was prepared according to the manufacturer’srecommendations (Life Technologies) and PCR-amplified for 30 cycles asabove with primers specific for either murine β-actin cDNA (Stratagene,La Jolla, California) or mCD40L cDNA.

Influenza specific immune assays. Mice were infected intranasally with240 viral hemagglutinating units of the influenza A virus, HKx31, as de-scribed46. Proliferative responses were assayed in triplicate cultures bymixing 2 × 105 immune spleen cells with different numbers of irradiatedvirus-infected or uninfected naive spleen cells in round-bottomed 96-wellplates. The cells were then cultured for 4 days and 3H-thymidine incorpo-ration was measured. Stimulation indices were calculated by dividing theaverage counts for each triplicate set of virus-infected cultures by the cor-responding uninfected control values. Uninfected mice produced a negli-gible response (not shown).

The 6-hour cytotoxicity assay was done as described47. Spontaneous re-lease was always less than 20%. Splenocytes were cultured for 5 days inthe presence of virus-infected, irradiated, T-cell-depleted splenocytesfrom unprimed B6J129SVF2 female mice, and the cytolytic activities gen-erated were tested at different effector-to-target ratios. The data reportedare the means of triplicate wells. Percent specific lysis was calculated as[(experimental release – spontaneous release)/(maximum release – spon-taneous release)] ×100. Influenza-specific ELISA and ELISPOT assays weredone with plates coated with disrupted influenza virus, as described48.

Immunization with DNP-KLH. Mice were immunized with 100 µg ofDNP-KLH (CalBiochem, La Jolla, California) that was precipitated on 2 mgof alum (aluminum hydroxide, Sigma), resuspended in 200 µl of PBS andinjected intraperitoneally49. The booster dose was given 3 weeks after thepriming dose; serum was collected 7 days later. To measure DNP-specificIgE by ELISA, 96-well plates were coated with anti-IgE, 2 µg/ml (clone R35-72; PharMingen, San Diego, California). Bound serum antibody was de-tected by DNP-BSA (Calbiochem, La Jolla, California) that had beenbiotinylated (Sigma), followed by Neutralite–avidin–alkaline phosphatase(Southern Biotechnology Associates, Birmingham, Alabama). The reactionwas developed with p-NPP (Kirkegaard-Perry Laboratories, Gaithersburg,Maryland) and the absorbance measured at 405 nm. A known quantity ofDNP-specific IgE (clone SPE-7; Sigma) was used for calibration.

Immunophenotyping and Immunohistochemistry. To examine the ex-pression of surface antigens, we washed the cells and resuspended them inPBS containing 0.2% BSA and 0.02% sodium azide (PBSA). Saturating con-centrations of conjugated antibodies were added and incubated for 10min at room temperature in the dark. Cells were washed in PBSA and fixedin 0.5% paraformaldehyde in PBS for analysis on a FACScan flow cytome-ter (Becton-Dickinson, San Jose, California). For analysis of TCR Vβ usage,the monoclonal antibodies, PCR primers and procedures were the same asthose described previously50. Immunohistochemistry was done on frozensections of thymus tissue as described1.

In vitro culture of tumor cells and tumor cell inoculation. Tumor cellswere cultured on irradiated M2-10B4 cells (American Type CultureCollection, Rockville, Maryland) in RPMI-1640 medium containing 10%FCS, 200 mg/ml streptomycin, 200 U/ml penicillin, 2 mM L-glutamine and50 µM 2-mercaptoethanol (‘medium’), and one of the following cytokines:recombinant murine stem cell factor, 100 ng/ml, recombinant murine IL-7, 10 ng/ml (R&D Systems, Minneapolis, Minnesota) or recombinanthuman IL-2, 10 U/ml (Chiron, Emeryville, California). For tumorogenicitystudies, tumor cells from mouse 14 were expanded with stem-cell factor,IL-2 and IL-7, pooled and washed in PBS twice; 5 × 106 cells were then in-jected intraperitoneally into each of four CD40L–/– mice. Tumor cells frommice 2 and 4 were expanded with IL-2 and injected as described above.

Detection of replication competent retrovirus. PCR analysis was donewith genomic DNA from each producer line used in this study(GP+E86/pG1a-mCD40L and PE501/GINa) and from tumor samples ofmice 2, 4, 14 and 15. The primers (5’–GTGGAACTGACGAGTTCGGAA-CAC–3’ and 5’–GAGGAGAACGGCCAGTATTGAAGC–3’) anneal in the


98 N

atur

e A

mer

ica

Inc.

•ht

tp://

med

icin

e.na

ture

.com


ARTICLES

packaging signal of the G1 retroviral vector series and in the gag region ofhelper retrovirus, respectively, and thus only amplify a product that re-sults from recombination between the two sites (primers provided by E.F.Vanin). Monkey genomic DNA, known to contain integrated helper retro-virus, served as a positive control51. The sensitivity of this assay is less than1/105. An XC plaque assay was done to test for the presence of replicationcompetent ecotropic retrovirus in the supernatant from the mCD40Lretroviral producer clone (Quality Biotech, Camden, New Jersey). Thesensitivity of this assay is less than 2 plaque forming units/ml. For electronmicroscopic detection of retroviral particles, tumor cells were cultured inrhIL-2 (10 U/ml) on M2-10B4 cells. A fresh cell pellet was fixed in glu-taraldehyde, embedded in epon and routinely processed for electron mi-croscopy, as described52.

AcknowledgementsWe thank S. Bodner for electron microscopy; M. Leventhal forimmunohistochemistry; J. Gunelson, S. Wingo, A. Slusher and M. Holladay fortechnical assistance; and J. Gilbert for scientific editing. The work in the authors’laboratories is supported by United States Public Health Service grants AI-29579to P.C.D.,AI-37597 to D.L.W., CA 78792 and CA 75014 to M.K.B., the AssisiFoundation and the American Lebanese Syrian Associated Charities(ALSAC).

RECEIVED 11 MAY; ACCEPTED 14 SEPTEMBER 1998

1. Dunn, R.J., Luedecker, C.J., Haugen, H.S., Clegg, C.H., & Farr, A.G. Thymic over-expression of CD40 ligand disrupts normal thymic epithelial organization. J.Histochem. Cytochem. 45, 129-141 (1997).

2. van Kooten. C. & Banchereau, J. CD40-CD40 ligand: a multifunctional receptor-ligand pair. Adv. Immunol. 61, 1-77 (1996).

3. Hasbold, J., Johnson-Leger, C., Atkins, C.J., Clark, E.A.& Klaus, G.B. Properties ofmouse CD40: cellular distribution of CD40 and B cell activation by monoclonalanti-mouse CD40 antibodies. Eur. J. Immunol. 24, 1835-1842 (1994).

4. Grewal, I.S. & Flavell, R.A. The CD40 ligand - at the center of the immune uni-verse? Immunol. Res. 16, 59-70 (1997).

5. Stout, R.D. & Suttles, J. The many roles of CD40 in cell-mediated inflammatoryresponses. Immunol. Today 17, 487-492 (1996).

6. Noelle, R.J. CD40 and its ligand in host defence. Immunity 4, 415-419 (1996).7. Hollenbaugh, D.,Ochs, H.D., Noelle, R.J., Ledbetter, J.A. & Aruffo, A. The role of

CD40 and its ligand in the regulation of the immune response. Immunol. Rev.138, 23-37 (1994).

8. Clark, E.A. & Ledbetter, J.A. How B and T cells talk to each other. Nature 367,425-428 (1994).

9. Kroczek, R.A.et al. Defective expression of CD40 ligand on T cells causes “X-linked immunodeficiency with hyper-IgM (HIGM1)”. Immunol. Rev. 138, 39-59(1994).

10. Fuleihan, R.L. & Geha, R.S. X-linked hyperIgM. The Immunologist 5, 133-136(1997).

11. Malech, H.L. et al. Prolonged production of NADPH oxidase-corrected granulo-cytes after gene therapy of chronic granulomatous disease. Proc. Natl. Acad. Sci.USA 94, 12133-12138 (1997).

12. Kohn, D.B. Gene therapy for hematopoietic and immune disorders. Bone MarrowTransplant. 18 (Suppl. 3), S55-S58 (1996).

13. Renshaw, B.R. et al. Humoral immune responses in CD40 ligand-deficient mice.J. Exp. Med. 180, 1889-1900 (1994).

14. Strzadala, L., Miazek, A., Matuszyk, J. & Kisielow, P. Role of thymic selection inthe development of thymic lymphomas in TCR transgenic mice. Int. Immunol. 9,127-138 (1997).

15. Tokoro, Y., Tsuda, S., Tanaka, S., Nakauchi, H. & Takahama, Y. CD3-inducedapoptosis of CD4+ CD8+ thymocytes in the absence of clonotypic T cell antigenreceptor. Eur. J. Immunol. 26, 1012-1017 (1996).

16. Sentman, C.L., Shutter, J.R., Hockenbery, D., Kanagawa, O. & Korsmeyer, S.J.Bcl-2 inhibits multiple forms of apoptosis but not negative selection in thymo-cytes. Cell 67, 879-888 (1991).

17. Peguet-Navarro, J. et al. CD40 ligation of human keratinocytes inhibits their pro-liferation and induces their differentiation. J. Immunol. 158, 144-152 (1997).

18. Heath, A.W. et al. Antibodies to murine CD40 stimulate normal B lymphocytesbut inhibit proliferation of B lymphoma cells. Cell. Immunol. 152, 468-480(1993).

19. Funakoshi, S. et al. Inhibition of human B-cell lymphoma growth by CD40 stim-ulation. Blood 83, 2787-2794 (1994).

20. Shortman, K., Vremec, D. & Egerton, M. The kinetics of T cell antigen receptorexpression by subgroups of CD4+8+ thymocytes: delineation of CD4+8+3(2+) thy-mocytes as post-selection intermediates leading to mature T cells. J. Exp. Med.

173, 323-332 (1991).21. Kisielow, P. & von Boehmer H. Development and selection of T cells: facts and

puzzles. Adv. Immunol. 58, 87-209 (1995).22. Bunting, K.D., Sangster, M.Y., Ihle, J.N. & Sorrentino, B.P. Restoration of lym-

phocyte function in Janus kinase 3-deficient mice by retroviral-mediated genetransfer. Nature Med. 4, 58-64 (1998).

23. Einerhand, M.P., Bakx, T.A., Kukler, A. & Valerio, D. Factors affecting the trans-duction of pluripotent hematopoietic stem cells: long-term expression of ahuman adenosine deaminase gene in mice. Blood 81, 254-263 (1993).

24. Qazilbash, M.H. et al. Retroviral vector for gene therapy of X-linked severe com-bined immunodeficiency syndrome. J.Hematother. 4, 91-98 (1995).

25. Clegg, C.H. et al. Thymus dysfunction and chronic inflammatory disease in g39transgenic mice. Int. Immunol. 9, 1111-1122 (1997).

26. Foy, T.M. et al. An essential role for gp39, the ligand for CD40, in thymic selec-tion. J. Exp. Med. 182, 1377-1388 (1995).

27. Miller, G. in Virology 2nd edn. (eds. Fields, B.N. et al.) 563–589 (Raven, NewYork, 1990).

28. Cayabyab, M., Phillips, J.H. & Lanier, L.L. CD40 preferentially costimulates acti-vation of CD4+ T lymphocytes. J. Immunol. 152, 1523-1531 (1994).

29. Armitage, R.J. et al. CD40 ligand is a potent T cell growth factor. Eur. J. Immunol.23, 2326-2331 (1993).

30. Fanslow, W.C. et al. Recombinant CD40 ligand exerts potent biologic effects onT cells. J. Immunol. 152, 4262-4269 (1994).

31. Yang, Y. & Wilson, J.M. CD40 ligand-dependent T cell activation: requirement ofB7-CD28 signaling through CD40. Science 273, 1862-1867 (1996).

32. Zhou, T., Bluethmann, H., Eldridge, J., Berry, K. & Mountz, J.D. Origin ofCD4–CD8–B220+ T cells in MRL-lpr/lpr mice; clues from a T cell receptor β trans-genic mouse. J. Immunol. 150, 3651-3667 (1993).

33. Zhou, T. et al. Kinetics of Fas-induced apoptosis in thymic organ culture. J. Clin.Immunol. 17, 74-84 (1997).

34. Ezine, S. et al. A novel CD45RA+ CD4+ transient thymic subpopulation in MRL-lpr/lpr mice : its relation to non-proliferating CD4– CD8– CD45RA+ tumor cells.Int. Immunol. 5, 89-96 (1993).

35. Smith, G.S., Walford, R.L. & Mickey, R.M. Lifespan and incidence of cancer andother diseases in selected long-lived inbred mice and their F1 hybrids. J. Natl.Cancer Inst. 50, 1195 (1973).

36. Hoag, W.G. Spontaneous cancer in mice. Ann. N.Y Acad. Sci. 108, 805 (1963).37. Filipovich, A.H. et al. in The Non-Hodgkin’s Lymphomas 2nd edn. (ed. McGrath,

I.T.) 459-469 (Oxford University Press, New York, 1997).38. Larson, R.C. et al. Protein dimerization between Lmo2 (Rbtn2) and Tal1 alters

thymocyte development and potentiates T cell tumorigenesis in transgenicmice. EMBO. J. 15, 1021-1027 (1996).

39. Anderson, W.F. Human gene therapy. Nature 392, 25–30 (1998).40. Grossmann, M.E., Brown, M.P. & Brenner, M.K. Antitumor responses induced by

transgenic expression of CD40 ligand. Hum. Gene. Ther. 8, 1935-1940 (1997).41. Farina, S.F., Girard, L.J., Vanin, E.F., Nienhuis, A.W. & Bodine, D.M.

Dysregulated expression of GATA-1 following retrovirus-mediated gene transferinto murine hematopoietic stem cells increases erythropoiesis. Blood 86, 4124-4133 (1995).

42. McLachlin, J.R., Mittereder, N., Daucher, M.B., Kadan, M. & Eglitis, M.A. Factorsaffecting retroviral vector function and structural integrity. Virology 195, 1-5(1993).

43. Hanenberg, H. et al. Colocalization of retrovirus and target cells on specific fi-bronectin fragments increases genetic transduction of mammalian cells. NatureMed. 2, 876-882 (1996).

44. Heslop, H.E. et al. Long-term restoration of immunity against Epstein-Barr virusinfection by adoptive transfer of gene-modified virus-specific T lymphocytes.Nature Med. 2, 551-555 (1996).

45. Sorrentino, B.P. et al. Selection of drug-resistant bone marrow cells in vivo afterretroviral transfer of human MDR1. Science 257, 99-103 (1992).

46. Allan, W., Tabi, Z., Cleary, A. & Doherty, P.C. Cellular events in the lymph nodeand lung of mice with influenza. J. Immunol. 144, 3980-3986 (1990).

47. Flynn, K.J. & Mullbacher, A. Memory alloreactive cytotoxic T cells do not requirecostimulation for activation in vitro. Immunol. Cell. Biol. 74, 413-420 (1996).

48. Sangster, M., Smith, F.S., Coleclough, C. & Hurwitz, J.L. Human parainfluenzavirus type 1 immunization of infant mice protects from subsequent sendai virusinfection. Virology 212, 13-19 (1995).

49. Harlow, E, & Lane, D. Antibodies: A Laboratory Manual. Cold Spring HarborLaboratory Press, 99 (1988).

50. Cole, G.A., Hogg, T.L. & Woodland, D.L. The MHC class I-restricted T cell responseto Sendai virus infection in C57BL/6 mice: a single immunodominant epitope elic-its an extremely diverse repertoire of T cells. Int. Immunol. 6, 1767-1775 (1994).

51. Vanin, E.F., Kaloss, M., Broscius, C. & Nienhuis, A.W. Characterization of replica-tion-competent retroviruses from nonhuman primates with virus-induced T-celllymphomas and observations regarding the mechanism of oncogenesis. J. Virol.68, 4241-4250 (1994).

52. Daniels, C.A.,Bodner, S. & Trofatter, K.F. Scanning and transmission electron mi-croscopic studies of complement-mediated lysis and antibody-dependent cell-mediated cytolysis of herpes simplex virus-infected human fibroblasts. Am. J.Pathol. 100, 663-675 (1980).


98 N

atur

e A

mer

ica

Inc.

•ht

tp://

med

icin

e.na

ture

.com

thymic lymphoproliferative disease after successful correction of cd40 ligand deficiency by gene...

Documents